>Feature sequence01 564 406 gene locus_tag LOCUS_00010 564 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 539 1660 gene locus_tag LOCUS_00020 539 1660 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038918.1 protein_id gnl|my_center|LOCUS_00020 3036 1738 gene locus_tag LOCUS_00030 gene aroA 3036 1738 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479628.1 protein_id gnl|my_center|LOCUS_00030 3843 3046 gene locus_tag LOCUS_00040 3843 3046 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776063.1 protein_id gnl|my_center|LOCUS_00040 4327 3794 gene locus_tag LOCUS_00050 4327 3794 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888229.1 protein_id gnl|my_center|LOCUS_00050 5035 4346 gene locus_tag LOCUS_00060 5035 4346 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887846.1 protein_id gnl|my_center|LOCUS_00060 7906 5099 gene locus_tag LOCUS_00070 gene treY 7906 5099 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479556.1 protein_id gnl|my_center|LOCUS_00070 9644 7896 gene locus_tag LOCUS_00080 gene treZ 9644 7896 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887109.1 protein_id gnl|my_center|LOCUS_00080 9828 10196 gene locus_tag LOCUS_00090 9828 10196 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687513.1 protein_id gnl|my_center|LOCUS_00090 10276 10860 gene locus_tag LOCUS_00100 10276 10860 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392688.1 protein_id gnl|my_center|LOCUS_00100 10857 11636 gene locus_tag LOCUS_00110 10857 11636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11633 12418 gene locus_tag LOCUS_00120 11633 12418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 12443 13021 gene locus_tag LOCUS_00130 12443 13021 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940717.1 protein_id gnl|my_center|LOCUS_00130 13816 12980 gene locus_tag LOCUS_00140 13816 12980 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545211.1 protein_id gnl|my_center|LOCUS_00140 17430 13804 gene locus_tag LOCUS_00150 gene metH 17430 13804 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887611.1 protein_id gnl|my_center|LOCUS_00150 17837 18403 gene locus_tag LOCUS_00160 17837 18403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 20438 18573 gene locus_tag LOCUS_00170 gene dxs 20438 18573 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888114.1 protein_id gnl|my_center|LOCUS_00170 21207 20467 gene locus_tag LOCUS_00180 21207 20467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227635.1 protein_id gnl|my_center|LOCUS_00180 21891 21226 gene locus_tag LOCUS_00190 21891 21226 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888112.1 protein_id gnl|my_center|LOCUS_00190 23019 21958 gene locus_tag LOCUS_00200 23019 21958 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103575.1 protein_id gnl|my_center|LOCUS_00200 23864 23079 gene locus_tag LOCUS_00210 23864 23079 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618886.1 protein_id gnl|my_center|LOCUS_00210 24607 23867 gene locus_tag LOCUS_00220 24607 23867 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889173.1 protein_id gnl|my_center|LOCUS_00220 24763 24839 gene locus_tag LOCUS_t00010 24763 24839 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 24841 24914 gene locus_tag LOCUS_t00020 24841 24914 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 24917 24993 gene locus_tag LOCUS_t00030 24917 24993 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 25667 25140 gene locus_tag LOCUS_00230 25667 25140 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480322.1 protein_id gnl|my_center|LOCUS_00230 25901 26920 gene locus_tag LOCUS_00240 gene mutY 25901 26920 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888913.1 protein_id gnl|my_center|LOCUS_00240 26917 27753 gene locus_tag LOCUS_00250 26917 27753 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480324.1 protein_id gnl|my_center|LOCUS_00250 27755 28336 gene locus_tag LOCUS_00260 gene trmH 27755 28336 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888841.1 protein_id gnl|my_center|LOCUS_00260 28333 29019 gene locus_tag LOCUS_00270 28333 29019 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228451.1 protein_id gnl|my_center|LOCUS_00270 29048 30268 gene locus_tag LOCUS_00280 29048 30268 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888856.1 protein_id gnl|my_center|LOCUS_00280 30327 31076 gene locus_tag LOCUS_00290 30327 31076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 31069 31560 gene locus_tag LOCUS_00300 31069 31560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480249.1 protein_id gnl|my_center|LOCUS_00300 31577 31930 gene locus_tag LOCUS_00310 31577 31930 CDS product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480250.1 protein_id gnl|my_center|LOCUS_00310 32571 31942 gene locus_tag LOCUS_00320 gene nth 32571 31942 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886934.1 protein_id gnl|my_center|LOCUS_00320 33487 32561 gene locus_tag LOCUS_00330 gene prfB 33487 32561 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149357985.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00330 34406 33687 gene locus_tag LOCUS_00340 34406 33687 CDS product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632942.1 protein_id gnl|my_center|LOCUS_00340 34470 35984 gene locus_tag LOCUS_00350 gene guaA 34470 35984 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888509.1 protein_id gnl|my_center|LOCUS_00350 36002 36541 gene locus_tag LOCUS_00360 gene raiA 36002 36541 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887725.1 protein_id gnl|my_center|LOCUS_00360 37425 36514 gene locus_tag LOCUS_00370 gene ribF 37425 36514 CDS product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887651.1 protein_id gnl|my_center|LOCUS_00370 37896 37429 gene locus_tag LOCUS_00380 gene ndx4 37896 37429 CDS product ADP-ribose pyrophosphatase Ndx4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172615.1 protein_id gnl|my_center|LOCUS_00380 38945 37899 gene locus_tag LOCUS_00390 gene ftsZ 38945 37899 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887276.1 protein_id gnl|my_center|LOCUS_00390 40338 38989 gene locus_tag LOCUS_00400 40338 38989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 40949 40338 gene locus_tag LOCUS_00410 40949 40338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 41782 40946 gene locus_tag LOCUS_00420 41782 40946 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228429.1 protein_id gnl|my_center|LOCUS_00420 43113 41776 gene locus_tag LOCUS_00430 gene murC 43113 41776 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887272.1 protein_id gnl|my_center|LOCUS_00430 44195 43113 gene locus_tag LOCUS_00440 gene murG 44195 43113 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349463.1 protein_id gnl|my_center|LOCUS_00440 45510 44206 gene locus_tag LOCUS_00450 gene radA 45510 44206 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479626.1 protein_id gnl|my_center|LOCUS_00450 47727 45511 gene locus_tag LOCUS_00460 47727 45511 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887760.1 protein_id gnl|my_center|LOCUS_00460 47960 48202 gene locus_tag LOCUS_00470 47960 48202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 50672 48150 gene locus_tag LOCUS_00480 50672 48150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 51138 50653 gene locus_tag LOCUS_00490 51138 50653 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887827.1 protein_id gnl|my_center|LOCUS_00490 51731 51138 gene locus_tag LOCUS_00500 51731 51138 CDS product MazG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887826.1 protein_id gnl|my_center|LOCUS_00500 51984 53303 gene locus_tag LOCUS_00510 51984 53303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 54009 53320 gene locus_tag LOCUS_00520 54009 53320 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888822.1 protein_id gnl|my_center|LOCUS_00520 56302 54002 gene locus_tag LOCUS_00530 56302 54002 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025567519.1 protein_id gnl|my_center|LOCUS_00530 56621 57814 gene locus_tag LOCUS_00540 56621 57814 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228877.1 protein_id gnl|my_center|LOCUS_00540 57826 58269 gene locus_tag LOCUS_00550 57826 58269 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228878.1 protein_id gnl|my_center|LOCUS_00550 58711 58220 gene locus_tag LOCUS_00560 58711 58220 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887852.1 protein_id gnl|my_center|LOCUS_00560 58772 60364 gene locus_tag LOCUS_00570 gene tilS 58772 60364 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029732762.1 protein_id gnl|my_center|LOCUS_00570 61020 60361 gene locus_tag LOCUS_00580 gene rpe 61020 60361 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_00580 61061 64147 gene locus_tag LOCUS_00590 61061 64147 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888171.1 protein_id gnl|my_center|LOCUS_00590 66212 64119 gene locus_tag LOCUS_00600 66212 64119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 67986 66238 gene locus_tag LOCUS_00610 67986 66238 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479832.1 protein_id gnl|my_center|LOCUS_00610 68493 68092 gene locus_tag LOCUS_00620 68493 68092 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887511.1 protein_id gnl|my_center|LOCUS_00620 69014 68556 gene locus_tag LOCUS_00630 69014 68556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 69918 69145 gene locus_tag LOCUS_00640 69918 69145 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888160.1 protein_id gnl|my_center|LOCUS_00640 70541 69915 gene locus_tag LOCUS_00650 70541 69915 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086535.1 protein_id gnl|my_center|LOCUS_00650 71424 70534 gene locus_tag LOCUS_00660 71424 70534 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391037.1 protein_id gnl|my_center|LOCUS_00660 72410 71421 gene locus_tag LOCUS_00670 gene queA 72410 71421 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173135.1 protein_id gnl|my_center|LOCUS_00670 72949 72410 gene locus_tag LOCUS_00680 72949 72410 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888217.1 protein_id gnl|my_center|LOCUS_00680 73691 72981 gene locus_tag LOCUS_00690 gene rlmB 73691 72981 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887393.1 protein_id gnl|my_center|LOCUS_00690 75397 73718 gene locus_tag LOCUS_00700 gene ilvD 75397 73718 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258705.1 protein_id gnl|my_center|LOCUS_00700 76955 75432 gene locus_tag LOCUS_00710 76955 75432 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480228.1 protein_id gnl|my_center|LOCUS_00710 77992 76988 gene locus_tag LOCUS_00720 gene ilvC 77992 76988 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480217.1 protein_id gnl|my_center|LOCUS_00720 78564 77989 gene locus_tag LOCUS_00730 gene ilvN 78564 77989 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185974702.1 protein_id gnl|my_center|LOCUS_00730 80219 78561 gene locus_tag LOCUS_00740 gene ilvB 80219 78561 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177759.1 protein_id gnl|my_center|LOCUS_00740 81662 80430 gene locus_tag LOCUS_00750 81662 80430 CDS product PEGA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228902.1 protein_id gnl|my_center|LOCUS_00750 82355 81759 gene locus_tag LOCUS_00760 82355 81759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 84248 82356 gene locus_tag LOCUS_00770 gene ftsH 84248 82356 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887228.1 protein_id gnl|my_center|LOCUS_00770 84436 86316 gene locus_tag LOCUS_00780 gene dnaK 84436 86316 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886777.1 protein_id gnl|my_center|LOCUS_00780 86341 87030 gene locus_tag LOCUS_00790 86341 87030 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026138697.1 protein_id gnl|my_center|LOCUS_00790 87052 87972 gene locus_tag LOCUS_00800 87052 87972 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886774.1 protein_id gnl|my_center|LOCUS_00800 87969 88328 gene locus_tag LOCUS_00810 87969 88328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888253.1 protein_id gnl|my_center|LOCUS_00810 88330 88470 gene locus_tag LOCUS_00820 88330 88470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 88467 89603 gene locus_tag LOCUS_00830 88467 89603 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 protein_id gnl|my_center|LOCUS_00830 90610 89621 gene locus_tag LOCUS_00840 90610 89621 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583513.1 protein_id gnl|my_center|LOCUS_00840 92001 90670 gene locus_tag LOCUS_00850 92001 90670 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888503.1 protein_id gnl|my_center|LOCUS_00850 92321 91992 gene locus_tag LOCUS_00860 92321 91992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 93187 92318 gene locus_tag LOCUS_00870 gene rsmH 93187 92318 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888501.1 protein_id gnl|my_center|LOCUS_00870 93615 93187 gene locus_tag LOCUS_00880 gene mraZ 93615 93187 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888500.1 protein_id gnl|my_center|LOCUS_00880 93869 95446 gene locus_tag LOCUS_00890 gene pckA 93869 95446 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227826.1 protein_id gnl|my_center|LOCUS_00890 96187 95549 gene locus_tag LOCUS_00900 96187 95549 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229094.1 protein_id gnl|my_center|LOCUS_00900 96701 96177 gene locus_tag LOCUS_00910 96701 96177 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142702.1 protein_id gnl|my_center|LOCUS_00910 96753 98129 gene locus_tag LOCUS_00920 96753 98129 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_00920 98325 98119 gene locus_tag LOCUS_00930 98325 98119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 99678 98344 gene locus_tag LOCUS_00940 99678 98344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 100552 99680 gene locus_tag LOCUS_00950 100552 99680 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479855.1 protein_id gnl|my_center|LOCUS_00950 101252 100569 gene locus_tag LOCUS_00960 gene ftsE 101252 100569 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173352.1 protein_id gnl|my_center|LOCUS_00960 101383 102747 gene locus_tag LOCUS_00970 101383 102747 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479857.1 protein_id gnl|my_center|LOCUS_00970 104028 102937 gene locus_tag LOCUS_00980 104028 102937 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869840.1 protein_id gnl|my_center|LOCUS_00980 105222 104146 gene locus_tag LOCUS_00990 105222 104146 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887765.1 protein_id gnl|my_center|LOCUS_00990 109753 105269 gene locus_tag LOCUS_01000 109753 105269 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228702.1 protein_id gnl|my_center|LOCUS_01000 112155 109885 gene locus_tag LOCUS_01010 112155 109885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 112335 112607 gene locus_tag LOCUS_01020 112335 112607 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630673.1 protein_id gnl|my_center|LOCUS_01020 112604 113839 gene locus_tag LOCUS_01030 112604 113839 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479925.1 protein_id gnl|my_center|LOCUS_01030 113861 115852 gene locus_tag LOCUS_01040 gene ligA 113861 115852 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871048.1 protein_id gnl|my_center|LOCUS_01040 115905 116357 gene locus_tag LOCUS_01050 115905 116357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 116354 116800 gene locus_tag LOCUS_01060 116354 116800 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888697.1 protein_id gnl|my_center|LOCUS_01060 117178 116777 gene locus_tag LOCUS_01070 117178 116777 CDS product NADH-quinone oxidoreductase subunit 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480001.1 protein_id gnl|my_center|LOCUS_01070 117676 117218 gene locus_tag LOCUS_01080 117676 117218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 117811 119628 gene locus_tag LOCUS_01090 117811 119628 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889193.1 protein_id gnl|my_center|LOCUS_01090 119646 121229 gene locus_tag LOCUS_01100 gene recN 119646 121229 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888116.1 protein_id gnl|my_center|LOCUS_01100 121253 122353 gene locus_tag LOCUS_01110 121253 122353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 122544 123146 gene locus_tag LOCUS_01120 gene tam 122544 123146 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312207.1 protein_id gnl|my_center|LOCUS_01120 123311 124069 gene locus_tag LOCUS_01130 123311 124069 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480305.1 protein_id gnl|my_center|LOCUS_01130 124066 124683 gene locus_tag LOCUS_01140 gene tmk 124066 124683 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886759.1 protein_id gnl|my_center|LOCUS_01140 124704 125204 gene locus_tag LOCUS_01150 124704 125204 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173648.1 protein_id gnl|my_center|LOCUS_01150 125206 126357 gene locus_tag LOCUS_01160 125206 126357 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931414.1 protein_id gnl|my_center|LOCUS_01160 126527 127003 gene locus_tag LOCUS_01170 126527 127003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 127288 129264 gene locus_tag LOCUS_01180 127288 129264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 129302 130606 gene locus_tag LOCUS_01190 129302 130606 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943582.1 protein_id gnl|my_center|LOCUS_01190 131568 130558 gene locus_tag LOCUS_01200 gene queG 131568 130558 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480231.1 protein_id gnl|my_center|LOCUS_01200 132358 131681 gene locus_tag LOCUS_01210 gene pgl 132358 131681 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939587.1 protein_id gnl|my_center|LOCUS_01210 133863 132358 gene locus_tag LOCUS_01220 gene zwf 133863 132358 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888234.1 protein_id gnl|my_center|LOCUS_01220 134768 133860 gene locus_tag LOCUS_01230 gene gnd 134768 133860 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350162.1 protein_id gnl|my_center|LOCUS_01230 134865 136931 gene locus_tag LOCUS_01240 134865 136931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 137387 136992 gene locus_tag LOCUS_01250 137387 136992 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172656.1 protein_id gnl|my_center|LOCUS_01250 137576 138511 gene locus_tag LOCUS_01260 gene miaA 137576 138511 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888325.1 protein_id gnl|my_center|LOCUS_01260 138627 140042 gene locus_tag LOCUS_01270 gene lnt 138627 140042 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119347.1 protein_id gnl|my_center|LOCUS_01270 140071 140493 gene locus_tag LOCUS_01280 gene smpB 140071 140493 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480230.1 protein_id gnl|my_center|LOCUS_01280 140501 141748 gene locus_tag LOCUS_01290 140501 141748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 141745 142290 gene locus_tag LOCUS_01300 141745 142290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 142306 145542 gene locus_tag LOCUS_01310 142306 145542 CDS product chromosome segregation SMC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480229.1 protein_id gnl|my_center|LOCUS_01310 145539 146963 gene locus_tag LOCUS_01320 gene zwf 145539 146963 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_01320 146974 147870 gene locus_tag LOCUS_01330 146974 147870 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031688.1 protein_id gnl|my_center|LOCUS_01330 148141 148689 gene locus_tag LOCUS_01340 148141 148689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 148930 149913 gene locus_tag LOCUS_01350 148930 149913 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967117.1 protein_id gnl|my_center|LOCUS_01350 149961 150950 gene locus_tag LOCUS_01360 149961 150950 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945947.1 protein_id gnl|my_center|LOCUS_01360 150961 151737 gene locus_tag LOCUS_01370 150961 151737 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223778.1 protein_id gnl|my_center|LOCUS_01370 151740 152750 gene locus_tag LOCUS_01380 gene iolX 151740 152750 CDS product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244942.1 protein_id gnl|my_center|LOCUS_01380 152747 154636 gene locus_tag LOCUS_01390 gene iolD 152747 154636 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 protein_id gnl|my_center|LOCUS_01390 154633 155499 gene locus_tag LOCUS_01400 154633 155499 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223781.1 protein_id gnl|my_center|LOCUS_01400 155489 156559 gene locus_tag LOCUS_01410 155489 156559 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331256.1 protein_id gnl|my_center|LOCUS_01410 156556 157425 gene locus_tag LOCUS_01420 156556 157425 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_01420 157422 158345 gene locus_tag LOCUS_01430 157422 158345 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 protein_id gnl|my_center|LOCUS_01430 158342 159352 gene locus_tag LOCUS_01440 gene iolG 158342 159352 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083264.1 protein_id gnl|my_center|LOCUS_01440 159349 160191 gene locus_tag LOCUS_01450 gene iolB 159349 160191 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528375.1 protein_id gnl|my_center|LOCUS_01450 160175 160975 gene locus_tag LOCUS_01460 160175 160975 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392145.1 protein_id gnl|my_center|LOCUS_01460 161742 160981 gene locus_tag LOCUS_01470 161742 160981 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969234.1 protein_id gnl|my_center|LOCUS_01470 161965 163263 gene locus_tag LOCUS_01480 161965 163263 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816106.1 protein_id gnl|my_center|LOCUS_01480 163340 164209 gene locus_tag LOCUS_01490 163340 164209 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816113.1 protein_id gnl|my_center|LOCUS_01490 164206 165081 gene locus_tag LOCUS_01500 164206 165081 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459730.1 protein_id gnl|my_center|LOCUS_01500 165081 165731 gene locus_tag LOCUS_01510 165081 165731 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729327.1 protein_id gnl|my_center|LOCUS_01510 165728 166672 gene locus_tag LOCUS_01520 165728 166672 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089272.1 protein_id gnl|my_center|LOCUS_01520 166682 167830 gene locus_tag LOCUS_01530 gene dgoD 166682 167830 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528179.1 protein_id gnl|my_center|LOCUS_01530 167824 168705 gene locus_tag LOCUS_01540 167824 168705 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970029.1 protein_id gnl|my_center|LOCUS_01540 169887 169027 gene locus_tag LOCUS_01550 169887 169027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 170786 169884 gene locus_tag LOCUS_01560 170786 169884 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888944.1 protein_id gnl|my_center|LOCUS_01560 171574 170792 gene locus_tag LOCUS_01570 171574 170792 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141114.1 protein_id gnl|my_center|LOCUS_01570 171878 171585 gene locus_tag LOCUS_01580 171878 171585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 171870 172064 gene locus_tag LOCUS_01590 171870 172064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 172547 171972 gene locus_tag LOCUS_01600 172547 171972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01600 172847 174154 gene locus_tag LOCUS_01610 172847 174154 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187767762.1 protein_id gnl|my_center|LOCUS_01610 174151 175110 gene locus_tag LOCUS_01620 174151 175110 CDS product alpha/beta fold hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887517.1 protein_id gnl|my_center|LOCUS_01620 177157 175133 gene locus_tag LOCUS_01630 177157 175133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 177285 178616 gene locus_tag LOCUS_01640 177285 178616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 178655 179995 gene locus_tag LOCUS_01650 178655 179995 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169107222.1 protein_id gnl|my_center|LOCUS_01650 180002 180295 gene locus_tag LOCUS_01660 180002 180295 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036600.1 protein_id gnl|my_center|LOCUS_01660 180327 182024 gene locus_tag LOCUS_01670 180327 182024 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228019.1 protein_id gnl|my_center|LOCUS_01670 182962 182021 gene locus_tag LOCUS_01680 182962 182021 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351104.1 protein_id gnl|my_center|LOCUS_01680 183861 182935 gene locus_tag LOCUS_01690 gene hslO 183861 182935 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479663.1 protein_id gnl|my_center|LOCUS_01690 184134 186449 gene locus_tag LOCUS_01700 184134 186449 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480129.1 protein_id gnl|my_center|LOCUS_01700 186451 187002 gene locus_tag LOCUS_01710 186451 187002 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101932.1 protein_id gnl|my_center|LOCUS_01710 186995 188185 gene locus_tag LOCUS_01720 186995 188185 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889105.1 protein_id gnl|my_center|LOCUS_01720 188182 189912 gene locus_tag LOCUS_01730 188182 189912 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172981.1 protein_id gnl|my_center|LOCUS_01730 192455 189927 gene locus_tag LOCUS_01740 192455 189927 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888825.1 protein_id gnl|my_center|LOCUS_01740 192770 193144 gene locus_tag LOCUS_01750 gene aroH 192770 193144 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172959.1 protein_id gnl|my_center|LOCUS_01750 193950 193138 gene locus_tag LOCUS_01760 gene trpC 193950 193138 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228482.1 protein_id gnl|my_center|LOCUS_01760 194503 193967 gene locus_tag LOCUS_01770 gene hpt 194503 193967 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888017.1 protein_id gnl|my_center|LOCUS_01770 195465 194518 gene locus_tag LOCUS_01780 gene speE 195465 194518 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172918.1 protein_id gnl|my_center|LOCUS_01780 195858 195475 gene locus_tag LOCUS_01790 195858 195475 CDS product S-adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172919.1 protein_id gnl|my_center|LOCUS_01790 196608 195883 gene locus_tag LOCUS_01800 196608 195883 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172461.1 protein_id gnl|my_center|LOCUS_01800 196659 196904 gene locus_tag LOCUS_01810 196659 196904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886772.1 protein_id gnl|my_center|LOCUS_01810 196901 198010 gene locus_tag LOCUS_01820 196901 198010 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480301.1 protein_id gnl|my_center|LOCUS_01820 198064 199155 gene locus_tag LOCUS_01830 gene galK 198064 199155 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011381253.1 protein_id gnl|my_center|LOCUS_01830 199625 200644 gene locus_tag LOCUS_01840 199625 200644 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229210.1 protein_id gnl|my_center|LOCUS_01840 200762 202444 gene locus_tag LOCUS_01850 200762 202444 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706882.1 protein_id gnl|my_center|LOCUS_01850 202474 203454 gene locus_tag LOCUS_01860 202474 203454 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230099.1 protein_id gnl|my_center|LOCUS_01860 203451 205319 gene locus_tag LOCUS_01870 203451 205319 CDS product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225594.1 protein_id gnl|my_center|LOCUS_01870 205319 206263 gene locus_tag LOCUS_01880 205319 206263 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776186.1 protein_id gnl|my_center|LOCUS_01880 206308 207645 gene locus_tag LOCUS_01890 206308 207645 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 protein_id gnl|my_center|LOCUS_01890 207941 207654 gene locus_tag LOCUS_01900 207941 207654 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633933.1 protein_id gnl|my_center|LOCUS_01900 208611 207943 gene locus_tag LOCUS_01910 208611 207943 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228234.1 protein_id gnl|my_center|LOCUS_01910 209106 208669 gene locus_tag LOCUS_01920 209106 208669 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946746.1 protein_id gnl|my_center|LOCUS_01920 209271 210269 gene locus_tag LOCUS_01930 209271 210269 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534169.1 protein_id gnl|my_center|LOCUS_01930 211450 210245 gene locus_tag LOCUS_01940 211450 210245 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529186.1 protein_id gnl|my_center|LOCUS_01940 211469 212806 gene locus_tag LOCUS_01950 211469 212806 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986115.1 protein_id gnl|my_center|LOCUS_01950 213600 212803 gene locus_tag LOCUS_01960 gene map 213600 212803 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480012.1 protein_id gnl|my_center|LOCUS_01960 214842 213637 gene locus_tag LOCUS_01970 gene ispG 214842 213637 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887031.1 protein_id gnl|my_center|LOCUS_01970 215018 215353 gene locus_tag LOCUS_01980 215018 215353 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480222.1 protein_id gnl|my_center|LOCUS_01980 215344 215883 gene locus_tag LOCUS_01990 215344 215883 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174271.1 protein_id gnl|my_center|LOCUS_01990 215880 216443 gene locus_tag LOCUS_02000 215880 216443 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888143.1 protein_id gnl|my_center|LOCUS_02000 216440 217645 gene locus_tag LOCUS_02010 gene nuoD 216440 217645 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888142.1 protein_id gnl|my_center|LOCUS_02010 217671 218264 gene locus_tag LOCUS_02020 gene nuoE 217671 218264 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888140.1 protein_id gnl|my_center|LOCUS_02020 218261 219604 gene locus_tag LOCUS_02030 gene nuoF 218261 219604 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888139.1 protein_id gnl|my_center|LOCUS_02030 219601 221727 gene locus_tag LOCUS_02040 gene nuoG 219601 221727 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888138.1 protein_id gnl|my_center|LOCUS_02040 221724 222854 gene locus_tag LOCUS_02050 gene nuoH 221724 222854 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888137.1 protein_id gnl|my_center|LOCUS_02050 222864 223394 gene locus_tag LOCUS_02060 gene nuoI 222864 223394 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888136.1 protein_id gnl|my_center|LOCUS_02060 223391 223945 gene locus_tag LOCUS_02070 223391 223945 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888135.1 protein_id gnl|my_center|LOCUS_02070 223942 224244 gene locus_tag LOCUS_02080 gene nuoK 223942 224244 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480224.1 protein_id gnl|my_center|LOCUS_02080 224247 226100 gene locus_tag LOCUS_02090 gene nuoL 224247 226100 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025566951.1 protein_id gnl|my_center|LOCUS_02090 226097 227530 gene locus_tag LOCUS_02100 226097 227530 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888132.1 protein_id gnl|my_center|LOCUS_02100 227530 228954 gene locus_tag LOCUS_02110 227530 228954 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888131.1 protein_id gnl|my_center|LOCUS_02110 228961 230829 gene locus_tag LOCUS_02120 228961 230829 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025567324.1 protein_id gnl|my_center|LOCUS_02120 230826 231557 gene locus_tag LOCUS_02130 230826 231557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 232606 231467 gene locus_tag LOCUS_02140 232606 231467 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349636.1 protein_id gnl|my_center|LOCUS_02140 233790 233113 gene locus_tag LOCUS_02150 233790 233113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 234787 233870 gene locus_tag LOCUS_02160 gene truB 234787 233870 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887965.1 protein_id gnl|my_center|LOCUS_02160 235273 234857 gene locus_tag LOCUS_02170 235273 234857 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618785.1 protein_id gnl|my_center|LOCUS_02170 235490 236032 gene locus_tag LOCUS_02180 gene pyrR 235490 236032 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887753.1 protein_id gnl|my_center|LOCUS_02180 236029 236952 gene locus_tag LOCUS_02190 236029 236952 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887752.1 protein_id gnl|my_center|LOCUS_02190 236952 238208 gene locus_tag LOCUS_02200 236952 238208 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887749.1 protein_id gnl|my_center|LOCUS_02200 238201 238956 gene locus_tag LOCUS_02210 238201 238956 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118509.1 protein_id gnl|my_center|LOCUS_02210 238953 239867 gene locus_tag LOCUS_02220 gene pyrD 238953 239867 CDS product dihydroorotate oxidase B catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081049.1 protein_id gnl|my_center|LOCUS_02220 240307 239864 gene locus_tag LOCUS_02230 240307 239864 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479949.1 protein_id gnl|my_center|LOCUS_02230 240425 242350 gene locus_tag LOCUS_02240 240425 242350 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887551.1 protein_id gnl|my_center|LOCUS_02240 243084 242347 gene locus_tag LOCUS_02250 243084 242347 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172511.1 protein_id gnl|my_center|LOCUS_02250 243844 243077 gene locus_tag LOCUS_02260 243844 243077 CDS product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632942.1 protein_id gnl|my_center|LOCUS_02260 243966 245513 gene locus_tag LOCUS_02270 gene bshC 243966 245513 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479890.1 protein_id gnl|my_center|LOCUS_02270 248791 245642 gene locus_tag LOCUS_02280 gene ileS 248791 245642 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228416.1 protein_id gnl|my_center|LOCUS_02280 249177 249833 gene locus_tag LOCUS_02290 gene fsa 249177 249833 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887978.1 protein_id gnl|my_center|LOCUS_02290 249830 251116 gene locus_tag LOCUS_02300 gene rho 249830 251116 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869108.1 protein_id gnl|my_center|LOCUS_02300 251137 252021 gene locus_tag LOCUS_02310 gene pdxS 251137 252021 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480030.1 protein_id gnl|my_center|LOCUS_02310 252002 252595 gene locus_tag LOCUS_02320 gene pdxT 252002 252595 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888007.1 protein_id gnl|my_center|LOCUS_02320 252669 253664 gene locus_tag LOCUS_02330 gene asd 252669 253664 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879003.1 protein_id gnl|my_center|LOCUS_02330 253675 255102 gene locus_tag LOCUS_02340 253675 255102 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888006.1 protein_id gnl|my_center|LOCUS_02340 255725 255027 gene locus_tag LOCUS_02350 255725 255027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 256426 255716 gene locus_tag LOCUS_02360 gene tpiA 256426 255716 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228317.1 protein_id gnl|my_center|LOCUS_02360 257607 256423 gene locus_tag LOCUS_02370 257607 256423 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480023.1 protein_id gnl|my_center|LOCUS_02370 258608 257607 gene locus_tag LOCUS_02380 gene gap 258608 257607 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228284.1 protein_id gnl|my_center|LOCUS_02380 259961 258657 gene locus_tag LOCUS_02390 gene asnS 259961 258657 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228137.1 protein_id gnl|my_center|LOCUS_02390 260754 259963 gene locus_tag LOCUS_02400 260754 259963 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887971.1 protein_id gnl|my_center|LOCUS_02400 262448 260751 gene locus_tag LOCUS_02410 gene aspS 262448 260751 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172809.1 protein_id gnl|my_center|LOCUS_02410 263764 262457 gene locus_tag LOCUS_02420 gene hisS 263764 262457 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887990.1 protein_id gnl|my_center|LOCUS_02420 264179 263802 gene locus_tag LOCUS_02430 264179 263802 CDS product IPT/TIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480028.1 protein_id gnl|my_center|LOCUS_02430 264723 264316 gene locus_tag LOCUS_02440 264723 264316 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918726.1 protein_id gnl|my_center|LOCUS_02440 265001 264720 gene locus_tag LOCUS_02450 265001 264720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 265101 265685 gene locus_tag LOCUS_02460 265101 265685 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228061.1 protein_id gnl|my_center|LOCUS_02460 265927 267147 gene locus_tag LOCUS_02470 265927 267147 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965994.1 protein_id gnl|my_center|LOCUS_02470 267192 268073 gene locus_tag LOCUS_02480 267192 268073 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931471.1 protein_id gnl|my_center|LOCUS_02480 268066 268980 gene locus_tag LOCUS_02490 268066 268980 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807650.1 protein_id gnl|my_center|LOCUS_02490 268970 269689 gene locus_tag LOCUS_02500 268970 269689 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870136.1 protein_id gnl|my_center|LOCUS_02500 269686 270408 gene locus_tag LOCUS_02510 269686 270408 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545450.1 protein_id gnl|my_center|LOCUS_02510 270658 272172 gene locus_tag LOCUS_02520 270658 272172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 272471 273859 gene locus_tag LOCUS_02530 272471 273859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 274156 275475 gene locus_tag LOCUS_02540 274156 275475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 275771 275977 gene locus_tag LOCUS_02550 275771 275977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 278540 276501 gene locus_tag LOCUS_02560 278540 276501 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258964.1 protein_id gnl|my_center|LOCUS_02560 278827 281271 gene locus_tag LOCUS_02570 278827 281271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 281262 283700 gene locus_tag LOCUS_02580 281262 283700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 284256 285179 gene locus_tag LOCUS_02590 284256 285179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 286384 285242 gene locus_tag LOCUS_02600 286384 285242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 289083 286537 gene locus_tag LOCUS_02610 289083 286537 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267734.1 protein_id gnl|my_center|LOCUS_02610 291062 289227 gene locus_tag LOCUS_02620 291062 289227 CDS product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204893.1 protein_id gnl|my_center|LOCUS_02620 294601 291062 gene locus_tag LOCUS_02630 gene drmA 294601 291062 CDS product DISARM system helicase DrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204892.1 protein_id gnl|my_center|LOCUS_02630 295492 300555 gene locus_tag LOCUS_02640 295492 300555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 300552 301811 gene locus_tag LOCUS_02650 300552 301811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 301924 302349 gene locus_tag LOCUS_02660 301924 302349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 302346 304094 gene locus_tag LOCUS_02670 302346 304094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 304272 306290 gene locus_tag LOCUS_02680 304272 306290 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385729.1 protein_id gnl|my_center|LOCUS_02680 307177 308007 gene locus_tag LOCUS_02690 307177 308007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 308004 308885 gene locus_tag LOCUS_02700 308004 308885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 308882 312112 gene locus_tag LOCUS_02710 308882 312112 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385732.1 protein_id gnl|my_center|LOCUS_02710 312781 313389 gene locus_tag LOCUS_02720 312781 313389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02720 313452 316784 gene locus_tag LOCUS_02730 313452 316784 CDS product VPA1262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477100.1 protein_id gnl|my_center|LOCUS_02730 317596 318615 gene locus_tag LOCUS_02740 317596 318615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 322860 319102 gene locus_tag LOCUS_02750 322860 319102 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256730.1 protein_id gnl|my_center|LOCUS_02750 325637 322857 gene locus_tag LOCUS_02760 325637 322857 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 protein_id gnl|my_center|LOCUS_02760 330793 325634 gene locus_tag LOCUS_02770 330793 325634 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883981.1 protein_id gnl|my_center|LOCUS_02770 >Feature sequence02 2 316 gene locus_tag LOCUS_02780 2 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 341 1615 gene locus_tag LOCUS_02790 341 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 2670 1894 gene locus_tag LOCUS_02800 2670 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 2885 4306 gene locus_tag LOCUS_02810 2885 4306 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480316.1 protein_id gnl|my_center|LOCUS_02810 5765 4380 gene locus_tag LOCUS_02820 5765 4380 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888074.1 protein_id gnl|my_center|LOCUS_02820 6601 5762 gene locus_tag LOCUS_02830 gene rapZ 6601 5762 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888073.1 protein_id gnl|my_center|LOCUS_02830 6827 8311 gene locus_tag LOCUS_02840 6827 8311 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381361.1 protein_id gnl|my_center|LOCUS_02840 8323 9336 gene locus_tag LOCUS_02850 8323 9336 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082660.1 protein_id gnl|my_center|LOCUS_02850 9333 10256 gene locus_tag LOCUS_02860 9333 10256 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082669.1 protein_id gnl|my_center|LOCUS_02860 10890 10426 gene locus_tag LOCUS_02870 10890 10426 CDS product thioredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398596.1 protein_id gnl|my_center|LOCUS_02870 12238 10928 gene locus_tag LOCUS_02880 12238 10928 CDS product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040400.1 protein_id gnl|my_center|LOCUS_02880 12647 12288 gene locus_tag LOCUS_02890 12647 12288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 13381 12869 gene locus_tag LOCUS_02900 13381 12869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 14805 13762 gene locus_tag LOCUS_02910 14805 13762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 16478 15240 gene locus_tag LOCUS_02920 16478 15240 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013408.1 protein_id gnl|my_center|LOCUS_02920 17504 17166 gene locus_tag LOCUS_02930 17504 17166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 17662 17841 gene locus_tag LOCUS_02940 17662 17841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 17792 18049 gene locus_tag LOCUS_02950 17792 18049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02950 18303 18803 gene locus_tag LOCUS_02960 18303 18803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 19472 18873 gene locus_tag LOCUS_02970 19472 18873 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142655.1 protein_id gnl|my_center|LOCUS_02970 19858 20685 gene locus_tag LOCUS_02980 19858 20685 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120708963.1 protein_id gnl|my_center|LOCUS_02980 20682 21542 gene locus_tag LOCUS_02990 20682 21542 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024997765.1 protein_id gnl|my_center|LOCUS_02990 21925 22194 gene locus_tag LOCUS_03000 21925 22194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03000 22198 22524 gene locus_tag LOCUS_03010 22198 22524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03010 22580 22870 gene locus_tag LOCUS_03020 22580 22870 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141200.1 protein_id gnl|my_center|LOCUS_03020 22867 23373 gene locus_tag LOCUS_03030 22867 23373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141199.1 protein_id gnl|my_center|LOCUS_03030 23851 24093 gene locus_tag LOCUS_03040 23851 24093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 24287 24096 gene locus_tag LOCUS_03050 24287 24096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 24736 24374 gene locus_tag LOCUS_03060 24736 24374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 25066 24977 gene locus_tag LOCUS_t00040 25066 24977 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 25243 26772 gene locus_tag LOCUS_03070 gene murJ 25243 26772 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177570.1 protein_id gnl|my_center|LOCUS_03070 27382 26762 gene locus_tag LOCUS_03080 27382 26762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 27546 28490 gene locus_tag LOCUS_03090 27546 28490 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926019.1 protein_id gnl|my_center|LOCUS_03090 28503 31163 gene locus_tag LOCUS_03100 gene topA 28503 31163 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227691.1 protein_id gnl|my_center|LOCUS_03100 31165 31449 gene locus_tag LOCUS_03110 31165 31449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 31453 32484 gene locus_tag LOCUS_03120 gene dusA 31453 32484 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039017.1 protein_id gnl|my_center|LOCUS_03120 33529 32459 gene locus_tag LOCUS_03130 33529 32459 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480164.1 protein_id gnl|my_center|LOCUS_03130 33989 33486 gene locus_tag LOCUS_03140 33989 33486 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351160.1 protein_id gnl|my_center|LOCUS_03140 35809 33971 gene locus_tag LOCUS_03150 35809 33971 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025567123.1 protein_id gnl|my_center|LOCUS_03150 36687 35947 gene locus_tag LOCUS_03160 36687 35947 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887221.1 protein_id gnl|my_center|LOCUS_03160 36805 37101 gene locus_tag LOCUS_03170 36805 37101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 37147 38085 gene locus_tag LOCUS_03180 37147 38085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 38088 38699 gene locus_tag LOCUS_03190 38088 38699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 38696 39307 gene locus_tag LOCUS_03200 38696 39307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 40221 39322 gene locus_tag LOCUS_03210 40221 39322 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228840.1 protein_id gnl|my_center|LOCUS_03210 40386 40760 gene locus_tag LOCUS_03220 40386 40760 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172987.1 protein_id gnl|my_center|LOCUS_03220 40792 42222 gene locus_tag LOCUS_03230 40792 42222 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228361.1 protein_id gnl|my_center|LOCUS_03230 42260 43168 gene locus_tag LOCUS_03240 42260 43168 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090741.1 protein_id gnl|my_center|LOCUS_03240 43165 43821 gene locus_tag LOCUS_03250 43165 43821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115937.1 protein_id gnl|my_center|LOCUS_03250 44351 49951 gene locus_tag LOCUS_03260 44351 49951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 51182 50025 gene locus_tag LOCUS_03270 51182 50025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 51891 51190 gene locus_tag LOCUS_03280 51891 51190 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086341.1 protein_id gnl|my_center|LOCUS_03280 51983 53389 gene locus_tag LOCUS_03290 51983 53389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 53386 54444 gene locus_tag LOCUS_03300 53386 54444 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228369.1 protein_id gnl|my_center|LOCUS_03300 54448 55710 gene locus_tag LOCUS_03310 54448 55710 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870666.1 protein_id gnl|my_center|LOCUS_03310 55707 59066 gene locus_tag LOCUS_03320 55707 59066 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887385.1 protein_id gnl|my_center|LOCUS_03320 61171 59063 gene locus_tag LOCUS_03330 gene glgX 61171 59063 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403613.1 protein_id gnl|my_center|LOCUS_03330 62279 61266 gene locus_tag LOCUS_03340 62279 61266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 63148 62276 gene locus_tag LOCUS_03350 63148 62276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 63818 64447 gene locus_tag LOCUS_03360 63818 64447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 64574 65080 gene locus_tag LOCUS_03370 64574 65080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 67121 65205 gene locus_tag LOCUS_03380 67121 65205 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942985.1 protein_id gnl|my_center|LOCUS_03380 68217 67180 gene locus_tag LOCUS_03390 gene tdh 68217 67180 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228031.1 protein_id gnl|my_center|LOCUS_03390 68852 68289 gene locus_tag LOCUS_03400 68852 68289 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886987.1 protein_id gnl|my_center|LOCUS_03400 69951 68893 gene locus_tag LOCUS_03410 69951 68893 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886988.1 protein_id gnl|my_center|LOCUS_03410 70418 69954 gene locus_tag LOCUS_03420 70418 69954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 70948 70415 gene locus_tag LOCUS_03430 70948 70415 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886990.1 protein_id gnl|my_center|LOCUS_03430 72924 70945 gene locus_tag LOCUS_03440 72924 70945 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_03440 73411 72941 gene locus_tag LOCUS_03450 gene ccmE 73411 72941 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228655.1 protein_id gnl|my_center|LOCUS_03450 74230 73511 gene locus_tag LOCUS_03460 gene ccsA 74230 73511 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886993.1 protein_id gnl|my_center|LOCUS_03460 74939 74262 gene locus_tag LOCUS_03470 74939 74262 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887052.1 protein_id gnl|my_center|LOCUS_03470 75600 74956 gene locus_tag LOCUS_03480 gene ccmA 75600 74956 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887051.1 protein_id gnl|my_center|LOCUS_03480 76289 75597 gene locus_tag LOCUS_03490 76289 75597 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887942.1 protein_id gnl|my_center|LOCUS_03490 76710 76309 gene locus_tag LOCUS_03500 76710 76309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 78920 76707 gene locus_tag LOCUS_03510 78920 76707 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177182973.1 protein_id gnl|my_center|LOCUS_03510 79354 78968 gene locus_tag LOCUS_03520 79354 78968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 80179 79388 gene locus_tag LOCUS_03530 80179 79388 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349517.1 protein_id gnl|my_center|LOCUS_03530 80282 80614 gene locus_tag LOCUS_03540 80282 80614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 81020 82537 gene locus_tag LOCUS_03550 gene nrfD 81020 82537 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259049.1 protein_id gnl|my_center|LOCUS_03550 82556 85483 gene locus_tag LOCUS_03560 82556 85483 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_03560 84613 84519 gene locus_tag LOCUS_t00050 84613 84519 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 85485 86360 gene locus_tag LOCUS_03570 85485 86360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 86357 87607 gene locus_tag LOCUS_03580 86357 87607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 87621 89705 gene locus_tag LOCUS_03590 gene ppk1 87621 89705 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479817.1 protein_id gnl|my_center|LOCUS_03590 90433 89708 gene locus_tag LOCUS_03600 90433 89708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888861.1 protein_id gnl|my_center|LOCUS_03600 90476 90805 gene locus_tag LOCUS_03610 90476 90805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 90901 91275 gene locus_tag LOCUS_03620 90901 91275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632112.1 protein_id gnl|my_center|LOCUS_03620 91259 91885 gene locus_tag LOCUS_03630 91259 91885 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888386.1 protein_id gnl|my_center|LOCUS_03630 91932 92354 gene locus_tag LOCUS_03640 gene dtd 91932 92354 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256355.1 protein_id gnl|my_center|LOCUS_03640 94322 92478 gene locus_tag LOCUS_03650 94322 92478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 94908 94681 gene locus_tag LOCUS_03660 94908 94681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 95187 95831 gene locus_tag LOCUS_03670 95187 95831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 96515 95862 gene locus_tag LOCUS_03680 96515 95862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 96585 97421 gene locus_tag LOCUS_03690 96585 97421 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327693.1 protein_id gnl|my_center|LOCUS_03690 98316 97426 gene locus_tag LOCUS_03700 98316 97426 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393325.1 protein_id gnl|my_center|LOCUS_03700 99868 98384 gene locus_tag LOCUS_03710 99868 98384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 99924 100628 gene locus_tag LOCUS_03720 99924 100628 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300570.1 protein_id gnl|my_center|LOCUS_03720 100630 101466 gene locus_tag LOCUS_03730 100630 101466 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261394.1 protein_id gnl|my_center|LOCUS_03730 101509 102759 gene locus_tag LOCUS_03740 101509 102759 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920974.1 protein_id gnl|my_center|LOCUS_03740 102803 103744 gene locus_tag LOCUS_03750 102803 103744 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080851.1 protein_id gnl|my_center|LOCUS_03750 103741 104595 gene locus_tag LOCUS_03760 103741 104595 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256995.1 protein_id gnl|my_center|LOCUS_03760 104592 105710 gene locus_tag LOCUS_03770 gene nagA 104592 105710 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195336.1 protein_id gnl|my_center|LOCUS_03770 105723 106607 gene locus_tag LOCUS_03780 gene rbsK 105723 106607 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246357.1 protein_id gnl|my_center|LOCUS_03780 107137 106613 gene locus_tag LOCUS_03790 107137 106613 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228210.1 protein_id gnl|my_center|LOCUS_03790 107263 108828 gene locus_tag LOCUS_03800 gene serA 107263 108828 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887934.1 protein_id gnl|my_center|LOCUS_03800 108858 110045 gene locus_tag LOCUS_03810 108858 110045 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479659.1 protein_id gnl|my_center|LOCUS_03810 110298 110098 gene locus_tag LOCUS_03820 110298 110098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 111013 110531 gene locus_tag LOCUS_03830 111013 110531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 110961 111326 gene locus_tag LOCUS_03840 110961 111326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 112938 111364 gene locus_tag LOCUS_03850 112938 111364 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225355414.1 protein_id gnl|my_center|LOCUS_03850 114581 113286 gene locus_tag LOCUS_03860 gene phr 114581 113286 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229192.1 protein_id gnl|my_center|LOCUS_03860 114672 115823 gene locus_tag LOCUS_03870 114672 115823 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618904.1 protein_id gnl|my_center|LOCUS_03870 116835 115786 gene locus_tag LOCUS_03880 gene recA 116835 115786 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888966.1 protein_id gnl|my_center|LOCUS_03880 117356 116832 gene locus_tag LOCUS_03890 117356 116832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 118582 117353 gene locus_tag LOCUS_03900 118582 117353 CDS product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888964.1 protein_id gnl|my_center|LOCUS_03900 118674 120314 gene locus_tag LOCUS_03910 118674 120314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 120358 121374 gene locus_tag LOCUS_03920 120358 121374 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618830.1 protein_id gnl|my_center|LOCUS_03920 121388 123181 gene locus_tag LOCUS_03930 gene lepA 121388 123181 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887788.1 protein_id gnl|my_center|LOCUS_03930 123184 124212 gene locus_tag LOCUS_03940 123184 124212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03940 124209 124808 gene locus_tag LOCUS_03950 124209 124808 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887536.1 protein_id gnl|my_center|LOCUS_03950 124977 125366 gene locus_tag LOCUS_03960 124977 125366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 125540 126511 gene locus_tag LOCUS_03970 125540 126511 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_03970 127588 126539 gene locus_tag LOCUS_03980 127588 126539 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889414.1 protein_id gnl|my_center|LOCUS_03980 129095 127647 gene locus_tag LOCUS_03990 129095 127647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 131023 129092 gene locus_tag LOCUS_04000 131023 129092 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257045.1 protein_id gnl|my_center|LOCUS_04000 131265 131020 gene locus_tag LOCUS_04010 131265 131020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 131690 131274 gene locus_tag LOCUS_04020 131690 131274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 133020 131671 gene locus_tag LOCUS_04030 133020 131671 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888807.1 protein_id gnl|my_center|LOCUS_04030 133345 133812 gene locus_tag LOCUS_04040 133345 133812 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227752.1 protein_id gnl|my_center|LOCUS_04040 133813 135039 gene locus_tag LOCUS_04050 133813 135039 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_04050 135036 136118 gene locus_tag LOCUS_04060 gene proB 135036 136118 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888462.1 protein_id gnl|my_center|LOCUS_04060 136503 136090 gene locus_tag LOCUS_04070 136503 136090 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887547.1 protein_id gnl|my_center|LOCUS_04070 137816 136500 gene locus_tag LOCUS_04080 gene glmM 137816 136500 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888702.1 protein_id gnl|my_center|LOCUS_04080 139222 137819 gene locus_tag LOCUS_04090 139222 137819 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889307.1 protein_id gnl|my_center|LOCUS_04090 139699 139364 gene locus_tag LOCUS_04100 139699 139364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173720.1 protein_id gnl|my_center|LOCUS_04100 139963 141393 gene locus_tag LOCUS_04110 139963 141393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 142277 142900 gene locus_tag LOCUS_04120 142277 142900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 145749 142906 gene locus_tag LOCUS_04130 145749 142906 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479509.1 protein_id gnl|my_center|LOCUS_04130 146191 147225 gene locus_tag LOCUS_04140 146191 147225 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892758.1 protein_id gnl|my_center|LOCUS_04140 147235 147987 gene locus_tag LOCUS_04150 147235 147987 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086009.1 protein_id gnl|my_center|LOCUS_04150 147981 149045 gene locus_tag LOCUS_04160 gene gutB 147981 149045 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 protein_id gnl|my_center|LOCUS_04160 150508 149141 gene locus_tag LOCUS_04170 150508 149141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 150477 150683 gene locus_tag LOCUS_04180 150477 150683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 151663 154524 gene locus_tag LOCUS_04190 151663 154524 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 protein_id gnl|my_center|LOCUS_04190 154524 158393 gene locus_tag LOCUS_04200 154524 158393 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256730.1 protein_id gnl|my_center|LOCUS_04200 159786 158863 gene locus_tag LOCUS_04210 159786 158863 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018647871.1 protein_id gnl|my_center|LOCUS_04210 160397 159783 gene locus_tag LOCUS_04220 160397 159783 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970322.1 protein_id gnl|my_center|LOCUS_04220 160936 161994 gene locus_tag LOCUS_04230 160936 161994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 162335 164323 gene locus_tag LOCUS_04240 162335 164323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 164463 165425 gene locus_tag LOCUS_04250 164463 165425 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227740.1 protein_id gnl|my_center|LOCUS_04250 165527 166000 gene locus_tag LOCUS_04260 165527 166000 CDS product DUF4384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887664.1 protein_id gnl|my_center|LOCUS_04260 165997 166329 gene locus_tag LOCUS_04270 165997 166329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 166330 167676 gene locus_tag LOCUS_04280 gene rimO 166330 167676 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889448.1 protein_id gnl|my_center|LOCUS_04280 167678 168049 gene locus_tag LOCUS_04290 167678 168049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 168037 168708 gene locus_tag LOCUS_04300 168037 168708 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480061.1 protein_id gnl|my_center|LOCUS_04300 168705 169988 gene locus_tag LOCUS_04310 168705 169988 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889042.1 protein_id gnl|my_center|LOCUS_04310 170117 171172 gene locus_tag LOCUS_04320 170117 171172 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893107.1 protein_id gnl|my_center|LOCUS_04320 171353 172588 gene locus_tag LOCUS_04330 171353 172588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 172648 173577 gene locus_tag LOCUS_04340 172648 173577 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224935.1 protein_id gnl|my_center|LOCUS_04340 173577 174419 gene locus_tag LOCUS_04350 173577 174419 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030645.1 protein_id gnl|my_center|LOCUS_04350 174452 176092 gene locus_tag LOCUS_04360 gene araB 174452 176092 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226245.1 protein_id gnl|my_center|LOCUS_04360 176092 176760 gene locus_tag LOCUS_04370 176092 176760 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776915.1 protein_id gnl|my_center|LOCUS_04370 176774 178282 gene locus_tag LOCUS_04380 gene araA 176774 178282 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082981.1 protein_id gnl|my_center|LOCUS_04380 178302 180224 gene locus_tag LOCUS_04390 178302 180224 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530523.1 protein_id gnl|my_center|LOCUS_04390 181832 180426 gene locus_tag LOCUS_04400 181832 180426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 182711 183046 gene locus_tag LOCUS_04410 182711 183046 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942689.1 protein_id gnl|my_center|LOCUS_04410 183043 183354 gene locus_tag LOCUS_04420 183043 183354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 >Feature sequence03 1120 161 gene locus_tag LOCUS_04430 1120 161 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582676.1 protein_id gnl|my_center|LOCUS_04430 2154 1156 gene locus_tag LOCUS_04440 2154 1156 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189263.1 protein_id gnl|my_center|LOCUS_04440 2265 4730 gene locus_tag LOCUS_04450 2265 4730 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584148.1 protein_id gnl|my_center|LOCUS_04450 4727 5404 gene locus_tag LOCUS_04460 4727 5404 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532294.1 protein_id gnl|my_center|LOCUS_04460 6780 5479 gene locus_tag LOCUS_04470 6780 5479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 6716 6922 gene locus_tag LOCUS_04480 6716 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 7040 8197 gene locus_tag LOCUS_04490 7040 8197 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229571.1 protein_id gnl|my_center|LOCUS_04490 8194 9030 gene locus_tag LOCUS_04500 8194 9030 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332337.1 protein_id gnl|my_center|LOCUS_04500 9027 10028 gene locus_tag LOCUS_04510 9027 10028 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615578.1 protein_id gnl|my_center|LOCUS_04510 10082 11320 gene locus_tag LOCUS_04520 10082 11320 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528982.1 protein_id gnl|my_center|LOCUS_04520 11360 12253 gene locus_tag LOCUS_04530 11360 12253 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528983.1 protein_id gnl|my_center|LOCUS_04530 12253 13077 gene locus_tag LOCUS_04540 12253 13077 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528984.1 protein_id gnl|my_center|LOCUS_04540 13965 13042 gene locus_tag LOCUS_04550 13965 13042 CDS product Cj0069 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965728.1 protein_id gnl|my_center|LOCUS_04550 15041 14100 gene locus_tag LOCUS_04560 15041 14100 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226614.1 protein_id gnl|my_center|LOCUS_04560 17864 15051 gene locus_tag LOCUS_04570 17864 15051 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161797787.1 protein_id gnl|my_center|LOCUS_04570 18748 17861 gene locus_tag LOCUS_04580 18748 17861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 18927 19003 gene locus_tag LOCUS_t00060 18927 19003 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 19046 19789 gene locus_tag LOCUS_04590 19046 19789 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887762.1 protein_id gnl|my_center|LOCUS_04590 20927 19758 gene locus_tag LOCUS_04600 20927 19758 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618807.1 protein_id gnl|my_center|LOCUS_04600 20967 21506 gene locus_tag LOCUS_04610 20967 21506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 22006 21743 gene locus_tag LOCUS_04620 22006 21743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 22764 22003 gene locus_tag LOCUS_04630 22764 22003 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887189.1 protein_id gnl|my_center|LOCUS_04630 23553 22798 gene locus_tag LOCUS_04640 23553 22798 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888247.1 protein_id gnl|my_center|LOCUS_04640 23609 25039 gene locus_tag LOCUS_04650 23609 25039 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350448.1 protein_id gnl|my_center|LOCUS_04650 25102 26241 gene locus_tag LOCUS_04660 25102 26241 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479989.1 protein_id gnl|my_center|LOCUS_04660 26293 26949 gene locus_tag LOCUS_04670 26293 26949 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118816.1 protein_id gnl|my_center|LOCUS_04670 26951 28207 gene locus_tag LOCUS_04680 gene baeS 26951 28207 CDS product two-component system sensor histidine kinase BaeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675144.1 protein_id gnl|my_center|LOCUS_04680 28211 29926 gene locus_tag LOCUS_04690 28211 29926 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878912.1 protein_id gnl|my_center|LOCUS_04690 29999 31435 gene locus_tag LOCUS_04700 29999 31435 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889218.1 protein_id gnl|my_center|LOCUS_04700 31458 32660 gene locus_tag LOCUS_04710 31458 32660 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889017.1 protein_id gnl|my_center|LOCUS_04710 33062 32710 gene locus_tag LOCUS_tm00010 33062 32710 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 33356 33108 gene locus_tag LOCUS_04720 33356 33108 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888716.1 protein_id gnl|my_center|LOCUS_04720 34408 33431 gene locus_tag LOCUS_04730 34408 33431 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023004213.1 protein_id gnl|my_center|LOCUS_04730 34798 34463 gene locus_tag LOCUS_04740 34798 34463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 35307 34813 gene locus_tag LOCUS_04750 35307 34813 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887521.1 protein_id gnl|my_center|LOCUS_04750 35514 37007 gene locus_tag LOCUS_04760 35514 37007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 37507 37079 gene locus_tag LOCUS_04770 37507 37079 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889232.1 protein_id gnl|my_center|LOCUS_04770 38767 37553 gene locus_tag LOCUS_04780 38767 37553 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228352.1 protein_id gnl|my_center|LOCUS_04780 40070 38913 gene locus_tag LOCUS_04790 40070 38913 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_04790 40441 40067 gene locus_tag LOCUS_04800 40441 40067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 40524 41420 gene locus_tag LOCUS_04810 40524 41420 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887392.1 protein_id gnl|my_center|LOCUS_04810 42681 41425 gene locus_tag LOCUS_04820 42681 41425 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228148.1 protein_id gnl|my_center|LOCUS_04820 42753 43613 gene locus_tag LOCUS_04830 42753 43613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 43610 44782 gene locus_tag LOCUS_04840 43610 44782 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480033.1 protein_id gnl|my_center|LOCUS_04840 46022 44763 gene locus_tag LOCUS_04850 46022 44763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 46744 46019 gene locus_tag LOCUS_04860 46744 46019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 47632 46748 gene locus_tag LOCUS_04870 47632 46748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888466.1 protein_id gnl|my_center|LOCUS_04870 48300 47668 gene locus_tag LOCUS_04880 48300 47668 CDS product DUF2847 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888467.1 protein_id gnl|my_center|LOCUS_04880 49413 48424 gene locus_tag LOCUS_04890 49413 48424 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888469.1 protein_id gnl|my_center|LOCUS_04890 50716 49388 gene locus_tag LOCUS_04900 gene trmFO 50716 49388 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350703.1 protein_id gnl|my_center|LOCUS_04900 51222 50812 gene locus_tag LOCUS_04910 51222 50812 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031500121.1 protein_id gnl|my_center|LOCUS_04910 52518 51550 gene locus_tag LOCUS_04920 52518 51550 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817250.1 protein_id gnl|my_center|LOCUS_04920 53094 53594 gene locus_tag LOCUS_04930 53094 53594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04930 53626 53817 gene locus_tag LOCUS_04940 53626 53817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04940 54231 56273 gene locus_tag LOCUS_04950 gene acs 54231 56273 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404429.1 protein_id gnl|my_center|LOCUS_04950 56296 56853 gene locus_tag LOCUS_04960 56296 56853 CDS product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705937.1 protein_id gnl|my_center|LOCUS_04960 57932 56901 gene locus_tag LOCUS_04970 gene galT 57932 56901 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229184.1 protein_id gnl|my_center|LOCUS_04970 59878 57953 gene locus_tag LOCUS_04980 59878 57953 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080133.1 protein_id gnl|my_center|LOCUS_04980 60714 59875 gene locus_tag LOCUS_04990 60714 59875 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031642.1 protein_id gnl|my_center|LOCUS_04990 61574 60711 gene locus_tag LOCUS_05000 61574 60711 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804057.1 protein_id gnl|my_center|LOCUS_05000 62970 61642 gene locus_tag LOCUS_05010 62970 61642 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225936.1 protein_id gnl|my_center|LOCUS_05010 64344 63184 gene locus_tag LOCUS_05020 64344 63184 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887268.1 protein_id gnl|my_center|LOCUS_05020 64456 64531 gene locus_tag LOCUS_t00070 64456 64531 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 65160 65924 gene locus_tag LOCUS_05030 65160 65924 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326902.1 protein_id gnl|my_center|LOCUS_05030 66509 67642 gene locus_tag LOCUS_05040 66509 67642 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385612.1 protein_id gnl|my_center|LOCUS_05040 67639 68553 gene locus_tag LOCUS_05050 67639 68553 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948769.1 protein_id gnl|my_center|LOCUS_05050 68550 69356 gene locus_tag LOCUS_05060 68550 69356 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538207.1 protein_id gnl|my_center|LOCUS_05060 69349 70422 gene locus_tag LOCUS_05070 69349 70422 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385610.1 protein_id gnl|my_center|LOCUS_05070 70559 71113 gene locus_tag LOCUS_05080 70559 71113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 71199 72512 gene locus_tag LOCUS_05090 71199 72512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 72785 73099 gene locus_tag LOCUS_05100 72785 73099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 74414 73077 gene locus_tag LOCUS_05110 74414 73077 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226019.1 protein_id gnl|my_center|LOCUS_05110 75317 74499 gene locus_tag LOCUS_05120 75317 74499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 76215 75310 gene locus_tag LOCUS_05130 76215 75310 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_05130 77544 76228 gene locus_tag LOCUS_05140 77544 76228 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704225.1 protein_id gnl|my_center|LOCUS_05140 77714 78127 gene locus_tag LOCUS_05150 77714 78127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 78312 78872 gene locus_tag LOCUS_05160 78312 78872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 78869 80080 gene locus_tag LOCUS_05170 78869 80080 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886724.1 protein_id gnl|my_center|LOCUS_05170 80288 80091 gene locus_tag LOCUS_05180 80288 80091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 80954 80364 gene locus_tag LOCUS_05190 80954 80364 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228626.1 protein_id gnl|my_center|LOCUS_05190 82243 80951 gene locus_tag LOCUS_05200 82243 80951 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228625.1 protein_id gnl|my_center|LOCUS_05200 83042 82305 gene locus_tag LOCUS_05210 83042 82305 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228624.1 protein_id gnl|my_center|LOCUS_05210 83925 83074 gene locus_tag LOCUS_05220 83925 83074 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975348.1 protein_id gnl|my_center|LOCUS_05220 85424 83973 gene locus_tag LOCUS_05230 85424 83973 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978046.1 protein_id gnl|my_center|LOCUS_05230 87450 85414 gene locus_tag LOCUS_05240 87450 85414 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244479.1 protein_id gnl|my_center|LOCUS_05240 88656 87478 gene locus_tag LOCUS_05250 gene rhaI 88656 87478 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027369.1 protein_id gnl|my_center|LOCUS_05250 89042 88653 gene locus_tag LOCUS_05260 89042 88653 CDS product sensory rhodopsin transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582807.1 protein_id gnl|my_center|LOCUS_05260 89830 89039 gene locus_tag LOCUS_05270 89830 89039 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391560.1 protein_id gnl|my_center|LOCUS_05270 90242 91246 gene locus_tag LOCUS_05280 90242 91246 CDS product autoinducer 2 ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742142.1 protein_id gnl|my_center|LOCUS_05280 91313 92809 gene locus_tag LOCUS_05290 91313 92809 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523590.1 protein_id gnl|my_center|LOCUS_05290 92822 93829 gene locus_tag LOCUS_05300 92822 93829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 93826 94779 gene locus_tag LOCUS_05310 93826 94779 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082684.1 protein_id gnl|my_center|LOCUS_05310 94803 95090 gene locus_tag LOCUS_05320 94803 95090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 95487 96860 gene locus_tag LOCUS_05330 gene merA 95487 96860 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228473.1 protein_id gnl|my_center|LOCUS_05330 98961 97144 gene locus_tag LOCUS_05340 gene glmS 98961 97144 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480280.1 protein_id gnl|my_center|LOCUS_05340 100090 99314 gene locus_tag LOCUS_05350 100090 99314 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228020.1 protein_id gnl|my_center|LOCUS_05350 100572 100102 gene locus_tag LOCUS_05360 100572 100102 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867261.1 protein_id gnl|my_center|LOCUS_05360 100771 102429 gene locus_tag LOCUS_05370 100771 102429 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861635.1 protein_id gnl|my_center|LOCUS_05370 103516 102464 gene locus_tag LOCUS_05380 gene mnmA 103516 102464 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480311.1 protein_id gnl|my_center|LOCUS_05380 104070 103516 gene locus_tag LOCUS_05390 gene pyrE 104070 103516 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228883.1 protein_id gnl|my_center|LOCUS_05390 104680 104093 gene locus_tag LOCUS_05400 104680 104093 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887361.1 protein_id gnl|my_center|LOCUS_05400 104821 105732 gene locus_tag LOCUS_05410 104821 105732 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228784.1 protein_id gnl|my_center|LOCUS_05410 105735 106940 gene locus_tag LOCUS_05420 105735 106940 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257115.1 protein_id gnl|my_center|LOCUS_05420 107616 107113 gene locus_tag LOCUS_05430 107616 107113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 107679 108002 gene locus_tag LOCUS_05440 107679 108002 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862931.1 protein_id gnl|my_center|LOCUS_05440 107999 108334 gene locus_tag LOCUS_05450 107999 108334 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118979.1 protein_id gnl|my_center|LOCUS_05450 108334 109107 gene locus_tag LOCUS_05460 108334 109107 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227694.1 protein_id gnl|my_center|LOCUS_05460 109330 109962 gene locus_tag LOCUS_05470 109330 109962 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887480.1 protein_id gnl|my_center|LOCUS_05470 110799 109969 gene locus_tag LOCUS_05480 110799 109969 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056252.1 protein_id gnl|my_center|LOCUS_05480 110970 112016 gene locus_tag LOCUS_05490 110970 112016 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886907.1 protein_id gnl|my_center|LOCUS_05490 112013 113575 gene locus_tag LOCUS_05500 112013 113575 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889113.1 protein_id gnl|my_center|LOCUS_05500 113589 114560 gene locus_tag LOCUS_05510 113589 114560 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886710.1 protein_id gnl|my_center|LOCUS_05510 114557 115210 gene locus_tag LOCUS_05520 114557 115210 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887197.1 protein_id gnl|my_center|LOCUS_05520 115216 116757 gene locus_tag LOCUS_05530 115216 116757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 116846 117625 gene locus_tag LOCUS_05540 116846 117625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 117711 118118 gene locus_tag LOCUS_05550 117711 118118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 118115 118465 gene locus_tag LOCUS_05560 118115 118465 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887808.1 protein_id gnl|my_center|LOCUS_05560 118488 119303 gene locus_tag LOCUS_05570 gene panC 118488 119303 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887807.1 protein_id gnl|my_center|LOCUS_05570 119300 120397 gene locus_tag LOCUS_05580 119300 120397 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887806.1 protein_id gnl|my_center|LOCUS_05580 120399 121094 gene locus_tag LOCUS_05590 120399 121094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 121114 121587 gene locus_tag LOCUS_05600 gene greA 121114 121587 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887805.1 protein_id gnl|my_center|LOCUS_05600 121580 122254 gene locus_tag LOCUS_05610 121580 122254 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031118.1 protein_id gnl|my_center|LOCUS_05610 122251 123717 gene locus_tag LOCUS_05620 gene guaB 122251 123717 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888513.1 protein_id gnl|my_center|LOCUS_05620 123731 125836 gene locus_tag LOCUS_05630 gene scpA 123731 125836 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887727.1 protein_id gnl|my_center|LOCUS_05630 125833 126807 gene locus_tag LOCUS_05640 gene meaB 125833 126807 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920341.1 protein_id gnl|my_center|LOCUS_05640 126788 127102 gene locus_tag LOCUS_05650 126788 127102 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888258.1 protein_id gnl|my_center|LOCUS_05650 127135 127662 gene locus_tag LOCUS_05660 127135 127662 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889035.1 protein_id gnl|my_center|LOCUS_05660 129193 127682 gene locus_tag LOCUS_05670 129193 127682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 129961 129194 gene locus_tag LOCUS_05680 gene lptB 129961 129194 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888765.1 protein_id gnl|my_center|LOCUS_05680 130026 131162 gene locus_tag LOCUS_05690 130026 131162 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479937.1 protein_id gnl|my_center|LOCUS_05690 131162 131560 gene locus_tag LOCUS_05700 131162 131560 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173310.1 protein_id gnl|my_center|LOCUS_05700 131557 132138 gene locus_tag LOCUS_05710 131557 132138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228144.1 protein_id gnl|my_center|LOCUS_05710 132135 133481 gene locus_tag LOCUS_05720 gene hisD 132135 133481 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888771.1 protein_id gnl|my_center|LOCUS_05720 135331 133472 gene locus_tag LOCUS_05730 135331 133472 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403165.1 protein_id gnl|my_center|LOCUS_05730 135463 136641 gene locus_tag LOCUS_05740 135463 136641 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028712.1 protein_id gnl|my_center|LOCUS_05740 137908 136622 gene locus_tag LOCUS_05750 137908 136622 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228985.1 protein_id gnl|my_center|LOCUS_05750 139318 137978 gene locus_tag LOCUS_05760 gene dnaB 139318 137978 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887194.1 protein_id gnl|my_center|LOCUS_05760 139459 140232 gene locus_tag LOCUS_05770 139459 140232 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401467.1 protein_id gnl|my_center|LOCUS_05770 >Feature sequence04 418 188 gene locus_tag LOCUS_05780 418 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 909 622 gene locus_tag LOCUS_05790 909 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05790 1215 997 gene locus_tag LOCUS_05800 1215 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05800 2350 1847 gene locus_tag LOCUS_05810 2350 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 2667 2377 gene locus_tag LOCUS_05820 2667 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 3127 4128 gene locus_tag LOCUS_05830 gene mgrA 3127 4128 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640297.1 protein_id gnl|my_center|LOCUS_05830 5318 4257 gene locus_tag LOCUS_05840 5318 4257 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009927050.1 protein_id gnl|my_center|LOCUS_05840 6644 5331 gene locus_tag LOCUS_05850 6644 5331 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969771.1 protein_id gnl|my_center|LOCUS_05850 8090 6747 gene locus_tag LOCUS_05860 8090 6747 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804375.1 protein_id gnl|my_center|LOCUS_05860 9118 8216 gene locus_tag LOCUS_05870 9118 8216 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026977.1 protein_id gnl|my_center|LOCUS_05870 10062 9115 gene locus_tag LOCUS_05880 10062 9115 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026976.1 protein_id gnl|my_center|LOCUS_05880 11132 10401 gene locus_tag LOCUS_05890 11132 10401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 12163 11132 gene locus_tag LOCUS_05900 12163 11132 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021548.1 protein_id gnl|my_center|LOCUS_05900 13245 12334 gene locus_tag LOCUS_05910 13245 12334 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031765.1 protein_id gnl|my_center|LOCUS_05910 13377 14006 gene locus_tag LOCUS_05920 13377 14006 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729092.1 protein_id gnl|my_center|LOCUS_05920 15145 14369 gene locus_tag LOCUS_05930 15145 14369 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104409.1 protein_id gnl|my_center|LOCUS_05930 15245 15802 gene locus_tag LOCUS_05940 15245 15802 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931294.1 protein_id gnl|my_center|LOCUS_05940 16046 18766 gene locus_tag LOCUS_05950 16046 18766 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926106.1 protein_id gnl|my_center|LOCUS_05950 18835 20805 gene locus_tag LOCUS_05960 18835 20805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 20834 21448 gene locus_tag LOCUS_05970 20834 21448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 22390 22136 gene locus_tag LOCUS_05980 22390 22136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 22937 22443 gene locus_tag LOCUS_05990 22937 22443 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222249.1 protein_id gnl|my_center|LOCUS_05990 23805 22966 gene locus_tag LOCUS_06000 23805 22966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 24190 23897 gene locus_tag LOCUS_06010 gene vapD 24190 23897 CDS product virulence-associated protein VapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693712.1 protein_id gnl|my_center|LOCUS_06010 24393 24190 gene locus_tag LOCUS_06020 24393 24190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 26335 24905 gene locus_tag LOCUS_06030 26335 24905 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120122.1 protein_id gnl|my_center|LOCUS_06030 27412 26714 gene locus_tag LOCUS_06040 27412 26714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 27513 28037 gene locus_tag LOCUS_06050 27513 28037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226778.1 protein_id gnl|my_center|LOCUS_06050 28612 29766 gene locus_tag LOCUS_06060 28612 29766 CDS product ATP/GTP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616490.1 protein_id gnl|my_center|LOCUS_06060 29769 30494 gene locus_tag LOCUS_06070 29769 30494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 31772 30624 gene locus_tag LOCUS_06080 31772 30624 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480170.1 protein_id gnl|my_center|LOCUS_06080 33486 31753 gene locus_tag LOCUS_06090 33486 31753 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886995.1 protein_id gnl|my_center|LOCUS_06090 33576 34865 gene locus_tag LOCUS_06100 33576 34865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 34956 35462 gene locus_tag LOCUS_06110 34956 35462 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_06110 35482 36297 gene locus_tag LOCUS_06120 gene rsmA 35482 36297 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618805.1 protein_id gnl|my_center|LOCUS_06120 36306 36938 gene locus_tag LOCUS_06130 36306 36938 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888617.1 protein_id gnl|my_center|LOCUS_06130 38894 37191 gene locus_tag LOCUS_06140 38894 37191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 40937 39276 gene locus_tag LOCUS_06150 40937 39276 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479878.1 protein_id gnl|my_center|LOCUS_06150 41465 41076 gene locus_tag LOCUS_06160 41465 41076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 41784 41455 gene locus_tag LOCUS_06170 41784 41455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 41930 42601 gene locus_tag LOCUS_06180 41930 42601 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889187.1 protein_id gnl|my_center|LOCUS_06180 42630 43538 gene locus_tag LOCUS_06190 42630 43538 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177599.1 protein_id gnl|my_center|LOCUS_06190 43584 45056 gene locus_tag LOCUS_06200 43584 45056 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258284.1 protein_id gnl|my_center|LOCUS_06200 45057 45974 gene locus_tag LOCUS_06210 gene folP 45057 45974 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886814.1 protein_id gnl|my_center|LOCUS_06210 45995 46945 gene locus_tag LOCUS_06220 45995 46945 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479751.1 protein_id gnl|my_center|LOCUS_06220 46939 47595 gene locus_tag LOCUS_06230 46939 47595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 49303 47657 gene locus_tag LOCUS_06240 49303 47657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 50985 49321 gene locus_tag LOCUS_06250 50985 49321 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963500.1 protein_id gnl|my_center|LOCUS_06250 52349 50982 gene locus_tag LOCUS_06260 52349 50982 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257261.1 protein_id gnl|my_center|LOCUS_06260 52523 53224 gene locus_tag LOCUS_06270 52523 53224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 53224 54174 gene locus_tag LOCUS_06280 53224 54174 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183315.1 protein_id gnl|my_center|LOCUS_06280 55643 54171 gene locus_tag LOCUS_06290 55643 54171 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875743.1 protein_id gnl|my_center|LOCUS_06290 56185 55640 gene locus_tag LOCUS_06300 56185 55640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 56287 57354 gene locus_tag LOCUS_06310 56287 57354 CDS product lipid II:glycine glycyltransferase FemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479637.1 protein_id gnl|my_center|LOCUS_06310 57374 58150 gene locus_tag LOCUS_06320 57374 58150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 58164 59756 gene locus_tag LOCUS_06330 58164 59756 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479846.1 protein_id gnl|my_center|LOCUS_06330 60020 60838 gene locus_tag LOCUS_06340 60020 60838 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706367.1 protein_id gnl|my_center|LOCUS_06340 61057 61893 gene locus_tag LOCUS_06350 61057 61893 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918723.1 protein_id gnl|my_center|LOCUS_06350 61893 62762 gene locus_tag LOCUS_06360 61893 62762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 63556 62759 gene locus_tag LOCUS_06370 63556 62759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 63583 64770 gene locus_tag LOCUS_06380 63583 64770 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943264.1 protein_id gnl|my_center|LOCUS_06380 64791 65198 gene locus_tag LOCUS_06390 gene mce 64791 65198 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172482.1 protein_id gnl|my_center|LOCUS_06390 65198 66148 gene locus_tag LOCUS_06400 65198 66148 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227738.1 protein_id gnl|my_center|LOCUS_06400 66148 67530 gene locus_tag LOCUS_06410 66148 67530 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258857.1 protein_id gnl|my_center|LOCUS_06410 69460 67559 gene locus_tag LOCUS_06420 69460 67559 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350791.1 protein_id gnl|my_center|LOCUS_06420 69499 69575 gene locus_tag LOCUS_t00080 69499 69575 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 69716 70639 gene locus_tag LOCUS_06430 69716 70639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 71222 70551 gene locus_tag LOCUS_06440 gene hisG 71222 70551 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888084.1 protein_id gnl|my_center|LOCUS_06440 72325 71219 gene locus_tag LOCUS_06450 72325 71219 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888083.1 protein_id gnl|my_center|LOCUS_06450 72391 72996 gene locus_tag LOCUS_06460 72391 72996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 73754 73008 gene locus_tag LOCUS_06470 73754 73008 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887469.1 protein_id gnl|my_center|LOCUS_06470 74678 73809 gene locus_tag LOCUS_06480 gene aguB 74678 73809 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889160.1 protein_id gnl|my_center|LOCUS_06480 75729 74671 gene locus_tag LOCUS_06490 75729 74671 CDS product agmatine/peptidylarginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618851.1 protein_id gnl|my_center|LOCUS_06490 76837 75854 gene locus_tag LOCUS_06500 76837 75854 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337813.1 protein_id gnl|my_center|LOCUS_06500 77206 77015 gene locus_tag LOCUS_06510 77206 77015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 77135 77323 gene locus_tag LOCUS_06520 77135 77323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 77581 78834 gene locus_tag LOCUS_06530 77581 78834 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928421.1 protein_id gnl|my_center|LOCUS_06530 79457 78843 gene locus_tag LOCUS_06540 79457 78843 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479800.1 protein_id gnl|my_center|LOCUS_06540 80083 79454 gene locus_tag LOCUS_06550 80083 79454 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479904.1 protein_id gnl|my_center|LOCUS_06550 80882 80109 gene locus_tag LOCUS_06560 80882 80109 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811978.1 protein_id gnl|my_center|LOCUS_06560 81886 80939 gene locus_tag LOCUS_06570 81886 80939 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247679.1 protein_id gnl|my_center|LOCUS_06570 83426 81912 gene locus_tag LOCUS_06580 83426 81912 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965798.1 protein_id gnl|my_center|LOCUS_06580 83834 85024 gene locus_tag LOCUS_06590 83834 85024 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886984.1 protein_id gnl|my_center|LOCUS_06590 85043 86662 gene locus_tag LOCUS_06600 85043 86662 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240985.1 protein_id gnl|my_center|LOCUS_06600 86664 87611 gene locus_tag LOCUS_06610 86664 87611 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089452.1 protein_id gnl|my_center|LOCUS_06610 87613 88488 gene locus_tag LOCUS_06620 gene appC 87613 88488 CDS product oligopeptide ABC transporter permease AppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232961.1 protein_id gnl|my_center|LOCUS_06620 88907 88497 gene locus_tag LOCUS_06630 88907 88497 CDS product phosphomannose isomerase type II C-terminal cupin domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103017550.1 protein_id gnl|my_center|LOCUS_06630 89984 88932 gene locus_tag LOCUS_06640 89984 88932 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479721.1 protein_id gnl|my_center|LOCUS_06640 91576 90146 gene locus_tag LOCUS_06650 gene pyk 91576 90146 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889259.1 protein_id gnl|my_center|LOCUS_06650 92831 91563 gene locus_tag LOCUS_06660 gene eno 92831 91563 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173981.1 protein_id gnl|my_center|LOCUS_06660 94051 92942 gene locus_tag LOCUS_06670 gene dnaN 94051 92942 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480259.1 protein_id gnl|my_center|LOCUS_06670 95685 94363 gene locus_tag LOCUS_06680 gene dnaA 95685 94363 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480258.1 protein_id gnl|my_center|LOCUS_06680 97068 95878 gene locus_tag LOCUS_06690 97068 95878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 98011 97139 gene locus_tag LOCUS_06700 98011 97139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847040.1 protein_id gnl|my_center|LOCUS_06700 98551 98087 gene locus_tag LOCUS_06710 98551 98087 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349510.1 protein_id gnl|my_center|LOCUS_06710 98714 101473 gene locus_tag LOCUS_06720 98714 101473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 102323 101475 gene locus_tag LOCUS_06730 102323 101475 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887711.1 protein_id gnl|my_center|LOCUS_06730 103486 102320 gene locus_tag LOCUS_06740 103486 102320 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887715.1 protein_id gnl|my_center|LOCUS_06740 104197 103553 gene locus_tag LOCUS_06750 104197 103553 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887723.1 protein_id gnl|my_center|LOCUS_06750 105337 104258 gene locus_tag LOCUS_06760 105337 104258 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228247.1 protein_id gnl|my_center|LOCUS_06760 106458 105334 gene locus_tag LOCUS_06770 gene dxr 106458 105334 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888147.1 protein_id gnl|my_center|LOCUS_06770 107325 106486 gene locus_tag LOCUS_06780 107325 106486 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480221.1 protein_id gnl|my_center|LOCUS_06780 107894 107352 gene locus_tag LOCUS_06790 gene frr 107894 107352 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888149.1 protein_id gnl|my_center|LOCUS_06790 108627 107920 gene locus_tag LOCUS_06800 gene pyrH 108627 107920 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480220.1 protein_id gnl|my_center|LOCUS_06800 109449 108640 gene locus_tag LOCUS_06810 gene tsf 109449 108640 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888151.1 protein_id gnl|my_center|LOCUS_06810 110231 109449 gene locus_tag LOCUS_06820 gene rpsB 110231 109449 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888152.1 protein_id gnl|my_center|LOCUS_06820 111529 110405 gene locus_tag LOCUS_06830 111529 110405 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350047.1 protein_id gnl|my_center|LOCUS_06830 111766 112347 gene locus_tag LOCUS_06840 gene coaE 111766 112347 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888527.1 protein_id gnl|my_center|LOCUS_06840 114068 112359 gene locus_tag LOCUS_06850 114068 112359 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888212.1 protein_id gnl|my_center|LOCUS_06850 114706 114152 gene locus_tag LOCUS_06860 gene tsaB 114706 114152 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887402.1 protein_id gnl|my_center|LOCUS_06860 115272 114703 gene locus_tag LOCUS_06870 115272 114703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 115321 116526 gene locus_tag LOCUS_06880 115321 116526 CDS product serine-tRNA(Ala) deacylase AlaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349482.1 protein_id gnl|my_center|LOCUS_06880 116842 116528 gene locus_tag LOCUS_06890 116842 116528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 117732 116926 gene locus_tag LOCUS_06900 117732 116926 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479587.1 protein_id gnl|my_center|LOCUS_06900 118202 117729 gene locus_tag LOCUS_06910 gene ribH 118202 117729 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886802.1 protein_id gnl|my_center|LOCUS_06910 119386 118199 gene locus_tag LOCUS_06920 119386 118199 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886801.1 protein_id gnl|my_center|LOCUS_06920 119991 119383 gene locus_tag LOCUS_06930 119991 119383 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886800.1 protein_id gnl|my_center|LOCUS_06930 121115 119991 gene locus_tag LOCUS_06940 gene ribD 121115 119991 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886799.1 protein_id gnl|my_center|LOCUS_06940 121246 121148 gene locus_tag LOCUS_t00090 121246 121148 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 122751 121333 gene locus_tag LOCUS_06950 gene glnA 122751 121333 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257332.1 protein_id gnl|my_center|LOCUS_06950 122653 122883 gene locus_tag LOCUS_06960 122653 122883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 123212 122994 gene locus_tag LOCUS_06970 gene rpmE 123212 122994 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887471.1 protein_id gnl|my_center|LOCUS_06970 124744 123293 gene locus_tag LOCUS_06980 124744 123293 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886942.1 protein_id gnl|my_center|LOCUS_06980 125525 124944 gene locus_tag LOCUS_06990 125525 124944 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391573.1 protein_id gnl|my_center|LOCUS_06990 126369 125560 gene locus_tag LOCUS_07000 126369 125560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 126514 127677 gene locus_tag LOCUS_07010 126514 127677 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031604.1 protein_id gnl|my_center|LOCUS_07010 128524 127682 gene locus_tag LOCUS_07020 gene pheA 128524 127682 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038038884.1 protein_id gnl|my_center|LOCUS_07020 128582 129376 gene locus_tag LOCUS_07030 gene proC 128582 129376 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888161.1 protein_id gnl|my_center|LOCUS_07030 129373 129927 gene locus_tag LOCUS_07040 129373 129927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926046.1 protein_id gnl|my_center|LOCUS_07040 129924 130472 gene locus_tag LOCUS_07050 129924 130472 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525946.1 protein_id gnl|my_center|LOCUS_07050 130469 130711 gene locus_tag LOCUS_07060 130469 130711 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886705.1 protein_id gnl|my_center|LOCUS_07060 130747 131706 gene locus_tag LOCUS_07070 130747 131706 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350359.1 protein_id gnl|my_center|LOCUS_07070 131693 133147 gene locus_tag LOCUS_07080 gene glmU 131693 133147 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479974.1 protein_id gnl|my_center|LOCUS_07080 133180 133392 gene locus_tag LOCUS_07090 133180 133392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 133399 134148 gene locus_tag LOCUS_07100 gene tatC 133399 134148 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056797.1 protein_id gnl|my_center|LOCUS_07100 134214 135299 gene locus_tag LOCUS_07110 134214 135299 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349615.1 protein_id gnl|my_center|LOCUS_07110 135400 136107 gene locus_tag LOCUS_07120 135400 136107 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886892.1 protein_id gnl|my_center|LOCUS_07120 136104 136931 gene locus_tag LOCUS_07130 gene prmC 136104 136931 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886891.1 protein_id gnl|my_center|LOCUS_07130 >Feature sequence05 1543 1124 gene locus_tag LOCUS_07140 1543 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07140 2245 1565 gene locus_tag LOCUS_07150 2245 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07150 2228 2413 gene locus_tag LOCUS_07160 2228 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 2989 3954 gene locus_tag LOCUS_07170 2989 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 6767 5271 gene locus_tag LOCUS_07180 6767 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 10301 6861 gene locus_tag LOCUS_07190 10301 6861 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258557.1 protein_id gnl|my_center|LOCUS_07190 10565 11506 gene locus_tag LOCUS_07200 10565 11506 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_07200 11615 13045 gene locus_tag LOCUS_07210 11615 13045 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083033.1 protein_id gnl|my_center|LOCUS_07210 13162 13926 gene locus_tag LOCUS_07220 13162 13926 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892760.1 protein_id gnl|my_center|LOCUS_07220 13974 14972 gene locus_tag LOCUS_07230 13974 14972 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906069.1 protein_id gnl|my_center|LOCUS_07230 15064 16053 gene locus_tag LOCUS_07240 15064 16053 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317694.1 protein_id gnl|my_center|LOCUS_07240 16050 17207 gene locus_tag LOCUS_07250 16050 17207 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172898.1 protein_id gnl|my_center|LOCUS_07250 17200 17961 gene locus_tag LOCUS_07260 17200 17961 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 protein_id gnl|my_center|LOCUS_07260 17977 19299 gene locus_tag LOCUS_07270 17977 19299 CDS product L-fuconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703671.1 protein_id gnl|my_center|LOCUS_07270 19352 20092 gene locus_tag LOCUS_07280 19352 20092 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703673.1 protein_id gnl|my_center|LOCUS_07280 20463 21374 gene locus_tag LOCUS_07290 gene dapA 20463 21374 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943917.1 protein_id gnl|my_center|LOCUS_07290 21467 22765 gene locus_tag LOCUS_07300 21467 22765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 22823 23710 gene locus_tag LOCUS_07310 22823 23710 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531801.1 protein_id gnl|my_center|LOCUS_07310 23703 24530 gene locus_tag LOCUS_07320 23703 24530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 24684 25667 gene locus_tag LOCUS_07330 24684 25667 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038032.1 protein_id gnl|my_center|LOCUS_07330 26571 25729 gene locus_tag LOCUS_07340 gene zapE 26571 25729 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887405.1 protein_id gnl|my_center|LOCUS_07340 27422 26718 gene locus_tag LOCUS_07350 27422 26718 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479982.1 protein_id gnl|my_center|LOCUS_07350 27526 27939 gene locus_tag LOCUS_07360 27526 27939 CDS product DUF3197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349644.1 protein_id gnl|my_center|LOCUS_07360 27943 28689 gene locus_tag LOCUS_07370 27943 28689 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888897.1 protein_id gnl|my_center|LOCUS_07370 28710 29963 gene locus_tag LOCUS_07380 28710 29963 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224419.1 protein_id gnl|my_center|LOCUS_07380 31205 30654 gene locus_tag LOCUS_07390 31205 30654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 32166 32092 gene locus_tag LOCUS_t00100 32166 32092 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 32243 32168 gene locus_tag LOCUS_t00110 32243 32168 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 32368 32769 gene locus_tag LOCUS_07400 32368 32769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 32812 34170 gene locus_tag LOCUS_07410 32812 34170 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479518.1 protein_id gnl|my_center|LOCUS_07410 34579 34157 gene locus_tag LOCUS_07420 34579 34157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 34678 35655 gene locus_tag LOCUS_07430 34678 35655 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172623.1 protein_id gnl|my_center|LOCUS_07430 36117 36935 gene locus_tag LOCUS_07440 36117 36935 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289730.1 protein_id gnl|my_center|LOCUS_07440 38073 36943 gene locus_tag LOCUS_07450 38073 36943 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888696.1 protein_id gnl|my_center|LOCUS_07450 38126 38758 gene locus_tag LOCUS_07460 38126 38758 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870755.1 protein_id gnl|my_center|LOCUS_07460 38755 39687 gene locus_tag LOCUS_07470 38755 39687 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887655.1 protein_id gnl|my_center|LOCUS_07470 39717 40487 gene locus_tag LOCUS_07480 39717 40487 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887656.1 protein_id gnl|my_center|LOCUS_07480 40536 41015 gene locus_tag LOCUS_07490 40536 41015 CDS product putative dsRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480332.1 protein_id gnl|my_center|LOCUS_07490 42319 40991 gene locus_tag LOCUS_07500 gene der 42319 40991 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888936.1 protein_id gnl|my_center|LOCUS_07500 43749 42319 gene locus_tag LOCUS_07510 43749 42319 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_07510 44948 43929 gene locus_tag LOCUS_07520 44948 43929 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035526.1 protein_id gnl|my_center|LOCUS_07520 45983 44982 gene locus_tag LOCUS_07530 45983 44982 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816110.1 protein_id gnl|my_center|LOCUS_07530 48090 46006 gene locus_tag LOCUS_07540 48090 46006 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582873.1 protein_id gnl|my_center|LOCUS_07540 49073 48087 gene locus_tag LOCUS_07550 49073 48087 CDS product tagatose 1,6-diphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089090.1 protein_id gnl|my_center|LOCUS_07550 49927 49073 gene locus_tag LOCUS_07560 49927 49073 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331257.1 protein_id gnl|my_center|LOCUS_07560 51255 49924 gene locus_tag LOCUS_07570 51255 49924 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459729.1 protein_id gnl|my_center|LOCUS_07570 52115 51261 gene locus_tag LOCUS_07580 52115 51261 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314872.1 protein_id gnl|my_center|LOCUS_07580 53014 52112 gene locus_tag LOCUS_07590 53014 52112 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992469.1 protein_id gnl|my_center|LOCUS_07590 54307 53018 gene locus_tag LOCUS_07600 54307 53018 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972909.1 protein_id gnl|my_center|LOCUS_07600 55406 54405 gene locus_tag LOCUS_07610 55406 54405 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970694.1 protein_id gnl|my_center|LOCUS_07610 56328 55396 gene locus_tag LOCUS_07620 56328 55396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 57496 56342 gene locus_tag LOCUS_07630 57496 56342 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980645.1 protein_id gnl|my_center|LOCUS_07630 57846 57529 gene locus_tag LOCUS_07640 57846 57529 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582865.1 protein_id gnl|my_center|LOCUS_07640 57906 58622 gene locus_tag LOCUS_07650 57906 58622 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393101.1 protein_id gnl|my_center|LOCUS_07650 59738 58773 gene locus_tag LOCUS_07660 59738 58773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 60859 59711 gene locus_tag LOCUS_07670 60859 59711 CDS product beta-carotene 2-hydroxylase CYP287A1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889098.1 protein_id gnl|my_center|LOCUS_07670 62187 60856 gene locus_tag LOCUS_07680 62187 60856 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871916.1 protein_id gnl|my_center|LOCUS_07680 63290 62199 gene locus_tag LOCUS_07690 63290 62199 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886737.1 protein_id gnl|my_center|LOCUS_07690 63937 63287 gene locus_tag LOCUS_07700 63937 63287 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886738.1 protein_id gnl|my_center|LOCUS_07700 65301 63904 gene locus_tag LOCUS_07710 65301 63904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 66830 65298 gene locus_tag LOCUS_07720 66830 65298 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886741.1 protein_id gnl|my_center|LOCUS_07720 66950 67876 gene locus_tag LOCUS_07730 66950 67876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 67873 68685 gene locus_tag LOCUS_07740 67873 68685 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093950166.1 protein_id gnl|my_center|LOCUS_07740 68744 69952 gene locus_tag LOCUS_07750 gene metK 68744 69952 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887285.1 protein_id gnl|my_center|LOCUS_07750 70493 69954 gene locus_tag LOCUS_07760 gene msrA 70493 69954 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_07760 70585 72078 gene locus_tag LOCUS_07770 gene cobA 70585 72078 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349821.1 protein_id gnl|my_center|LOCUS_07770 72105 72860 gene locus_tag LOCUS_07780 72105 72860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 74999 72816 gene locus_tag LOCUS_07790 74999 72816 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926052.1 protein_id gnl|my_center|LOCUS_07790 75077 75643 gene locus_tag LOCUS_07800 75077 75643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 75640 76839 gene locus_tag LOCUS_07810 gene hemA 75640 76839 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480102.1 protein_id gnl|my_center|LOCUS_07810 76849 77235 gene locus_tag LOCUS_07820 76849 77235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 78258 77251 gene locus_tag LOCUS_07830 78258 77251 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887472.1 protein_id gnl|my_center|LOCUS_07830 80320 78266 gene locus_tag LOCUS_07840 80320 78266 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886706.1 protein_id gnl|my_center|LOCUS_07840 81084 80320 gene locus_tag LOCUS_07850 81084 80320 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926063.1 protein_id gnl|my_center|LOCUS_07850 81170 83041 gene locus_tag LOCUS_07860 81170 83041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228795.1 protein_id gnl|my_center|LOCUS_07860 83100 83489 gene locus_tag LOCUS_07870 83100 83489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 84456 83410 gene locus_tag LOCUS_07880 gene hemB 84456 83410 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056277.1 protein_id gnl|my_center|LOCUS_07880 84455 85354 gene locus_tag LOCUS_07890 gene holA 84455 85354 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887887.1 protein_id gnl|my_center|LOCUS_07890 85913 85317 gene locus_tag LOCUS_07900 85913 85317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 86107 85913 gene locus_tag LOCUS_07910 86107 85913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 86477 86145 gene locus_tag LOCUS_07920 86477 86145 CDS product DUF3208 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888787.1 protein_id gnl|my_center|LOCUS_07920 87082 86474 gene locus_tag LOCUS_07930 87082 86474 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887473.1 protein_id gnl|my_center|LOCUS_07930 87242 87166 gene locus_tag LOCUS_t00120 87242 87166 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 88754 87279 gene locus_tag LOCUS_07940 88754 87279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 89323 88886 gene locus_tag LOCUS_07950 89323 88886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 89700 90326 gene locus_tag LOCUS_07960 gene clpP 89700 90326 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888605.1 protein_id gnl|my_center|LOCUS_07960 90310 91509 gene locus_tag LOCUS_07970 gene clpX 90310 91509 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888606.1 protein_id gnl|my_center|LOCUS_07970 91671 94094 gene locus_tag LOCUS_07980 gene lon 91671 94094 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888607.1 protein_id gnl|my_center|LOCUS_07980 94232 95398 gene locus_tag LOCUS_07990 94232 95398 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804023.1 protein_id gnl|my_center|LOCUS_07990 96887 95406 gene locus_tag LOCUS_08000 gene xylB 96887 95406 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_08000 98127 96910 gene locus_tag LOCUS_08010 98127 96910 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977660.1 protein_id gnl|my_center|LOCUS_08010 99041 98124 gene locus_tag LOCUS_08020 99041 98124 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532966.1 protein_id gnl|my_center|LOCUS_08020 100168 99041 gene locus_tag LOCUS_08030 gene xylA 100168 99041 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977662.1 protein_id gnl|my_center|LOCUS_08030 101715 100258 gene locus_tag LOCUS_08040 101715 100258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 102615 101818 gene locus_tag LOCUS_08050 102615 101818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 102896 102612 gene locus_tag LOCUS_08060 102896 102612 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338575.1 protein_id gnl|my_center|LOCUS_08060 104043 102931 gene locus_tag LOCUS_08070 104043 102931 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480328.1 protein_id gnl|my_center|LOCUS_08070 105077 104040 gene locus_tag LOCUS_08080 105077 104040 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025567746.1 protein_id gnl|my_center|LOCUS_08080 105220 105966 gene locus_tag LOCUS_08090 105220 105966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 105976 106650 gene locus_tag LOCUS_08100 105976 106650 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259746.1 protein_id gnl|my_center|LOCUS_08100 106647 107966 gene locus_tag LOCUS_08110 106647 107966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081492.1 protein_id gnl|my_center|LOCUS_08110 110394 108019 gene locus_tag LOCUS_08120 110394 108019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 112424 110394 gene locus_tag LOCUS_08130 112424 110394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 113197 112631 gene locus_tag LOCUS_08140 113197 112631 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888450.1 protein_id gnl|my_center|LOCUS_08140 114180 113197 gene locus_tag LOCUS_08150 gene mltG 114180 113197 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889177.1 protein_id gnl|my_center|LOCUS_08150 115283 114177 gene locus_tag LOCUS_08160 gene purK 115283 114177 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886672.1 protein_id gnl|my_center|LOCUS_08160 115822 115280 gene locus_tag LOCUS_08170 gene purE 115822 115280 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886671.1 protein_id gnl|my_center|LOCUS_08170 117482 115845 gene locus_tag LOCUS_08180 117482 115845 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030930.1 protein_id gnl|my_center|LOCUS_08180 117961 117500 gene locus_tag LOCUS_08190 117961 117500 CDS product DUF3830 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532979.1 protein_id gnl|my_center|LOCUS_08190 119064 117961 gene locus_tag LOCUS_08200 119064 117961 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249072.1 protein_id gnl|my_center|LOCUS_08200 120190 119054 gene locus_tag LOCUS_08210 120190 119054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 120285 121460 gene locus_tag LOCUS_08220 120285 121460 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257115.1 protein_id gnl|my_center|LOCUS_08220 121474 122025 gene locus_tag LOCUS_08230 121474 122025 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092772562.1 protein_id gnl|my_center|LOCUS_08230 123289 122132 gene locus_tag LOCUS_08240 gene kch 123289 122132 CDS product voltage-gated potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931563.1 protein_id gnl|my_center|LOCUS_08240 123354 124142 gene locus_tag LOCUS_08250 123354 124142 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918580.1 protein_id gnl|my_center|LOCUS_08250 124414 124154 gene locus_tag LOCUS_08260 124414 124154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 125327 124521 gene locus_tag LOCUS_08270 125327 124521 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227843.1 protein_id gnl|my_center|LOCUS_08270 125374 126078 gene locus_tag LOCUS_08280 gene pgeF 125374 126078 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888599.1 protein_id gnl|my_center|LOCUS_08280 126075 126596 gene locus_tag LOCUS_08290 126075 126596 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888598.1 protein_id gnl|my_center|LOCUS_08290 126593 129253 gene locus_tag LOCUS_08300 126593 129253 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479822.1 protein_id gnl|my_center|LOCUS_08300 129282 130451 gene locus_tag LOCUS_08310 129282 130451 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350111.1 protein_id gnl|my_center|LOCUS_08310 131855 130461 gene locus_tag LOCUS_08320 gene lpdA 131855 130461 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888996.1 protein_id gnl|my_center|LOCUS_08320 133217 131898 gene locus_tag LOCUS_08330 133217 131898 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227796.1 protein_id gnl|my_center|LOCUS_08330 134192 133221 gene locus_tag LOCUS_08340 134192 133221 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886678.1 protein_id gnl|my_center|LOCUS_08340 135277 134189 gene locus_tag LOCUS_08350 135277 134189 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480247.1 protein_id gnl|my_center|LOCUS_08350 >Feature sequence06 10 1053 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgcacccgaccctcgggccgggtgaggattgaaac 1347 2813 gene locus_tag LOCUS_08360 1347 2813 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392514.1 protein_id gnl|my_center|LOCUS_08360 2976 3050 gene locus_tag LOCUS_t00130 2976 3050 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 3056 3130 gene locus_tag LOCUS_t00140 3056 3130 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5444 3282 gene locus_tag LOCUS_08370 5444 3282 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933069.1 protein_id gnl|my_center|LOCUS_08370 5566 6285 gene locus_tag LOCUS_08380 5566 6285 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480283.1 protein_id gnl|my_center|LOCUS_08380 6341 7057 gene locus_tag LOCUS_08390 6341 7057 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173486.1 protein_id gnl|my_center|LOCUS_08390 7054 7848 gene locus_tag LOCUS_08400 7054 7848 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025568069.1 protein_id gnl|my_center|LOCUS_08400 7848 8777 gene locus_tag LOCUS_08410 7848 8777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 8788 10047 gene locus_tag LOCUS_08420 8788 10047 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883969.1 protein_id gnl|my_center|LOCUS_08420 10674 10033 gene locus_tag LOCUS_08430 10674 10033 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403754.1 protein_id gnl|my_center|LOCUS_08430 11408 10731 gene locus_tag LOCUS_08440 11408 10731 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350459.1 protein_id gnl|my_center|LOCUS_08440 12322 11405 gene locus_tag LOCUS_08450 gene cysK 12322 11405 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887435.1 protein_id gnl|my_center|LOCUS_08450 12512 13174 gene locus_tag LOCUS_08460 gene pxpB 12512 13174 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249288.1 protein_id gnl|my_center|LOCUS_08460 13168 14151 gene locus_tag LOCUS_08470 13168 14151 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097548.1 protein_id gnl|my_center|LOCUS_08470 15699 14497 gene locus_tag LOCUS_08480 15699 14497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 15929 15738 gene locus_tag LOCUS_08490 15929 15738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 16250 16975 gene locus_tag LOCUS_08500 16250 16975 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869459.1 protein_id gnl|my_center|LOCUS_08500 16972 17613 gene locus_tag LOCUS_08510 gene pcp 16972 17613 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704765.1 protein_id gnl|my_center|LOCUS_08510 18541 17582 gene locus_tag LOCUS_08520 18541 17582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 18836 19867 gene locus_tag LOCUS_08530 gene pheS 18836 19867 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888980.1 protein_id gnl|my_center|LOCUS_08530 19867 22197 gene locus_tag LOCUS_08540 19867 22197 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888983.1 protein_id gnl|my_center|LOCUS_08540 22585 22983 gene locus_tag LOCUS_08550 22585 22983 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566317.1 protein_id gnl|my_center|LOCUS_08550 24449 23853 gene locus_tag LOCUS_08560 24449 23853 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975929.1 protein_id gnl|my_center|LOCUS_08560 25211 24783 gene locus_tag LOCUS_08570 25211 24783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08570 25898 25584 gene locus_tag LOCUS_08580 25898 25584 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888583.1 protein_id gnl|my_center|LOCUS_08580 27229 25895 gene locus_tag LOCUS_08590 gene sufD 27229 25895 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888732.1 protein_id gnl|my_center|LOCUS_08590 28629 27229 gene locus_tag LOCUS_08600 gene sufB 28629 27229 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888737.1 protein_id gnl|my_center|LOCUS_08600 29410 28643 gene locus_tag LOCUS_08610 gene sufC 29410 28643 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888738.1 protein_id gnl|my_center|LOCUS_08610 30755 29538 gene locus_tag LOCUS_08620 gene fabF 30755 29538 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479818.1 protein_id gnl|my_center|LOCUS_08620 31056 30826 gene locus_tag LOCUS_08630 gene acpP 31056 30826 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479819.1 protein_id gnl|my_center|LOCUS_08630 31825 31094 gene locus_tag LOCUS_08640 gene fabG 31825 31094 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888576.1 protein_id gnl|my_center|LOCUS_08640 32748 31822 gene locus_tag LOCUS_08650 gene fabD 32748 31822 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888578.1 protein_id gnl|my_center|LOCUS_08650 33719 32745 gene locus_tag LOCUS_08660 33719 32745 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172506.1 protein_id gnl|my_center|LOCUS_08660 33956 33774 gene locus_tag LOCUS_08670 gene rpmF 33956 33774 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888992.1 protein_id gnl|my_center|LOCUS_08670 34427 34020 gene locus_tag LOCUS_08680 34427 34020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886716.1 protein_id gnl|my_center|LOCUS_08680 35318 34452 gene locus_tag LOCUS_08690 35318 34452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 35797 35315 gene locus_tag LOCUS_08700 gene moaC 35797 35315 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228918.1 protein_id gnl|my_center|LOCUS_08700 36378 35797 gene locus_tag LOCUS_08710 36378 35797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 36446 36850 gene locus_tag LOCUS_08720 36446 36850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 36859 37281 gene locus_tag LOCUS_08730 36859 37281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349654.1 protein_id gnl|my_center|LOCUS_08730 37339 38016 gene locus_tag LOCUS_08740 37339 38016 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887388.1 protein_id gnl|my_center|LOCUS_08740 38033 39493 gene locus_tag LOCUS_08750 38033 39493 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618826.1 protein_id gnl|my_center|LOCUS_08750 39533 40342 gene locus_tag LOCUS_08760 39533 40342 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887924.1 protein_id gnl|my_center|LOCUS_08760 40326 42794 gene locus_tag LOCUS_08770 40326 42794 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887926.1 protein_id gnl|my_center|LOCUS_08770 44038 43442 gene locus_tag LOCUS_08780 gene rdgB 44038 43442 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886825.1 protein_id gnl|my_center|LOCUS_08780 47261 44538 gene locus_tag LOCUS_08790 47261 44538 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228571.1 protein_id gnl|my_center|LOCUS_08790 48487 47258 gene locus_tag LOCUS_08800 48487 47258 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479813.1 protein_id gnl|my_center|LOCUS_08800 48582 50051 gene locus_tag LOCUS_08810 gene csm6 48582 50051 CDS product type III-A CRISPR-associated protein Csm6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229148.1 protein_id gnl|my_center|LOCUS_08810 50017 50517 gene locus_tag LOCUS_08820 50017 50517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 50960 51130 gene locus_tag LOCUS_08830 50960 51130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 52301 51339 gene locus_tag LOCUS_08840 52301 51339 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888504.1 protein_id gnl|my_center|LOCUS_08840 53547 52315 gene locus_tag LOCUS_08850 53547 52315 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228734.1 protein_id gnl|my_center|LOCUS_08850 53604 54527 gene locus_tag LOCUS_08860 53604 54527 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425747.1 protein_id gnl|my_center|LOCUS_08860 54524 55717 gene locus_tag LOCUS_08870 gene lysA 54524 55717 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888393.1 protein_id gnl|my_center|LOCUS_08870 56496 55696 gene locus_tag LOCUS_08880 56496 55696 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349500.1 protein_id gnl|my_center|LOCUS_08880 56571 57278 gene locus_tag LOCUS_08890 56571 57278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 57357 57432 gene locus_tag LOCUS_t00150 57357 57432 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 57437 57512 gene locus_tag LOCUS_t00160 57437 57512 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 57522 57596 gene locus_tag LOCUS_t00170 57522 57596 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 57877 58239 gene locus_tag LOCUS_08900 57877 58239 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971062.1 protein_id gnl|my_center|LOCUS_08900 59780 58287 gene locus_tag LOCUS_08910 59780 58287 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767035.1 protein_id gnl|my_center|LOCUS_08910 60016 59807 gene locus_tag LOCUS_08920 60016 59807 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920093.1 protein_id gnl|my_center|LOCUS_08920 60399 60013 gene locus_tag LOCUS_08930 60399 60013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 61261 60431 gene locus_tag LOCUS_08940 61261 60431 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064562.1 protein_id gnl|my_center|LOCUS_08940 61368 62948 gene locus_tag LOCUS_08950 61368 62948 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339159.1 protein_id gnl|my_center|LOCUS_08950 62955 63968 gene locus_tag LOCUS_08960 62955 63968 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370098.1 protein_id gnl|my_center|LOCUS_08960 63965 64822 gene locus_tag LOCUS_08970 63965 64822 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_08970 64930 66120 gene locus_tag LOCUS_08980 64930 66120 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304593.1 protein_id gnl|my_center|LOCUS_08980 68192 66396 gene locus_tag LOCUS_08990 68192 66396 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858956.1 protein_id gnl|my_center|LOCUS_08990 68352 70073 gene locus_tag LOCUS_09000 gene hflX 68352 70073 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480296.1 protein_id gnl|my_center|LOCUS_09000 71098 70046 gene locus_tag LOCUS_09010 gene rodA 71098 70046 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228544.1 protein_id gnl|my_center|LOCUS_09010 71412 71161 gene locus_tag LOCUS_09020 gene minE 71412 71161 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887397.1 protein_id gnl|my_center|LOCUS_09020 72212 71412 gene locus_tag LOCUS_09030 gene minD 72212 71412 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479992.1 protein_id gnl|my_center|LOCUS_09030 73013 72450 gene locus_tag LOCUS_09040 73013 72450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 74937 73090 gene locus_tag LOCUS_09050 gene ftsH 74937 73090 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480146.1 protein_id gnl|my_center|LOCUS_09050 75104 76534 gene locus_tag LOCUS_09060 75104 76534 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480147.1 protein_id gnl|my_center|LOCUS_09060 77726 76542 gene locus_tag LOCUS_09070 77726 76542 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298533.1 protein_id gnl|my_center|LOCUS_09070 78544 77723 gene locus_tag LOCUS_09080 gene panB 78544 77723 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_09080 79080 78541 gene locus_tag LOCUS_09090 79080 78541 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034358328.1 protein_id gnl|my_center|LOCUS_09090 79314 80210 gene locus_tag LOCUS_09100 79314 80210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 80243 81280 gene locus_tag LOCUS_09110 gene coxB 80243 81280 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227850.1 protein_id gnl|my_center|LOCUS_09110 81302 83704 gene locus_tag LOCUS_09120 81302 83704 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889244.1 protein_id gnl|my_center|LOCUS_09120 83701 84285 gene locus_tag LOCUS_09130 83701 84285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 84282 85262 gene locus_tag LOCUS_09140 gene ruvB 84282 85262 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887241.1 protein_id gnl|my_center|LOCUS_09140 85263 86306 gene locus_tag LOCUS_09150 85263 86306 CDS product DUF4388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172495.1 protein_id gnl|my_center|LOCUS_09150 86365 88119 gene locus_tag LOCUS_09160 gene dnaG 86365 88119 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887246.1 protein_id gnl|my_center|LOCUS_09160 89085 88135 gene locus_tag LOCUS_09170 89085 88135 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084230.1 protein_id gnl|my_center|LOCUS_09170 91531 89117 gene locus_tag LOCUS_09180 gene lon 91531 89117 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886994.1 protein_id gnl|my_center|LOCUS_09180 93427 91622 gene locus_tag LOCUS_09190 93427 91622 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173582854.1 protein_id gnl|my_center|LOCUS_09190 94812 93439 gene locus_tag LOCUS_09200 94812 93439 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967718.1 protein_id gnl|my_center|LOCUS_09200 95900 94809 gene locus_tag LOCUS_09210 95900 94809 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967719.1 protein_id gnl|my_center|LOCUS_09210 97210 95954 gene locus_tag LOCUS_09220 97210 95954 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257891.1 protein_id gnl|my_center|LOCUS_09220 98190 97207 gene locus_tag LOCUS_09230 98190 97207 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027638.1 protein_id gnl|my_center|LOCUS_09230 98503 98871 gene locus_tag LOCUS_09240 98503 98871 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618908.1 protein_id gnl|my_center|LOCUS_09240 98868 99653 gene locus_tag LOCUS_09250 98868 99653 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_09250 99650 101278 gene locus_tag LOCUS_09260 99650 101278 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887112.1 protein_id gnl|my_center|LOCUS_09260 103161 102727 gene locus_tag LOCUS_09270 103161 102727 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275140.1 protein_id gnl|my_center|LOCUS_09270 103604 103254 gene locus_tag LOCUS_09280 gene rplQ 103604 103254 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888760.1 protein_id gnl|my_center|LOCUS_09280 104593 103640 gene locus_tag LOCUS_09290 104593 103640 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888759.1 protein_id gnl|my_center|LOCUS_09290 105222 104605 gene locus_tag LOCUS_09300 gene rpsD 105222 104605 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888758.1 protein_id gnl|my_center|LOCUS_09300 105619 105227 gene locus_tag LOCUS_09310 gene rpsK 105619 105227 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888757.1 protein_id gnl|my_center|LOCUS_09310 105999 105619 gene locus_tag LOCUS_09320 gene rpsM 105999 105619 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888756.1 protein_id gnl|my_center|LOCUS_09320 106436 106182 gene locus_tag LOCUS_09330 gene infA 106436 106182 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479941.1 protein_id gnl|my_center|LOCUS_09330 107062 106472 gene locus_tag LOCUS_09340 107062 106472 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888748.1 protein_id gnl|my_center|LOCUS_09340 108383 107052 gene locus_tag LOCUS_09350 gene secY 108383 107052 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888747.1 protein_id gnl|my_center|LOCUS_09350 108838 108383 gene locus_tag LOCUS_09360 gene rplO 108838 108383 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888746.1 protein_id gnl|my_center|LOCUS_09360 109002 108835 gene locus_tag LOCUS_09370 gene rpmD 109002 108835 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888745.1 protein_id gnl|my_center|LOCUS_09370 109502 108999 gene locus_tag LOCUS_09380 gene rpsE 109502 108999 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350334.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09380 109824 109486 gene locus_tag LOCUS_09390 gene rplR 109824 109486 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633391.1 protein_id gnl|my_center|LOCUS_09390 110279 109821 gene locus_tag LOCUS_09400 110279 109821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 110193 110384 gene locus_tag LOCUS_09410 110193 110384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 110795 110400 gene locus_tag LOCUS_09420 gene rpsH 110795 110400 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888741.1 protein_id gnl|my_center|LOCUS_09420 111091 110906 gene locus_tag LOCUS_09430 111091 110906 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638073.1 protein_id gnl|my_center|LOCUS_09430 111644 111105 gene locus_tag LOCUS_09440 gene rplE 111644 111105 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886968.1 protein_id gnl|my_center|LOCUS_09440 111991 111653 gene locus_tag LOCUS_09450 gene rplX 111991 111653 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871863.1 protein_id gnl|my_center|LOCUS_09450 112395 111991 gene locus_tag LOCUS_09460 gene rplN 112395 111991 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886966.1 protein_id gnl|my_center|LOCUS_09460 112646 112392 gene locus_tag LOCUS_09470 gene rpsQ 112646 112392 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886965.1 protein_id gnl|my_center|LOCUS_09470 112849 112649 gene locus_tag LOCUS_09480 gene rpmC 112849 112649 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886964.1 protein_id gnl|my_center|LOCUS_09480 113261 112836 gene locus_tag LOCUS_09490 gene rplP 113261 112836 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025567820.1 protein_id gnl|my_center|LOCUS_09490 114003 113248 gene locus_tag LOCUS_09500 gene rpsC 114003 113248 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886962.1 protein_id gnl|my_center|LOCUS_09500 114364 113993 gene locus_tag LOCUS_09510 gene rplV 114364 113993 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886961.1 protein_id gnl|my_center|LOCUS_09510 114651 114364 gene locus_tag LOCUS_09520 gene rpsS 114651 114364 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886960.1 protein_id gnl|my_center|LOCUS_09520 115505 114675 gene locus_tag LOCUS_09530 gene rplB 115505 114675 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886959.1 protein_id gnl|my_center|LOCUS_09530 115805 115518 gene locus_tag LOCUS_09540 115805 115518 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633421.1 protein_id gnl|my_center|LOCUS_09540 116428 115802 gene locus_tag LOCUS_09550 gene rplD 116428 115802 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886957.1 protein_id gnl|my_center|LOCUS_09550 117048 116428 gene locus_tag LOCUS_09560 gene rplC 117048 116428 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886956.1 protein_id gnl|my_center|LOCUS_09560 117365 117045 gene locus_tag LOCUS_09570 gene rpsJ 117365 117045 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886955.1 protein_id gnl|my_center|LOCUS_09570 >Feature sequence07 623 1864 gene locus_tag LOCUS_09580 gene glgC 623 1864 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227648.1 protein_id gnl|my_center|LOCUS_09580 1966 4650 gene locus_tag LOCUS_09590 gene acnA 1966 4650 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888355.1 protein_id gnl|my_center|LOCUS_09590 4736 5365 gene locus_tag LOCUS_09600 4736 5365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632535.1 protein_id gnl|my_center|LOCUS_09600 5401 7302 gene locus_tag LOCUS_09610 5401 7302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 8481 7294 gene locus_tag LOCUS_09620 8481 7294 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479853.1 protein_id gnl|my_center|LOCUS_09620 9733 8975 gene locus_tag LOCUS_09630 9733 8975 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887541.1 protein_id gnl|my_center|LOCUS_09630 9835 9761 gene locus_tag LOCUS_t00180 9835 9761 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 10238 9891 gene locus_tag LOCUS_09640 10238 9891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 10299 10475 gene locus_tag LOCUS_09650 10299 10475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 10475 11365 gene locus_tag LOCUS_09660 10475 11365 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228215.1 protein_id gnl|my_center|LOCUS_09660 11362 12306 gene locus_tag LOCUS_09670 11362 12306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 12333 13589 gene locus_tag LOCUS_09680 gene purD 12333 13589 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228217.1 protein_id gnl|my_center|LOCUS_09680 13632 13716 gene locus_tag LOCUS_t00190 13632 13716 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13729 13950 gene locus_tag LOCUS_09690 13729 13950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 14047 15057 gene locus_tag LOCUS_09700 14047 15057 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618802.1 protein_id gnl|my_center|LOCUS_09700 15054 16043 gene locus_tag LOCUS_09710 15054 16043 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888206.1 protein_id gnl|my_center|LOCUS_09710 16100 16687 gene locus_tag LOCUS_09720 16100 16687 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350278.1 protein_id gnl|my_center|LOCUS_09720 16810 18270 gene locus_tag LOCUS_09730 gene malQ 16810 18270 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479885.1 protein_id gnl|my_center|LOCUS_09730 18267 18815 gene locus_tag LOCUS_09740 18267 18815 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173934.1 protein_id gnl|my_center|LOCUS_09740 19044 18763 gene locus_tag LOCUS_09750 19044 18763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 19237 20523 gene locus_tag LOCUS_09760 gene murA 19237 20523 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887766.1 protein_id gnl|my_center|LOCUS_09760 21212 20529 gene locus_tag LOCUS_09770 21212 20529 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768488.1 protein_id gnl|my_center|LOCUS_09770 22473 21319 gene locus_tag LOCUS_09780 22473 21319 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887132.1 protein_id gnl|my_center|LOCUS_09780 22762 23307 gene locus_tag LOCUS_09790 22762 23307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 23344 25638 gene locus_tag LOCUS_09800 gene recG 23344 25638 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479810.1 protein_id gnl|my_center|LOCUS_09800 25702 26391 gene locus_tag LOCUS_09810 gene rpiA 25702 26391 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632746.1 protein_id gnl|my_center|LOCUS_09810 26423 26854 gene locus_tag LOCUS_09820 26423 26854 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479850.1 protein_id gnl|my_center|LOCUS_09820 26873 28528 gene locus_tag LOCUS_09830 gene treS 26873 28528 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224468.1 protein_id gnl|my_center|LOCUS_09830 28579 29244 gene locus_tag LOCUS_09840 28579 29244 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888874.1 protein_id gnl|my_center|LOCUS_09840 29235 30239 gene locus_tag LOCUS_09850 29235 30239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 30236 30901 gene locus_tag LOCUS_09860 gene phoU 30236 30901 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888872.1 protein_id gnl|my_center|LOCUS_09860 31046 30970 gene locus_tag LOCUS_t00200 31046 30970 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 31155 33878 gene locus_tag LOCUS_09870 31155 33878 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886932.1 protein_id gnl|my_center|LOCUS_09870 33875 35065 gene locus_tag LOCUS_09880 gene odhB 33875 35065 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886731.1 protein_id gnl|my_center|LOCUS_09880 35065 36468 gene locus_tag LOCUS_09890 gene lpdA 35065 36468 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480111.1 protein_id gnl|my_center|LOCUS_09890 37612 36446 gene locus_tag LOCUS_09900 37612 36446 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228809.1 protein_id gnl|my_center|LOCUS_09900 38800 37637 gene locus_tag LOCUS_09910 38800 37637 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889122.1 protein_id gnl|my_center|LOCUS_09910 40098 38797 gene locus_tag LOCUS_09920 gene murD 40098 38797 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889121.1 protein_id gnl|my_center|LOCUS_09920 41024 40095 gene locus_tag LOCUS_09930 gene mraY 41024 40095 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888470.1 protein_id gnl|my_center|LOCUS_09930 41928 41134 gene locus_tag LOCUS_09940 41928 41134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 43162 41906 gene locus_tag LOCUS_09950 43162 41906 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887414.1 protein_id gnl|my_center|LOCUS_09950 44277 43165 gene locus_tag LOCUS_09960 gene ald 44277 43165 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479806.1 protein_id gnl|my_center|LOCUS_09960 46027 44390 gene locus_tag LOCUS_09970 46027 44390 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479602.1 protein_id gnl|my_center|LOCUS_09970 46204 47097 gene locus_tag LOCUS_09980 46204 47097 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887299.1 protein_id gnl|my_center|LOCUS_09980 47180 48388 gene locus_tag LOCUS_09990 47180 48388 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214261.1 protein_id gnl|my_center|LOCUS_09990 48419 50437 gene locus_tag LOCUS_10000 48419 50437 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479574.1 protein_id gnl|my_center|LOCUS_10000 50448 53246 gene locus_tag LOCUS_10010 50448 53246 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011114777.1 protein_id gnl|my_center|LOCUS_10010 53577 53182 gene locus_tag LOCUS_10020 gene rsfS 53577 53182 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889204.1 protein_id gnl|my_center|LOCUS_10020 54080 53571 gene locus_tag LOCUS_10030 54080 53571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 54750 54112 gene locus_tag LOCUS_10040 gene nadD 54750 54112 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404800.1 protein_id gnl|my_center|LOCUS_10040 55937 54747 gene locus_tag LOCUS_10050 gene obgE 55937 54747 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886732.1 protein_id gnl|my_center|LOCUS_10050 56288 56028 gene locus_tag LOCUS_10060 gene rpmA 56288 56028 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886733.1 protein_id gnl|my_center|LOCUS_10060 56604 56278 gene locus_tag LOCUS_10070 gene rplU 56604 56278 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480310.1 protein_id gnl|my_center|LOCUS_10070 57886 56666 gene locus_tag LOCUS_10080 57886 56666 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480162.1 protein_id gnl|my_center|LOCUS_10080 59775 57883 gene locus_tag LOCUS_10090 gene speA 59775 57883 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480160.1 protein_id gnl|my_center|LOCUS_10090 60366 59860 gene locus_tag LOCUS_10100 60366 59860 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228225.1 protein_id gnl|my_center|LOCUS_10100 60465 61124 gene locus_tag LOCUS_10110 60465 61124 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228227.1 protein_id gnl|my_center|LOCUS_10110 61776 61024 gene locus_tag LOCUS_10120 61776 61024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 62780 61773 gene locus_tag LOCUS_10130 gene trpS 62780 61773 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887203.1 protein_id gnl|my_center|LOCUS_10130 62817 63254 gene locus_tag LOCUS_10140 62817 63254 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 protein_id gnl|my_center|LOCUS_10140 63387 64601 gene locus_tag LOCUS_10150 63387 64601 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888391.1 protein_id gnl|my_center|LOCUS_10150 64628 65593 gene locus_tag LOCUS_10160 64628 65593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 65644 66291 gene locus_tag LOCUS_10170 65644 66291 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172926.1 protein_id gnl|my_center|LOCUS_10170 66291 66896 gene locus_tag LOCUS_10180 66291 66896 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228230.1 protein_id gnl|my_center|LOCUS_10180 66874 67374 gene locus_tag LOCUS_10190 66874 67374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 67504 68199 gene locus_tag LOCUS_10200 67504 68199 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888398.1 protein_id gnl|my_center|LOCUS_10200 68236 69276 gene locus_tag LOCUS_10210 gene recF 68236 69276 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887732.1 protein_id gnl|my_center|LOCUS_10210 69273 70088 gene locus_tag LOCUS_10220 69273 70088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 70085 70582 gene locus_tag LOCUS_10230 70085 70582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 70869 73562 gene locus_tag LOCUS_10240 70869 73562 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886794.1 protein_id gnl|my_center|LOCUS_10240 73555 74553 gene locus_tag LOCUS_10250 73555 74553 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869626.1 protein_id gnl|my_center|LOCUS_10250 74480 74833 gene locus_tag LOCUS_10260 74480 74833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 74833 76545 gene locus_tag LOCUS_10270 gene kdpA 74833 76545 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388910.1 protein_id gnl|my_center|LOCUS_10270 76555 78606 gene locus_tag LOCUS_10280 gene kdpB 76555 78606 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388911.1 protein_id gnl|my_center|LOCUS_10280 78617 79198 gene locus_tag LOCUS_10290 gene kdpC 78617 79198 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930951.1 protein_id gnl|my_center|LOCUS_10290 79243 81939 gene locus_tag LOCUS_10300 79243 81939 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388913.1 protein_id gnl|my_center|LOCUS_10300 81920 82624 gene locus_tag LOCUS_10310 81920 82624 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114598.1 protein_id gnl|my_center|LOCUS_10310 83827 82634 gene locus_tag LOCUS_10320 83827 82634 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257531.1 protein_id gnl|my_center|LOCUS_10320 87064 83855 gene locus_tag LOCUS_10330 87064 83855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 88382 87231 gene locus_tag LOCUS_10340 88382 87231 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763164.1 protein_id gnl|my_center|LOCUS_10340 88538 89944 gene locus_tag LOCUS_10350 gene trpE 88538 89944 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888426.1 protein_id gnl|my_center|LOCUS_10350 89941 90522 gene locus_tag LOCUS_10360 89941 90522 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926075.1 protein_id gnl|my_center|LOCUS_10360 90519 91532 gene locus_tag LOCUS_10370 gene trpD 90519 91532 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480347.1 protein_id gnl|my_center|LOCUS_10370 92566 91499 gene locus_tag LOCUS_10380 gene alr 92566 91499 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479629.1 protein_id gnl|my_center|LOCUS_10380 93285 92611 gene locus_tag LOCUS_10390 93285 92611 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887118.1 protein_id gnl|my_center|LOCUS_10390 94445 93285 gene locus_tag LOCUS_10400 94445 93285 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887119.1 protein_id gnl|my_center|LOCUS_10400 94569 94496 gene locus_tag LOCUS_t00210 94569 94496 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 94787 96091 gene locus_tag LOCUS_10410 94787 96091 CDS product homoaconitate hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888413.1 protein_id gnl|my_center|LOCUS_10410 96078 96563 gene locus_tag LOCUS_10420 96078 96563 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888419.1 protein_id gnl|my_center|LOCUS_10420 96556 97581 gene locus_tag LOCUS_10430 gene leuB 96556 97581 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888420.1 protein_id gnl|my_center|LOCUS_10430 98144 97578 gene locus_tag LOCUS_10440 98144 97578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 98997 98134 gene locus_tag LOCUS_10450 98997 98134 CDS product bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887513.1 protein_id gnl|my_center|LOCUS_10450 100508 98994 gene locus_tag LOCUS_10460 gene purH 100508 98994 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443404.1 protein_id gnl|my_center|LOCUS_10460 100787 101896 gene locus_tag LOCUS_10470 100787 101896 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926069.1 protein_id gnl|my_center|LOCUS_10470 103131 101893 gene locus_tag LOCUS_10480 gene icd 103131 101893 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479852.1 protein_id gnl|my_center|LOCUS_10480 104939 103167 gene locus_tag LOCUS_10490 104939 103167 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017872038.1 protein_id gnl|my_center|LOCUS_10490 105176 105379 gene locus_tag LOCUS_10500 105176 105379 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228864.1 protein_id gnl|my_center|LOCUS_10500 105376 105678 gene locus_tag LOCUS_10510 gene csoR 105376 105678 CDS product metal-sensitive transcriptional regulator CsoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173741.1 protein_id gnl|my_center|LOCUS_10510 105701 108100 gene locus_tag LOCUS_10520 105701 108100 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967529.1 protein_id gnl|my_center|LOCUS_10520 108119 108967 gene locus_tag LOCUS_10530 108119 108967 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979881.1 protein_id gnl|my_center|LOCUS_10530 109919 108969 gene locus_tag LOCUS_10540 109919 108969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 109978 111267 gene locus_tag LOCUS_10550 109978 111267 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227893.1 protein_id gnl|my_center|LOCUS_10550 111283 112206 gene locus_tag LOCUS_10560 111283 112206 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582771.1 protein_id gnl|my_center|LOCUS_10560 112251 113042 gene locus_tag LOCUS_10570 112251 113042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 >Feature sequence08 1841 1311 gene locus_tag LOCUS_10580 1841 1311 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479526.1 protein_id gnl|my_center|LOCUS_10580 2413 1877 gene locus_tag LOCUS_10590 2413 1877 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633254.1 protein_id gnl|my_center|LOCUS_10590 2649 3320 gene locus_tag LOCUS_10600 2649 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 5044 3389 gene locus_tag LOCUS_10610 5044 3389 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887436.1 protein_id gnl|my_center|LOCUS_10610 7036 5108 gene locus_tag LOCUS_10620 7036 5108 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886811.1 protein_id gnl|my_center|LOCUS_10620 7699 7052 gene locus_tag LOCUS_10630 7699 7052 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887290.1 protein_id gnl|my_center|LOCUS_10630 7769 8335 gene locus_tag LOCUS_10640 7769 8335 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479504.1 protein_id gnl|my_center|LOCUS_10640 8382 8885 gene locus_tag LOCUS_10650 gene coaD 8382 8885 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173005.1 protein_id gnl|my_center|LOCUS_10650 9018 9302 gene locus_tag LOCUS_10660 gene rpsT 9018 9302 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887951.1 protein_id gnl|my_center|LOCUS_10660 9871 9365 gene locus_tag LOCUS_10670 9871 9365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 10597 9977 gene locus_tag LOCUS_10680 10597 9977 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480313.1 protein_id gnl|my_center|LOCUS_10680 10712 11080 gene locus_tag LOCUS_10690 10712 11080 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480312.1 protein_id gnl|my_center|LOCUS_10690 11254 11697 gene locus_tag LOCUS_10700 gene rimP 11254 11697 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888431.1 protein_id gnl|my_center|LOCUS_10700 11712 12902 gene locus_tag LOCUS_10710 gene nusA 11712 12902 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350009.1 protein_id gnl|my_center|LOCUS_10710 13174 14898 gene locus_tag LOCUS_10720 gene infB 13174 14898 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888434.1 protein_id gnl|my_center|LOCUS_10720 14929 17196 gene locus_tag LOCUS_10730 gene secD 14929 17196 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888457.1 protein_id gnl|my_center|LOCUS_10730 17147 17551 gene locus_tag LOCUS_10740 17147 17551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 17608 19548 gene locus_tag LOCUS_10750 gene recJ 17608 19548 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479621.1 protein_id gnl|my_center|LOCUS_10750 19586 20575 gene locus_tag LOCUS_10760 19586 20575 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639933.1 protein_id gnl|my_center|LOCUS_10760 20585 21592 gene locus_tag LOCUS_10770 20585 21592 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583041.1 protein_id gnl|my_center|LOCUS_10770 21614 22375 gene locus_tag LOCUS_10780 21614 22375 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140835.1 protein_id gnl|my_center|LOCUS_10780 22372 23523 gene locus_tag LOCUS_10790 22372 23523 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887506.1 protein_id gnl|my_center|LOCUS_10790 23603 26533 gene locus_tag LOCUS_10800 gene uvrA 23603 26533 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888406.1 protein_id gnl|my_center|LOCUS_10800 26517 27008 gene locus_tag LOCUS_10810 26517 27008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 27076 27747 gene locus_tag LOCUS_10820 27076 27747 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842726.1 protein_id gnl|my_center|LOCUS_10820 27747 28166 gene locus_tag LOCUS_10830 27747 28166 CDS product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228417.1 protein_id gnl|my_center|LOCUS_10830 29848 28169 gene locus_tag LOCUS_10840 29848 28169 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888181.1 protein_id gnl|my_center|LOCUS_10840 29847 30569 gene locus_tag LOCUS_10850 29847 30569 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349631.1 protein_id gnl|my_center|LOCUS_10850 30628 31395 gene locus_tag LOCUS_10860 30628 31395 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887538.1 protein_id gnl|my_center|LOCUS_10860 31376 32092 gene locus_tag LOCUS_10870 31376 32092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 32643 32080 gene locus_tag LOCUS_10880 32643 32080 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888898.1 protein_id gnl|my_center|LOCUS_10880 32721 35282 gene locus_tag LOCUS_10890 32721 35282 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255972.1 protein_id gnl|my_center|LOCUS_10890 36158 35241 gene locus_tag LOCUS_10900 36158 35241 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026138789.1 protein_id gnl|my_center|LOCUS_10900 37547 36387 gene locus_tag LOCUS_10910 37547 36387 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888201.1 protein_id gnl|my_center|LOCUS_10910 38175 37552 gene locus_tag LOCUS_10920 gene upp 38175 37552 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479860.1 protein_id gnl|my_center|LOCUS_10920 38975 38199 gene locus_tag LOCUS_10930 38975 38199 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888203.1 protein_id gnl|my_center|LOCUS_10930 40080 38998 gene locus_tag LOCUS_10940 40080 38998 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479861.1 protein_id gnl|my_center|LOCUS_10940 40610 40137 gene locus_tag LOCUS_10950 40610 40137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 42118 40649 gene locus_tag LOCUS_10960 42118 40649 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256247.1 protein_id gnl|my_center|LOCUS_10960 43692 42151 gene locus_tag LOCUS_10970 43692 42151 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256246.1 protein_id gnl|my_center|LOCUS_10970 44396 43689 gene locus_tag LOCUS_10980 44396 43689 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228966.1 protein_id gnl|my_center|LOCUS_10980 45020 44427 gene locus_tag LOCUS_10990 45020 44427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 46225 45020 gene locus_tag LOCUS_11000 46225 45020 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876399.1 protein_id gnl|my_center|LOCUS_11000 48101 46215 gene locus_tag LOCUS_11010 48101 46215 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003907280.1 protein_id gnl|my_center|LOCUS_11010 48826 48098 gene locus_tag LOCUS_11020 48826 48098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 50189 48840 gene locus_tag LOCUS_11030 50189 48840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 51637 50186 gene locus_tag LOCUS_11040 51637 50186 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181950125.1 protein_id gnl|my_center|LOCUS_11040 52284 51634 gene locus_tag LOCUS_11050 52284 51634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 53237 52281 gene locus_tag LOCUS_11060 53237 52281 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528372.1 protein_id gnl|my_center|LOCUS_11060 53750 53394 gene locus_tag LOCUS_11070 53750 53394 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634053.1 protein_id gnl|my_center|LOCUS_11070 54088 53747 gene locus_tag LOCUS_11080 54088 53747 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634053.1 protein_id gnl|my_center|LOCUS_11080 55065 54112 gene locus_tag LOCUS_11090 55065 54112 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887615.1 protein_id gnl|my_center|LOCUS_11090 55814 55062 gene locus_tag LOCUS_11100 55814 55062 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887616.1 protein_id gnl|my_center|LOCUS_11100 56966 55824 gene locus_tag LOCUS_11110 56966 55824 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480016.1 protein_id gnl|my_center|LOCUS_11110 58135 56972 gene locus_tag LOCUS_11120 58135 56972 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887898.1 protein_id gnl|my_center|LOCUS_11120 58230 59216 gene locus_tag LOCUS_11130 gene ispH 58230 59216 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888795.1 protein_id gnl|my_center|LOCUS_11130 59995 59189 gene locus_tag LOCUS_11140 59995 59189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 60195 60467 gene locus_tag LOCUS_11150 gene pprM 60195 60467 CDS product DNA damage response modulator PprM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869024.1 protein_id gnl|my_center|LOCUS_11150 61689 60511 gene locus_tag LOCUS_11160 61689 60511 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921004.1 protein_id gnl|my_center|LOCUS_11160 62485 61682 gene locus_tag LOCUS_11170 62485 61682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 63015 62482 gene locus_tag LOCUS_11180 63015 62482 CDS product putative metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887487.1 protein_id gnl|my_center|LOCUS_11180 63115 64461 gene locus_tag LOCUS_11190 gene gntK 63115 64461 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450003.1 protein_id gnl|my_center|LOCUS_11190 64571 64495 gene locus_tag LOCUS_t00220 64571 64495 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 64646 65071 gene locus_tag LOCUS_11200 gene ruvX 64646 65071 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889134.1 protein_id gnl|my_center|LOCUS_11200 65068 66486 gene locus_tag LOCUS_11210 65068 66486 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479935.1 protein_id gnl|my_center|LOCUS_11210 67124 66561 gene locus_tag LOCUS_11220 67124 66561 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177743.1 protein_id gnl|my_center|LOCUS_11220 67857 67132 gene locus_tag LOCUS_11230 67857 67132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 67896 68543 gene locus_tag LOCUS_11240 gene cmk 67896 68543 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480105.1 protein_id gnl|my_center|LOCUS_11240 68522 69064 gene locus_tag LOCUS_11250 68522 69064 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871511.1 protein_id gnl|my_center|LOCUS_11250 69076 69666 gene locus_tag LOCUS_11260 69076 69666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 69679 70149 gene locus_tag LOCUS_11270 69679 70149 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174007.1 protein_id gnl|my_center|LOCUS_11270 71461 70133 gene locus_tag LOCUS_11280 71461 70133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 72219 71551 gene locus_tag LOCUS_11290 72219 71551 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887427.1 protein_id gnl|my_center|LOCUS_11290 73376 72330 gene locus_tag LOCUS_11300 73376 72330 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889181.1 protein_id gnl|my_center|LOCUS_11300 73536 74546 gene locus_tag LOCUS_11310 73536 74546 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_11310 74556 75344 gene locus_tag LOCUS_11320 74556 75344 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393781.1 protein_id gnl|my_center|LOCUS_11320 77178 75346 gene locus_tag LOCUS_11330 77178 75346 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152423524.1 protein_id gnl|my_center|LOCUS_11330 77274 77798 gene locus_tag LOCUS_11340 77274 77798 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479804.1 protein_id gnl|my_center|LOCUS_11340 78835 77804 gene locus_tag LOCUS_11350 gene plsX 78835 77804 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479836.1 protein_id gnl|my_center|LOCUS_11350 79014 79349 gene locus_tag LOCUS_11360 gene trxA 79014 79349 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479673.1 protein_id gnl|my_center|LOCUS_11360 80614 79367 gene locus_tag LOCUS_11370 80614 79367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 82186 80732 gene locus_tag LOCUS_11380 gene gatA 82186 80732 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888491.1 protein_id gnl|my_center|LOCUS_11380 82669 83298 gene locus_tag LOCUS_11390 82669 83298 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479802.1 protein_id gnl|my_center|LOCUS_11390 83295 84137 gene locus_tag LOCUS_11400 83295 84137 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479803.1 protein_id gnl|my_center|LOCUS_11400 85171 84143 gene locus_tag LOCUS_11410 85171 84143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 86011 85172 gene locus_tag LOCUS_11420 86011 85172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 86541 86182 gene locus_tag LOCUS_11430 86541 86182 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173441.1 protein_id gnl|my_center|LOCUS_11430 87536 86538 gene locus_tag LOCUS_11440 87536 86538 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177598.1 protein_id gnl|my_center|LOCUS_11440 89231 87552 gene locus_tag LOCUS_11450 89231 87552 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986790.1 protein_id gnl|my_center|LOCUS_11450 90312 89323 gene locus_tag LOCUS_11460 90312 89323 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887921.1 protein_id gnl|my_center|LOCUS_11460 90424 91506 gene locus_tag LOCUS_11470 gene prfA 90424 91506 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349619.1 protein_id gnl|my_center|LOCUS_11470 91522 92013 gene locus_tag LOCUS_11480 91522 92013 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887620.1 protein_id gnl|my_center|LOCUS_11480 92954 92010 gene locus_tag LOCUS_11490 92954 92010 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480024.1 protein_id gnl|my_center|LOCUS_11490 93140 93066 gene locus_tag LOCUS_t00230 93140 93066 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 93691 93206 gene locus_tag LOCUS_11500 93691 93206 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479831.1 protein_id gnl|my_center|LOCUS_11500 94635 93688 gene locus_tag LOCUS_11510 gene trxB 94635 93688 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229015.1 protein_id gnl|my_center|LOCUS_11510 94790 94717 gene locus_tag LOCUS_t00240 94790 94717 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 95639 94821 gene locus_tag LOCUS_11520 95639 94821 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228903.1 protein_id gnl|my_center|LOCUS_11520 96481 95636 gene locus_tag LOCUS_11530 gene accD 96481 95636 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887858.1 protein_id gnl|my_center|LOCUS_11530 96576 97454 gene locus_tag LOCUS_11540 gene era 96576 97454 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887291.1 protein_id gnl|my_center|LOCUS_11540 97456 98763 gene locus_tag LOCUS_11550 97456 98763 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349496.1 protein_id gnl|my_center|LOCUS_11550 99785 98751 gene locus_tag LOCUS_11560 99785 98751 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867759.1 protein_id gnl|my_center|LOCUS_11560 100384 99782 gene locus_tag LOCUS_11570 gene pth 100384 99782 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888998.1 protein_id gnl|my_center|LOCUS_11570 100824 100381 gene locus_tag LOCUS_11580 100824 100381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 103095 100879 gene locus_tag LOCUS_11590 103095 100879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 103174 103641 gene locus_tag LOCUS_11600 103174 103641 CDS product DUF1999 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887837.1 protein_id gnl|my_center|LOCUS_11600 103665 103874 gene locus_tag LOCUS_11610 103665 103874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888118.1 protein_id gnl|my_center|LOCUS_11610 103876 104199 gene locus_tag LOCUS_11620 103876 104199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 >Feature sequence09 1643 771 gene locus_tag LOCUS_11630 1643 771 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479973.1 protein_id gnl|my_center|LOCUS_11630 2482 1640 gene locus_tag LOCUS_11640 2482 1640 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173573.1 protein_id gnl|my_center|LOCUS_11640 2728 2631 gene locus_tag LOCUS_t00250 2728 2631 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3515 4129 gene locus_tag LOCUS_11650 gene ldrP 3515 4129 CDS product transcriptional regulator LdrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229195.1 protein_id gnl|my_center|LOCUS_11650 4126 5016 gene locus_tag LOCUS_11660 4126 5016 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479830.1 protein_id gnl|my_center|LOCUS_11660 5100 5930 gene locus_tag LOCUS_11670 5100 5930 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034357836.1 protein_id gnl|my_center|LOCUS_11670 6600 5845 gene locus_tag LOCUS_11680 gene surE 6600 5845 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889023.1 protein_id gnl|my_center|LOCUS_11680 7308 6637 gene locus_tag LOCUS_11690 7308 6637 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391560.1 protein_id gnl|my_center|LOCUS_11690 8144 7413 gene locus_tag LOCUS_11700 8144 7413 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720123.1 protein_id gnl|my_center|LOCUS_11700 8239 8499 gene locus_tag LOCUS_11710 8239 8499 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630832.1 protein_id gnl|my_center|LOCUS_11710 8579 10435 gene locus_tag LOCUS_11720 gene uvrC 8579 10435 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887995.1 protein_id gnl|my_center|LOCUS_11720 10586 11152 gene locus_tag LOCUS_11730 10586 11152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 11149 11931 gene locus_tag LOCUS_11740 11149 11931 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480253.1 protein_id gnl|my_center|LOCUS_11740 11897 12733 gene locus_tag LOCUS_11750 gene parB 11897 12733 CDS product ParB/RepB/Spo0J family partition protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886660.1 protein_id gnl|my_center|LOCUS_11750 13531 12884 gene locus_tag LOCUS_11760 13531 12884 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886771.1 protein_id gnl|my_center|LOCUS_11760 13597 16719 gene locus_tag LOCUS_11770 13597 16719 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082402.1 protein_id gnl|my_center|LOCUS_11770 18148 16676 gene locus_tag LOCUS_11780 gene gcvPB 18148 16676 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228003.1 protein_id gnl|my_center|LOCUS_11780 19427 18141 gene locus_tag LOCUS_11790 gene gcvPA 19427 18141 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172605.1 protein_id gnl|my_center|LOCUS_11790 19849 19472 gene locus_tag LOCUS_11800 gene gcvH 19849 19472 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173499.1 protein_id gnl|my_center|LOCUS_11800 20994 19924 gene locus_tag LOCUS_11810 gene gcvT 20994 19924 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479785.1 protein_id gnl|my_center|LOCUS_11810 23383 21023 gene locus_tag LOCUS_11820 23383 21023 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140201.1 protein_id gnl|my_center|LOCUS_11820 23297 24160 gene locus_tag LOCUS_11830 23297 24160 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350521.1 protein_id gnl|my_center|LOCUS_11830 24216 24292 gene locus_tag LOCUS_t00260 24216 24292 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 24310 24394 gene locus_tag LOCUS_t00270 24310 24394 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 24476 25807 gene locus_tag LOCUS_11840 gene tig 24476 25807 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888581.1 protein_id gnl|my_center|LOCUS_11840 26305 25880 gene locus_tag LOCUS_11850 gene mscL 26305 25880 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928676.1 protein_id gnl|my_center|LOCUS_11850 26455 26925 gene locus_tag LOCUS_11860 26455 26925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 27730 27032 gene locus_tag LOCUS_11870 gene recO 27730 27032 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887465.1 protein_id gnl|my_center|LOCUS_11870 28556 27774 gene locus_tag LOCUS_11880 28556 27774 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932815.1 protein_id gnl|my_center|LOCUS_11880 28626 29585 gene locus_tag LOCUS_11890 28626 29585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 29587 31017 gene locus_tag LOCUS_11900 29587 31017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 31028 32653 gene locus_tag LOCUS_11910 31028 32653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 32689 34176 gene locus_tag LOCUS_11920 32689 34176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 34277 36070 gene locus_tag LOCUS_11930 34277 36070 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479771.1 protein_id gnl|my_center|LOCUS_11930 36078 37046 gene locus_tag LOCUS_11940 36078 37046 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479770.1 protein_id gnl|my_center|LOCUS_11940 37043 38089 gene locus_tag LOCUS_11950 37043 38089 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889467.1 protein_id gnl|my_center|LOCUS_11950 38169 39542 gene locus_tag LOCUS_11960 38169 39542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 39505 40434 gene locus_tag LOCUS_11970 39505 40434 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887563.1 protein_id gnl|my_center|LOCUS_11970 40427 41545 gene locus_tag LOCUS_11980 40427 41545 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887564.1 protein_id gnl|my_center|LOCUS_11980 41596 42342 gene locus_tag LOCUS_11990 41596 42342 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797101.1 protein_id gnl|my_center|LOCUS_11990 43815 42484 gene locus_tag LOCUS_12000 43815 42484 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230065.1 protein_id gnl|my_center|LOCUS_12000 43898 44596 gene locus_tag LOCUS_12010 43898 44596 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528648.1 protein_id gnl|my_center|LOCUS_12010 44841 44766 gene locus_tag LOCUS_t00280 44841 44766 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 45721 44882 gene locus_tag LOCUS_12020 45721 44882 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479789.1 protein_id gnl|my_center|LOCUS_12020 45815 45905 gene locus_tag LOCUS_t00290 45815 45905 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 46004 47158 gene locus_tag LOCUS_12030 gene pilM 46004 47158 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887416.1 protein_id gnl|my_center|LOCUS_12030 47151 47774 gene locus_tag LOCUS_12040 47151 47774 CDS product competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228637.1 protein_id gnl|my_center|LOCUS_12040 47764 48411 gene locus_tag LOCUS_12050 gene pilO 47764 48411 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173434.1 protein_id gnl|my_center|LOCUS_12050 48423 49496 gene locus_tag LOCUS_12060 48423 49496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 49504 51081 gene locus_tag LOCUS_12070 49504 51081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 51121 52272 gene locus_tag LOCUS_12080 gene aroC 51121 52272 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887421.1 protein_id gnl|my_center|LOCUS_12080 52253 52876 gene locus_tag LOCUS_12090 52253 52876 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350371.1 protein_id gnl|my_center|LOCUS_12090 52923 53804 gene locus_tag LOCUS_12100 52923 53804 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582695.1 protein_id gnl|my_center|LOCUS_12100 54303 53824 gene locus_tag LOCUS_12110 54303 53824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479844.1 protein_id gnl|my_center|LOCUS_12110 54359 55006 gene locus_tag LOCUS_12120 54359 55006 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887077.1 protein_id gnl|my_center|LOCUS_12120 55024 57678 gene locus_tag LOCUS_12130 gene alaS 55024 57678 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888928.1 protein_id gnl|my_center|LOCUS_12130 58186 57737 gene locus_tag LOCUS_12140 58186 57737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 59520 58267 gene locus_tag LOCUS_12150 59520 58267 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268537.1 protein_id gnl|my_center|LOCUS_12150 60009 59740 gene locus_tag LOCUS_12160 60009 59740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12160 60477 60052 gene locus_tag LOCUS_12170 60477 60052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 61138 60677 gene locus_tag LOCUS_12180 61138 60677 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349477.1 protein_id gnl|my_center|LOCUS_12180 62646 61240 gene locus_tag LOCUS_12190 62646 61240 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144042.1 protein_id gnl|my_center|LOCUS_12190 62881 64140 gene locus_tag LOCUS_12200 62881 64140 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228779.1 protein_id gnl|my_center|LOCUS_12200 64137 65417 gene locus_tag LOCUS_12210 64137 65417 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228779.1 protein_id gnl|my_center|LOCUS_12210 65649 66005 gene locus_tag LOCUS_12220 65649 66005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 66008 66295 gene locus_tag LOCUS_12230 66008 66295 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969543.1 protein_id gnl|my_center|LOCUS_12230 66308 66535 gene locus_tag LOCUS_12240 66308 66535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12240 66565 66855 gene locus_tag LOCUS_12250 66565 66855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12250 67199 66852 gene locus_tag LOCUS_12260 67199 66852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 67165 67410 gene locus_tag LOCUS_12270 67165 67410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 68814 67663 gene locus_tag LOCUS_12280 68814 67663 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900904.1 protein_id gnl|my_center|LOCUS_12280 69164 68817 gene locus_tag LOCUS_12290 gene ychN 69164 68817 CDS product DsrE/F sulfur relay family protein YchN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169669.1 protein_id gnl|my_center|LOCUS_12290 69846 69166 gene locus_tag LOCUS_12300 69846 69166 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408266.1 protein_id gnl|my_center|LOCUS_12300 71036 70554 gene locus_tag LOCUS_12310 71036 70554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888930.1 protein_id gnl|my_center|LOCUS_12310 71165 72070 gene locus_tag LOCUS_12320 71165 72070 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411157.1 protein_id gnl|my_center|LOCUS_12320 72063 72842 gene locus_tag LOCUS_12330 72063 72842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 74231 72903 gene locus_tag LOCUS_12340 74231 72903 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229206.1 protein_id gnl|my_center|LOCUS_12340 75096 74254 gene locus_tag LOCUS_12350 75096 74254 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896545.1 protein_id gnl|my_center|LOCUS_12350 75983 75093 gene locus_tag LOCUS_12360 75983 75093 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803811.1 protein_id gnl|my_center|LOCUS_12360 77302 76037 gene locus_tag LOCUS_12370 77302 76037 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730345.1 protein_id gnl|my_center|LOCUS_12370 78405 77374 gene locus_tag LOCUS_12380 78405 77374 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707764.1 protein_id gnl|my_center|LOCUS_12380 80948 78711 gene locus_tag LOCUS_12390 80948 78711 CDS product DNA polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943858.1 protein_id gnl|my_center|LOCUS_12390 82539 80995 gene locus_tag LOCUS_12400 82539 80995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 82985 82536 gene locus_tag LOCUS_12410 82985 82536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 84150 83542 gene locus_tag LOCUS_12420 84150 83542 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888961.1 protein_id gnl|my_center|LOCUS_12420 84304 85485 gene locus_tag LOCUS_12430 84304 85485 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259142.1 protein_id gnl|my_center|LOCUS_12430 85469 86542 gene locus_tag LOCUS_12440 gene aroB 85469 86542 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887423.1 protein_id gnl|my_center|LOCUS_12440 86588 87016 gene locus_tag LOCUS_12450 gene aroQ 86588 87016 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887424.1 protein_id gnl|my_center|LOCUS_12450 87126 87554 gene locus_tag LOCUS_12460 gene rplM 87126 87554 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886820.1 protein_id gnl|my_center|LOCUS_12460 87551 87940 gene locus_tag LOCUS_12470 gene rpsI 87551 87940 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886821.1 protein_id gnl|my_center|LOCUS_12470 89263 88001 gene locus_tag LOCUS_12480 89263 88001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 90221 89349 gene locus_tag LOCUS_12490 gene aroE 90221 89349 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081608222.1 protein_id gnl|my_center|LOCUS_12490 90294 90665 gene locus_tag LOCUS_12500 90294 90665 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632387.1 protein_id gnl|my_center|LOCUS_12500 93483 90667 gene locus_tag LOCUS_12510 gene secA 93483 90667 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228548.1 protein_id gnl|my_center|LOCUS_12510 93897 96446 gene locus_tag LOCUS_12520 93897 96446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 >Feature sequence10 130 726 gene locus_tag LOCUS_12530 130 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 4600 800 gene locus_tag LOCUS_12540 gene dnaE 4600 800 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887152.1 protein_id gnl|my_center|LOCUS_12540 4822 7491 gene locus_tag LOCUS_12550 4822 7491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 9380 7506 gene locus_tag LOCUS_12560 9380 7506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 9427 9654 gene locus_tag LOCUS_12570 9427 9654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 9667 9864 gene locus_tag LOCUS_12580 9667 9864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 9914 10894 gene locus_tag LOCUS_12590 9914 10894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 11225 11659 gene locus_tag LOCUS_12600 gene mog 11225 11659 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943343.1 protein_id gnl|my_center|LOCUS_12600 13609 11921 gene locus_tag LOCUS_12610 13609 11921 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480118.1 protein_id gnl|my_center|LOCUS_12610 13676 13752 gene locus_tag LOCUS_t00300 13676 13752 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 14197 14451 gene locus_tag LOCUS_12620 14197 14451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 14448 14876 gene locus_tag LOCUS_12630 14448 14876 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_12630 15075 14896 gene locus_tag LOCUS_12640 15075 14896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 15136 15456 gene locus_tag LOCUS_12650 15136 15456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12650 17668 16700 gene locus_tag LOCUS_12660 17668 16700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480209.1 protein_id gnl|my_center|LOCUS_12660 18018 17665 gene locus_tag LOCUS_12670 18018 17665 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193399.1 protein_id gnl|my_center|LOCUS_12670 20307 18022 gene locus_tag LOCUS_12680 20307 18022 CDS product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528921.1 protein_id gnl|my_center|LOCUS_12680 20368 21870 gene locus_tag LOCUS_12690 gene lysS 20368 21870 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887017.1 protein_id gnl|my_center|LOCUS_12690 22468 21857 gene locus_tag LOCUS_12700 22468 21857 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229199.1 protein_id gnl|my_center|LOCUS_12700 22594 23883 gene locus_tag LOCUS_12710 22594 23883 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228148.1 protein_id gnl|my_center|LOCUS_12710 23891 24958 gene locus_tag LOCUS_12720 23891 24958 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228426.1 protein_id gnl|my_center|LOCUS_12720 25781 24984 gene locus_tag LOCUS_12730 25781 24984 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480276.1 protein_id gnl|my_center|LOCUS_12730 26731 25778 gene locus_tag LOCUS_12740 26731 25778 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350864.1 protein_id gnl|my_center|LOCUS_12740 27675 26785 gene locus_tag LOCUS_12750 27675 26785 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480277.1 protein_id gnl|my_center|LOCUS_12750 27959 28657 gene locus_tag LOCUS_12760 27959 28657 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_12760 28654 29052 gene locus_tag LOCUS_12770 28654 29052 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887102.1 protein_id gnl|my_center|LOCUS_12770 29120 30730 gene locus_tag LOCUS_12780 29120 30730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12780 30768 31478 gene locus_tag LOCUS_12790 30768 31478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887104.1 protein_id gnl|my_center|LOCUS_12790 32374 31562 gene locus_tag LOCUS_12800 32374 31562 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227389.1 protein_id gnl|my_center|LOCUS_12800 32451 33398 gene locus_tag LOCUS_12810 32451 33398 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227789.1 protein_id gnl|my_center|LOCUS_12810 33395 34009 gene locus_tag LOCUS_12820 33395 34009 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443401.1 protein_id gnl|my_center|LOCUS_12820 35652 34012 gene locus_tag LOCUS_12830 35652 34012 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480060.1 protein_id gnl|my_center|LOCUS_12830 36906 35698 gene locus_tag LOCUS_12840 gene tyrS 36906 35698 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480260.1 protein_id gnl|my_center|LOCUS_12840 38384 36960 gene locus_tag LOCUS_12850 38384 36960 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479933.1 protein_id gnl|my_center|LOCUS_12850 38632 38381 gene locus_tag LOCUS_12860 gene yidD 38632 38381 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172533.1 protein_id gnl|my_center|LOCUS_12860 39137 39003 gene locus_tag LOCUS_12870 gene rpmH 39137 39003 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888783.1 protein_id gnl|my_center|LOCUS_12870 39842 39186 gene locus_tag LOCUS_12880 gene gmk 39842 39186 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633187.1 protein_id gnl|my_center|LOCUS_12880 41793 39820 gene locus_tag LOCUS_12890 gene tkt 41793 39820 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888884.1 protein_id gnl|my_center|LOCUS_12890 41874 42578 gene locus_tag LOCUS_12900 41874 42578 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256366.1 protein_id gnl|my_center|LOCUS_12900 43178 42585 gene locus_tag LOCUS_12910 gene ruvA 43178 42585 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887917.1 protein_id gnl|my_center|LOCUS_12910 43220 43780 gene locus_tag LOCUS_12920 gene lepB 43220 43780 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887963.1 protein_id gnl|my_center|LOCUS_12920 43874 45511 gene locus_tag LOCUS_12930 gene rny 43874 45511 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889087.1 protein_id gnl|my_center|LOCUS_12930 45501 46529 gene locus_tag LOCUS_12940 45501 46529 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887007.1 protein_id gnl|my_center|LOCUS_12940 46529 46828 gene locus_tag LOCUS_12950 46529 46828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 46882 47334 gene locus_tag LOCUS_12960 46882 47334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 47331 48791 gene locus_tag LOCUS_12970 47331 48791 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392514.1 protein_id gnl|my_center|LOCUS_12970 48856 49335 gene locus_tag LOCUS_12980 48856 49335 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889507.1 protein_id gnl|my_center|LOCUS_12980 49328 51466 gene locus_tag LOCUS_12990 49328 51466 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889506.1 protein_id gnl|my_center|LOCUS_12990 51477 51896 gene locus_tag LOCUS_13000 51477 51896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 51907 52161 gene locus_tag LOCUS_13010 51907 52161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 52259 54103 gene locus_tag LOCUS_13020 52259 54103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 54150 54659 gene locus_tag LOCUS_13030 54150 54659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 56586 54889 gene locus_tag LOCUS_13040 56586 54889 CDS product copper amine oxidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177726.1 protein_id gnl|my_center|LOCUS_13040 56683 57648 gene locus_tag LOCUS_13050 gene argF 56683 57648 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177765.1 protein_id gnl|my_center|LOCUS_13050 57645 58634 gene locus_tag LOCUS_13060 gene argC 57645 58634 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173267.1 protein_id gnl|my_center|LOCUS_13060 58653 59813 gene locus_tag LOCUS_13070 gene argJ 58653 59813 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228506.1 protein_id gnl|my_center|LOCUS_13070 60883 59816 gene locus_tag LOCUS_13080 60883 59816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 61394 60975 gene locus_tag LOCUS_13090 61394 60975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 63131 61491 gene locus_tag LOCUS_13100 gene groL 63131 61491 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887252.1 protein_id gnl|my_center|LOCUS_13100 63461 63204 gene locus_tag LOCUS_13110 gene groES 63461 63204 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174076.1 protein_id gnl|my_center|LOCUS_13110 64176 64892 gene locus_tag LOCUS_13120 64176 64892 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143410.1 protein_id gnl|my_center|LOCUS_13120 64889 66478 gene locus_tag LOCUS_13130 64889 66478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 66507 67121 gene locus_tag LOCUS_13140 66507 67121 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887249.1 protein_id gnl|my_center|LOCUS_13140 68107 67118 gene locus_tag LOCUS_13150 68107 67118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 68211 68576 gene locus_tag LOCUS_13160 68211 68576 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349502.1 protein_id gnl|my_center|LOCUS_13160 69026 68652 gene locus_tag LOCUS_13170 69026 68652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 70876 69203 gene locus_tag LOCUS_13180 70876 69203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 71021 71797 gene locus_tag LOCUS_13190 71021 71797 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530129.1 protein_id gnl|my_center|LOCUS_13190 72481 71801 gene locus_tag LOCUS_13200 72481 71801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 72675 74927 gene locus_tag LOCUS_13210 72675 74927 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046464039.1 protein_id gnl|my_center|LOCUS_13210 74946 75971 gene locus_tag LOCUS_13220 74946 75971 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337813.1 protein_id gnl|my_center|LOCUS_13220 76966 75968 gene locus_tag LOCUS_13230 76966 75968 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229118.1 protein_id gnl|my_center|LOCUS_13230 77021 77932 gene locus_tag LOCUS_13240 77021 77932 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257625.1 protein_id gnl|my_center|LOCUS_13240 79304 77934 gene locus_tag LOCUS_13250 79304 77934 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889272.1 protein_id gnl|my_center|LOCUS_13250 79379 79816 gene locus_tag LOCUS_13260 79379 79816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 79944 81887 gene locus_tag LOCUS_13270 79944 81887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 81892 83178 gene locus_tag LOCUS_13280 81892 83178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 83246 84106 gene locus_tag LOCUS_13290 gene iaaA 83246 84106 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704837.1 protein_id gnl|my_center|LOCUS_13290 85411 84158 gene locus_tag LOCUS_13300 85411 84158 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532975.1 protein_id gnl|my_center|LOCUS_13300 86415 85459 gene locus_tag LOCUS_13310 86415 85459 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173609.1 protein_id gnl|my_center|LOCUS_13310 87311 86412 gene locus_tag LOCUS_13320 87311 86412 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532983.1 protein_id gnl|my_center|LOCUS_13320 88030 87308 gene locus_tag LOCUS_13330 88030 87308 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532982.1 protein_id gnl|my_center|LOCUS_13330 88785 88027 gene locus_tag LOCUS_13340 88785 88027 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532981.1 protein_id gnl|my_center|LOCUS_13340 88996 91143 gene locus_tag LOCUS_13350 88996 91143 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249928.1 protein_id gnl|my_center|LOCUS_13350 91265 91179 gene locus_tag LOCUS_t00310 91265 91179 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 91326 91670 gene locus_tag LOCUS_13360 91326 91670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 91736 92152 gene locus_tag LOCUS_13370 91736 92152 CDS product DUF4864 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085003.1 protein_id gnl|my_center|LOCUS_13370 93561 92149 gene locus_tag LOCUS_13380 93561 92149 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228014.1 protein_id gnl|my_center|LOCUS_13380 93748 95415 gene locus_tag LOCUS_13390 93748 95415 CDS product bifunctional sulfate adenylyltransferase/adenylylsulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208002274.1 protein_id gnl|my_center|LOCUS_13390 >Feature sequence11 1583 2800 gene locus_tag LOCUS_13400 1583 2800 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173220.1 protein_id gnl|my_center|LOCUS_13400 2881 2805 gene locus_tag LOCUS_t00320 2881 2805 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3584 2898 gene locus_tag LOCUS_13410 gene queC 3584 2898 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126004.1 protein_id gnl|my_center|LOCUS_13410 4294 3584 gene locus_tag LOCUS_13420 4294 3584 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126003.1 protein_id gnl|my_center|LOCUS_13420 4685 4278 gene locus_tag LOCUS_13430 gene queD 4685 4278 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003389277.1 protein_id gnl|my_center|LOCUS_13430 5119 4685 gene locus_tag LOCUS_13440 5119 4685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 6197 5169 gene locus_tag LOCUS_13450 6197 5169 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460176.1 protein_id gnl|my_center|LOCUS_13450 6640 6260 gene locus_tag LOCUS_13460 6640 6260 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367486.1 protein_id gnl|my_center|LOCUS_13460 6740 7369 gene locus_tag LOCUS_13470 6740 7369 CDS product MIP family channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530368.1 protein_id gnl|my_center|LOCUS_13470 8405 7413 gene locus_tag LOCUS_13480 8405 7413 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174155.1 protein_id gnl|my_center|LOCUS_13480 9216 8431 gene locus_tag LOCUS_13490 gene lepB 9216 8431 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350452.1 protein_id gnl|my_center|LOCUS_13490 9335 10153 gene locus_tag LOCUS_13500 9335 10153 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228629.1 protein_id gnl|my_center|LOCUS_13500 10198 11004 gene locus_tag LOCUS_13510 10198 11004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 11042 11117 gene locus_tag LOCUS_t00330 11042 11117 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 11198 11575 gene locus_tag LOCUS_13520 11198 11575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 11909 11595 gene locus_tag LOCUS_13530 11909 11595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 11826 12452 gene locus_tag LOCUS_13540 11826 12452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 14986 12461 gene locus_tag LOCUS_13550 gene polA 14986 12461 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228405.1 protein_id gnl|my_center|LOCUS_13550 15073 15741 gene locus_tag LOCUS_13560 gene ubiE 15073 15741 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228961.1 protein_id gnl|my_center|LOCUS_13560 15918 16409 gene locus_tag LOCUS_13570 15918 16409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 16406 17350 gene locus_tag LOCUS_13580 16406 17350 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888315.1 protein_id gnl|my_center|LOCUS_13580 17351 19588 gene locus_tag LOCUS_13590 17351 19588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 19650 20861 gene locus_tag LOCUS_13600 19650 20861 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350283.1 protein_id gnl|my_center|LOCUS_13600 20884 22188 gene locus_tag LOCUS_13610 gene purB 20884 22188 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888809.1 protein_id gnl|my_center|LOCUS_13610 22222 22677 gene locus_tag LOCUS_13620 22222 22677 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_13620 23959 22949 gene locus_tag LOCUS_13630 23959 22949 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002185292.1 protein_id gnl|my_center|LOCUS_13630 26357 23979 gene locus_tag LOCUS_13640 26357 23979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 27239 26814 gene locus_tag LOCUS_13650 gene ndk 27239 26814 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227764.1 protein_id gnl|my_center|LOCUS_13650 27297 28283 gene locus_tag LOCUS_13660 27297 28283 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228492.1 protein_id gnl|my_center|LOCUS_13660 28304 29539 gene locus_tag LOCUS_13670 28304 29539 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480158.1 protein_id gnl|my_center|LOCUS_13670 29622 30635 gene locus_tag LOCUS_13680 29622 30635 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903488.1 protein_id gnl|my_center|LOCUS_13680 30632 31402 gene locus_tag LOCUS_13690 30632 31402 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869292.1 protein_id gnl|my_center|LOCUS_13690 31863 31480 gene locus_tag LOCUS_13700 31863 31480 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887084.1 protein_id gnl|my_center|LOCUS_13700 31949 33160 gene locus_tag LOCUS_13710 31949 33160 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479553.1 protein_id gnl|my_center|LOCUS_13710 33223 33909 gene locus_tag LOCUS_13720 33223 33909 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887188.1 protein_id gnl|my_center|LOCUS_13720 33918 34823 gene locus_tag LOCUS_13730 33918 34823 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479524.1 protein_id gnl|my_center|LOCUS_13730 34814 35347 gene locus_tag LOCUS_13740 34814 35347 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403143.1 protein_id gnl|my_center|LOCUS_13740 37529 35349 gene locus_tag LOCUS_13750 gene clpA 37529 35349 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389862.1 protein_id gnl|my_center|LOCUS_13750 37848 37549 gene locus_tag LOCUS_13760 gene clpS 37848 37549 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640501.1 protein_id gnl|my_center|LOCUS_13760 38466 37864 gene locus_tag LOCUS_13770 38466 37864 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888340.1 protein_id gnl|my_center|LOCUS_13770 39485 38511 gene locus_tag LOCUS_13780 39485 38511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 39568 41364 gene locus_tag LOCUS_13790 gene pepF 39568 41364 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256129.1 protein_id gnl|my_center|LOCUS_13790 41364 41630 gene locus_tag LOCUS_13800 41364 41630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 41967 41563 gene locus_tag LOCUS_13810 41967 41563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 42136 42813 gene locus_tag LOCUS_13820 gene lipB 42136 42813 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174104.1 protein_id gnl|my_center|LOCUS_13820 42806 43753 gene locus_tag LOCUS_13830 gene lipA 42806 43753 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887411.1 protein_id gnl|my_center|LOCUS_13830 44780 43806 gene locus_tag LOCUS_13840 44780 43806 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552051.1 protein_id gnl|my_center|LOCUS_13840 46094 44805 gene locus_tag LOCUS_13850 46094 44805 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766673.1 protein_id gnl|my_center|LOCUS_13850 51056 46179 gene locus_tag LOCUS_13860 51056 46179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 52795 51053 gene locus_tag LOCUS_13870 52795 51053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 55040 52788 gene locus_tag LOCUS_13880 55040 52788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 56665 55046 gene locus_tag LOCUS_13890 56665 55046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 56915 57856 gene locus_tag LOCUS_13900 56915 57856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 57902 58567 gene locus_tag LOCUS_13910 57902 58567 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228792.1 protein_id gnl|my_center|LOCUS_13910 58564 59832 gene locus_tag LOCUS_13920 58564 59832 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228791.1 protein_id gnl|my_center|LOCUS_13920 59829 60344 gene locus_tag LOCUS_13930 59829 60344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 61386 60388 gene locus_tag LOCUS_13940 61386 60388 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943262.1 protein_id gnl|my_center|LOCUS_13940 62381 61383 gene locus_tag LOCUS_13950 62381 61383 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084174.1 protein_id gnl|my_center|LOCUS_13950 63260 62382 gene locus_tag LOCUS_13960 63260 62382 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383587.1 protein_id gnl|my_center|LOCUS_13960 64293 63265 gene locus_tag LOCUS_13970 64293 63265 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383586.1 protein_id gnl|my_center|LOCUS_13970 65897 64311 gene locus_tag LOCUS_13980 65897 64311 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383585.1 protein_id gnl|my_center|LOCUS_13980 67032 65938 gene locus_tag LOCUS_13990 67032 65938 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721245.1 protein_id gnl|my_center|LOCUS_13990 68122 67019 gene locus_tag LOCUS_14000 68122 67019 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311988.1 protein_id gnl|my_center|LOCUS_14000 69659 68115 gene locus_tag LOCUS_14010 69659 68115 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972706.1 protein_id gnl|my_center|LOCUS_14010 69857 71023 gene locus_tag LOCUS_14020 69857 71023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 71060 71995 gene locus_tag LOCUS_14030 71060 71995 CDS product DUF1177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391755.1 protein_id gnl|my_center|LOCUS_14030 72375 72905 gene locus_tag LOCUS_14040 72375 72905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 73837 72971 gene locus_tag LOCUS_14050 73837 72971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 75105 73936 gene locus_tag LOCUS_14060 75105 73936 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337440.1 protein_id gnl|my_center|LOCUS_14060 75613 76119 gene locus_tag LOCUS_14070 75613 76119 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902391.1 protein_id gnl|my_center|LOCUS_14070 77029 76121 gene locus_tag LOCUS_14080 77029 76121 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037942.1 protein_id gnl|my_center|LOCUS_14080 >Feature sequence12 264 190 gene locus_tag LOCUS_t00340 264 190 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 343 268 gene locus_tag LOCUS_t00350 343 268 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 439 354 gene locus_tag LOCUS_t00360 439 354 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 536 460 gene locus_tag LOCUS_t00370 536 460 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 678 1427 gene locus_tag LOCUS_14090 678 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 1448 2851 gene locus_tag LOCUS_14100 gene fumC 1448 2851 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089259.1 protein_id gnl|my_center|LOCUS_14100 2848 3180 gene locus_tag LOCUS_14110 2848 3180 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889215.1 protein_id gnl|my_center|LOCUS_14110 3173 3904 gene locus_tag LOCUS_14120 3173 3904 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889246.1 protein_id gnl|my_center|LOCUS_14120 3908 4876 gene locus_tag LOCUS_14130 3908 4876 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889245.1 protein_id gnl|my_center|LOCUS_14130 4989 6407 gene locus_tag LOCUS_14140 4989 6407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 7336 6413 gene locus_tag LOCUS_14150 7336 6413 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528532.1 protein_id gnl|my_center|LOCUS_14150 8176 7346 gene locus_tag LOCUS_14160 gene pyrF 8176 7346 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479917.1 protein_id gnl|my_center|LOCUS_14160 9045 8173 gene locus_tag LOCUS_14170 9045 8173 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174107.1 protein_id gnl|my_center|LOCUS_14170 9174 10028 gene locus_tag LOCUS_14180 gene rocF 9174 10028 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887296.1 protein_id gnl|my_center|LOCUS_14180 11577 10285 gene locus_tag LOCUS_14190 gene serS 11577 10285 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887919.1 protein_id gnl|my_center|LOCUS_14190 11865 11581 gene locus_tag LOCUS_14200 gene gatC 11865 11581 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_14200 12633 11887 gene locus_tag LOCUS_14210 12633 11887 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888267.1 protein_id gnl|my_center|LOCUS_14210 13023 13961 gene locus_tag LOCUS_14220 13023 13961 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887460.1 protein_id gnl|my_center|LOCUS_14220 14006 15424 gene locus_tag LOCUS_14230 14006 15424 CDS product cation-efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085925.1 protein_id gnl|my_center|LOCUS_14230 17365 15425 gene locus_tag LOCUS_14240 gene thrS 17365 15425 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888712.1 protein_id gnl|my_center|LOCUS_14240 18282 17362 gene locus_tag LOCUS_14250 gene hemC 18282 17362 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888978.1 protein_id gnl|my_center|LOCUS_14250 19239 18301 gene locus_tag LOCUS_14260 gene thrB 19239 18301 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889016.1 protein_id gnl|my_center|LOCUS_14260 20276 19236 gene locus_tag LOCUS_14270 gene thrC 20276 19236 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729257.1 protein_id gnl|my_center|LOCUS_14270 21458 20499 gene locus_tag LOCUS_14280 21458 20499 CDS product DUF3089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918560.1 protein_id gnl|my_center|LOCUS_14280 21457 21699 gene locus_tag LOCUS_14290 21457 21699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 22575 21715 gene locus_tag LOCUS_14300 gene pstA 22575 21715 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404794.1 protein_id gnl|my_center|LOCUS_14300 23533 22559 gene locus_tag LOCUS_14310 gene pstC 23533 22559 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404792.1 protein_id gnl|my_center|LOCUS_14310 24632 23586 gene locus_tag LOCUS_14320 gene pstS 24632 23586 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900236.1 protein_id gnl|my_center|LOCUS_14320 25367 24741 gene locus_tag LOCUS_14330 gene sodA 25367 24741 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887922.1 protein_id gnl|my_center|LOCUS_14330 25438 26094 gene locus_tag LOCUS_14340 25438 26094 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888582.1 protein_id gnl|my_center|LOCUS_14340 26188 28152 gene locus_tag LOCUS_14350 26188 28152 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118691.1 protein_id gnl|my_center|LOCUS_14350 28639 28115 gene locus_tag LOCUS_14360 28639 28115 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349616.1 protein_id gnl|my_center|LOCUS_14360 29267 28644 gene locus_tag LOCUS_14370 29267 28644 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887642.1 protein_id gnl|my_center|LOCUS_14370 30342 29278 gene locus_tag LOCUS_14380 30342 29278 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887641.1 protein_id gnl|my_center|LOCUS_14380 30422 31714 gene locus_tag LOCUS_14390 30422 31714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 31776 32375 gene locus_tag LOCUS_14400 31776 32375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 33127 32378 gene locus_tag LOCUS_14410 33127 32378 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479969.1 protein_id gnl|my_center|LOCUS_14410 33172 33582 gene locus_tag LOCUS_14420 33172 33582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 33625 34866 gene locus_tag LOCUS_14430 gene trpB 33625 34866 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349629.1 protein_id gnl|my_center|LOCUS_14430 34863 35660 gene locus_tag LOCUS_14440 gene trpA 34863 35660 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887587.1 protein_id gnl|my_center|LOCUS_14440 35741 37390 gene locus_tag LOCUS_14450 35741 37390 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051713212.1 protein_id gnl|my_center|LOCUS_14450 37499 38815 gene locus_tag LOCUS_14460 37499 38815 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887096.1 protein_id gnl|my_center|LOCUS_14460 39213 40478 gene locus_tag LOCUS_14470 39213 40478 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143468.1 protein_id gnl|my_center|LOCUS_14470 40771 40508 gene locus_tag LOCUS_14480 40771 40508 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272681.1 protein_id gnl|my_center|LOCUS_14480 40878 41474 gene locus_tag LOCUS_14490 gene kynB 40878 41474 CDS product kynurenine formamidase KynB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114853.1 protein_id gnl|my_center|LOCUS_14490 41471 42640 gene locus_tag LOCUS_14500 gene kynU 41471 42640 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276276.1 protein_id gnl|my_center|LOCUS_14500 42680 44116 gene locus_tag LOCUS_14510 gene gltX 42680 44116 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227935.1 protein_id gnl|my_center|LOCUS_14510 44103 45044 gene locus_tag LOCUS_14520 gene ftsY 44103 45044 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888888.1 protein_id gnl|my_center|LOCUS_14520 46844 45054 gene locus_tag LOCUS_14530 46844 45054 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349776.1 protein_id gnl|my_center|LOCUS_14530 47856 46861 gene locus_tag LOCUS_14540 47856 46861 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887482.1 protein_id gnl|my_center|LOCUS_14540 48342 47863 gene locus_tag LOCUS_14550 48342 47863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 50453 48378 gene locus_tag LOCUS_14560 50453 48378 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888537.1 protein_id gnl|my_center|LOCUS_14560 50681 50472 gene locus_tag LOCUS_14570 50681 50472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 52017 50674 gene locus_tag LOCUS_14580 52017 50674 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550958.1 protein_id gnl|my_center|LOCUS_14580 52134 53564 gene locus_tag LOCUS_14590 52134 53564 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979729.1 protein_id gnl|my_center|LOCUS_14590 63100 53591 gene locus_tag LOCUS_14600 63100 53591 CDS product translocation/assembly module TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618893.1 protein_id gnl|my_center|LOCUS_14600 65148 63238 gene locus_tag LOCUS_14610 65148 63238 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173259.1 protein_id gnl|my_center|LOCUS_14610 65645 65145 gene locus_tag LOCUS_14620 65645 65145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 66421 65645 gene locus_tag LOCUS_14630 gene mreC 66421 65645 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228502.1 protein_id gnl|my_center|LOCUS_14630 67029 66418 gene locus_tag LOCUS_14640 67029 66418 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142709.1 protein_id gnl|my_center|LOCUS_14640 67758 67030 gene locus_tag LOCUS_14650 gene deoC 67758 67030 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389958.1 protein_id gnl|my_center|LOCUS_14650 68066 68536 gene locus_tag LOCUS_14660 68066 68536 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887492.1 protein_id gnl|my_center|LOCUS_14660 68965 69792 gene locus_tag LOCUS_14670 68965 69792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 69863 70534 gene locus_tag LOCUS_14680 69863 70534 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546865.1 protein_id gnl|my_center|LOCUS_14680 70531 71646 gene locus_tag LOCUS_14690 70531 71646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 72097 72759 gene locus_tag LOCUS_14700 gene sdaAB 72097 72759 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479548.1 protein_id gnl|my_center|LOCUS_14700 72957 73832 gene locus_tag LOCUS_14710 gene sdaAA 72957 73832 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479580.1 protein_id gnl|my_center|LOCUS_14710 >Feature sequence13 2669 216 gene locus_tag LOCUS_14720 2669 216 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393490.1 protein_id gnl|my_center|LOCUS_14720 3431 2673 gene locus_tag LOCUS_14730 3431 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 4125 3739 gene locus_tag LOCUS_14740 4125 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 4983 5369 gene locus_tag LOCUS_14750 4983 5369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14750 5574 6344 gene locus_tag LOCUS_14760 5574 6344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14760 7776 7420 gene locus_tag LOCUS_14770 7776 7420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 8818 7868 gene locus_tag LOCUS_14780 gene fmt 8818 7868 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889060.1 protein_id gnl|my_center|LOCUS_14780 9411 8815 gene locus_tag LOCUS_14790 gene def 9411 8815 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889059.1 protein_id gnl|my_center|LOCUS_14790 10361 9441 gene locus_tag LOCUS_14800 10361 9441 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886656.1 protein_id gnl|my_center|LOCUS_14800 11143 10361 gene locus_tag LOCUS_14810 gene cdaA 11143 10361 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177770.1 protein_id gnl|my_center|LOCUS_14810 11280 12434 gene locus_tag LOCUS_14820 11280 12434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 12431 13261 gene locus_tag LOCUS_14830 12431 13261 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228026.1 protein_id gnl|my_center|LOCUS_14830 13258 13878 gene locus_tag LOCUS_14840 13258 13878 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888009.1 protein_id gnl|my_center|LOCUS_14840 14006 14581 gene locus_tag LOCUS_14850 14006 14581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 15885 14587 gene locus_tag LOCUS_14860 gene miaB 15885 14587 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479611.1 protein_id gnl|my_center|LOCUS_14860 18399 16450 gene locus_tag LOCUS_14870 18399 16450 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479701.1 protein_id gnl|my_center|LOCUS_14870 18786 19154 gene locus_tag LOCUS_14880 18786 19154 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_14880 19994 19296 gene locus_tag LOCUS_14890 19994 19296 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087053.1 protein_id gnl|my_center|LOCUS_14890 20110 22194 gene locus_tag LOCUS_14900 gene pnp 20110 22194 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479957.1 protein_id gnl|my_center|LOCUS_14900 22191 22499 gene locus_tag LOCUS_14910 22191 22499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480244.1 protein_id gnl|my_center|LOCUS_14910 22520 23350 gene locus_tag LOCUS_14920 22520 23350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 23350 24801 gene locus_tag LOCUS_14930 23350 24801 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869246.1 protein_id gnl|my_center|LOCUS_14930 24753 25523 gene locus_tag LOCUS_14940 24753 25523 CDS product DUF4388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228649.1 protein_id gnl|my_center|LOCUS_14940 26943 25525 gene locus_tag LOCUS_14950 gene purF 26943 25525 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886866.1 protein_id gnl|my_center|LOCUS_14950 29138 26940 gene locus_tag LOCUS_14960 gene purL 29138 26940 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886868.1 protein_id gnl|my_center|LOCUS_14960 29827 29135 gene locus_tag LOCUS_14970 gene purQ 29827 29135 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141325.1 protein_id gnl|my_center|LOCUS_14970 30078 29824 gene locus_tag LOCUS_14980 gene purS 30078 29824 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886870.1 protein_id gnl|my_center|LOCUS_14980 30782 30075 gene locus_tag LOCUS_14990 30782 30075 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480166.1 protein_id gnl|my_center|LOCUS_14990 31563 30805 gene locus_tag LOCUS_15000 31563 30805 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480190.1 protein_id gnl|my_center|LOCUS_15000 31771 32301 gene locus_tag LOCUS_15010 31771 32301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051056491.1 protein_id gnl|my_center|LOCUS_15010 32298 33182 gene locus_tag LOCUS_15020 32298 33182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888947.1 protein_id gnl|my_center|LOCUS_15020 33209 33946 gene locus_tag LOCUS_15030 33209 33946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 34024 34098 gene locus_tag LOCUS_t00380 34024 34098 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 35016 34456 gene locus_tag LOCUS_15040 gene dcd 35016 34456 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174218.1 protein_id gnl|my_center|LOCUS_15040 35522 35013 gene locus_tag LOCUS_15050 35522 35013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 35847 36233 gene locus_tag LOCUS_15060 35847 36233 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480008.1 protein_id gnl|my_center|LOCUS_15060 36230 37579 gene locus_tag LOCUS_15070 36230 37579 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092263432.1 protein_id gnl|my_center|LOCUS_15070 37833 38147 gene locus_tag LOCUS_15080 37833 38147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 38176 40146 gene locus_tag LOCUS_15090 38176 40146 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887340.1 protein_id gnl|my_center|LOCUS_15090 40143 40442 gene locus_tag LOCUS_15100 40143 40442 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173338.1 protein_id gnl|my_center|LOCUS_15100 40442 41017 gene locus_tag LOCUS_15110 40442 41017 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228563.1 protein_id gnl|my_center|LOCUS_15110 41029 42003 gene locus_tag LOCUS_15120 41029 42003 CDS product V-type ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480006.1 protein_id gnl|my_center|LOCUS_15120 41996 42319 gene locus_tag LOCUS_15130 41996 42319 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887344.1 protein_id gnl|my_center|LOCUS_15130 42336 44075 gene locus_tag LOCUS_15140 42336 44075 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887345.1 protein_id gnl|my_center|LOCUS_15140 44084 45493 gene locus_tag LOCUS_15150 44084 45493 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887346.1 protein_id gnl|my_center|LOCUS_15150 45512 46180 gene locus_tag LOCUS_15160 45512 46180 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887347.1 protein_id gnl|my_center|LOCUS_15160 46393 47451 gene locus_tag LOCUS_15170 gene xylF 46393 47451 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936757.1 protein_id gnl|my_center|LOCUS_15170 47506 48273 gene locus_tag LOCUS_15180 47506 48273 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972912.1 protein_id gnl|my_center|LOCUS_15180 48273 49475 gene locus_tag LOCUS_15190 48273 49475 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972911.1 protein_id gnl|my_center|LOCUS_15190 50634 49498 gene locus_tag LOCUS_15200 50634 49498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 53432 50655 gene locus_tag LOCUS_15210 53432 50655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887218.1 protein_id gnl|my_center|LOCUS_15210 54586 53429 gene locus_tag LOCUS_15220 54586 53429 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887217.1 protein_id gnl|my_center|LOCUS_15220 56097 54745 gene locus_tag LOCUS_15230 gene accC 56097 54745 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886765.1 protein_id gnl|my_center|LOCUS_15230 56544 56098 gene locus_tag LOCUS_15240 gene accB 56544 56098 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228456.1 protein_id gnl|my_center|LOCUS_15240 57101 56544 gene locus_tag LOCUS_15250 gene efp 57101 56544 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886767.1 protein_id gnl|my_center|LOCUS_15250 58090 57098 gene locus_tag LOCUS_15260 58090 57098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480038.1 protein_id gnl|my_center|LOCUS_15260 58434 60182 gene locus_tag LOCUS_15270 gene dnaX 58434 60182 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889036.1 protein_id gnl|my_center|LOCUS_15270 60187 61494 gene locus_tag LOCUS_15280 gene hemL 60187 61494 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479528.1 protein_id gnl|my_center|LOCUS_15280 61560 61937 gene locus_tag LOCUS_15290 61560 61937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 61972 62451 gene locus_tag LOCUS_15300 61972 62451 CDS product GreA/GreB family elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888603.1 protein_id gnl|my_center|LOCUS_15300 62486 62770 gene locus_tag LOCUS_15310 62486 62770 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480331.1 protein_id gnl|my_center|LOCUS_15310 62782 64074 gene locus_tag LOCUS_15320 62782 64074 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887834.1 protein_id gnl|my_center|LOCUS_15320 64102 65547 gene locus_tag LOCUS_15330 64102 65547 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349591.1 protein_id gnl|my_center|LOCUS_15330 67478 65550 gene locus_tag LOCUS_15340 gene metG 67478 65550 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228577.1 protein_id gnl|my_center|LOCUS_15340 69117 67486 gene locus_tag LOCUS_15350 69117 67486 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479947.1 protein_id gnl|my_center|LOCUS_15350 >Feature sequence14 294 806 gene locus_tag LOCUS_15360 294 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 819 1229 gene locus_tag LOCUS_15370 819 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 1504 2847 gene locus_tag LOCUS_15380 1504 2847 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888650.1 protein_id gnl|my_center|LOCUS_15380 3601 2834 gene locus_tag LOCUS_15390 gene argB 3601 2834 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889067.1 protein_id gnl|my_center|LOCUS_15390 4070 3576 gene locus_tag LOCUS_15400 4070 3576 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889066.1 protein_id gnl|my_center|LOCUS_15400 4135 5130 gene locus_tag LOCUS_15410 4135 5130 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480119.1 protein_id gnl|my_center|LOCUS_15410 6037 5141 gene locus_tag LOCUS_15420 6037 5141 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889019.1 protein_id gnl|my_center|LOCUS_15420 6106 7779 gene locus_tag LOCUS_15430 6106 7779 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144132.1 protein_id gnl|my_center|LOCUS_15430 7885 9735 gene locus_tag LOCUS_15440 7885 9735 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618939.1 protein_id gnl|my_center|LOCUS_15440 9732 11579 gene locus_tag LOCUS_15450 9732 11579 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888683.1 protein_id gnl|my_center|LOCUS_15450 11572 12174 gene locus_tag LOCUS_15460 gene fadR 11572 12174 CDS product TetR family transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227711.1 protein_id gnl|my_center|LOCUS_15460 12167 13594 gene locus_tag LOCUS_15470 12167 13594 CDS product 2-phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350737.1 protein_id gnl|my_center|LOCUS_15470 14547 13576 gene locus_tag LOCUS_15480 14547 13576 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889247.1 protein_id gnl|my_center|LOCUS_15480 16385 15159 gene locus_tag LOCUS_15490 16385 15159 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888498.1 protein_id gnl|my_center|LOCUS_15490 16397 17026 gene locus_tag LOCUS_15500 16397 17026 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172885.1 protein_id gnl|my_center|LOCUS_15500 17011 17535 gene locus_tag LOCUS_15510 gene scpB 17011 17535 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888496.1 protein_id gnl|my_center|LOCUS_15510 17537 18337 gene locus_tag LOCUS_15520 17537 18337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 18741 18376 gene locus_tag LOCUS_15530 gene rplT 18741 18376 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888637.1 protein_id gnl|my_center|LOCUS_15530 18938 18741 gene locus_tag LOCUS_15540 gene rpmI 18938 18741 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888638.1 protein_id gnl|my_center|LOCUS_15540 19555 19064 gene locus_tag LOCUS_15550 19555 19064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 19762 21732 gene locus_tag LOCUS_15560 19762 21732 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909312.1 protein_id gnl|my_center|LOCUS_15560 21729 22409 gene locus_tag LOCUS_15570 21729 22409 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886838.1 protein_id gnl|my_center|LOCUS_15570 22409 22744 gene locus_tag LOCUS_15580 22409 22744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 22765 23064 gene locus_tag LOCUS_15590 22765 23064 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886845.1 protein_id gnl|my_center|LOCUS_15590 23068 23661 gene locus_tag LOCUS_15600 gene recR 23068 23661 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886844.1 protein_id gnl|my_center|LOCUS_15600 23661 24008 gene locus_tag LOCUS_15610 23661 24008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 24005 24373 gene locus_tag LOCUS_15620 24005 24373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 24394 24753 gene locus_tag LOCUS_15630 24394 24753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 25464 24769 gene locus_tag LOCUS_15640 25464 24769 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480290.1 protein_id gnl|my_center|LOCUS_15640 26576 25554 gene locus_tag LOCUS_15650 gene moaA 26576 25554 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166466103.1 protein_id gnl|my_center|LOCUS_15650 26808 26578 gene locus_tag LOCUS_15660 26808 26578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 27888 26827 gene locus_tag LOCUS_15670 27888 26827 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479720.1 protein_id gnl|my_center|LOCUS_15670 28683 27925 gene locus_tag LOCUS_15680 28683 27925 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888038.1 protein_id gnl|my_center|LOCUS_15680 28753 29271 gene locus_tag LOCUS_15690 28753 29271 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087107.1 protein_id gnl|my_center|LOCUS_15690 29342 30430 gene locus_tag LOCUS_15700 29342 30430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228882.1 protein_id gnl|my_center|LOCUS_15700 31996 30434 gene locus_tag LOCUS_15710 31996 30434 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887958.1 protein_id gnl|my_center|LOCUS_15710 32409 32026 gene locus_tag LOCUS_15720 32409 32026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 33452 32406 gene locus_tag LOCUS_15730 gene fni 33452 32406 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870894.1 protein_id gnl|my_center|LOCUS_15730 33982 33449 gene locus_tag LOCUS_15740 33982 33449 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480058.1 protein_id gnl|my_center|LOCUS_15740 34332 34009 gene locus_tag LOCUS_15750 34332 34009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 35089 34340 gene locus_tag LOCUS_15760 35089 34340 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351130.1 protein_id gnl|my_center|LOCUS_15760 36195 35086 gene locus_tag LOCUS_15770 gene menC 36195 35086 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480242.1 protein_id gnl|my_center|LOCUS_15770 36826 36218 gene locus_tag LOCUS_15780 36826 36218 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227885.1 protein_id gnl|my_center|LOCUS_15780 36943 37464 gene locus_tag LOCUS_15790 36943 37464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 37549 38589 gene locus_tag LOCUS_15800 37549 38589 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173840.1 protein_id gnl|my_center|LOCUS_15800 38589 39020 gene locus_tag LOCUS_15810 gene fabZ 38589 39020 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479633.1 protein_id gnl|my_center|LOCUS_15810 39013 40212 gene locus_tag LOCUS_15820 39013 40212 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479632.1 protein_id gnl|my_center|LOCUS_15820 40267 41382 gene locus_tag LOCUS_15830 40267 41382 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349606.1 protein_id gnl|my_center|LOCUS_15830 41382 42650 gene locus_tag LOCUS_15840 41382 42650 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887720.1 protein_id gnl|my_center|LOCUS_15840 43439 42657 gene locus_tag LOCUS_15850 43439 42657 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114424.1 protein_id gnl|my_center|LOCUS_15850 44496 43504 gene locus_tag LOCUS_15860 44496 43504 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403126.1 protein_id gnl|my_center|LOCUS_15860 44601 45716 gene locus_tag LOCUS_15870 44601 45716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 45701 46315 gene locus_tag LOCUS_15880 45701 46315 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889270.1 protein_id gnl|my_center|LOCUS_15880 47379 46609 gene locus_tag LOCUS_15890 47379 46609 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974415.1 protein_id gnl|my_center|LOCUS_15890 47676 47455 gene locus_tag LOCUS_15900 47676 47455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 48740 47706 gene locus_tag LOCUS_15910 gene argC 48740 47706 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229001.1 protein_id gnl|my_center|LOCUS_15910 49585 48737 gene locus_tag LOCUS_15920 gene lysX 49585 48737 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479919.1 protein_id gnl|my_center|LOCUS_15920 49746 49582 gene locus_tag LOCUS_15930 gene lysW 49746 49582 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229005.1 protein_id gnl|my_center|LOCUS_15930 50121 49762 gene locus_tag LOCUS_15940 50121 49762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 50623 50132 gene locus_tag LOCUS_15950 50623 50132 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229007.1 protein_id gnl|my_center|LOCUS_15950 51845 50616 gene locus_tag LOCUS_15960 51845 50616 CDS product homoaconitate hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888248.1 protein_id gnl|my_center|LOCUS_15960 53032 51857 gene locus_tag LOCUS_15970 gene lysS 53032 51857 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480200.1 protein_id gnl|my_center|LOCUS_15970 53196 54854 gene locus_tag LOCUS_15980 53196 54854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 55778 54864 gene locus_tag LOCUS_15990 55778 54864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 57031 55868 gene locus_tag LOCUS_16000 57031 55868 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889306.1 protein_id gnl|my_center|LOCUS_16000 57158 57084 gene locus_tag LOCUS_t00390 57158 57084 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 59276 57189 gene locus_tag LOCUS_16010 59276 57189 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926052.1 protein_id gnl|my_center|LOCUS_16010 59348 59947 gene locus_tag LOCUS_16020 59348 59947 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887810.1 protein_id gnl|my_center|LOCUS_16020 59974 60165 gene locus_tag LOCUS_16030 59974 60165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 60208 61302 gene locus_tag LOCUS_16040 gene ychF 60208 61302 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888025.1 protein_id gnl|my_center|LOCUS_16040 62683 61451 gene locus_tag LOCUS_16050 62683 61451 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173094.1 protein_id gnl|my_center|LOCUS_16050 63363 62680 gene locus_tag LOCUS_16060 63363 62680 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140495.1 protein_id gnl|my_center|LOCUS_16060 64700 63360 gene locus_tag LOCUS_16070 64700 63360 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393804.1 protein_id gnl|my_center|LOCUS_16070 66002 64800 gene locus_tag LOCUS_16080 66002 64800 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228589.1 protein_id gnl|my_center|LOCUS_16080 66697 65999 gene locus_tag LOCUS_16090 66697 65999 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889412.1 protein_id gnl|my_center|LOCUS_16090 66838 67371 gene locus_tag LOCUS_16100 66838 67371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 67505 68680 gene locus_tag LOCUS_16110 67505 68680 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414924.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence15 1631 121 gene locus_tag LOCUS_r00010 1631 121 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3439 2102 gene locus_tag LOCUS_16120 3439 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 4210 3788 gene locus_tag LOCUS_16130 4210 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 5648 4428 gene locus_tag LOCUS_16140 5648 4428 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228367.1 protein_id gnl|my_center|LOCUS_16140 6312 5656 gene locus_tag LOCUS_16150 6312 5656 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118816.1 protein_id gnl|my_center|LOCUS_16150 6862 6332 gene locus_tag LOCUS_16160 6862 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 7158 6967 gene locus_tag LOCUS_16170 7158 6967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 7859 7155 gene locus_tag LOCUS_16180 7859 7155 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887187.1 protein_id gnl|my_center|LOCUS_16180 7951 8886 gene locus_tag LOCUS_16190 7951 8886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 8883 9974 gene locus_tag LOCUS_16200 8883 9974 CDS product [LysW]-lysine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888052.1 protein_id gnl|my_center|LOCUS_16200 10036 10278 gene locus_tag LOCUS_16210 10036 10278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 10283 11245 gene locus_tag LOCUS_16220 10283 11245 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886974.1 protein_id gnl|my_center|LOCUS_16220 11361 11669 gene locus_tag LOCUS_16230 gene rpsF 11361 11669 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886746.1 protein_id gnl|my_center|LOCUS_16230 11697 12551 gene locus_tag LOCUS_16240 11697 12551 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480308.1 protein_id gnl|my_center|LOCUS_16240 12585 12851 gene locus_tag LOCUS_16250 gene rpsR 12585 12851 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886749.1 protein_id gnl|my_center|LOCUS_16250 12848 13297 gene locus_tag LOCUS_16260 gene rplI 12848 13297 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227802.1 protein_id gnl|my_center|LOCUS_16260 13402 14238 gene locus_tag LOCUS_16270 13402 14238 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480361.1 protein_id gnl|my_center|LOCUS_16270 14744 15208 gene locus_tag LOCUS_16280 14744 15208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 15205 15981 gene locus_tag LOCUS_16290 15205 15981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 16018 16209 gene locus_tag LOCUS_16300 16018 16209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 16842 17753 gene locus_tag LOCUS_16310 16842 17753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 18023 19186 gene locus_tag LOCUS_16320 18023 19186 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102573.1 protein_id gnl|my_center|LOCUS_16320 19180 20367 gene locus_tag LOCUS_16330 19180 20367 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544567.1 protein_id gnl|my_center|LOCUS_16330 20364 21539 gene locus_tag LOCUS_16340 20364 21539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 21536 22735 gene locus_tag LOCUS_16350 21536 22735 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189296.1 protein_id gnl|my_center|LOCUS_16350 24055 23429 gene locus_tag LOCUS_16360 24055 23429 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405446.1 protein_id gnl|my_center|LOCUS_16360 25254 24082 gene locus_tag LOCUS_16370 25254 24082 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086031.1 protein_id gnl|my_center|LOCUS_16370 26116 26370 gene locus_tag LOCUS_16380 26116 26370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 26370 29696 gene locus_tag LOCUS_16390 26370 29696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 29931 31016 gene locus_tag LOCUS_16400 29931 31016 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909134.1 protein_id gnl|my_center|LOCUS_16400 32077 33147 gene locus_tag LOCUS_16410 32077 33147 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143227.1 protein_id gnl|my_center|LOCUS_16410 33144 33866 gene locus_tag LOCUS_16420 33144 33866 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349836.1 protein_id gnl|my_center|LOCUS_16420 33854 34396 gene locus_tag LOCUS_16430 33854 34396 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889303.1 protein_id gnl|my_center|LOCUS_16430 34389 35387 gene locus_tag LOCUS_16440 gene rfbB 34389 35387 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_16440 35880 35599 gene locus_tag LOCUS_16450 35880 35599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 37216 36215 gene locus_tag LOCUS_16460 37216 36215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 37504 37761 gene locus_tag LOCUS_16470 37504 37761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 38118 37846 gene locus_tag LOCUS_16480 38118 37846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 38832 40016 gene locus_tag LOCUS_16490 38832 40016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 40016 43774 gene locus_tag LOCUS_16500 40016 43774 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877559.1 protein_id gnl|my_center|LOCUS_16500 46175 44022 gene locus_tag LOCUS_16510 46175 44022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 46481 47425 gene locus_tag LOCUS_16520 46481 47425 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_16520 47422 47871 gene locus_tag LOCUS_16530 47422 47871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 48536 48093 gene locus_tag LOCUS_16540 48536 48093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 48676 49629 gene locus_tag LOCUS_16550 48676 49629 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509752.1 protein_id gnl|my_center|LOCUS_16550 49626 51716 gene locus_tag LOCUS_16560 49626 51716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 52157 52462 gene locus_tag LOCUS_16570 52157 52462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16570 53965 55206 gene locus_tag LOCUS_16580 53965 55206 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_16580 55203 55823 gene locus_tag LOCUS_16590 55203 55823 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224619.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence16 243 1199 gene locus_tag LOCUS_16600 243 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 1199 2077 gene locus_tag LOCUS_16610 1199 2077 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583080.1 protein_id gnl|my_center|LOCUS_16610 2115 2543 gene locus_tag LOCUS_16620 2115 2543 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887820.1 protein_id gnl|my_center|LOCUS_16620 3590 2550 gene locus_tag LOCUS_16630 3590 2550 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404687.1 protein_id gnl|my_center|LOCUS_16630 4874 3597 gene locus_tag LOCUS_16640 4874 3597 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887081.1 protein_id gnl|my_center|LOCUS_16640 5511 4918 gene locus_tag LOCUS_16650 5511 4918 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229024.1 protein_id gnl|my_center|LOCUS_16650 6075 5533 gene locus_tag LOCUS_16660 6075 5533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 7049 6240 gene locus_tag LOCUS_16670 7049 6240 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521810.1 protein_id gnl|my_center|LOCUS_16670 7119 7877 gene locus_tag LOCUS_16680 7119 7877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 7994 8932 gene locus_tag LOCUS_16690 7994 8932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 9593 8940 gene locus_tag LOCUS_16700 9593 8940 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391993.1 protein_id gnl|my_center|LOCUS_16700 10109 9621 gene locus_tag LOCUS_16710 gene rnhA 10109 9621 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887544.1 protein_id gnl|my_center|LOCUS_16710 10428 10147 gene locus_tag LOCUS_16720 10428 10147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 11066 10536 gene locus_tag LOCUS_16730 11066 10536 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618862.1 protein_id gnl|my_center|LOCUS_16730 13085 11067 gene locus_tag LOCUS_16740 gene uvrB 13085 11067 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480336.1 protein_id gnl|my_center|LOCUS_16740 13203 13466 gene locus_tag LOCUS_16750 13203 13466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 14478 13450 gene locus_tag LOCUS_16760 14478 13450 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887591.1 protein_id gnl|my_center|LOCUS_16760 14747 14508 gene locus_tag LOCUS_16770 14747 14508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 16933 14750 gene locus_tag LOCUS_16780 gene glgB 16933 14750 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337498.1 protein_id gnl|my_center|LOCUS_16780 17581 16955 gene locus_tag LOCUS_16790 gene hisH 17581 16955 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887071.1 protein_id gnl|my_center|LOCUS_16790 18153 17578 gene locus_tag LOCUS_16800 gene hisB 18153 17578 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479567.1 protein_id gnl|my_center|LOCUS_16800 18853 18203 gene locus_tag LOCUS_16810 gene phoU 18853 18203 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174206.1 protein_id gnl|my_center|LOCUS_16810 19659 18853 gene locus_tag LOCUS_16820 gene pstB 19659 18853 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889420.1 protein_id gnl|my_center|LOCUS_16820 19714 20103 gene locus_tag LOCUS_16830 19714 20103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 20103 20345 gene locus_tag LOCUS_16840 20103 20345 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479840.1 protein_id gnl|my_center|LOCUS_16840 20352 20885 gene locus_tag LOCUS_16850 20352 20885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 20906 21676 gene locus_tag LOCUS_16860 gene trmD 20906 21676 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888644.1 protein_id gnl|my_center|LOCUS_16860 22389 21673 gene locus_tag LOCUS_16870 gene tmpR 22389 21673 CDS product bifunctional dihydropteridine reductase/dihydrofolate reductase TmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172549.1 protein_id gnl|my_center|LOCUS_16870 22790 22386 gene locus_tag LOCUS_16880 22790 22386 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172548.1 protein_id gnl|my_center|LOCUS_16880 22846 24222 gene locus_tag LOCUS_16890 22846 24222 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889146.1 protein_id gnl|my_center|LOCUS_16890 24219 25736 gene locus_tag LOCUS_16900 24219 25736 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257763.1 protein_id gnl|my_center|LOCUS_16900 25793 28726 gene locus_tag LOCUS_16910 gene fdhF 25793 28726 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245240.1 protein_id gnl|my_center|LOCUS_16910 28719 29180 gene locus_tag LOCUS_16920 28719 29180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 29177 30055 gene locus_tag LOCUS_16930 gene fdhD 29177 30055 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229108.1 protein_id gnl|my_center|LOCUS_16930 30067 31206 gene locus_tag LOCUS_16940 gene sucC 30067 31206 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887890.1 protein_id gnl|my_center|LOCUS_16940 31203 32105 gene locus_tag LOCUS_16950 gene sucD 31203 32105 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887891.1 protein_id gnl|my_center|LOCUS_16950 32123 32587 gene locus_tag LOCUS_16960 32123 32587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 32593 33438 gene locus_tag LOCUS_16970 32593 33438 CDS product AAC(3) family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480376.1 protein_id gnl|my_center|LOCUS_16970 34544 33414 gene locus_tag LOCUS_16980 gene bshA 34544 33414 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618804.1 protein_id gnl|my_center|LOCUS_16980 34706 35068 gene locus_tag LOCUS_16990 34706 35068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888423.1 protein_id gnl|my_center|LOCUS_16990 35081 35830 gene locus_tag LOCUS_17000 35081 35830 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888493.1 protein_id gnl|my_center|LOCUS_17000 37384 35846 gene locus_tag LOCUS_17010 37384 35846 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887662.1 protein_id gnl|my_center|LOCUS_17010 38878 37394 gene locus_tag LOCUS_17020 gene glpK 38878 37394 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943390.1 protein_id gnl|my_center|LOCUS_17020 39021 38875 gene locus_tag LOCUS_17030 39021 38875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 39074 39208 gene locus_tag LOCUS_17040 39074 39208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 41655 39193 gene locus_tag LOCUS_17050 gene leuS 41655 39193 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479923.1 protein_id gnl|my_center|LOCUS_17050 41826 42827 gene locus_tag LOCUS_17060 41826 42827 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259351.1 protein_id gnl|my_center|LOCUS_17060 42860 44224 gene locus_tag LOCUS_17070 42860 44224 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_17070 44221 45492 gene locus_tag LOCUS_17080 gene aspS 44221 45492 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887698.1 protein_id gnl|my_center|LOCUS_17080 46405 45482 gene locus_tag LOCUS_17090 46405 45482 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189262.1 protein_id gnl|my_center|LOCUS_17090 47456 47211 gene locus_tag LOCUS_17100 47456 47211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17100 48255 50420 gene locus_tag LOCUS_17110 48255 50420 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888410.1 protein_id gnl|my_center|LOCUS_17110 50555 51550 gene locus_tag LOCUS_17120 gene tsaD 50555 51550 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479578.1 protein_id gnl|my_center|LOCUS_17120 51553 52596 gene locus_tag LOCUS_17130 51553 52596 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887889.1 protein_id gnl|my_center|LOCUS_17130 52659 52814 gene locus_tag LOCUS_17140 52659 52814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 52963 53475 gene locus_tag LOCUS_17150 52963 53475 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480199.1 protein_id gnl|my_center|LOCUS_17150 53592 53518 gene locus_tag LOCUS_t00400 53592 53518 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence17 2012 798 gene locus_tag LOCUS_17160 2012 798 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_17160 4888 2015 gene locus_tag LOCUS_17170 4888 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 5741 4905 gene locus_tag LOCUS_17180 5741 4905 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030752.1 protein_id gnl|my_center|LOCUS_17180 6631 5738 gene locus_tag LOCUS_17190 6631 5738 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030753.1 protein_id gnl|my_center|LOCUS_17190 8038 6761 gene locus_tag LOCUS_17200 8038 6761 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030754.1 protein_id gnl|my_center|LOCUS_17200 9559 8276 gene locus_tag LOCUS_17210 9559 8276 CDS product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769085.1 protein_id gnl|my_center|LOCUS_17210 11602 9611 gene locus_tag LOCUS_17220 11602 9611 CDS product DUF4900 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229178.1 protein_id gnl|my_center|LOCUS_17220 12483 11599 gene locus_tag LOCUS_17230 12483 11599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 12904 12458 gene locus_tag LOCUS_17240 12904 12458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 13392 12901 gene locus_tag LOCUS_17250 13392 12901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 14199 13447 gene locus_tag LOCUS_17260 14199 13447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 15071 14196 gene locus_tag LOCUS_17270 15071 14196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 16104 15079 gene locus_tag LOCUS_17280 16104 15079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 16176 17120 gene locus_tag LOCUS_17290 16176 17120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 17117 18298 gene locus_tag LOCUS_17300 17117 18298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 18393 19472 gene locus_tag LOCUS_17310 18393 19472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 19701 19477 gene locus_tag LOCUS_17320 19701 19477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 20550 19711 gene locus_tag LOCUS_17330 gene truA 20550 19711 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888918.1 protein_id gnl|my_center|LOCUS_17330 20549 21247 gene locus_tag LOCUS_17340 20549 21247 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065123.1 protein_id gnl|my_center|LOCUS_17340 21247 21879 gene locus_tag LOCUS_17350 21247 21879 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889326.1 protein_id gnl|my_center|LOCUS_17350 22493 21897 gene locus_tag LOCUS_17360 22493 21897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 22641 23546 gene locus_tag LOCUS_17370 22641 23546 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618835.1 protein_id gnl|my_center|LOCUS_17370 23580 24161 gene locus_tag LOCUS_17380 23580 24161 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889002.1 protein_id gnl|my_center|LOCUS_17380 24301 26586 gene locus_tag LOCUS_17390 24301 26586 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479827.1 protein_id gnl|my_center|LOCUS_17390 26583 27656 gene locus_tag LOCUS_17400 gene rlmN 26583 27656 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229030.1 protein_id gnl|my_center|LOCUS_17400 27691 29205 gene locus_tag LOCUS_17410 27691 29205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 29212 30150 gene locus_tag LOCUS_17420 29212 30150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 30147 30872 gene locus_tag LOCUS_17430 30147 30872 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479676.1 protein_id gnl|my_center|LOCUS_17430 30894 31223 gene locus_tag LOCUS_17440 30894 31223 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480049.1 protein_id gnl|my_center|LOCUS_17440 31237 32706 gene locus_tag LOCUS_17450 31237 32706 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479527.1 protein_id gnl|my_center|LOCUS_17450 32777 33373 gene locus_tag LOCUS_17460 32777 33373 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350207.1 protein_id gnl|my_center|LOCUS_17460 33333 34262 gene locus_tag LOCUS_17470 33333 34262 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350204.1 protein_id gnl|my_center|LOCUS_17470 34355 35305 gene locus_tag LOCUS_17480 34355 35305 CDS product homoisocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173431.1 protein_id gnl|my_center|LOCUS_17480 35322 36101 gene locus_tag LOCUS_17490 gene hisF 35322 36101 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480000.1 protein_id gnl|my_center|LOCUS_17490 36094 36738 gene locus_tag LOCUS_17500 gene hisIE 36094 36738 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887378.1 protein_id gnl|my_center|LOCUS_17500 38114 36777 gene locus_tag LOCUS_17510 38114 36777 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257411.1 protein_id gnl|my_center|LOCUS_17510 38869 38270 gene locus_tag LOCUS_17520 38869 38270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 41582 39102 gene locus_tag LOCUS_17530 gene gyrA 41582 39102 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888548.1 protein_id gnl|my_center|LOCUS_17530 42371 41679 gene locus_tag LOCUS_17540 42371 41679 CDS product type-5 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173217.1 protein_id gnl|my_center|LOCUS_17540 45439 42359 gene locus_tag LOCUS_17550 gene carB 45439 42359 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887313.1 protein_id gnl|my_center|LOCUS_17550 45683 46882 gene locus_tag LOCUS_17560 45683 46882 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887319.1 protein_id gnl|my_center|LOCUS_17560 46879 48288 gene locus_tag LOCUS_17570 gene argH 46879 48288 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479496.1 protein_id gnl|my_center|LOCUS_17570 48288 48815 gene locus_tag LOCUS_17580 48288 48815 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887328.1 protein_id gnl|my_center|LOCUS_17580 48840 50015 gene locus_tag LOCUS_17590 gene carA 48840 50015 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887329.1 protein_id gnl|my_center|LOCUS_17590 50075 50151 gene locus_tag LOCUS_t00410 50075 50151 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 50212 51939 gene locus_tag LOCUS_17600 50212 51939 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967661.1 protein_id gnl|my_center|LOCUS_17600 52413 51988 gene locus_tag LOCUS_17610 52413 51988 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886862.1 protein_id gnl|my_center|LOCUS_17610 52571 53419 gene locus_tag LOCUS_17620 52571 53419 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632430.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence18 151 375 gene locus_tag LOCUS_17630 151 375 CDS product DUF3248 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888640.1 protein_id gnl|my_center|LOCUS_17630 585 430 gene locus_tag LOCUS_17640 585 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 544 861 gene locus_tag LOCUS_17650 544 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 864 1532 gene locus_tag LOCUS_17660 864 1532 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480256.1 protein_id gnl|my_center|LOCUS_17660 2196 1537 gene locus_tag LOCUS_17670 2196 1537 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480266.1 protein_id gnl|my_center|LOCUS_17670 2822 2193 gene locus_tag LOCUS_17680 2822 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 2865 4385 gene locus_tag LOCUS_17690 2865 4385 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889445.1 protein_id gnl|my_center|LOCUS_17690 5418 4390 gene locus_tag LOCUS_17700 5418 4390 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931705.1 protein_id gnl|my_center|LOCUS_17700 6459 5455 gene locus_tag LOCUS_17710 6459 5455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 7157 6471 gene locus_tag LOCUS_17720 gene thyX 7157 6471 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228435.1 protein_id gnl|my_center|LOCUS_17720 7649 7170 gene locus_tag LOCUS_17730 7649 7170 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887211.1 protein_id gnl|my_center|LOCUS_17730 7720 8448 gene locus_tag LOCUS_17740 7720 8448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 8700 9716 gene locus_tag LOCUS_17750 8700 9716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 9713 10492 gene locus_tag LOCUS_17760 9713 10492 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727098.1 protein_id gnl|my_center|LOCUS_17760 10519 12018 gene locus_tag LOCUS_17770 10519 12018 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_17770 12683 12024 gene locus_tag LOCUS_17780 12683 12024 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888011.1 protein_id gnl|my_center|LOCUS_17780 12843 13337 gene locus_tag LOCUS_17790 12843 13337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 13361 14668 gene locus_tag LOCUS_17800 13361 14668 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_17800 14669 15553 gene locus_tag LOCUS_17810 14669 15553 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480339.1 protein_id gnl|my_center|LOCUS_17810 15645 17255 gene locus_tag LOCUS_17820 15645 17255 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957568.1 protein_id gnl|my_center|LOCUS_17820 17311 17946 gene locus_tag LOCUS_17830 17311 17946 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259716.1 protein_id gnl|my_center|LOCUS_17830 18543 17962 gene locus_tag LOCUS_17840 gene folE 18543 17962 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871165.1 protein_id gnl|my_center|LOCUS_17840 19889 18681 gene locus_tag LOCUS_17850 19889 18681 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886683.1 protein_id gnl|my_center|LOCUS_17850 21333 19927 gene locus_tag LOCUS_17860 21333 19927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 21601 23388 gene locus_tag LOCUS_17870 21601 23388 CDS product DUF5693 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871314.1 protein_id gnl|my_center|LOCUS_17870 23385 24359 gene locus_tag LOCUS_17880 gene csaB 23385 24359 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886807.1 protein_id gnl|my_center|LOCUS_17880 24356 24808 gene locus_tag LOCUS_17890 24356 24808 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889032.1 protein_id gnl|my_center|LOCUS_17890 25155 24811 gene locus_tag LOCUS_17900 25155 24811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 25182 25568 gene locus_tag LOCUS_17910 25182 25568 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350530.1 protein_id gnl|my_center|LOCUS_17910 25574 25858 gene locus_tag LOCUS_17920 25574 25858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888925.1 protein_id gnl|my_center|LOCUS_17920 25860 26750 gene locus_tag LOCUS_17930 25860 26750 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888924.1 protein_id gnl|my_center|LOCUS_17930 26758 27453 gene locus_tag LOCUS_17940 26758 27453 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889164.1 protein_id gnl|my_center|LOCUS_17940 27463 28791 gene locus_tag LOCUS_17950 27463 28791 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942269.1 protein_id gnl|my_center|LOCUS_17950 28781 30151 gene locus_tag LOCUS_17960 28781 30151 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228206.1 protein_id gnl|my_center|LOCUS_17960 30549 30148 gene locus_tag LOCUS_17970 30549 30148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 30613 30978 gene locus_tag LOCUS_17980 gene folB 30613 30978 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227765.1 protein_id gnl|my_center|LOCUS_17980 31005 31436 gene locus_tag LOCUS_17990 gene folK 31005 31436 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 protein_id gnl|my_center|LOCUS_17990 32326 31403 gene locus_tag LOCUS_18000 32326 31403 CDS product DNA polymerase III subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888958.1 protein_id gnl|my_center|LOCUS_18000 33075 32323 gene locus_tag LOCUS_18010 33075 32323 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888957.1 protein_id gnl|my_center|LOCUS_18010 33116 33628 gene locus_tag LOCUS_18020 33116 33628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 33697 34740 gene locus_tag LOCUS_18030 gene hemW 33697 34740 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886778.1 protein_id gnl|my_center|LOCUS_18030 34873 35172 gene locus_tag LOCUS_18040 34873 35172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 35188 35928 gene locus_tag LOCUS_18050 35188 35928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 36278 35925 gene locus_tag LOCUS_18060 36278 35925 CDS product FUN14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926073.1 protein_id gnl|my_center|LOCUS_18060 36328 36909 gene locus_tag LOCUS_18070 36328 36909 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480180.1 protein_id gnl|my_center|LOCUS_18070 36896 38023 gene locus_tag LOCUS_18080 36896 38023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 38286 38002 gene locus_tag LOCUS_18090 38286 38002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 39203 38283 gene locus_tag LOCUS_18100 gene fba 39203 38283 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888228.1 protein_id gnl|my_center|LOCUS_18100 40672 39221 gene locus_tag LOCUS_18110 gene gatB 40672 39221 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480100.1 protein_id gnl|my_center|LOCUS_18110 41201 40755 gene locus_tag LOCUS_18120 41201 40755 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887264.1 protein_id gnl|my_center|LOCUS_18120 41260 41682 gene locus_tag LOCUS_18130 41260 41682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 41679 41870 gene locus_tag LOCUS_18140 41679 41870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479506.1 protein_id gnl|my_center|LOCUS_18140 42088 41858 gene locus_tag LOCUS_18150 42088 41858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 41993 42703 gene locus_tag LOCUS_18160 41993 42703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 42708 43676 gene locus_tag LOCUS_18170 gene pfkA 42708 43676 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887280.1 protein_id gnl|my_center|LOCUS_18170 43781 44797 gene locus_tag LOCUS_18180 gene galE 43781 44797 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929113.1 protein_id gnl|my_center|LOCUS_18180 44848 46284 gene locus_tag LOCUS_18190 44848 46284 CDS product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889294.1 protein_id gnl|my_center|LOCUS_18190 47075 46278 gene locus_tag LOCUS_18200 47075 46278 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245496.1 protein_id gnl|my_center|LOCUS_18200 47893 47075 gene locus_tag LOCUS_18210 47893 47075 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266510.1 protein_id gnl|my_center|LOCUS_18210 48932 48507 gene locus_tag LOCUS_18220 48932 48507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 50599 49313 gene locus_tag LOCUS_18230 50599 49313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 >Feature sequence19 2 325 gene locus_tag LOCUS_18240 2 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 352 852 gene locus_tag LOCUS_18250 352 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 1234 2883 gene locus_tag LOCUS_18260 1234 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 2961 4646 gene locus_tag LOCUS_18270 2961 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 4719 5681 gene locus_tag LOCUS_18280 4719 5681 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972807.1 protein_id gnl|my_center|LOCUS_18280 5681 6589 gene locus_tag LOCUS_18290 5681 6589 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972808.1 protein_id gnl|my_center|LOCUS_18290 6647 6868 gene locus_tag LOCUS_18300 6647 6868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 6927 7427 gene locus_tag LOCUS_18310 6927 7427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 7491 7940 gene locus_tag LOCUS_18320 7491 7940 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173597.1 protein_id gnl|my_center|LOCUS_18320 7937 9094 gene locus_tag LOCUS_18330 gene tgt 7937 9094 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350581.1 protein_id gnl|my_center|LOCUS_18330 9513 12548 gene locus_tag LOCUS_18340 9513 12548 CDS product S-layer homology domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228992.1 protein_id gnl|my_center|LOCUS_18340 12629 13333 gene locus_tag LOCUS_18350 12629 13333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 13333 14658 gene locus_tag LOCUS_18360 13333 14658 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584110.1 protein_id gnl|my_center|LOCUS_18360 14786 16153 gene locus_tag LOCUS_18370 14786 16153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 16150 17154 gene locus_tag LOCUS_18380 16150 17154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 17151 18356 gene locus_tag LOCUS_18390 17151 18356 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870666.1 protein_id gnl|my_center|LOCUS_18390 18353 21709 gene locus_tag LOCUS_18400 18353 21709 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228151.1 protein_id gnl|my_center|LOCUS_18400 22325 21741 gene locus_tag LOCUS_18410 gene plsY 22325 21741 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228511.1 protein_id gnl|my_center|LOCUS_18410 23495 22347 gene locus_tag LOCUS_18420 23495 22347 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229018.1 protein_id gnl|my_center|LOCUS_18420 24196 23492 gene locus_tag LOCUS_18430 24196 23492 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229019.1 protein_id gnl|my_center|LOCUS_18430 24301 24762 gene locus_tag LOCUS_18440 24301 24762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 25489 24773 gene locus_tag LOCUS_18450 25489 24773 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888749.1 protein_id gnl|my_center|LOCUS_18450 26247 25489 gene locus_tag LOCUS_18460 26247 25489 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618819.1 protein_id gnl|my_center|LOCUS_18460 27145 26231 gene locus_tag LOCUS_18470 27145 26231 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888751.1 protein_id gnl|my_center|LOCUS_18470 28095 27145 gene locus_tag LOCUS_18480 28095 27145 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479942.1 protein_id gnl|my_center|LOCUS_18480 29289 28102 gene locus_tag LOCUS_18490 29289 28102 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888753.1 protein_id gnl|my_center|LOCUS_18490 30562 29432 gene locus_tag LOCUS_18500 30562 29432 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480363.1 protein_id gnl|my_center|LOCUS_18500 30598 31092 gene locus_tag LOCUS_18510 gene ispF 30598 31092 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886876.1 protein_id gnl|my_center|LOCUS_18510 31283 33886 gene locus_tag LOCUS_18520 gene pulA 31283 33886 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082389.1 protein_id gnl|my_center|LOCUS_18520 33898 35262 gene locus_tag LOCUS_18530 33898 35262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 35316 37064 gene locus_tag LOCUS_18540 35316 37064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 37731 37234 gene locus_tag LOCUS_18550 37731 37234 CDS product DUF1572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 protein_id gnl|my_center|LOCUS_18550 38829 37777 gene locus_tag LOCUS_18560 38829 37777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 40213 38906 gene locus_tag LOCUS_18570 gene ffh 40213 38906 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888471.1 protein_id gnl|my_center|LOCUS_18570 42700 40238 gene locus_tag LOCUS_18580 42700 40238 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887024.1 protein_id gnl|my_center|LOCUS_18580 42950 43882 gene locus_tag LOCUS_18590 42950 43882 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973684.1 protein_id gnl|my_center|LOCUS_18590 44001 44741 gene locus_tag LOCUS_18600 44001 44741 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898651.1 protein_id gnl|my_center|LOCUS_18600 >Feature sequence20 39 2141 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggtccatccccacgtgcgtggggaacgc 2660 2585 gene locus_tag LOCUS_t00420 2660 2585 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3882 2698 gene locus_tag LOCUS_18610 3882 2698 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349521.1 protein_id gnl|my_center|LOCUS_18610 4604 3879 gene locus_tag LOCUS_18620 4604 3879 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230868.1 protein_id gnl|my_center|LOCUS_18620 5269 4601 gene locus_tag LOCUS_18630 5269 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18630 5416 6420 gene locus_tag LOCUS_18640 5416 6420 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173509960.1 protein_id gnl|my_center|LOCUS_18640 6420 8162 gene locus_tag LOCUS_18650 6420 8162 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812769.1 protein_id gnl|my_center|LOCUS_18650 8170 9216 gene locus_tag LOCUS_18660 8170 9216 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173056.1 protein_id gnl|my_center|LOCUS_18660 9213 10007 gene locus_tag LOCUS_18670 9213 10007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 10004 10180 gene locus_tag LOCUS_18680 10004 10180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 10247 11155 gene locus_tag LOCUS_18690 10247 11155 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978840.1 protein_id gnl|my_center|LOCUS_18690 12977 11526 gene locus_tag LOCUS_18700 12977 11526 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975886.1 protein_id gnl|my_center|LOCUS_18700 14359 12980 gene locus_tag LOCUS_18710 14359 12980 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227796.1 protein_id gnl|my_center|LOCUS_18710 15384 14359 gene locus_tag LOCUS_18720 15384 14359 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228309.1 protein_id gnl|my_center|LOCUS_18720 16442 15381 gene locus_tag LOCUS_18730 gene pdhA 16442 15381 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228310.1 protein_id gnl|my_center|LOCUS_18730 16845 17264 gene locus_tag LOCUS_18740 16845 17264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 17320 18912 gene locus_tag LOCUS_18750 17320 18912 CDS product PQQ-dependent methanol/ethanol family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895174.1 protein_id gnl|my_center|LOCUS_18750 18974 19642 gene locus_tag LOCUS_18760 18974 19642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 20138 19695 gene locus_tag LOCUS_18770 gene speD 20138 19695 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014510642.1 protein_id gnl|my_center|LOCUS_18770 20501 20857 gene locus_tag LOCUS_18780 gene sdhC 20501 20857 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887599.1 protein_id gnl|my_center|LOCUS_18780 20857 21255 gene locus_tag LOCUS_18790 20857 21255 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887598.1 protein_id gnl|my_center|LOCUS_18790 21291 23024 gene locus_tag LOCUS_18800 gene sdhA 21291 23024 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228694.1 protein_id gnl|my_center|LOCUS_18800 23034 23738 gene locus_tag LOCUS_18810 23034 23738 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177613.1 protein_id gnl|my_center|LOCUS_18810 24641 23739 gene locus_tag LOCUS_18820 24641 23739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 24880 25851 gene locus_tag LOCUS_18830 24880 25851 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366639.1 protein_id gnl|my_center|LOCUS_18830 25860 26339 gene locus_tag LOCUS_18840 25860 26339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 26355 27431 gene locus_tag LOCUS_18850 26355 27431 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889086.1 protein_id gnl|my_center|LOCUS_18850 28132 27428 gene locus_tag LOCUS_18860 gene hisA 28132 27428 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228483.1 protein_id gnl|my_center|LOCUS_18860 28267 29085 gene locus_tag LOCUS_18870 gene menB 28267 29085 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256004.1 protein_id gnl|my_center|LOCUS_18870 29030 30556 gene locus_tag LOCUS_18880 29030 30556 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256006.1 protein_id gnl|my_center|LOCUS_18880 30553 31842 gene locus_tag LOCUS_18890 gene pchA 30553 31842 CDS product isochorismate synthase PchA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114686.1 protein_id gnl|my_center|LOCUS_18890 31839 33539 gene locus_tag LOCUS_18900 gene menD 31839 33539 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259491.1 protein_id gnl|my_center|LOCUS_18900 33536 34351 gene locus_tag LOCUS_18910 gene menH 33536 34351 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255997.1 protein_id gnl|my_center|LOCUS_18910 35007 34921 gene locus_tag LOCUS_t00430 35007 34921 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 35242 35739 gene locus_tag LOCUS_18920 35242 35739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 35774 36166 gene locus_tag LOCUS_18930 35774 36166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 36163 36870 gene locus_tag LOCUS_18940 36163 36870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 36879 38192 gene locus_tag LOCUS_18950 36879 38192 CDS product pilus assembly PilX N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228526.1 protein_id gnl|my_center|LOCUS_18950 38451 39098 gene locus_tag LOCUS_18960 38451 39098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 39301 39675 gene locus_tag LOCUS_18970 gene rpsL 39301 39675 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886950.1 protein_id gnl|my_center|LOCUS_18970 39713 40183 gene locus_tag LOCUS_18980 gene rpsG 39713 40183 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886951.1 protein_id gnl|my_center|LOCUS_18980 40186 42270 gene locus_tag LOCUS_18990 gene fusA 40186 42270 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886952.1 protein_id gnl|my_center|LOCUS_18990 >Feature sequence21 1413 307 gene locus_tag LOCUS_19000 1413 307 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227840.1 protein_id gnl|my_center|LOCUS_19000 2066 1410 gene locus_tag LOCUS_19010 2066 1410 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889003.1 protein_id gnl|my_center|LOCUS_19010 2983 2063 gene locus_tag LOCUS_19020 2983 2063 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889319.1 protein_id gnl|my_center|LOCUS_19020 3280 3939 gene locus_tag LOCUS_19030 3280 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 3967 4701 gene locus_tag LOCUS_19040 3967 4701 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350944.1 protein_id gnl|my_center|LOCUS_19040 5732 4695 gene locus_tag LOCUS_19050 5732 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 6074 5799 gene locus_tag LOCUS_19060 6074 5799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 7333 6152 gene locus_tag LOCUS_19070 7333 6152 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350363.1 protein_id gnl|my_center|LOCUS_19070 7436 8665 gene locus_tag LOCUS_19080 7436 8665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 9142 8570 gene locus_tag LOCUS_19090 9142 8570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 10128 9205 gene locus_tag LOCUS_19100 10128 9205 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888164.1 protein_id gnl|my_center|LOCUS_19100 10855 10226 gene locus_tag LOCUS_19110 10855 10226 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888969.1 protein_id gnl|my_center|LOCUS_19110 11316 10855 gene locus_tag LOCUS_19120 gene argR 11316 10855 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479994.1 protein_id gnl|my_center|LOCUS_19120 12511 11324 gene locus_tag LOCUS_19130 gene coaBC 12511 11324 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228764.1 protein_id gnl|my_center|LOCUS_19130 12802 12518 gene locus_tag LOCUS_19140 gene rpoZ 12802 12518 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480122.1 protein_id gnl|my_center|LOCUS_19140 12881 13861 gene locus_tag LOCUS_19150 12881 13861 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252564.1 protein_id gnl|my_center|LOCUS_19150 13894 14904 gene locus_tag LOCUS_19160 gene gutB 13894 14904 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 protein_id gnl|my_center|LOCUS_19160 18852 14971 gene locus_tag LOCUS_19170 18852 14971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 20145 19123 gene locus_tag LOCUS_19180 20145 19123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 20620 20147 gene locus_tag LOCUS_19190 20620 20147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 21123 20650 gene locus_tag LOCUS_19200 21123 20650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19200 21596 21117 gene locus_tag LOCUS_19210 21596 21117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 22513 21710 gene locus_tag LOCUS_19220 22513 21710 CDS product [LysW]-aminoadipate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888059.1 protein_id gnl|my_center|LOCUS_19220 22551 23060 gene locus_tag LOCUS_19230 gene ruvC 22551 23060 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887085.1 protein_id gnl|my_center|LOCUS_19230 26225 23037 gene locus_tag LOCUS_19240 26225 23037 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028423.1 protein_id gnl|my_center|LOCUS_19240 26934 26260 gene locus_tag LOCUS_19250 gene moaD 26934 26260 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889231.1 protein_id gnl|my_center|LOCUS_19250 28459 26957 gene locus_tag LOCUS_19260 gene ilvA 28459 26957 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258444.1 protein_id gnl|my_center|LOCUS_19260 28944 28477 gene locus_tag LOCUS_19270 gene dps 28944 28477 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312098.1 protein_id gnl|my_center|LOCUS_19270 30369 29620 gene locus_tag LOCUS_19280 30369 29620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 31125 30376 gene locus_tag LOCUS_19290 31125 30376 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530528.1 protein_id gnl|my_center|LOCUS_19290 >Feature sequence22 474 1439 gene locus_tag LOCUS_19300 474 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 1799 1470 gene locus_tag LOCUS_19310 1799 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 3203 2721 gene locus_tag LOCUS_19320 3203 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 3524 5563 gene locus_tag LOCUS_19330 3524 5563 CDS product prolyl oligopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889128.1 protein_id gnl|my_center|LOCUS_19330 5987 6430 gene locus_tag LOCUS_19340 5987 6430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 7962 6754 gene locus_tag LOCUS_19350 7962 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 8045 9511 gene locus_tag LOCUS_19360 gene cysS 8045 9511 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479901.1 protein_id gnl|my_center|LOCUS_19360 10152 9499 gene locus_tag LOCUS_19370 10152 9499 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355190.1 protein_id gnl|my_center|LOCUS_19370 10216 11484 gene locus_tag LOCUS_19380 10216 11484 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888648.1 protein_id gnl|my_center|LOCUS_19380 11508 12584 gene locus_tag LOCUS_19390 11508 12584 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871885.1 protein_id gnl|my_center|LOCUS_19390 12639 13529 gene locus_tag LOCUS_19400 12639 13529 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_19400 14745 13543 gene locus_tag LOCUS_19410 14745 13543 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119310.1 protein_id gnl|my_center|LOCUS_19410 14873 15604 gene locus_tag LOCUS_19420 14873 15604 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727258.1 protein_id gnl|my_center|LOCUS_19420 15729 17297 gene locus_tag LOCUS_19430 15729 17297 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583223.1 protein_id gnl|my_center|LOCUS_19430 17298 18296 gene locus_tag LOCUS_19440 17298 18296 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948861.1 protein_id gnl|my_center|LOCUS_19440 18307 19200 gene locus_tag LOCUS_19450 18307 19200 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047036674.1 protein_id gnl|my_center|LOCUS_19450 19213 20139 gene locus_tag LOCUS_19460 19213 20139 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804461.1 protein_id gnl|my_center|LOCUS_19460 20614 21435 gene locus_tag LOCUS_19470 20614 21435 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014630030.1 protein_id gnl|my_center|LOCUS_19470 21432 23003 gene locus_tag LOCUS_19480 21432 23003 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_19480 23032 23979 gene locus_tag LOCUS_19490 23032 23979 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258638.1 protein_id gnl|my_center|LOCUS_19490 23972 24853 gene locus_tag LOCUS_19500 23972 24853 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939732.1 protein_id gnl|my_center|LOCUS_19500 24998 26206 gene locus_tag LOCUS_19510 24998 26206 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861718.1 protein_id gnl|my_center|LOCUS_19510 26208 27065 gene locus_tag LOCUS_19520 26208 27065 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384269.1 protein_id gnl|my_center|LOCUS_19520 28177 27176 gene locus_tag LOCUS_19530 28177 27176 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223743.1 protein_id gnl|my_center|LOCUS_19530 >Feature sequence23 1824 628 gene locus_tag LOCUS_19540 1824 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 2959 2078 gene locus_tag LOCUS_19550 2959 2078 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776904.1 protein_id gnl|my_center|LOCUS_19550 3883 2969 gene locus_tag LOCUS_19560 3883 2969 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975883.1 protein_id gnl|my_center|LOCUS_19560 5262 3967 gene locus_tag LOCUS_19570 5262 3967 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975884.1 protein_id gnl|my_center|LOCUS_19570 7185 5329 gene locus_tag LOCUS_19580 7185 5329 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229244.1 protein_id gnl|my_center|LOCUS_19580 7394 8356 gene locus_tag LOCUS_19590 7394 8356 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970438.1 protein_id gnl|my_center|LOCUS_19590 8467 9657 gene locus_tag LOCUS_19600 8467 9657 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222508.1 protein_id gnl|my_center|LOCUS_19600 10076 9624 gene locus_tag LOCUS_19610 10076 9624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 12616 10073 gene locus_tag LOCUS_19620 12616 10073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 14406 12661 gene locus_tag LOCUS_19630 14406 12661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018111959.1 protein_id gnl|my_center|LOCUS_19630 15074 14406 gene locus_tag LOCUS_19640 15074 14406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 15203 16387 gene locus_tag LOCUS_19650 15203 16387 CDS product BioF/Kbl family PLP-dependent acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618850.1 protein_id gnl|my_center|LOCUS_19650 16422 18239 gene locus_tag LOCUS_19660 16422 18239 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350387.1 protein_id gnl|my_center|LOCUS_19660 19340 18258 gene locus_tag LOCUS_19670 gene cobT 19340 18258 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889499.1 protein_id gnl|my_center|LOCUS_19670 19852 19337 gene locus_tag LOCUS_19680 19852 19337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19680 21264 19846 gene locus_tag LOCUS_19690 21264 19846 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012695322.1 protein_id gnl|my_center|LOCUS_19690 22234 21251 gene locus_tag LOCUS_19700 22234 21251 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883990.1 protein_id gnl|my_center|LOCUS_19700 23162 22227 gene locus_tag LOCUS_19710 gene cbiB 23162 22227 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351275.1 protein_id gnl|my_center|LOCUS_19710 23799 23152 gene locus_tag LOCUS_19720 gene bluB 23799 23152 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631426.1 protein_id gnl|my_center|LOCUS_19720 24425 23799 gene locus_tag LOCUS_19730 gene cobO 24425 23799 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081799310.1 protein_id gnl|my_center|LOCUS_19730 25015 24467 gene locus_tag LOCUS_19740 25015 24467 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229232.1 protein_id gnl|my_center|LOCUS_19740 25727 25005 gene locus_tag LOCUS_19750 25727 25005 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889498.1 protein_id gnl|my_center|LOCUS_19750 25774 26793 gene locus_tag LOCUS_19760 25774 26793 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349607.1 protein_id gnl|my_center|LOCUS_19760 27548 26790 gene locus_tag LOCUS_19770 27548 26790 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888014.1 protein_id gnl|my_center|LOCUS_19770 >Feature sequence24 297 482 gene locus_tag LOCUS_19780 297 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 874 1101 gene locus_tag LOCUS_19790 874 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 1061 1384 gene locus_tag LOCUS_19800 1061 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 1553 2170 gene locus_tag LOCUS_19810 1553 2170 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990775.1 protein_id gnl|my_center|LOCUS_19810 2357 2683 gene locus_tag LOCUS_19820 2357 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19820 4153 3005 gene locus_tag LOCUS_19830 4153 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 5882 4449 gene locus_tag LOCUS_19840 5882 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 5857 5994 gene locus_tag LOCUS_19850 5857 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 6009 6161 gene locus_tag LOCUS_19860 6009 6161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 7150 6281 gene locus_tag LOCUS_19870 7150 6281 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528576.1 protein_id gnl|my_center|LOCUS_19870 8239 7157 gene locus_tag LOCUS_19880 8239 7157 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963509.1 protein_id gnl|my_center|LOCUS_19880 9531 8236 gene locus_tag LOCUS_19890 9531 8236 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525207.1 protein_id gnl|my_center|LOCUS_19890 10450 9617 gene locus_tag LOCUS_19900 10450 9617 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385216.1 protein_id gnl|my_center|LOCUS_19900 11382 10450 gene locus_tag LOCUS_19910 11382 10450 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385217.1 protein_id gnl|my_center|LOCUS_19910 12233 11379 gene locus_tag LOCUS_19920 gene murQ 12233 11379 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889472.1 protein_id gnl|my_center|LOCUS_19920 13195 12230 gene locus_tag LOCUS_19930 13195 12230 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889475.1 protein_id gnl|my_center|LOCUS_19930 13373 14110 gene locus_tag LOCUS_19940 13373 14110 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639963.1 protein_id gnl|my_center|LOCUS_19940 15540 14542 gene locus_tag LOCUS_19950 15540 14542 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039254.1 protein_id gnl|my_center|LOCUS_19950 16679 15537 gene locus_tag LOCUS_19960 16679 15537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 17510 16989 gene locus_tag LOCUS_19970 17510 16989 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082252685.1 protein_id gnl|my_center|LOCUS_19970 18436 18233 gene locus_tag LOCUS_19980 18436 18233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 19031 19981 gene locus_tag LOCUS_19990 19031 19981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 20265 20522 gene locus_tag LOCUS_20000 20265 20522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 22609 21029 gene locus_tag LOCUS_20010 22609 21029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 23782 22685 gene locus_tag LOCUS_20020 23782 22685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 25955 23691 gene locus_tag LOCUS_20030 25955 23691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20030 >Feature sequence25 2181 1306 gene locus_tag LOCUS_20040 2181 1306 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090157.1 protein_id gnl|my_center|LOCUS_20040 3428 2190 gene locus_tag LOCUS_20050 3428 2190 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618783.1 protein_id gnl|my_center|LOCUS_20050 3467 3552 gene locus_tag LOCUS_t00440 3467 3552 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6115 3557 gene locus_tag LOCUS_20060 gene clpB 6115 3557 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479647.1 protein_id gnl|my_center|LOCUS_20060 6258 7112 gene locus_tag LOCUS_20070 6258 7112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 7112 7729 gene locus_tag LOCUS_20080 7112 7729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 8255 10123 gene locus_tag LOCUS_20090 8255 10123 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968009.1 protein_id gnl|my_center|LOCUS_20090 11269 10223 gene locus_tag LOCUS_20100 11269 10223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 11495 11277 gene locus_tag LOCUS_20110 11495 11277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 12505 11549 gene locus_tag LOCUS_20120 12505 11549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 13395 12643 gene locus_tag LOCUS_20130 13395 12643 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 protein_id gnl|my_center|LOCUS_20130 14020 13469 gene locus_tag LOCUS_20140 14020 13469 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262936.1 protein_id gnl|my_center|LOCUS_20140 14783 14082 gene locus_tag LOCUS_20150 14783 14082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028978.1 protein_id gnl|my_center|LOCUS_20150 15312 14788 gene locus_tag LOCUS_20160 15312 14788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 16289 18613 gene locus_tag LOCUS_20170 16289 18613 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388583.1 protein_id gnl|my_center|LOCUS_20170 18640 19383 gene locus_tag LOCUS_20180 gene cas5c 18640 19383 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392034.1 protein_id gnl|my_center|LOCUS_20180 19383 21290 gene locus_tag LOCUS_20190 19383 21290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 21355 22344 gene locus_tag LOCUS_20200 gene cas7c 21355 22344 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070169.1 protein_id gnl|my_center|LOCUS_20200 22540 23148 gene locus_tag LOCUS_20210 gene cas4 22540 23148 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392031.1 protein_id gnl|my_center|LOCUS_20210 24183 24479 gene locus_tag LOCUS_20220 gene cas2 24183 24479 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392029.1 protein_id gnl|my_center|LOCUS_20220 24720 25190 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgcacccgaccctcgggccgggtgaggattgaaac >Feature sequence26 1856 573 gene locus_tag LOCUS_20230 1856 573 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889381.1 protein_id gnl|my_center|LOCUS_20230 3432 1858 gene locus_tag LOCUS_20240 3432 1858 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889290.1 protein_id gnl|my_center|LOCUS_20240 3941 3429 gene locus_tag LOCUS_20250 3941 3429 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480176.1 protein_id gnl|my_center|LOCUS_20250 4130 5497 gene locus_tag LOCUS_20260 4130 5497 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479718.1 protein_id gnl|my_center|LOCUS_20260 5494 6855 gene locus_tag LOCUS_20270 5494 6855 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889289.1 protein_id gnl|my_center|LOCUS_20270 7271 6948 gene locus_tag LOCUS_20280 7271 6948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 7732 7268 gene locus_tag LOCUS_20290 gene ybeY 7732 7268 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479950.1 protein_id gnl|my_center|LOCUS_20290 8649 7729 gene locus_tag LOCUS_20300 8649 7729 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871086.1 protein_id gnl|my_center|LOCUS_20300 9583 8765 gene locus_tag LOCUS_20310 9583 8765 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889229.1 protein_id gnl|my_center|LOCUS_20310 10218 9580 gene locus_tag LOCUS_20320 gene ispD 10218 9580 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889228.1 protein_id gnl|my_center|LOCUS_20320 10330 10839 gene locus_tag LOCUS_20330 10330 10839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 10852 11616 gene locus_tag LOCUS_20340 10852 11616 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174274.1 protein_id gnl|my_center|LOCUS_20340 11665 13443 gene locus_tag LOCUS_20350 11665 13443 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111158892.1 protein_id gnl|my_center|LOCUS_20350 14376 13828 gene locus_tag LOCUS_20360 14376 13828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 15202 14465 gene locus_tag LOCUS_20370 15202 14465 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228741.1 protein_id gnl|my_center|LOCUS_20370 15837 17498 gene locus_tag LOCUS_20380 15837 17498 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257035.1 protein_id gnl|my_center|LOCUS_20380 17746 17964 gene locus_tag LOCUS_20390 17746 17964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 18085 18507 gene locus_tag LOCUS_20400 18085 18507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 19967 18477 gene locus_tag LOCUS_20410 19967 18477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144052.1 protein_id gnl|my_center|LOCUS_20410 >Feature sequence27 762 2471 gene locus_tag LOCUS_20420 gene hutU 762 2471 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889411.1 protein_id gnl|my_center|LOCUS_20420 2468 3388 gene locus_tag LOCUS_20430 2468 3388 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889409.1 protein_id gnl|my_center|LOCUS_20430 3385 4575 gene locus_tag LOCUS_20440 gene hutI 3385 4575 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889408.1 protein_id gnl|my_center|LOCUS_20440 4581 6101 gene locus_tag LOCUS_20450 gene hutH 4581 6101 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889407.1 protein_id gnl|my_center|LOCUS_20450 6127 7242 gene locus_tag LOCUS_20460 gene wecB 6127 7242 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119483.1 protein_id gnl|my_center|LOCUS_20460 11824 7250 gene locus_tag LOCUS_20470 gene rpoC 11824 7250 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887556.1 protein_id gnl|my_center|LOCUS_20470 15317 11868 gene locus_tag LOCUS_20480 15317 11868 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479684.1 protein_id gnl|my_center|LOCUS_20480 15944 15576 gene locus_tag LOCUS_20490 gene rplL 15944 15576 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888675.1 protein_id gnl|my_center|LOCUS_20490 16447 15959 gene locus_tag LOCUS_20500 gene rplJ 16447 15959 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888676.1 protein_id gnl|my_center|LOCUS_20500 17240 16560 gene locus_tag LOCUS_20510 gene rplA 17240 16560 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888677.1 protein_id gnl|my_center|LOCUS_20510 17667 17233 gene locus_tag LOCUS_20520 gene rplK 17667 17233 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888678.1 protein_id gnl|my_center|LOCUS_20520 18308 17739 gene locus_tag LOCUS_20530 gene nusG 18308 17739 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888679.1 protein_id gnl|my_center|LOCUS_20530 18490 18305 gene locus_tag LOCUS_20540 gene secE 18490 18305 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630510.1 protein_id gnl|my_center|LOCUS_20540 18657 18490 gene locus_tag LOCUS_20550 gene rpmG 18657 18490 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888681.1 protein_id gnl|my_center|LOCUS_20550 >Feature sequence28 308 232 gene locus_tag LOCUS_t00450 308 232 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 409 320 gene locus_tag LOCUS_t00460 409 320 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 514 427 gene locus_tag LOCUS_t00470 514 427 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1771 620 gene locus_tag LOCUS_20560 1771 620 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189088205.1 protein_id gnl|my_center|LOCUS_20560 1906 2292 gene locus_tag LOCUS_20570 1906 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 3233 2256 gene locus_tag LOCUS_20580 gene meaB 3233 2256 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227730.1 protein_id gnl|my_center|LOCUS_20580 3645 3259 gene locus_tag LOCUS_20590 gene crcB 3645 3259 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392062.1 protein_id gnl|my_center|LOCUS_20590 4407 3700 gene locus_tag LOCUS_20600 4407 3700 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888032.1 protein_id gnl|my_center|LOCUS_20600 5432 4404 gene locus_tag LOCUS_20610 gene purM 5432 4404 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177712.1 protein_id gnl|my_center|LOCUS_20610 5726 6694 gene locus_tag LOCUS_20620 gene crtE 5726 6694 CDS product geranylgeranyl diphosphate synthase CrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888034.1 protein_id gnl|my_center|LOCUS_20620 6795 9695 gene locus_tag LOCUS_20630 6795 9695 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389558.1 protein_id gnl|my_center|LOCUS_20630 9747 10673 gene locus_tag LOCUS_20640 9747 10673 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889201.1 protein_id gnl|my_center|LOCUS_20640 10674 11918 gene locus_tag LOCUS_20650 10674 11918 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152423784.1 protein_id gnl|my_center|LOCUS_20650 12006 13217 gene locus_tag LOCUS_20660 12006 13217 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228265.1 protein_id gnl|my_center|LOCUS_20660 14402 13182 gene locus_tag LOCUS_20670 14402 13182 CDS product lipid-A-disaccharide synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889249.1 protein_id gnl|my_center|LOCUS_20670 14976 14386 gene locus_tag LOCUS_20680 14976 14386 CDS product ADP-ribosylation factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887499.1 protein_id gnl|my_center|LOCUS_20680 15467 14973 gene locus_tag LOCUS_20690 15467 14973 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887500.1 protein_id gnl|my_center|LOCUS_20690 15542 17260 gene locus_tag LOCUS_20700 15542 17260 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618866.1 protein_id gnl|my_center|LOCUS_20700 >Feature sequence29 40 373 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcgttccccacgcacgtggggatggaccg 779 465 gene locus_tag LOCUS_20710 779 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 1776 820 gene locus_tag LOCUS_20720 gene cas1e 1776 820 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229111.1 protein_id gnl|my_center|LOCUS_20720 2275 1793 gene locus_tag LOCUS_20730 2275 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 3104 2427 gene locus_tag LOCUS_20740 gene cas5e 3104 2427 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229113.1 protein_id gnl|my_center|LOCUS_20740 4272 3106 gene locus_tag LOCUS_20750 gene cas7e 4272 3106 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229114.1 protein_id gnl|my_center|LOCUS_20750 4898 4290 gene locus_tag LOCUS_20760 gene casB 4898 4290 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229115.1 protein_id gnl|my_center|LOCUS_20760 6514 4895 gene locus_tag LOCUS_20770 gene casA 6514 4895 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229116.1 protein_id gnl|my_center|LOCUS_20770 8943 6775 gene locus_tag LOCUS_20780 8943 6775 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229117.1 protein_id gnl|my_center|LOCUS_20780 10927 10094 gene locus_tag LOCUS_20790 10927 10094 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888626.1 protein_id gnl|my_center|LOCUS_20790 11835 10924 gene locus_tag LOCUS_20800 11835 10924 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888673.1 protein_id gnl|my_center|LOCUS_20800 13281 11836 gene locus_tag LOCUS_20810 13281 11836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 13326 14096 gene locus_tag LOCUS_20820 13326 14096 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887106.1 protein_id gnl|my_center|LOCUS_20820 14161 15270 gene locus_tag LOCUS_20830 gene dnaJ 14161 15270 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927968.1 protein_id gnl|my_center|LOCUS_20830 15455 16327 gene locus_tag LOCUS_20840 15455 16327 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187767767.1 protein_id gnl|my_center|LOCUS_20840 >Feature sequence30 720 4 gene locus_tag LOCUS_20850 gene bshB1 720 4 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888991.1 protein_id gnl|my_center|LOCUS_20850 2457 1033 gene locus_tag LOCUS_20860 2457 1033 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349984.1 protein_id gnl|my_center|LOCUS_20860 3348 2473 gene locus_tag LOCUS_20870 3348 2473 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975209.1 protein_id gnl|my_center|LOCUS_20870 4277 3345 gene locus_tag LOCUS_20880 4277 3345 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401253.1 protein_id gnl|my_center|LOCUS_20880 5623 4349 gene locus_tag LOCUS_20890 5623 4349 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888077.1 protein_id gnl|my_center|LOCUS_20890 5998 5780 gene locus_tag LOCUS_20900 gene xseB 5998 5780 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350868.1 protein_id gnl|my_center|LOCUS_20900 7179 5995 gene locus_tag LOCUS_20910 gene xseA 7179 5995 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886832.1 protein_id gnl|my_center|LOCUS_20910 >Feature sequence31 2777 864 gene locus_tag LOCUS_20920 gene rqkA 2777 864 CDS product DNA damage-responsive serine/threonine-protein kinase RqkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889143.1 protein_id gnl|my_center|LOCUS_20920 4698 2770 gene locus_tag LOCUS_20930 4698 2770 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887578.1 protein_id gnl|my_center|LOCUS_20930 4750 6207 gene locus_tag LOCUS_20940 gene proS 4750 6207 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887909.1 protein_id gnl|my_center|LOCUS_20940 >Feature sequence32 2537 753 gene locus_tag LOCUS_20950 gene typA 2537 753 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887841.1 protein_id gnl|my_center|LOCUS_20950 2646 3521 gene locus_tag LOCUS_20960 2646 3521 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228998.1 protein_id gnl|my_center|LOCUS_20960