>Feature sequence001 2342 1923 gene locus_tag LOCUS_00010 2342 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2959 2354 gene locus_tag LOCUS_00020 2959 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3241 2978 gene locus_tag LOCUS_00030 3241 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3432 3235 gene locus_tag LOCUS_00040 3432 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3657 3445 gene locus_tag LOCUS_00050 3657 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4930 3650 gene locus_tag LOCUS_00060 gene xseA 4930 3650 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886832.1 protein_id gnl|my_center|LOCUS_00060 5687 4977 gene locus_tag LOCUS_00070 5687 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6109 5684 gene locus_tag LOCUS_00080 6109 5684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 7114 6158 gene locus_tag LOCUS_00090 7114 6158 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339629.1 protein_id gnl|my_center|LOCUS_00090 7941 7153 gene locus_tag LOCUS_00100 7941 7153 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529074.1 protein_id gnl|my_center|LOCUS_00100 8222 7962 gene locus_tag LOCUS_00110 8222 7962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 8858 8295 gene locus_tag LOCUS_00120 8858 8295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 9467 9057 gene locus_tag LOCUS_00130 9467 9057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 9720 9484 gene locus_tag LOCUS_00140 9720 9484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 9886 10530 gene locus_tag LOCUS_00150 9886 10530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 11122 10454 gene locus_tag LOCUS_00160 gene tmk 11122 10454 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546833.1 protein_id gnl|my_center|LOCUS_00160 12370 11228 gene locus_tag LOCUS_00170 12370 11228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 12757 12419 gene locus_tag LOCUS_00180 12757 12419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 13176 12829 gene locus_tag LOCUS_00190 13176 12829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 13950 13207 gene locus_tag LOCUS_00200 13950 13207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 14235 14044 gene locus_tag LOCUS_00210 14235 14044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 14717 14322 gene locus_tag LOCUS_00220 14717 14322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 15504 14743 gene locus_tag LOCUS_00230 15504 14743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 15651 16391 gene locus_tag LOCUS_00240 15651 16391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 17498 16530 gene locus_tag LOCUS_00250 17498 16530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 18241 17510 gene locus_tag LOCUS_00260 18241 17510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 20455 18836 gene locus_tag LOCUS_00270 20455 18836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 21042 20539 gene locus_tag LOCUS_00280 21042 20539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 21536 21054 gene locus_tag LOCUS_00290 21536 21054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 22198 21587 gene locus_tag LOCUS_00300 22198 21587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 22781 22215 gene locus_tag LOCUS_00310 22781 22215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 22944 22795 gene locus_tag LOCUS_00320 22944 22795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 23625 23269 gene locus_tag LOCUS_00330 23625 23269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 24156 23686 gene locus_tag LOCUS_00340 24156 23686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 24688 24158 gene locus_tag LOCUS_00350 24688 24158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 25180 24809 gene locus_tag LOCUS_00360 25180 24809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 25524 25177 gene locus_tag LOCUS_00370 25524 25177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 26575 25526 gene locus_tag LOCUS_00380 26575 25526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 27195 26584 gene locus_tag LOCUS_00390 27195 26584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 27358 27209 gene locus_tag LOCUS_00400 27358 27209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 27938 27420 gene locus_tag LOCUS_00410 27938 27420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 29407 27935 gene locus_tag LOCUS_00420 29407 27935 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072910.1 protein_id gnl|my_center|LOCUS_00420 30774 29404 gene locus_tag LOCUS_00430 30774 29404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 31303 30968 gene locus_tag LOCUS_00440 31303 30968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 31775 31470 gene locus_tag LOCUS_00450 31775 31470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 32502 31996 gene locus_tag LOCUS_00460 32502 31996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 33089 32817 gene locus_tag LOCUS_00470 33089 32817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 33403 33086 gene locus_tag LOCUS_00480 33403 33086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 33795 33643 gene locus_tag LOCUS_00490 33795 33643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 34448 33795 gene locus_tag LOCUS_00500 34448 33795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 35468 34527 gene locus_tag LOCUS_00510 35468 34527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 37906 36338 gene locus_tag LOCUS_00520 37906 36338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 38835 37918 gene locus_tag LOCUS_00530 38835 37918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 38816 38998 gene locus_tag LOCUS_00540 38816 38998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 39678 39043 gene locus_tag LOCUS_00550 39678 39043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 40229 39675 gene locus_tag LOCUS_00560 40229 39675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 41432 40248 gene locus_tag LOCUS_00570 41432 40248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 41752 41486 gene locus_tag LOCUS_00580 41752 41486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 42551 41919 gene locus_tag LOCUS_00590 42551 41919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 43124 42780 gene locus_tag LOCUS_00600 43124 42780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 43900 43142 gene locus_tag LOCUS_00610 43900 43142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 44111 43893 gene locus_tag LOCUS_00620 44111 43893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 44722 44108 gene locus_tag LOCUS_00630 44722 44108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 45553 44837 gene locus_tag LOCUS_00640 45553 44837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 45741 45553 gene locus_tag LOCUS_00650 45741 45553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 46001 45738 gene locus_tag LOCUS_00660 46001 45738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 46978 46070 gene locus_tag LOCUS_00670 46978 46070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942797.1 protein_id gnl|my_center|LOCUS_00670 47124 48089 gene locus_tag LOCUS_00680 47124 48089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 48070 49107 gene locus_tag LOCUS_00690 48070 49107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 49104 50690 gene locus_tag LOCUS_00700 49104 50690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 50814 52451 gene locus_tag LOCUS_00710 50814 52451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 52468 52971 gene locus_tag LOCUS_00720 52468 52971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 52992 54044 gene locus_tag LOCUS_00730 52992 54044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 54050 54529 gene locus_tag LOCUS_00740 54050 54529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 54676 55962 gene locus_tag LOCUS_00750 54676 55962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 55872 56504 gene locus_tag LOCUS_00760 55872 56504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 56501 56986 gene locus_tag LOCUS_00770 56501 56986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 57000 57410 gene locus_tag LOCUS_00780 57000 57410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 57457 59607 gene locus_tag LOCUS_00790 gene dinG 57457 59607 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071940.1 protein_id gnl|my_center|LOCUS_00790 59788 60147 gene locus_tag LOCUS_00800 59788 60147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 60523 62745 gene locus_tag LOCUS_00810 60523 62745 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545329.1 protein_id gnl|my_center|LOCUS_00810 >Feature sequence002 842 2080 gene locus_tag LOCUS_00820 gene waaC 842 2080 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_00820 2098 3186 gene locus_tag LOCUS_00830 gene waaC 2098 3186 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_00830 3183 4214 gene locus_tag LOCUS_00840 gene waaF 3183 4214 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_00840 4205 4822 gene locus_tag LOCUS_00850 4205 4822 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391311.1 protein_id gnl|my_center|LOCUS_00850 5426 5031 gene locus_tag LOCUS_00860 5426 5031 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970565.1 protein_id gnl|my_center|LOCUS_00860 5668 5423 gene locus_tag LOCUS_00870 5668 5423 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529937.1 protein_id gnl|my_center|LOCUS_00870 5975 6166 gene locus_tag LOCUS_00880 5975 6166 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937959.1 protein_id gnl|my_center|LOCUS_00880 6232 7233 gene locus_tag LOCUS_00890 6232 7233 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938297.1 protein_id gnl|my_center|LOCUS_00890 7235 8263 gene locus_tag LOCUS_00900 7235 8263 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532810.1 protein_id gnl|my_center|LOCUS_00900 8260 8988 gene locus_tag LOCUS_00910 8260 8988 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064011.1 protein_id gnl|my_center|LOCUS_00910 8985 10160 gene locus_tag LOCUS_00920 8985 10160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 10187 10498 gene locus_tag LOCUS_00930 10187 10498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 12121 10775 gene locus_tag LOCUS_00940 12121 10775 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038711081.1 protein_id gnl|my_center|LOCUS_00940 12315 13895 gene locus_tag LOCUS_00950 gene cydA 12315 13895 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979005.1 protein_id gnl|my_center|LOCUS_00950 13911 15050 gene locus_tag LOCUS_00960 gene cydB 13911 15050 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568274.1 protein_id gnl|my_center|LOCUS_00960 15076 15213 gene locus_tag LOCUS_00970 15076 15213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 15289 16566 gene locus_tag LOCUS_00980 15289 16566 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724487.1 protein_id gnl|my_center|LOCUS_00980 17253 16849 gene locus_tag LOCUS_00990 17253 16849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 18290 17403 gene locus_tag LOCUS_01000 18290 17403 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388335.1 protein_id gnl|my_center|LOCUS_01000 19144 18287 gene locus_tag LOCUS_01010 19144 18287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 19550 19215 gene locus_tag LOCUS_01020 19550 19215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 20270 19713 gene locus_tag LOCUS_01030 20270 19713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 21652 20267 gene locus_tag LOCUS_01040 gene bioA 21652 20267 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942227.1 protein_id gnl|my_center|LOCUS_01040 21710 22519 gene locus_tag LOCUS_01050 21710 22519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 22582 23832 gene locus_tag LOCUS_01060 22582 23832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 23856 24890 gene locus_tag LOCUS_01070 23856 24890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 24887 25573 gene locus_tag LOCUS_01080 24887 25573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01080 25599 26087 gene locus_tag LOCUS_01090 gene ispF 25599 26087 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098560.1 protein_id gnl|my_center|LOCUS_01090 26084 26815 gene locus_tag LOCUS_01100 gene cysE 26084 26815 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069591551.1 protein_id gnl|my_center|LOCUS_01100 26812 27378 gene locus_tag LOCUS_01110 26812 27378 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931701.1 protein_id gnl|my_center|LOCUS_01110 27375 28943 gene locus_tag LOCUS_01120 27375 28943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 28953 30188 gene locus_tag LOCUS_01130 gene waaC 28953 30188 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095779.1 protein_id gnl|my_center|LOCUS_01130 30185 31018 gene locus_tag LOCUS_01140 30185 31018 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404707.1 protein_id gnl|my_center|LOCUS_01140 31015 32547 gene locus_tag LOCUS_01150 31015 32547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 32656 34230 gene locus_tag LOCUS_01160 gene purH 32656 34230 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244516.1 protein_id gnl|my_center|LOCUS_01160 34268 35539 gene locus_tag LOCUS_01170 gene purD 34268 35539 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230794.1 protein_id gnl|my_center|LOCUS_01170 35549 36160 gene locus_tag LOCUS_01180 35549 36160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 36417 37277 gene locus_tag LOCUS_01190 36417 37277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 38758 37385 gene locus_tag LOCUS_01200 gene ccoN 38758 37385 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087322.1 protein_id gnl|my_center|LOCUS_01200 39648 38950 gene locus_tag LOCUS_01210 gene radC 39648 38950 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021974.1 protein_id gnl|my_center|LOCUS_01210 40417 39758 gene locus_tag LOCUS_01220 40417 39758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 41121 40414 gene locus_tag LOCUS_01230 41121 40414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 42727 41114 gene locus_tag LOCUS_01240 42727 41114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 43559 42852 gene locus_tag LOCUS_01250 43559 42852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 43699 44796 gene locus_tag LOCUS_01260 43699 44796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 45944 44679 gene locus_tag LOCUS_01270 45944 44679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 46185 46724 gene locus_tag LOCUS_01280 46185 46724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 >Feature sequence003 5355 223 gene locus_tag LOCUS_01290 5355 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 5718 6215 gene locus_tag LOCUS_01300 5718 6215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 6924 6664 gene locus_tag LOCUS_01310 6924 6664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 6873 7940 gene locus_tag LOCUS_01320 6873 7940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 7963 8652 gene locus_tag LOCUS_01330 7963 8652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 8762 9271 gene locus_tag LOCUS_01340 8762 9271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 9268 9891 gene locus_tag LOCUS_01350 9268 9891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 9950 10174 gene locus_tag LOCUS_01360 9950 10174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 10180 11166 gene locus_tag LOCUS_01370 10180 11166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 11375 12490 gene locus_tag LOCUS_01380 11375 12490 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626585.1 protein_id gnl|my_center|LOCUS_01380 13643 12516 gene locus_tag LOCUS_01390 13643 12516 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943777.1 protein_id gnl|my_center|LOCUS_01390 14888 13749 gene locus_tag LOCUS_01400 14888 13749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 15838 14885 gene locus_tag LOCUS_01410 15838 14885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 16878 15835 gene locus_tag LOCUS_01420 16878 15835 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942134.1 protein_id gnl|my_center|LOCUS_01420 17807 16878 gene locus_tag LOCUS_01430 17807 16878 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142176.1 protein_id gnl|my_center|LOCUS_01430 19543 17858 gene locus_tag LOCUS_01440 gene ilvD 19543 17858 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880508.1 protein_id gnl|my_center|LOCUS_01440 19723 20232 gene locus_tag LOCUS_01450 19723 20232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 21431 20709 gene locus_tag LOCUS_01460 gene sfsA 21431 20709 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943351.1 protein_id gnl|my_center|LOCUS_01460 21465 21857 gene locus_tag LOCUS_01470 21465 21857 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813393.1 protein_id gnl|my_center|LOCUS_01470 23155 21818 gene locus_tag LOCUS_01480 23155 21818 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_01480 23257 24396 gene locus_tag LOCUS_01490 gene thiO 23257 24396 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333314.1 protein_id gnl|my_center|LOCUS_01490 24411 25118 gene locus_tag LOCUS_01500 24411 25118 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976828.1 protein_id gnl|my_center|LOCUS_01500 25283 27721 gene locus_tag LOCUS_01510 25283 27721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 27973 28293 gene locus_tag LOCUS_01520 27973 28293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 28307 29011 gene locus_tag LOCUS_01530 28307 29011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 30466 29168 gene locus_tag LOCUS_01540 30466 29168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 30760 30566 gene locus_tag LOCUS_01550 30760 30566 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227652.1 protein_id gnl|my_center|LOCUS_01550 31531 31755 gene locus_tag LOCUS_01560 31531 31755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 32296 31880 gene locus_tag LOCUS_01570 32296 31880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 33050 32463 gene locus_tag LOCUS_01580 33050 32463 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031813.1 protein_id gnl|my_center|LOCUS_01580 34584 33739 gene locus_tag LOCUS_01590 34584 33739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 35476 34748 gene locus_tag LOCUS_01600 gene rlmB 35476 34748 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869599.1 protein_id gnl|my_center|LOCUS_01600 36978 35494 gene locus_tag LOCUS_01610 gene cysS 36978 35494 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943976.1 protein_id gnl|my_center|LOCUS_01610 37811 36975 gene locus_tag LOCUS_01620 gene surE 37811 36975 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942170.1 protein_id gnl|my_center|LOCUS_01620 38075 37999 gene locus_tag LOCUS_t00010 38075 37999 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 38437 38108 gene locus_tag LOCUS_01630 38437 38108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 38810 38490 gene locus_tag LOCUS_01640 38810 38490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 39837 39019 gene locus_tag LOCUS_01650 gene lpxA 39837 39019 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941664.1 protein_id gnl|my_center|LOCUS_01650 41422 39827 gene locus_tag LOCUS_01660 gene cimA 41422 39827 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880180.1 protein_id gnl|my_center|LOCUS_01660 42656 41415 gene locus_tag LOCUS_01670 42656 41415 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545682.1 protein_id gnl|my_center|LOCUS_01670 >Feature sequence004 3601 185 gene locus_tag LOCUS_01680 3601 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 3849 4289 gene locus_tag LOCUS_01690 gene queF 3849 4289 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546535.1 protein_id gnl|my_center|LOCUS_01690 5129 4347 gene locus_tag LOCUS_01700 5129 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 5503 5147 gene locus_tag LOCUS_01710 5503 5147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 6754 5528 gene locus_tag LOCUS_01720 6754 5528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 7839 6751 gene locus_tag LOCUS_01730 gene aroB 7839 6751 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393064.1 protein_id gnl|my_center|LOCUS_01730 8390 7836 gene locus_tag LOCUS_01740 gene aroL 8390 7836 CDS product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095816.1 protein_id gnl|my_center|LOCUS_01740 9577 8387 gene locus_tag LOCUS_01750 gene aroC 9577 8387 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_01750 10134 9574 gene locus_tag LOCUS_01760 10134 9574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 11047 10139 gene locus_tag LOCUS_01770 gene rapZ 11047 10139 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_01770 11616 11092 gene locus_tag LOCUS_01780 gene raiA 11616 11092 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942531.1 protein_id gnl|my_center|LOCUS_01780 13143 11650 gene locus_tag LOCUS_01790 gene rpoN 13143 11650 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_01790 13886 13140 gene locus_tag LOCUS_01800 gene lptB 13886 13140 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942533.1 protein_id gnl|my_center|LOCUS_01800 14505 13876 gene locus_tag LOCUS_01810 14505 13876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 15064 14486 gene locus_tag LOCUS_01820 15064 14486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 16123 15128 gene locus_tag LOCUS_01830 gene mdh 16123 15128 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_01830 17716 16358 gene locus_tag LOCUS_01840 17716 16358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 18647 17700 gene locus_tag LOCUS_01850 18647 17700 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545031.1 protein_id gnl|my_center|LOCUS_01850 19099 19254 gene locus_tag LOCUS_01860 19099 19254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 20000 19200 gene locus_tag LOCUS_01870 20000 19200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 20643 20005 gene locus_tag LOCUS_01880 20643 20005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 21731 20850 gene locus_tag LOCUS_01890 gene nadC 21731 20850 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067615902.1 protein_id gnl|my_center|LOCUS_01890 24415 21728 gene locus_tag LOCUS_01900 24415 21728 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942688.1 protein_id gnl|my_center|LOCUS_01900 25470 24436 gene locus_tag LOCUS_01910 gene mltG 25470 24436 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941176.1 protein_id gnl|my_center|LOCUS_01910 25994 25467 gene locus_tag LOCUS_01920 gene ruvX 25994 25467 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021214669.1 protein_id gnl|my_center|LOCUS_01920 28660 26009 gene locus_tag LOCUS_01930 gene alaS 28660 26009 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940824.1 protein_id gnl|my_center|LOCUS_01930 26404 26495 gene locus_tag LOCUS_t00020 26404 26495 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 29735 28665 gene locus_tag LOCUS_01940 gene recA 29735 28665 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504720.1 protein_id gnl|my_center|LOCUS_01940 30181 29771 gene locus_tag LOCUS_01950 30181 29771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 30955 30242 gene locus_tag LOCUS_01960 30955 30242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 31205 31858 gene locus_tag LOCUS_01970 31205 31858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 32293 32763 gene locus_tag LOCUS_01980 gene speD 32293 32763 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545906.1 protein_id gnl|my_center|LOCUS_01980 32729 33649 gene locus_tag LOCUS_01990 gene speE 32729 33649 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583812.1 protein_id gnl|my_center|LOCUS_01990 33667 35139 gene locus_tag LOCUS_02000 33667 35139 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048125.1 protein_id gnl|my_center|LOCUS_02000 35285 38029 gene locus_tag LOCUS_02010 35285 38029 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942970.1 protein_id gnl|my_center|LOCUS_02010 >Feature sequence005 370 633 gene locus_tag LOCUS_02020 370 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 667 1446 gene locus_tag LOCUS_02030 667 1446 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102956.1 protein_id gnl|my_center|LOCUS_02030 2046 1513 gene locus_tag LOCUS_02040 2046 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 4066 2081 gene locus_tag LOCUS_02050 4066 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 4996 4079 gene locus_tag LOCUS_02060 4996 4079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 5974 5000 gene locus_tag LOCUS_02070 5974 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 6341 6123 gene locus_tag LOCUS_02080 6341 6123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 6904 6338 gene locus_tag LOCUS_02090 6904 6338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 7282 7049 gene locus_tag LOCUS_02100 7282 7049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 8717 7311 gene locus_tag LOCUS_02110 8717 7311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 9034 9192 gene locus_tag LOCUS_02120 9034 9192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 10413 9367 gene locus_tag LOCUS_02130 10413 9367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 11130 10450 gene locus_tag LOCUS_02140 11130 10450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 13023 11215 gene locus_tag LOCUS_02150 13023 11215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 14232 13057 gene locus_tag LOCUS_02160 14232 13057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 16755 14245 gene locus_tag LOCUS_02170 16755 14245 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970257.1 protein_id gnl|my_center|LOCUS_02170 17091 16759 gene locus_tag LOCUS_02180 17091 16759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 17498 17160 gene locus_tag LOCUS_02190 17498 17160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 18610 17540 gene locus_tag LOCUS_02200 gene trbB 18610 17540 CDS product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891624.1 protein_id gnl|my_center|LOCUS_02200 19094 18603 gene locus_tag LOCUS_02210 19094 18603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 20785 19193 gene locus_tag LOCUS_02220 20785 19193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 21237 20782 gene locus_tag LOCUS_02230 gene traF 21237 20782 CDS product conjugative transfer signal peptidase TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974897.1 protein_id gnl|my_center|LOCUS_02230 22095 21910 gene locus_tag LOCUS_02240 22095 21910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 22010 23239 gene locus_tag LOCUS_02250 22010 23239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 23281 23730 gene locus_tag LOCUS_02260 23281 23730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 23727 24257 gene locus_tag LOCUS_02270 23727 24257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 24494 25858 gene locus_tag LOCUS_02280 24494 25858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 27069 25945 gene locus_tag LOCUS_02290 27069 25945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 28180 27071 gene locus_tag LOCUS_02300 28180 27071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 28661 28473 gene locus_tag LOCUS_02310 28661 28473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 28820 29431 gene locus_tag LOCUS_02320 28820 29431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 29428 30492 gene locus_tag LOCUS_02330 29428 30492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 31478 30540 gene locus_tag LOCUS_02340 31478 30540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 31726 31475 gene locus_tag LOCUS_02350 31726 31475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 32708 31806 gene locus_tag LOCUS_02360 32708 31806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 33480 32692 gene locus_tag LOCUS_02370 33480 32692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 >Feature sequence006 1539 412 gene locus_tag LOCUS_02380 1539 412 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176601.1 protein_id gnl|my_center|LOCUS_02380 1869 1615 gene locus_tag LOCUS_02390 1869 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 2858 1905 gene locus_tag LOCUS_02400 2858 1905 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817098.1 protein_id gnl|my_center|LOCUS_02400 5258 3279 gene locus_tag LOCUS_02410 5258 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 6434 5652 gene locus_tag LOCUS_02420 6434 5652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 7086 8309 gene locus_tag LOCUS_02430 7086 8309 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_02430 9935 8418 gene locus_tag LOCUS_02440 9935 8418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 11037 10081 gene locus_tag LOCUS_02450 11037 10081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 12197 11325 gene locus_tag LOCUS_02460 12197 11325 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412005.1 protein_id gnl|my_center|LOCUS_02460 13042 12194 gene locus_tag LOCUS_02470 13042 12194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 14696 13128 gene locus_tag LOCUS_02480 14696 13128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 18151 14906 gene locus_tag LOCUS_02490 18151 14906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 19569 18157 gene locus_tag LOCUS_02500 gene prsR 19569 18157 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942585.1 protein_id gnl|my_center|LOCUS_02500 20273 19566 gene locus_tag LOCUS_02510 20273 19566 CDS product EpsI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176634.1 protein_id gnl|my_center|LOCUS_02510 21108 20263 gene locus_tag LOCUS_02520 gene xrt 21108 20263 CDS product exosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176633.1 protein_id gnl|my_center|LOCUS_02520 22012 21083 gene locus_tag LOCUS_02530 gene galU 22012 21083 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941523.1 protein_id gnl|my_center|LOCUS_02530 23545 22283 gene locus_tag LOCUS_02540 23545 22283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 24623 23571 gene locus_tag LOCUS_02550 24623 23571 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205740.1 protein_id gnl|my_center|LOCUS_02550 26502 24658 gene locus_tag LOCUS_02560 26502 24658 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403374.1 protein_id gnl|my_center|LOCUS_02560 28448 26499 gene locus_tag LOCUS_02570 28448 26499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 29802 28462 gene locus_tag LOCUS_02580 29802 28462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 30636 29839 gene locus_tag LOCUS_02590 30636 29839 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942629.1 protein_id gnl|my_center|LOCUS_02590 >Feature sequence007 992 156 gene locus_tag LOCUS_02600 992 156 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939346.1 protein_id gnl|my_center|LOCUS_02600 1342 1019 gene locus_tag LOCUS_02610 1342 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 1612 1445 gene locus_tag LOCUS_02620 1612 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 2572 1736 gene locus_tag LOCUS_02630 2572 1736 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939346.1 protein_id gnl|my_center|LOCUS_02630 2922 2599 gene locus_tag LOCUS_02640 2922 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 5577 3025 gene locus_tag LOCUS_02650 5577 3025 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941142.1 protein_id gnl|my_center|LOCUS_02650 6834 5677 gene locus_tag LOCUS_02660 6834 5677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 7941 8276 gene locus_tag LOCUS_02670 7941 8276 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084574.1 protein_id gnl|my_center|LOCUS_02670 8634 8284 gene locus_tag LOCUS_02680 8634 8284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 10430 8631 gene locus_tag LOCUS_02690 10430 8631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 11376 10456 gene locus_tag LOCUS_02700 gene rfaD 11376 10456 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880173.1 protein_id gnl|my_center|LOCUS_02700 11519 12421 gene locus_tag LOCUS_02710 gene rfbD 11519 12421 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868299.1 protein_id gnl|my_center|LOCUS_02710 13241 12408 gene locus_tag LOCUS_02720 13241 12408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 14803 13238 gene locus_tag LOCUS_02730 14803 13238 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530900.1 protein_id gnl|my_center|LOCUS_02730 15903 14803 gene locus_tag LOCUS_02740 15903 14803 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143157.1 protein_id gnl|my_center|LOCUS_02740 17231 15900 gene locus_tag LOCUS_02750 17231 15900 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224260.1 protein_id gnl|my_center|LOCUS_02750 18722 17403 gene locus_tag LOCUS_02760 18722 17403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 19064 18756 gene locus_tag LOCUS_02770 19064 18756 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262427.1 protein_id gnl|my_center|LOCUS_02770 19591 19073 gene locus_tag LOCUS_02780 19591 19073 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_02780 20578 19610 gene locus_tag LOCUS_02790 20578 19610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 20883 20575 gene locus_tag LOCUS_02800 20883 20575 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250981.1 protein_id gnl|my_center|LOCUS_02800 21050 20974 gene locus_tag LOCUS_t00030 21050 20974 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 21876 21415 gene locus_tag LOCUS_02810 21876 21415 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_02810 22738 22028 gene locus_tag LOCUS_02820 22738 22028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 23278 22808 gene locus_tag LOCUS_02830 23278 22808 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328750.1 protein_id gnl|my_center|LOCUS_02830 24009 23275 gene locus_tag LOCUS_02840 24009 23275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 24787 24464 gene locus_tag LOCUS_02850 24787 24464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 25155 24961 gene locus_tag LOCUS_02860 25155 24961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 25569 25390 gene locus_tag LOCUS_02870 25569 25390 CDS product SAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941661.1 protein_id gnl|my_center|LOCUS_02870 26289 25858 gene locus_tag LOCUS_02880 26289 25858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 26597 26322 gene locus_tag LOCUS_02890 26597 26322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 28748 27318 gene locus_tag LOCUS_02900 28748 27318 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113486.1 protein_id gnl|my_center|LOCUS_02900 28850 29245 gene locus_tag LOCUS_02910 28850 29245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 <30014 29447 gene locus_tag LOCUS_02920 <30014 29447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235893157.1:group II intron reverse transcriptase/maturase >Feature sequence008 1194 529 gene locus_tag LOCUS_02930 1194 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 2199 1429 gene locus_tag LOCUS_02940 2199 1429 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964960.1 protein_id gnl|my_center|LOCUS_02940 2846 2196 gene locus_tag LOCUS_02950 2846 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 4259 2862 gene locus_tag LOCUS_02960 gene accC 4259 2862 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_02960 4723 4259 gene locus_tag LOCUS_02970 gene accB 4723 4259 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545496.1 protein_id gnl|my_center|LOCUS_02970 5327 4752 gene locus_tag LOCUS_02980 gene efp 5327 4752 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545338.1 protein_id gnl|my_center|LOCUS_02980 5838 5374 gene locus_tag LOCUS_02990 gene aroQ 5838 5374 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095385.1 protein_id gnl|my_center|LOCUS_02990 7280 5835 gene locus_tag LOCUS_03000 7280 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 8902 8570 gene locus_tag LOCUS_03010 8902 8570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 8801 10456 gene locus_tag LOCUS_03020 8801 10456 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550958.1 protein_id gnl|my_center|LOCUS_03020 11830 10532 gene locus_tag LOCUS_03030 gene coaBC 11830 10532 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460556.1 protein_id gnl|my_center|LOCUS_03030 12243 11836 gene locus_tag LOCUS_03040 12243 11836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 13018 12308 gene locus_tag LOCUS_03050 gene gmk 13018 12308 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942878.1 protein_id gnl|my_center|LOCUS_03050 13936 13058 gene locus_tag LOCUS_03060 13936 13058 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971395.1 protein_id gnl|my_center|LOCUS_03060 18586 13976 gene locus_tag LOCUS_03070 18586 13976 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944060.1 protein_id gnl|my_center|LOCUS_03070 19959 19315 gene locus_tag LOCUS_03080 19959 19315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 21134 19959 gene locus_tag LOCUS_03090 gene nifS 21134 19959 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_03090 21382 21131 gene locus_tag LOCUS_03100 21382 21131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 22208 21423 gene locus_tag LOCUS_03110 22208 21423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 22688 22233 gene locus_tag LOCUS_03120 22688 22233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 23350 22832 gene locus_tag LOCUS_03130 23350 22832 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024397.1 protein_id gnl|my_center|LOCUS_03130 23525 24229 gene locus_tag LOCUS_03140 23525 24229 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524793.1 protein_id gnl|my_center|LOCUS_03140 24258 24617 gene locus_tag LOCUS_03150 24258 24617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 24614 25927 gene locus_tag LOCUS_03160 24614 25927 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244177.1 protein_id gnl|my_center|LOCUS_03160 26055 27221 gene locus_tag LOCUS_03170 26055 27221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 27870 27523 gene locus_tag LOCUS_03180 27870 27523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 28141 28983 gene locus_tag LOCUS_03190 28141 28983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 >Feature sequence009 2459 381 gene locus_tag LOCUS_03200 gene kdpB 2459 381 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816820.1 protein_id gnl|my_center|LOCUS_03200 4263 2485 gene locus_tag LOCUS_03210 gene kdpA 4263 2485 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185359.1 protein_id gnl|my_center|LOCUS_03210 4752 7418 gene locus_tag LOCUS_03220 4752 7418 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943120.1 protein_id gnl|my_center|LOCUS_03220 7415 7963 gene locus_tag LOCUS_03230 7415 7963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 7995 9902 gene locus_tag LOCUS_03240 7995 9902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 10088 11368 gene locus_tag LOCUS_03250 10088 11368 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257829.1 protein_id gnl|my_center|LOCUS_03250 11365 12663 gene locus_tag LOCUS_03260 11365 12663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 12959 12714 gene locus_tag LOCUS_03270 12959 12714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 13054 15075 gene locus_tag LOCUS_03280 13054 15075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 15244 16137 gene locus_tag LOCUS_03290 15244 16137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 16134 17333 gene locus_tag LOCUS_03300 16134 17333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 17436 17846 gene locus_tag LOCUS_03310 17436 17846 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027506.1 protein_id gnl|my_center|LOCUS_03310 18951 18265 gene locus_tag LOCUS_03320 18951 18265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 20285 18948 gene locus_tag LOCUS_03330 gene pafA 20285 18948 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_03330 20990 20298 gene locus_tag LOCUS_03340 gene prcA 20990 20298 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226723.1 protein_id gnl|my_center|LOCUS_03340 21794 20997 gene locus_tag LOCUS_03350 gene prcB 21794 20997 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_03350 21998 21798 gene locus_tag LOCUS_03360 21998 21798 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027899.1 protein_id gnl|my_center|LOCUS_03360 23596 21995 gene locus_tag LOCUS_03370 gene dop 23596 21995 CDS product pup deamidase/depupylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908269.1 protein_id gnl|my_center|LOCUS_03370 25374 23593 gene locus_tag LOCUS_03380 gene arc 25374 23593 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908268.1 protein_id gnl|my_center|LOCUS_03380 26275 26102 gene locus_tag LOCUS_03390 26275 26102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 26662 26318 gene locus_tag LOCUS_03400 26662 26318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 27093 28094 gene locus_tag LOCUS_03410 27093 28094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 >Feature sequence010 1965 604 gene locus_tag LOCUS_03420 1965 604 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892661.1 protein_id gnl|my_center|LOCUS_03420 3510 2116 gene locus_tag LOCUS_03430 3510 2116 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978673.1 protein_id gnl|my_center|LOCUS_03430 4351 3599 gene locus_tag LOCUS_03440 4351 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 5500 4361 gene locus_tag LOCUS_03450 5500 4361 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878064.1 protein_id gnl|my_center|LOCUS_03450 7422 5803 gene locus_tag LOCUS_03460 7422 5803 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943215.1 protein_id gnl|my_center|LOCUS_03460 8087 9460 gene locus_tag LOCUS_03470 gene thiC 8087 9460 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921089.1 protein_id gnl|my_center|LOCUS_03470 9593 10279 gene locus_tag LOCUS_03480 9593 10279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 10276 12735 gene locus_tag LOCUS_03490 10276 12735 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943552.1 protein_id gnl|my_center|LOCUS_03490 14010 12829 gene locus_tag LOCUS_03500 14010 12829 CDS product RuBisCO large subunit C-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933432.1 protein_id gnl|my_center|LOCUS_03500 15167 14373 gene locus_tag LOCUS_03510 15167 14373 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123462.1 protein_id gnl|my_center|LOCUS_03510 15860 15207 gene locus_tag LOCUS_03520 gene lirB 15860 15207 CDS product type IV secretion system effector LirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947678.1 protein_id gnl|my_center|LOCUS_03520 17674 15857 gene locus_tag LOCUS_03530 gene typA 17674 15857 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941168.1 protein_id gnl|my_center|LOCUS_03530 17897 19303 gene locus_tag LOCUS_03540 17897 19303 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392943.1 protein_id gnl|my_center|LOCUS_03540 19320 20750 gene locus_tag LOCUS_03550 gene pyk 19320 20750 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066546.1 protein_id gnl|my_center|LOCUS_03550 21976 20798 gene locus_tag LOCUS_03560 21976 20798 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943264.1 protein_id gnl|my_center|LOCUS_03560 22506 22285 gene locus_tag LOCUS_03570 22506 22285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 22415 23356 gene locus_tag LOCUS_03580 22415 23356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 23451 24509 gene locus_tag LOCUS_03590 23451 24509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 24506 25138 gene locus_tag LOCUS_03600 24506 25138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 >Feature sequence011 646 1743 gene locus_tag LOCUS_03610 646 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 1200 1298 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1937 2719 gene locus_tag LOCUS_03620 1937 2719 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898431.1 protein_id gnl|my_center|LOCUS_03620 4102 2750 gene locus_tag LOCUS_03630 4102 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 3124 3221 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4442 4888 gene locus_tag LOCUS_03640 4442 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 5854 4973 gene locus_tag LOCUS_03650 5854 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 6483 5851 gene locus_tag LOCUS_03660 6483 5851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 8004 6847 gene locus_tag LOCUS_03670 8004 6847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 8687 8001 gene locus_tag LOCUS_03680 8687 8001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 9937 8684 gene locus_tag LOCUS_03690 9937 8684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 10556 9951 gene locus_tag LOCUS_03700 10556 9951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 13036 10538 gene locus_tag LOCUS_03710 13036 10538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 13268 13026 gene locus_tag LOCUS_03720 13268 13026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 13537 13268 gene locus_tag LOCUS_03730 13537 13268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 14102 15352 gene locus_tag LOCUS_03740 gene icd 14102 15352 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479852.1 protein_id gnl|my_center|LOCUS_03740 15828 15442 gene locus_tag LOCUS_03750 15828 15442 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252024.1 protein_id gnl|my_center|LOCUS_03750 16076 15825 gene locus_tag LOCUS_03760 16076 15825 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242138.1 protein_id gnl|my_center|LOCUS_03760 16589 17494 gene locus_tag LOCUS_03770 16589 17494 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257568.1 protein_id gnl|my_center|LOCUS_03770 17494 18174 gene locus_tag LOCUS_03780 17494 18174 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256391.1 protein_id gnl|my_center|LOCUS_03780 18181 20742 gene locus_tag LOCUS_03790 18181 20742 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404082.1 protein_id gnl|my_center|LOCUS_03790 20739 21845 gene locus_tag LOCUS_03800 20739 21845 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404080.1 protein_id gnl|my_center|LOCUS_03800 22870 21878 gene locus_tag LOCUS_03810 22870 21878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 >Feature sequence012 373 1491 gene locus_tag LOCUS_03820 373 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 1708 1716 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2530 1769 gene locus_tag LOCUS_03830 gene xth 2530 1769 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039115.1 protein_id gnl|my_center|LOCUS_03830 3092 2547 gene locus_tag LOCUS_03840 3092 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 3975 3136 gene locus_tag LOCUS_03850 gene panB 3975 3136 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_03850 4852 3983 gene locus_tag LOCUS_03860 4852 3983 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941524.1 protein_id gnl|my_center|LOCUS_03860 5726 4866 gene locus_tag LOCUS_03870 gene folD 5726 4866 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_03870 6778 5849 gene locus_tag LOCUS_03880 6778 5849 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091401.1 protein_id gnl|my_center|LOCUS_03880 6909 7856 gene locus_tag LOCUS_03890 6909 7856 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347004.1 protein_id gnl|my_center|LOCUS_03890 7989 7840 gene locus_tag LOCUS_03900 7989 7840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03900 9104 8541 gene locus_tag LOCUS_03910 gene folE 9104 8541 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545785.1 protein_id gnl|my_center|LOCUS_03910 9726 9097 gene locus_tag LOCUS_03920 9726 9097 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881124.1 protein_id gnl|my_center|LOCUS_03920 11113 9716 gene locus_tag LOCUS_03930 11113 9716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 11468 13522 gene locus_tag LOCUS_03940 11468 13522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 13547 14254 gene locus_tag LOCUS_03950 13547 14254 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958411.1 protein_id gnl|my_center|LOCUS_03950 14280 15284 gene locus_tag LOCUS_03960 gene trpS 14280 15284 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942477.1 protein_id gnl|my_center|LOCUS_03960 16924 15935 gene locus_tag LOCUS_03970 16924 15935 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038752.1 protein_id gnl|my_center|LOCUS_03970 17061 17714 gene locus_tag LOCUS_03980 gene cobC 17061 17714 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914029.1 protein_id gnl|my_center|LOCUS_03980 17711 19129 gene locus_tag LOCUS_03990 17711 19129 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272612.1 protein_id gnl|my_center|LOCUS_03990 19174 20151 gene locus_tag LOCUS_04000 19174 20151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 21167 20550 gene locus_tag LOCUS_04010 21167 20550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 21595 22392 gene locus_tag LOCUS_04020 21595 22392 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813221.1 protein_id gnl|my_center|LOCUS_04020 >Feature sequence013 224 535 gene locus_tag LOCUS_04030 224 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 713 955 gene locus_tag LOCUS_04040 713 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 1592 1056 gene locus_tag LOCUS_04050 1592 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 2194 1763 gene locus_tag LOCUS_04060 2194 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 2364 2191 gene locus_tag LOCUS_04070 2364 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 3020 2604 gene locus_tag LOCUS_04080 3020 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 5560 3020 gene locus_tag LOCUS_04090 5560 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 5792 5610 gene locus_tag LOCUS_04100 5792 5610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 6012 6704 gene locus_tag LOCUS_04110 6012 6704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 6706 7809 gene locus_tag LOCUS_04120 6706 7809 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_04120 7898 7824 gene locus_tag LOCUS_t00040 7898 7824 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8167 7943 gene locus_tag LOCUS_04130 8167 7943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 8270 9238 gene locus_tag LOCUS_04140 8270 9238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 9511 9311 gene locus_tag LOCUS_04150 9511 9311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 9468 10964 gene locus_tag LOCUS_04160 9468 10964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 10973 12673 gene locus_tag LOCUS_04170 gene gspE 10973 12673 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041913993.1 protein_id gnl|my_center|LOCUS_04170 13084 12767 gene locus_tag LOCUS_04180 13084 12767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 13047 13901 gene locus_tag LOCUS_04190 13047 13901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04190 13923 14396 gene locus_tag LOCUS_04200 gene gspG 13923 14396 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_04200 14483 15445 gene locus_tag LOCUS_04210 14483 15445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 15423 16829 gene locus_tag LOCUS_04220 15423 16829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 16822 17412 gene locus_tag LOCUS_04230 16822 17412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 17468 18442 gene locus_tag LOCUS_04240 17468 18442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 20166 18466 gene locus_tag LOCUS_04250 20166 18466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 21513 20170 gene locus_tag LOCUS_04260 21513 20170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 >Feature sequence014 2176 1556 gene locus_tag LOCUS_04270 2176 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 3743 2232 gene locus_tag LOCUS_04280 3743 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 6400 3740 gene locus_tag LOCUS_04290 gene tssH 6400 3740 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941102.1 protein_id gnl|my_center|LOCUS_04290 7443 6397 gene locus_tag LOCUS_04300 gene tssG 7443 6397 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200970.1 protein_id gnl|my_center|LOCUS_04300 9134 7407 gene locus_tag LOCUS_04310 gene tssF 9134 7407 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941100.1 protein_id gnl|my_center|LOCUS_04310 9599 9183 gene locus_tag LOCUS_04320 gene tssE 9599 9183 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941099.1 protein_id gnl|my_center|LOCUS_04320 9781 9877 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11771 10281 gene locus_tag LOCUS_04330 gene tssC 11771 10281 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200974.1 protein_id gnl|my_center|LOCUS_04330 12315 11815 gene locus_tag LOCUS_04340 gene tssB 12315 11815 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530571.1 protein_id gnl|my_center|LOCUS_04340 12503 16276 gene locus_tag LOCUS_04350 12503 16276 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445472.1 protein_id gnl|my_center|LOCUS_04350 16724 17035 gene locus_tag LOCUS_04360 16724 17035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459999.1 protein_id gnl|my_center|LOCUS_04360 17230 19563 gene locus_tag LOCUS_04370 17230 19563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 >Feature sequence015 443 1855 gene locus_tag LOCUS_04380 443 1855 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967081.1 protein_id gnl|my_center|LOCUS_04380 1978 2271 gene locus_tag LOCUS_04390 1978 2271 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943754.1 protein_id gnl|my_center|LOCUS_04390 3731 2331 gene locus_tag LOCUS_04400 3731 2331 CDS product NCS1 family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339102.1 protein_id gnl|my_center|LOCUS_04400 3965 4558 gene locus_tag LOCUS_04410 3965 4558 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140820.1 protein_id gnl|my_center|LOCUS_04410 4563 5081 gene locus_tag LOCUS_04420 gene cobU 4563 5081 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392601.1 protein_id gnl|my_center|LOCUS_04420 5123 6247 gene locus_tag LOCUS_04430 gene cobT 5123 6247 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943639.1 protein_id gnl|my_center|LOCUS_04430 6244 7011 gene locus_tag LOCUS_04440 6244 7011 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086787.1 protein_id gnl|my_center|LOCUS_04440 7205 8035 gene locus_tag LOCUS_04450 7205 8035 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_04450 8180 9067 gene locus_tag LOCUS_04460 8180 9067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847040.1 protein_id gnl|my_center|LOCUS_04460 9070 10149 gene locus_tag LOCUS_04470 9070 10149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 10156 13242 gene locus_tag LOCUS_04480 10156 13242 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941497.1 protein_id gnl|my_center|LOCUS_04480 13581 14075 gene locus_tag LOCUS_04490 13581 14075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 14146 15000 gene locus_tag LOCUS_04500 14146 15000 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_04500 15032 15772 gene locus_tag LOCUS_04510 15032 15772 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941592.1 protein_id gnl|my_center|LOCUS_04510 15769 16497 gene locus_tag LOCUS_04520 15769 16497 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941593.1 protein_id gnl|my_center|LOCUS_04520 16511 17482 gene locus_tag LOCUS_04530 16511 17482 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545262.1 protein_id gnl|my_center|LOCUS_04530 17482 18702 gene locus_tag LOCUS_04540 17482 18702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 >Feature sequence016 680 1012 gene locus_tag LOCUS_04550 680 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04550 1093 1506 gene locus_tag LOCUS_04560 1093 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04560 2303 1503 gene locus_tag LOCUS_04570 2303 1503 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250866.1 protein_id gnl|my_center|LOCUS_04570 2450 3208 gene locus_tag LOCUS_04580 2450 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 3217 3600 gene locus_tag LOCUS_04590 3217 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 3615 4643 gene locus_tag LOCUS_04600 3615 4643 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941971.1 protein_id gnl|my_center|LOCUS_04600 4681 5964 gene locus_tag LOCUS_04610 4681 5964 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_04610 6908 5982 gene locus_tag LOCUS_04620 6908 5982 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256790.1 protein_id gnl|my_center|LOCUS_04620 7890 6985 gene locus_tag LOCUS_04630 7890 6985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 8413 7937 gene locus_tag LOCUS_04640 gene lspA 8413 7937 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939214.1 protein_id gnl|my_center|LOCUS_04640 11392 8537 gene locus_tag LOCUS_04650 gene ileS 11392 8537 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943758.1 protein_id gnl|my_center|LOCUS_04650 11472 11546 gene locus_tag LOCUS_t00050 11472 11546 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 12396 11605 gene locus_tag LOCUS_04660 12396 11605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 13512 12430 gene locus_tag LOCUS_04670 gene mnmA 13512 12430 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_04670 13891 13505 gene locus_tag LOCUS_04680 13891 13505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 14747 13881 gene locus_tag LOCUS_04690 14747 13881 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229053.1 protein_id gnl|my_center|LOCUS_04690 15510 14740 gene locus_tag LOCUS_04700 15510 14740 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_04700 16149 15553 gene locus_tag LOCUS_04710 16149 15553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 17987 16146 gene locus_tag LOCUS_04720 gene mnmG 17987 16146 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054993407.1 protein_id gnl|my_center|LOCUS_04720 <18602 17992 gene locus_tag LOCUS_04730 <18602 17992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009872073.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE >Feature sequence017 1092 418 gene locus_tag LOCUS_04740 gene cmk 1092 418 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460204.1 protein_id gnl|my_center|LOCUS_04740 2429 1089 gene locus_tag LOCUS_04750 gene aroA 2429 1089 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943243.1 protein_id gnl|my_center|LOCUS_04750 3316 2426 gene locus_tag LOCUS_04760 3316 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04760 4335 3316 gene locus_tag LOCUS_04770 gene aroF 4335 3316 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546648.1 protein_id gnl|my_center|LOCUS_04770 5510 4368 gene locus_tag LOCUS_04780 gene pheA 5510 4368 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880586.1 protein_id gnl|my_center|LOCUS_04780 6274 5519 gene locus_tag LOCUS_04790 6274 5519 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545318.1 protein_id gnl|my_center|LOCUS_04790 7237 6350 gene locus_tag LOCUS_04800 7237 6350 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086635.1 protein_id gnl|my_center|LOCUS_04800 7440 7234 gene locus_tag LOCUS_04810 7440 7234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 9434 7437 gene locus_tag LOCUS_04820 9434 7437 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926730.1 protein_id gnl|my_center|LOCUS_04820 10343 9870 gene locus_tag LOCUS_04830 10343 9870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 12039 10957 gene locus_tag LOCUS_04840 12039 10957 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193577.1 protein_id gnl|my_center|LOCUS_04840 14483 12399 gene locus_tag LOCUS_04850 14483 12399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 14929 14501 gene locus_tag LOCUS_04860 14929 14501 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943873.1 protein_id gnl|my_center|LOCUS_04860 17995 14987 gene locus_tag LOCUS_04870 17995 14987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 >Feature sequence018 777 172 gene locus_tag LOCUS_04880 777 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 1080 781 gene locus_tag LOCUS_04890 1080 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 1639 1169 gene locus_tag LOCUS_04900 1639 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 1695 2204 gene locus_tag LOCUS_04910 1695 2204 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869771.1 protein_id gnl|my_center|LOCUS_04910 2564 3994 gene locus_tag LOCUS_04920 2564 3994 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148136891.1 protein_id gnl|my_center|LOCUS_04920 3991 5499 gene locus_tag LOCUS_04930 gene trpE 3991 5499 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_04930 5487 6092 gene locus_tag LOCUS_04940 5487 6092 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257601.1 protein_id gnl|my_center|LOCUS_04940 6089 7099 gene locus_tag LOCUS_04950 gene trpD 6089 7099 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_04950 7096 7893 gene locus_tag LOCUS_04960 gene trpC 7096 7893 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392852.1 protein_id gnl|my_center|LOCUS_04960 7877 8518 gene locus_tag LOCUS_04970 7877 8518 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104200.1 protein_id gnl|my_center|LOCUS_04970 8515 9762 gene locus_tag LOCUS_04980 gene trpB 8515 9762 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546381.1 protein_id gnl|my_center|LOCUS_04980 9759 10550 gene locus_tag LOCUS_04990 gene trpA 9759 10550 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546593.1 protein_id gnl|my_center|LOCUS_04990 10547 11479 gene locus_tag LOCUS_05000 gene accD 10547 11479 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_05000 11476 12861 gene locus_tag LOCUS_05010 11476 12861 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227872.1 protein_id gnl|my_center|LOCUS_05010 12948 15134 gene locus_tag LOCUS_05020 12948 15134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 15921 15145 gene locus_tag LOCUS_05030 15921 15145 CDS product M14 family metallocarboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073531.1 protein_id gnl|my_center|LOCUS_05030 16802 15918 gene locus_tag LOCUS_05040 16802 15918 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_05040 >Feature sequence019 915 2156 gene locus_tag LOCUS_05050 gene ltrA 915 2156 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975689.1 protein_id gnl|my_center|LOCUS_05050 3161 2274 gene locus_tag LOCUS_05060 3161 2274 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876526.1 protein_id gnl|my_center|LOCUS_05060 3395 3643 gene locus_tag LOCUS_05070 3395 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 4348 3647 gene locus_tag LOCUS_05080 4348 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 5738 4491 gene locus_tag LOCUS_05090 5738 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 6359 5775 gene locus_tag LOCUS_05100 6359 5775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 6850 6356 gene locus_tag LOCUS_05110 6850 6356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 7578 6850 gene locus_tag LOCUS_05120 7578 6850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 8212 7772 gene locus_tag LOCUS_05130 8212 7772 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173797.1 protein_id gnl|my_center|LOCUS_05130 8667 8212 gene locus_tag LOCUS_05140 8667 8212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 9223 8681 gene locus_tag LOCUS_05150 9223 8681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 10451 9210 gene locus_tag LOCUS_05160 10451 9210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 11376 10462 gene locus_tag LOCUS_05170 11376 10462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 11574 11416 gene locus_tag LOCUS_05180 11574 11416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 13616 11607 gene locus_tag LOCUS_05190 13616 11607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 15901 13766 gene locus_tag LOCUS_05200 15901 13766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 17014 15917 gene locus_tag LOCUS_05210 17014 15917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 17796 17014 gene locus_tag LOCUS_05220 17796 17014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 >Feature sequence020 1570 2853 gene locus_tag LOCUS_05230 1570 2853 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941984.1 protein_id gnl|my_center|LOCUS_05230 2843 4228 gene locus_tag LOCUS_05240 2843 4228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 4225 7428 gene locus_tag LOCUS_05250 4225 7428 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004542866.1 protein_id gnl|my_center|LOCUS_05250 7425 7805 gene locus_tag LOCUS_05260 7425 7805 CDS product copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529974.1 protein_id gnl|my_center|LOCUS_05260 7830 8186 gene locus_tag LOCUS_05270 7830 8186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 8309 8599 gene locus_tag LOCUS_05280 8309 8599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 9038 9205 gene locus_tag LOCUS_05290 9038 9205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 9350 10105 gene locus_tag LOCUS_05300 9350 10105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 10217 10600 gene locus_tag LOCUS_05310 10217 10600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05310 10633 10935 gene locus_tag LOCUS_05320 10633 10935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05320 11086 11499 gene locus_tag LOCUS_05330 11086 11499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 11577 11912 gene locus_tag LOCUS_05340 11577 11912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 11981 12298 gene locus_tag LOCUS_05350 11981 12298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 12379 12576 gene locus_tag LOCUS_05360 12379 12576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 12518 12937 gene locus_tag LOCUS_05370 12518 12937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 12999 13565 gene locus_tag LOCUS_05380 12999 13565 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147291.1 protein_id gnl|my_center|LOCUS_05380 13794 14228 gene locus_tag LOCUS_05390 13794 14228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 14320 14652 gene locus_tag LOCUS_05400 14320 14652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 14709 15437 gene locus_tag LOCUS_05410 14709 15437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 15434 16363 gene locus_tag LOCUS_05420 15434 16363 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963375.1 protein_id gnl|my_center|LOCUS_05420 16552 17535 gene locus_tag LOCUS_05430 16552 17535 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674001.1 protein_id gnl|my_center|LOCUS_05430 >Feature sequence021 690 1154 gene locus_tag LOCUS_05440 690 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 1518 1078 gene locus_tag LOCUS_05450 1518 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 2800 1964 gene locus_tag LOCUS_05460 2800 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 3510 3292 gene locus_tag LOCUS_05470 3510 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 3705 4679 gene locus_tag LOCUS_05480 3705 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 5538 4693 gene locus_tag LOCUS_05490 5538 4693 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037847.1 protein_id gnl|my_center|LOCUS_05490 5741 5535 gene locus_tag LOCUS_05500 5741 5535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 5950 5738 gene locus_tag LOCUS_05510 5950 5738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 7149 6022 gene locus_tag LOCUS_05520 7149 6022 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880477.1 protein_id gnl|my_center|LOCUS_05520 8439 7318 gene locus_tag LOCUS_05530 8439 7318 CDS product DUF3443 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192528.1 protein_id gnl|my_center|LOCUS_05530 9128 8436 gene locus_tag LOCUS_05540 9128 8436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 11051 9135 gene locus_tag LOCUS_05550 11051 9135 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275246.1 protein_id gnl|my_center|LOCUS_05550 11212 12015 gene locus_tag LOCUS_05560 11212 12015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 12547 12020 gene locus_tag LOCUS_05570 12547 12020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 12851 12525 gene locus_tag LOCUS_05580 12851 12525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 13786 12944 gene locus_tag LOCUS_05590 13786 12944 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060993210.1 protein_id gnl|my_center|LOCUS_05590 13967 15595 gene locus_tag LOCUS_05600 13967 15595 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545554.1 protein_id gnl|my_center|LOCUS_05600 15739 17136 gene locus_tag LOCUS_05610 15739 17136 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811709.1 protein_id gnl|my_center|LOCUS_05610 >Feature sequence022 1453 1022 gene locus_tag LOCUS_05620 gene mqsA 1453 1022 CDS product type II toxin-antitoxin system antitoxin MqsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650107.1 protein_id gnl|my_center|LOCUS_05620 2940 2086 gene locus_tag LOCUS_05630 gene purU 2940 2086 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101174.1 protein_id gnl|my_center|LOCUS_05630 2939 3169 gene locus_tag LOCUS_05640 2939 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 4212 3424 gene locus_tag LOCUS_05650 4212 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 5178 4294 gene locus_tag LOCUS_05660 5178 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 6268 5168 gene locus_tag LOCUS_05670 gene hisC 6268 5168 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268858.1 protein_id gnl|my_center|LOCUS_05670 6598 7974 gene locus_tag LOCUS_05680 6598 7974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 8954 8016 gene locus_tag LOCUS_05690 8954 8016 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049979583.1 protein_id gnl|my_center|LOCUS_05690 9482 8997 gene locus_tag LOCUS_05700 9482 8997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 10365 9979 gene locus_tag LOCUS_05710 10365 9979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 10466 10714 gene locus_tag LOCUS_05720 10466 10714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 11928 10624 gene locus_tag LOCUS_05730 11928 10624 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_05730 13813 11960 gene locus_tag LOCUS_05740 gene glmS 13813 11960 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393728.1 protein_id gnl|my_center|LOCUS_05740 16002 14464 gene locus_tag LOCUS_05750 16002 14464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 >Feature sequence023 2527 77 gene locus_tag LOCUS_05760 2527 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 3152 2508 gene locus_tag LOCUS_05770 3152 2508 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196436.1 protein_id gnl|my_center|LOCUS_05770 4191 3172 gene locus_tag LOCUS_05780 gene ilvC 4191 3172 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545824.1 protein_id gnl|my_center|LOCUS_05780 4795 4244 gene locus_tag LOCUS_05790 gene ilvN 4795 4244 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545180.1 protein_id gnl|my_center|LOCUS_05790 6549 4792 gene locus_tag LOCUS_05800 gene ilvB 6549 4792 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545836.1 protein_id gnl|my_center|LOCUS_05800 7106 6663 gene locus_tag LOCUS_05810 7106 6663 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414624.1 protein_id gnl|my_center|LOCUS_05810 7345 7103 gene locus_tag LOCUS_05820 7345 7103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 7776 9137 gene locus_tag LOCUS_05830 gene dnaA 7776 9137 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_05830 9184 10359 gene locus_tag LOCUS_05840 gene dnaN 9184 10359 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546822.1 protein_id gnl|my_center|LOCUS_05840 10433 12862 gene locus_tag LOCUS_05850 gene gyrB 10433 12862 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220005.1 protein_id gnl|my_center|LOCUS_05850 12879 15353 gene locus_tag LOCUS_05860 gene gyrA 12879 15353 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282851.1 protein_id gnl|my_center|LOCUS_05860 15382 16191 gene locus_tag LOCUS_05870 15382 16191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 >Feature sequence024 23 403 gene locus_tag LOCUS_05880 23 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 1728 400 gene locus_tag LOCUS_05890 gene ccoG 1728 400 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073459.1 protein_id gnl|my_center|LOCUS_05890 2052 1777 gene locus_tag LOCUS_05900 2052 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 2651 2049 gene locus_tag LOCUS_05910 2651 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 3804 2674 gene locus_tag LOCUS_05920 3804 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 4385 3810 gene locus_tag LOCUS_05930 4385 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 4845 4405 gene locus_tag LOCUS_05940 4845 4405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 5091 4879 gene locus_tag LOCUS_05950 5091 4879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 5254 5427 gene locus_tag LOCUS_05960 5254 5427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 5749 5570 gene locus_tag LOCUS_05970 5749 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 6432 6100 gene locus_tag LOCUS_05980 6432 6100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 7083 6553 gene locus_tag LOCUS_05990 7083 6553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 7739 7503 gene locus_tag LOCUS_06000 7739 7503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 8063 8698 gene locus_tag LOCUS_06010 8063 8698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 8784 9731 gene locus_tag LOCUS_06020 8784 9731 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838316.1 protein_id gnl|my_center|LOCUS_06020 9718 10797 gene locus_tag LOCUS_06030 9718 10797 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068709.1 protein_id gnl|my_center|LOCUS_06030 12240 10882 gene locus_tag LOCUS_06040 12240 10882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 13061 12309 gene locus_tag LOCUS_06050 13061 12309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 13872 13051 gene locus_tag LOCUS_06060 gene prcB 13872 13051 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_06060 14137 13904 gene locus_tag LOCUS_06070 14137 13904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 15674 14142 gene locus_tag LOCUS_06080 gene dop 15674 14142 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775655.1 protein_id gnl|my_center|LOCUS_06080 <16434 15710 gene locus_tag LOCUS_06090 <16434 15710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005086527.1:proteasome ATPase >Feature sequence025 304 603 gene locus_tag LOCUS_06100 304 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 572 2224 gene locus_tag LOCUS_06110 572 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 4188 2491 gene locus_tag LOCUS_06120 4188 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 5168 4641 gene locus_tag LOCUS_06130 5168 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06130 6381 5080 gene locus_tag LOCUS_06140 6381 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06140 6930 7400 gene locus_tag LOCUS_06150 6930 7400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 7559 7963 gene locus_tag LOCUS_06160 7559 7963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 7960 8904 gene locus_tag LOCUS_06170 7960 8904 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943450.1 protein_id gnl|my_center|LOCUS_06170 8901 9863 gene locus_tag LOCUS_06180 8901 9863 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943451.1 protein_id gnl|my_center|LOCUS_06180 9860 10996 gene locus_tag LOCUS_06190 9860 10996 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943452.1 protein_id gnl|my_center|LOCUS_06190 11003 12136 gene locus_tag LOCUS_06200 11003 12136 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943453.1 protein_id gnl|my_center|LOCUS_06200 12168 13586 gene locus_tag LOCUS_06210 12168 13586 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926801.1 protein_id gnl|my_center|LOCUS_06210 14076 13630 gene locus_tag LOCUS_06220 14076 13630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06220 14532 14131 gene locus_tag LOCUS_06230 14532 14131 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957957.1 protein_id gnl|my_center|LOCUS_06230 14760 15122 gene locus_tag LOCUS_06240 14760 15122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 15128 15589 gene locus_tag LOCUS_06250 15128 15589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 16416 15832 gene locus_tag LOCUS_06260 16416 15832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 >Feature sequence026 <1 1159 gene locus_tag LOCUS_06270 <1 1159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705394.1:NAD(P)-binding protein 1838 1560 gene locus_tag LOCUS_06280 1838 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06280 2383 1955 gene locus_tag LOCUS_06290 gene gloA 2383 1955 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003015234.1 protein_id gnl|my_center|LOCUS_06290 4267 2384 gene locus_tag LOCUS_06300 gene acs 4267 2384 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255917.1 protein_id gnl|my_center|LOCUS_06300 3279 3335 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5070 4411 gene locus_tag LOCUS_06310 5070 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 6048 5098 gene locus_tag LOCUS_06320 6048 5098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 6004 6198 gene locus_tag LOCUS_06330 6004 6198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 6470 6826 gene locus_tag LOCUS_06340 6470 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 6925 7743 gene locus_tag LOCUS_06350 6925 7743 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545324.1 protein_id gnl|my_center|LOCUS_06350 7743 8381 gene locus_tag LOCUS_06360 gene thiE 7743 8381 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276331.1 protein_id gnl|my_center|LOCUS_06360 8374 9372 gene locus_tag LOCUS_06370 8374 9372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 8976 8984 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9369 10205 gene locus_tag LOCUS_06380 gene thiD 9369 10205 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221739.1 protein_id gnl|my_center|LOCUS_06380 10328 10711 gene locus_tag LOCUS_06390 gene queD 10328 10711 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546681.1 protein_id gnl|my_center|LOCUS_06390 10711 11730 gene locus_tag LOCUS_06400 10711 11730 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083810.1 protein_id gnl|my_center|LOCUS_06400 11720 12727 gene locus_tag LOCUS_06410 11720 12727 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 protein_id gnl|my_center|LOCUS_06410 12729 14297 gene locus_tag LOCUS_06420 12729 14297 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680967.1 protein_id gnl|my_center|LOCUS_06420 14339 16054 gene locus_tag LOCUS_06430 gene pheT 14339 16054 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889759.1 protein_id gnl|my_center|LOCUS_06430 >Feature sequence027 1257 595 gene locus_tag LOCUS_06440 1257 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 2804 1353 gene locus_tag LOCUS_06450 2804 1353 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 protein_id gnl|my_center|LOCUS_06450 3079 5802 gene locus_tag LOCUS_06460 3079 5802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 5813 6544 gene locus_tag LOCUS_06470 5813 6544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 7956 6583 gene locus_tag LOCUS_06480 7956 6583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06480 9782 7857 gene locus_tag LOCUS_06490 9782 7857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 10460 9810 gene locus_tag LOCUS_06500 10460 9810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 15065 10674 gene locus_tag LOCUS_06510 15065 10674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 15102 15395 gene locus_tag LOCUS_06520 15102 15395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 15538 15957 gene locus_tag LOCUS_06530 15538 15957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900634.1 protein_id gnl|my_center|LOCUS_06530 >Feature sequence028 501 2072 gene locus_tag LOCUS_06540 501 2072 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143459.1 protein_id gnl|my_center|LOCUS_06540 2098 3768 gene locus_tag LOCUS_06550 2098 3768 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_06550 5049 3802 gene locus_tag LOCUS_06560 5049 3802 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 protein_id gnl|my_center|LOCUS_06560 5975 5118 gene locus_tag LOCUS_06570 5975 5118 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 protein_id gnl|my_center|LOCUS_06570 6340 6014 gene locus_tag LOCUS_06580 6340 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 7409 6450 gene locus_tag LOCUS_06590 gene pfkB 7409 6450 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640859.1 protein_id gnl|my_center|LOCUS_06590 9857 7509 gene locus_tag LOCUS_06600 9857 7509 CDS product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528921.1 protein_id gnl|my_center|LOCUS_06600 10053 10661 gene locus_tag LOCUS_06610 10053 10661 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229706.1 protein_id gnl|my_center|LOCUS_06610 10658 12301 gene locus_tag LOCUS_06620 gene pgi 10658 12301 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888377.1 protein_id gnl|my_center|LOCUS_06620 12714 12328 gene locus_tag LOCUS_06630 12714 12328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 13342 12863 gene locus_tag LOCUS_06640 13342 12863 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095198.1 protein_id gnl|my_center|LOCUS_06640 13579 14874 gene locus_tag LOCUS_06650 13579 14874 CDS product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706112.1 protein_id gnl|my_center|LOCUS_06650 >Feature sequence029 796 71 gene locus_tag LOCUS_06660 796 71 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545472.1 protein_id gnl|my_center|LOCUS_06660 1983 802 gene locus_tag LOCUS_06670 gene nifV 1983 802 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941605.1 protein_id gnl|my_center|LOCUS_06670 2230 2033 gene locus_tag LOCUS_06680 2230 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 2855 2349 gene locus_tag LOCUS_06690 2855 2349 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087344.1 protein_id gnl|my_center|LOCUS_06690 3424 3002 gene locus_tag LOCUS_06700 3424 3002 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545421.1 protein_id gnl|my_center|LOCUS_06700 3767 3450 gene locus_tag LOCUS_06710 3767 3450 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546547.1 protein_id gnl|my_center|LOCUS_06710 4157 3825 gene locus_tag LOCUS_06720 4157 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 4491 4180 gene locus_tag LOCUS_06730 gene fdxB 4491 4180 CDS product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720698.1 protein_id gnl|my_center|LOCUS_06730 5403 4513 gene locus_tag LOCUS_06740 5403 4513 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533515.1 protein_id gnl|my_center|LOCUS_06740 5669 5409 gene locus_tag LOCUS_06750 5669 5409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 5890 5681 gene locus_tag LOCUS_06760 gene nifT 5890 5681 CDS product putative nitrogen fixation protein NifT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533514.1 protein_id gnl|my_center|LOCUS_06760 6269 5970 gene locus_tag LOCUS_06770 6269 5970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 6591 6253 gene locus_tag LOCUS_06780 6591 6253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 6905 6588 gene locus_tag LOCUS_06790 6905 6588 CDS product nitrogen fixation protein NifZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028153326.1 protein_id gnl|my_center|LOCUS_06790 7248 6931 gene locus_tag LOCUS_06800 7248 6931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 8383 7220 gene locus_tag LOCUS_06810 8383 7220 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_06810 9540 8380 gene locus_tag LOCUS_06820 gene nifS 9540 8380 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_06820 10319 9537 gene locus_tag LOCUS_06830 10319 9537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 10831 10316 gene locus_tag LOCUS_06840 10831 10316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 11219 10836 gene locus_tag LOCUS_06850 11219 10836 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887084.1 protein_id gnl|my_center|LOCUS_06850 11520 11263 gene locus_tag LOCUS_06860 11520 11263 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084462.1 protein_id gnl|my_center|LOCUS_06860 13092 11530 gene locus_tag LOCUS_06870 gene nifB 13092 11530 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084568.1 protein_id gnl|my_center|LOCUS_06870 13608 13147 gene locus_tag LOCUS_06880 13608 13147 CDS product NifX-associated nitrogen fixation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389938.1 protein_id gnl|my_center|LOCUS_06880 14082 13684 gene locus_tag LOCUS_06890 gene nifX 14082 13684 CDS product nitrogen fixation protein NifX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084556.1 protein_id gnl|my_center|LOCUS_06890 <15198 14079 gene locus_tag LOCUS_06900 <15198 14079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084555.1:nitrogenase iron-molybdenum cofactor biosynthesis protein NifN >Feature sequence030 1922 3334 gene locus_tag LOCUS_06910 1922 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 3677 3594 gene locus_tag LOCUS_t00060 3677 3594 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3713 4540 gene locus_tag LOCUS_06920 3713 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 7614 4543 gene locus_tag LOCUS_06930 7614 4543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 9473 7614 gene locus_tag LOCUS_06940 gene uvrC 9473 7614 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_06940 9733 9912 gene locus_tag LOCUS_06950 9733 9912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 10831 9920 gene locus_tag LOCUS_06960 gene ftsY 10831 9920 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232026.1 protein_id gnl|my_center|LOCUS_06960 11349 10831 gene locus_tag LOCUS_06970 gene ybeY 11349 10831 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880869.1 protein_id gnl|my_center|LOCUS_06970 12387 11359 gene locus_tag LOCUS_06980 12387 11359 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545286.1 protein_id gnl|my_center|LOCUS_06980 12920 12387 gene locus_tag LOCUS_06990 12920 12387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 13689 13099 gene locus_tag LOCUS_07000 13689 13099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 14853 13966 gene locus_tag LOCUS_07010 14853 13966 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730867.1 protein_id gnl|my_center|LOCUS_07010 >Feature sequence031 29 928 gene locus_tag LOCUS_07020 29 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 1019 1186 gene locus_tag LOCUS_07030 1019 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 1232 1771 gene locus_tag LOCUS_07040 1232 1771 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392381.1 protein_id gnl|my_center|LOCUS_07040 2745 2131 gene locus_tag LOCUS_07050 2745 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 3691 2885 gene locus_tag LOCUS_07060 gene pgl 3691 2885 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939587.1 protein_id gnl|my_center|LOCUS_07060 4785 3688 gene locus_tag LOCUS_07070 gene glk 4785 3688 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812576.1 protein_id gnl|my_center|LOCUS_07070 5004 6020 gene locus_tag LOCUS_07080 gene hpnH 5004 6020 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056444.1 protein_id gnl|my_center|LOCUS_07080 6042 6716 gene locus_tag LOCUS_07090 6042 6716 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080979.1 protein_id gnl|my_center|LOCUS_07090 8121 6727 gene locus_tag LOCUS_07100 gene hemG 8121 6727 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256541.1 protein_id gnl|my_center|LOCUS_07100 8520 9914 gene locus_tag LOCUS_07110 8520 9914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 9981 10586 gene locus_tag LOCUS_07120 gene clpP 9981 10586 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392065.1 protein_id gnl|my_center|LOCUS_07120 10615 11922 gene locus_tag LOCUS_07130 gene clpX 10615 11922 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_07130 12565 11942 gene locus_tag LOCUS_07140 12565 11942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 12593 13954 gene locus_tag LOCUS_07150 12593 13954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 13961 14515 gene locus_tag LOCUS_07160 13961 14515 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086898.1 protein_id gnl|my_center|LOCUS_07160 >Feature sequence032 125 628 gene locus_tag LOCUS_07170 125 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 648 1679 gene locus_tag LOCUS_07180 648 1679 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_07180 1688 2548 gene locus_tag LOCUS_07190 gene mreC 1688 2548 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116449.1 protein_id gnl|my_center|LOCUS_07190 2545 3060 gene locus_tag LOCUS_07200 2545 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 2999 4879 gene locus_tag LOCUS_07210 gene mrdA 2999 4879 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545126.1 protein_id gnl|my_center|LOCUS_07210 4897 5988 gene locus_tag LOCUS_07220 gene rodA 4897 5988 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_07220 6119 7678 gene locus_tag LOCUS_07230 gene rng 6119 7678 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_07230 7707 8189 gene locus_tag LOCUS_07240 7707 8189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 8193 8609 gene locus_tag LOCUS_07250 8193 8609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 8606 9445 gene locus_tag LOCUS_07260 8606 9445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 9686 9940 gene locus_tag LOCUS_07270 9686 9940 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763614.1 protein_id gnl|my_center|LOCUS_07270 9997 11880 gene locus_tag LOCUS_07280 9997 11880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 11913 12359 gene locus_tag LOCUS_07290 gene rplM 11913 12359 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250038.1 protein_id gnl|my_center|LOCUS_07290 12359 12766 gene locus_tag LOCUS_07300 gene rpsI 12359 12766 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939789.1 protein_id gnl|my_center|LOCUS_07300 12839 13870 gene locus_tag LOCUS_07310 gene argC 12839 13870 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_07310 14193 14202 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence033 705 2792 gene locus_tag LOCUS_07320 705 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 3703 2918 gene locus_tag LOCUS_07330 3703 2918 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288522.1 protein_id gnl|my_center|LOCUS_07330 6063 3700 gene locus_tag LOCUS_07340 6063 3700 CDS product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528921.1 protein_id gnl|my_center|LOCUS_07340 7530 6142 gene locus_tag LOCUS_07350 7530 6142 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978673.1 protein_id gnl|my_center|LOCUS_07350 7784 7548 gene locus_tag LOCUS_07360 7784 7548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 7888 7986 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8588 8719 gene locus_tag LOCUS_07370 8588 8719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 9242 8967 gene locus_tag LOCUS_07380 9242 8967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 12263 10296 gene locus_tag LOCUS_07390 12263 10296 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880620.1 protein_id gnl|my_center|LOCUS_07390 13045 12260 gene locus_tag LOCUS_07400 13045 12260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 13601 13281 gene locus_tag LOCUS_07410 13601 13281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 >Feature sequence034 198 872 gene locus_tag LOCUS_07420 198 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 1147 1920 gene locus_tag LOCUS_07430 gene rpsB 1147 1920 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942566.1 protein_id gnl|my_center|LOCUS_07430 2024 2620 gene locus_tag LOCUS_07440 gene tsf 2024 2620 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082052.1 protein_id gnl|my_center|LOCUS_07440 2620 3327 gene locus_tag LOCUS_07450 gene pyrH 2620 3327 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_07450 3358 3912 gene locus_tag LOCUS_07460 gene frr 3358 3912 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545660.1 protein_id gnl|my_center|LOCUS_07460 3917 5140 gene locus_tag LOCUS_07470 gene alr 3917 5140 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_07470 5109 5882 gene locus_tag LOCUS_07480 5109 5882 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880179.1 protein_id gnl|my_center|LOCUS_07480 5870 6673 gene locus_tag LOCUS_07490 5870 6673 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433117.1 protein_id gnl|my_center|LOCUS_07490 6720 8282 gene locus_tag LOCUS_07500 6720 8282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 8447 10000 gene locus_tag LOCUS_07510 8447 10000 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393686.1 protein_id gnl|my_center|LOCUS_07510 10103 10954 gene locus_tag LOCUS_07520 gene ccsB 10103 10954 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941276.1 protein_id gnl|my_center|LOCUS_07520 10973 11572 gene locus_tag LOCUS_07530 10973 11572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 11598 12170 gene locus_tag LOCUS_07540 11598 12170 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388157.1 protein_id gnl|my_center|LOCUS_07540 12170 12919 gene locus_tag LOCUS_07550 12170 12919 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_07550 12933 14177 gene locus_tag LOCUS_07560 12933 14177 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064950.1 protein_id gnl|my_center|LOCUS_07560 >Feature sequence035 <1 2536 gene locus_tag LOCUS_07570 <1 2536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164925941.1:EAL domain-containing protein 3596 2547 gene locus_tag LOCUS_07580 3596 2547 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072122.1 protein_id gnl|my_center|LOCUS_07580 4156 3806 gene locus_tag LOCUS_07590 gene rplT 4156 3806 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004727974.1 protein_id gnl|my_center|LOCUS_07590 4431 4231 gene locus_tag LOCUS_07600 gene rpmI 4431 4231 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679992.1 protein_id gnl|my_center|LOCUS_07600 4855 4508 gene locus_tag LOCUS_07610 4855 4508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 4769 5098 gene locus_tag LOCUS_07620 4769 5098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 6881 5118 gene locus_tag LOCUS_07630 gene thrS 6881 5118 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_07630 7291 8190 gene locus_tag LOCUS_07640 7291 8190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 9032 8841 gene locus_tag LOCUS_07650 9032 8841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 9132 9320 gene locus_tag LOCUS_07660 9132 9320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 9365 11335 gene locus_tag LOCUS_07670 9365 11335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 11845 11339 gene locus_tag LOCUS_07680 11845 11339 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_07680 12189 12512 gene locus_tag LOCUS_07690 gene rplU 12189 12512 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388997.1 protein_id gnl|my_center|LOCUS_07690 12527 12811 gene locus_tag LOCUS_07700 gene rpmA 12527 12811 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222623.1 protein_id gnl|my_center|LOCUS_07700 12863 13903 gene locus_tag LOCUS_07710 gene obgE 12863 13903 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881354.1 protein_id gnl|my_center|LOCUS_07710 >Feature sequence036 313 630 gene locus_tag LOCUS_07720 313 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 811 1083 gene locus_tag LOCUS_07730 811 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 3390 1048 gene locus_tag LOCUS_07740 3390 1048 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673989.1 protein_id gnl|my_center|LOCUS_07740 3944 3399 gene locus_tag LOCUS_07750 3944 3399 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727452.1 protein_id gnl|my_center|LOCUS_07750 4290 4475 gene locus_tag LOCUS_07760 4290 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 4668 5537 gene locus_tag LOCUS_07770 4668 5537 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082894.1 protein_id gnl|my_center|LOCUS_07770 5534 7720 gene locus_tag LOCUS_07780 gene glyS 5534 7720 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460837.1 protein_id gnl|my_center|LOCUS_07780 7717 8877 gene locus_tag LOCUS_07790 gene ribD 7717 8877 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_07790 8921 9553 gene locus_tag LOCUS_07800 8921 9553 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123705.1 protein_id gnl|my_center|LOCUS_07800 9546 9752 gene locus_tag LOCUS_07810 9546 9752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 9752 10528 gene locus_tag LOCUS_07820 gene cobI 9752 10528 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392605.1 protein_id gnl|my_center|LOCUS_07820 10513 11034 gene locus_tag LOCUS_07830 10513 11034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 11034 11849 gene locus_tag LOCUS_07840 gene cobM 11034 11849 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812298.1 protein_id gnl|my_center|LOCUS_07840 12158 12991 gene locus_tag LOCUS_07850 12158 12991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 13178 13534 gene locus_tag LOCUS_07860 13178 13534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 >Feature sequence037 2925 1426 gene locus_tag LOCUS_07870 2925 1426 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967804.1 protein_id gnl|my_center|LOCUS_07870 4963 3032 gene locus_tag LOCUS_07880 gene nuoL 4963 3032 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546379.1 protein_id gnl|my_center|LOCUS_07880 5288 4986 gene locus_tag LOCUS_07890 gene nuoK 5288 4986 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941016.1 protein_id gnl|my_center|LOCUS_07890 5840 5322 gene locus_tag LOCUS_07900 5840 5322 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329056.1 protein_id gnl|my_center|LOCUS_07900 6392 5844 gene locus_tag LOCUS_07910 gene nuoI 6392 5844 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186558.1 protein_id gnl|my_center|LOCUS_07910 7538 6453 gene locus_tag LOCUS_07920 gene nuoH 7538 6453 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017378.1 protein_id gnl|my_center|LOCUS_07920 10047 7597 gene locus_tag LOCUS_07930 10047 7597 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941177.1 protein_id gnl|my_center|LOCUS_07930 9943 11118 gene locus_tag LOCUS_07940 gene nuoD 9943 11118 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_07940 11248 11775 gene locus_tag LOCUS_07950 gene nuoE 11248 11775 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_07950 11912 13765 gene locus_tag LOCUS_07960 gene nuoF 11912 13765 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 protein_id gnl|my_center|LOCUS_07960 >Feature sequence038 <1 768 gene locus_tag LOCUS_07970 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615854.1:efflux RND transporter periplasmic adaptor subunit 818 3994 gene locus_tag LOCUS_07980 818 3994 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140878.1 protein_id gnl|my_center|LOCUS_07980 5089 4076 gene locus_tag LOCUS_07990 5089 4076 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258471.1 protein_id gnl|my_center|LOCUS_07990 5419 5515 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5576 6526 gene locus_tag LOCUS_08000 5576 6526 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140877.1 protein_id gnl|my_center|LOCUS_08000 6584 8107 gene locus_tag LOCUS_08010 6584 8107 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212583.1 protein_id gnl|my_center|LOCUS_08010 8200 9144 gene locus_tag LOCUS_08020 gene trxB 8200 9144 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975041.1 protein_id gnl|my_center|LOCUS_08020 9151 9633 gene locus_tag LOCUS_08030 9151 9633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 9611 10852 gene locus_tag LOCUS_08040 9611 10852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 10937 12328 gene locus_tag LOCUS_08050 10937 12328 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021944.1 protein_id gnl|my_center|LOCUS_08050 12730 13266 gene locus_tag LOCUS_08060 12730 13266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 >Feature sequence039 515 66 gene locus_tag LOCUS_08070 515 66 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940846.1 protein_id gnl|my_center|LOCUS_08070 649 512 gene locus_tag LOCUS_08080 649 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 1345 848 gene locus_tag LOCUS_08090 1345 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 3094 3735 gene locus_tag LOCUS_08100 3094 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 4396 3761 gene locus_tag LOCUS_08110 4396 3761 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198059.1 protein_id gnl|my_center|LOCUS_08110 5757 4393 gene locus_tag LOCUS_08120 gene pmbA 5757 4393 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567741.1 protein_id gnl|my_center|LOCUS_08120 7257 5809 gene locus_tag LOCUS_08130 gene tldD 7257 5809 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037736.1 protein_id gnl|my_center|LOCUS_08130 7519 8622 gene locus_tag LOCUS_08140 7519 8622 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031746.1 protein_id gnl|my_center|LOCUS_08140 9548 8592 gene locus_tag LOCUS_08150 gene hpnC 9548 8592 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040123.1 protein_id gnl|my_center|LOCUS_08150 10957 9545 gene locus_tag LOCUS_08160 gene hpnE 10957 9545 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085787.1 protein_id gnl|my_center|LOCUS_08160 11859 10954 gene locus_tag LOCUS_08170 gene hpnD 11859 10954 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930256.1 protein_id gnl|my_center|LOCUS_08170 <13463 12350 gene locus_tag LOCUS_08180 <13463 12350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941702.1:methyl-accepting chemotaxis protein >Feature sequence040 786 88 gene locus_tag LOCUS_08190 786 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 1481 786 gene locus_tag LOCUS_08200 1481 786 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583200.1 protein_id gnl|my_center|LOCUS_08200 2039 1488 gene locus_tag LOCUS_08210 2039 1488 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404734.1 protein_id gnl|my_center|LOCUS_08210 2289 3341 gene locus_tag LOCUS_08220 2289 3341 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817249.1 protein_id gnl|my_center|LOCUS_08220 3357 4088 gene locus_tag LOCUS_08230 3357 4088 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057263.1 protein_id gnl|my_center|LOCUS_08230 4181 5209 gene locus_tag LOCUS_08240 gene fliM 4181 5209 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938209.1 protein_id gnl|my_center|LOCUS_08240 5576 5501 gene locus_tag LOCUS_t00070 5576 5501 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 6091 5663 gene locus_tag LOCUS_08250 6091 5663 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393898.1 protein_id gnl|my_center|LOCUS_08250 6213 7385 gene locus_tag LOCUS_08260 gene nifS 6213 7385 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861166.1 protein_id gnl|my_center|LOCUS_08260 7398 8282 gene locus_tag LOCUS_08270 7398 8282 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921431.1 protein_id gnl|my_center|LOCUS_08270 8282 9052 gene locus_tag LOCUS_08280 8282 9052 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231012.1 protein_id gnl|my_center|LOCUS_08280 9158 9514 gene locus_tag LOCUS_08290 9158 9514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 9557 9763 gene locus_tag LOCUS_08300 9557 9763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 9828 9904 gene locus_tag LOCUS_t00080 9828 9904 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10512 9931 gene locus_tag LOCUS_08310 10512 9931 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085913.1 protein_id gnl|my_center|LOCUS_08310 11804 10629 gene locus_tag LOCUS_08320 11804 10629 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550333.1 protein_id gnl|my_center|LOCUS_08320 >Feature sequence041 1441 902 gene locus_tag LOCUS_08330 1441 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 1418 1615 gene locus_tag LOCUS_08340 1418 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 2277 1627 gene locus_tag LOCUS_08350 2277 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 2607 2682 gene locus_tag LOCUS_t00090 2607 2682 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2705 3382 gene locus_tag LOCUS_08360 2705 3382 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140258.1 protein_id gnl|my_center|LOCUS_08360 3902 3357 gene locus_tag LOCUS_08370 3902 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 4108 3905 gene locus_tag LOCUS_08380 4108 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 5308 4127 gene locus_tag LOCUS_08390 5308 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 5436 5831 gene locus_tag LOCUS_08400 5436 5831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 7512 5854 gene locus_tag LOCUS_08410 7512 5854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08410 7624 7890 gene locus_tag LOCUS_08420 7624 7890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 8528 8995 gene locus_tag LOCUS_08430 8528 8995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 9094 9630 gene locus_tag LOCUS_08440 9094 9630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 10090 10458 gene locus_tag LOCUS_08450 10090 10458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 10951 10427 gene locus_tag LOCUS_08460 10951 10427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 11924 10932 gene locus_tag LOCUS_08470 gene thiL 11924 10932 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_08470 12815 11937 gene locus_tag LOCUS_08480 gene galU 12815 11937 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941523.1 protein_id gnl|my_center|LOCUS_08480 <13341 12812 gene locus_tag LOCUS_08490 <13341 12812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002387006.1:dephospho-CoA kinase >Feature sequence042 182 466 gene locus_tag LOCUS_08500 182 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 463 1626 gene locus_tag LOCUS_08510 463 1626 CDS product DUF3443 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192528.1 protein_id gnl|my_center|LOCUS_08510 1669 2124 gene locus_tag LOCUS_08520 1669 2124 CDS product DUF2844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535926.1 protein_id gnl|my_center|LOCUS_08520 2207 3676 gene locus_tag LOCUS_08530 2207 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 3867 5657 gene locus_tag LOCUS_08540 3867 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 5663 6727 gene locus_tag LOCUS_08550 5663 6727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 7008 8111 gene locus_tag LOCUS_08560 7008 8111 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461712.1 protein_id gnl|my_center|LOCUS_08560 8114 9142 gene locus_tag LOCUS_08570 8114 9142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 9260 9682 gene locus_tag LOCUS_08580 9260 9682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 9722 10339 gene locus_tag LOCUS_08590 9722 10339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 10641 11456 gene locus_tag LOCUS_08600 10641 11456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 12931 11756 gene locus_tag LOCUS_08610 12931 11756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 >Feature sequence043 1615 20 gene locus_tag LOCUS_08620 1615 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 2303 1617 gene locus_tag LOCUS_08630 2303 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 3094 2537 gene locus_tag LOCUS_08640 3094 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 4065 3268 gene locus_tag LOCUS_08650 4065 3268 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880039.1 protein_id gnl|my_center|LOCUS_08650 6084 4162 gene locus_tag LOCUS_08660 6084 4162 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144073.1 protein_id gnl|my_center|LOCUS_08660 6483 6319 gene locus_tag LOCUS_08670 6483 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 7498 6515 gene locus_tag LOCUS_08680 7498 6515 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930782.1 protein_id gnl|my_center|LOCUS_08680 8778 7528 gene locus_tag LOCUS_08690 8778 7528 CDS product succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880832.1 protein_id gnl|my_center|LOCUS_08690 9373 9999 gene locus_tag LOCUS_08700 gene lexA 9373 9999 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942262.1 protein_id gnl|my_center|LOCUS_08700 10239 10652 gene locus_tag LOCUS_08710 10239 10652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 10652 10927 gene locus_tag LOCUS_08720 10652 10927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 >Feature sequence044 69 404 gene locus_tag LOCUS_08730 69 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 575 2218 gene locus_tag LOCUS_08740 575 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 2215 2679 gene locus_tag LOCUS_08750 2215 2679 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389344.1 protein_id gnl|my_center|LOCUS_08750 2684 4807 gene locus_tag LOCUS_08760 2684 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 4931 6412 gene locus_tag LOCUS_08770 gene glgA 4931 6412 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_08770 6579 6445 gene locus_tag LOCUS_08780 6579 6445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 7325 6612 gene locus_tag LOCUS_08790 7325 6612 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584159.1 protein_id gnl|my_center|LOCUS_08790 7806 9215 gene locus_tag LOCUS_08800 7806 9215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 9451 9651 gene locus_tag LOCUS_08810 9451 9651 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991299.1 protein_id gnl|my_center|LOCUS_08810 9875 10456 gene locus_tag LOCUS_08820 9875 10456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 10464 10835 gene locus_tag LOCUS_08830 gene gspI 10464 10835 CDS product type II secretion system minor pseudopilin GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639899.1 protein_id gnl|my_center|LOCUS_08830 10903 11547 gene locus_tag LOCUS_08840 10903 11547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 11891 12175 gene locus_tag LOCUS_08850 11891 12175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 <13066 12180 gene locus_tag LOCUS_08860 <13066 12180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000826423.1:RNA-guided endonuclease TnpB family protein >Feature sequence045 1029 778 gene locus_tag LOCUS_08870 1029 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 1837 1073 gene locus_tag LOCUS_08880 1837 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 2441 1902 gene locus_tag LOCUS_08890 2441 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 5039 3327 gene locus_tag LOCUS_08900 5039 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 6745 5036 gene locus_tag LOCUS_08910 6745 5036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 6936 6754 gene locus_tag LOCUS_08920 6936 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 7352 6999 gene locus_tag LOCUS_08930 7352 6999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 7650 7339 gene locus_tag LOCUS_08940 7650 7339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 8424 7726 gene locus_tag LOCUS_08950 8424 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 8630 8451 gene locus_tag LOCUS_08960 8630 8451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 9031 8666 gene locus_tag LOCUS_08970 9031 8666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 9224 9042 gene locus_tag LOCUS_08980 9224 9042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 10505 9363 gene locus_tag LOCUS_08990 10505 9363 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207588.1 protein_id gnl|my_center|LOCUS_08990 11233 10631 gene locus_tag LOCUS_09000 11233 10631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 11568 11230 gene locus_tag LOCUS_09010 11568 11230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 12086 11580 gene locus_tag LOCUS_09020 12086 11580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 12456 12118 gene locus_tag LOCUS_09030 12456 12118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 12660 12871 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggaacacccccacatgcgtggggaagact >Feature sequence046 477 1994 gene locus_tag LOCUS_09040 477 1994 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545143.1 protein_id gnl|my_center|LOCUS_09040 2053 2526 gene locus_tag LOCUS_09050 2053 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 2709 3161 gene locus_tag LOCUS_09060 2709 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 3133 3501 gene locus_tag LOCUS_09070 3133 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09070 3455 4180 gene locus_tag LOCUS_09080 3455 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09080 4882 4202 gene locus_tag LOCUS_09090 4882 4202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 4944 5768 gene locus_tag LOCUS_09100 4944 5768 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258850.1 protein_id gnl|my_center|LOCUS_09100 5854 6162 gene locus_tag LOCUS_09110 5854 6162 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258292.1 protein_id gnl|my_center|LOCUS_09110 6155 7189 gene locus_tag LOCUS_09120 6155 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_09120 7165 8082 gene locus_tag LOCUS_09130 7165 8082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 8079 9026 gene locus_tag LOCUS_09140 8079 9026 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085438.1 protein_id gnl|my_center|LOCUS_09140 9262 8963 gene locus_tag LOCUS_09150 9262 8963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 9221 9529 gene locus_tag LOCUS_09160 9221 9529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 9526 9933 gene locus_tag LOCUS_09170 9526 9933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 9970 11013 gene locus_tag LOCUS_09180 gene fbp 9970 11013 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056391.1 protein_id gnl|my_center|LOCUS_09180 12500 11010 gene locus_tag LOCUS_09190 12500 11010 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223099.1 protein_id gnl|my_center|LOCUS_09190 >Feature sequence047 2044 1526 gene locus_tag LOCUS_09200 gene rfaE2 2044 1526 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880070.1 protein_id gnl|my_center|LOCUS_09200 2658 2065 gene locus_tag LOCUS_09210 2658 2065 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546496.1 protein_id gnl|my_center|LOCUS_09210 3764 2685 gene locus_tag LOCUS_09220 gene hemL 3764 2685 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880497.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09220 4289 4528 gene locus_tag LOCUS_09230 4289 4528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 5718 4855 gene locus_tag LOCUS_09240 5718 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 6466 5813 gene locus_tag LOCUS_09250 6466 5813 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705502.1 protein_id gnl|my_center|LOCUS_09250 6676 7269 gene locus_tag LOCUS_09260 6676 7269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 7310 7594 gene locus_tag LOCUS_09270 7310 7594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 7628 8032 gene locus_tag LOCUS_09280 7628 8032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 8442 9662 gene locus_tag LOCUS_09290 8442 9662 CDS product ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880756.1 protein_id gnl|my_center|LOCUS_09290 9655 10548 gene locus_tag LOCUS_09300 9655 10548 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880757.1 protein_id gnl|my_center|LOCUS_09300 10564 11256 gene locus_tag LOCUS_09310 10564 11256 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880758.1 protein_id gnl|my_center|LOCUS_09310 11284 11496 gene locus_tag LOCUS_09320 11284 11496 CDS product ferredoxin oxidoreductase 2 subunit ForD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880734.1 protein_id gnl|my_center|LOCUS_09320 11581 11838 gene locus_tag LOCUS_09330 11581 11838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 12664 11885 gene locus_tag LOCUS_09340 12664 11885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 >Feature sequence048 1700 204 gene locus_tag LOCUS_09350 1700 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 2628 1663 gene locus_tag LOCUS_09360 2628 1663 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390713.1 protein_id gnl|my_center|LOCUS_09360 3605 2625 gene locus_tag LOCUS_09370 gene hemB 3605 2625 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_09370 5317 3602 gene locus_tag LOCUS_09380 gene cobA 5317 3602 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_09380 6317 5370 gene locus_tag LOCUS_09390 gene hemC 6317 5370 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208189.1 protein_id gnl|my_center|LOCUS_09390 7690 6311 gene locus_tag LOCUS_09400 gene hemA 7690 6311 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546522.1 protein_id gnl|my_center|LOCUS_09400 8591 7743 gene locus_tag LOCUS_09410 8591 7743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 8843 10216 gene locus_tag LOCUS_09420 8843 10216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 10308 11567 gene locus_tag LOCUS_09430 10308 11567 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942398.1 protein_id gnl|my_center|LOCUS_09430 11564 12313 gene locus_tag LOCUS_09440 gene bluB 11564 12313 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975712.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence049 1724 660 gene locus_tag LOCUS_09450 gene thrC 1724 660 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546273.1 protein_id gnl|my_center|LOCUS_09450 3073 1724 gene locus_tag LOCUS_09460 3073 1724 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942336.1 protein_id gnl|my_center|LOCUS_09460 3782 3099 gene locus_tag LOCUS_09470 3782 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 5068 3782 gene locus_tag LOCUS_09480 5068 3782 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938190.1 protein_id gnl|my_center|LOCUS_09480 5018 5027 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5396 5566 gene locus_tag LOCUS_09490 5396 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 6580 5963 gene locus_tag LOCUS_09500 6580 5963 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225626.1 protein_id gnl|my_center|LOCUS_09500 6725 7294 gene locus_tag LOCUS_09510 6725 7294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 7437 7258 gene locus_tag LOCUS_09520 7437 7258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 7716 7958 gene locus_tag LOCUS_09530 7716 7958 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140635.1 protein_id gnl|my_center|LOCUS_09530 8154 8250 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8377 8559 gene locus_tag LOCUS_09540 8377 8559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 8582 9823 gene locus_tag LOCUS_09550 8582 9823 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310055.1 protein_id gnl|my_center|LOCUS_09550 9941 10327 gene locus_tag LOCUS_09560 9941 10327 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140634.1 protein_id gnl|my_center|LOCUS_09560 10604 10529 gene locus_tag LOCUS_t00100 10604 10529 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence050 378 617 gene locus_tag LOCUS_09570 378 617 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770970.1 protein_id gnl|my_center|LOCUS_09570 757 1035 gene locus_tag LOCUS_09580 757 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09580 1803 1264 gene locus_tag LOCUS_09590 1803 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 5080 2168 gene locus_tag LOCUS_09600 5080 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 6221 5373 gene locus_tag LOCUS_09610 6221 5373 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_09610 6981 6319 gene locus_tag LOCUS_09620 6981 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 7400 6981 gene locus_tag LOCUS_09630 7400 6981 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_09630 8220 7489 gene locus_tag LOCUS_09640 8220 7489 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069550.1 protein_id gnl|my_center|LOCUS_09640 8586 8750 gene locus_tag LOCUS_09650 8586 8750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 10931 9678 gene locus_tag LOCUS_09660 10931 9678 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_09660 12090 11236 gene locus_tag LOCUS_09670 12090 11236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 >Feature sequence051 <1 2424 gene locus_tag LOCUS_09680 <1 2424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122252.1:DEAD/DEAH box helicase 2918 2439 gene locus_tag LOCUS_09690 2918 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 4679 2922 gene locus_tag LOCUS_09700 gene dnaK 4679 2922 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582444.1 protein_id gnl|my_center|LOCUS_09700 5359 4667 gene locus_tag LOCUS_09710 5359 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 5649 5356 gene locus_tag LOCUS_09720 5649 5356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 8006 5646 gene locus_tag LOCUS_09730 8006 5646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 9294 8215 gene locus_tag LOCUS_09740 9294 8215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 11950 9299 gene locus_tag LOCUS_09750 11950 9299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 >Feature sequence052 1742 27 gene locus_tag LOCUS_09760 1742 27 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_09760 2737 1733 gene locus_tag LOCUS_09770 gene porB 2737 1733 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020090.1 protein_id gnl|my_center|LOCUS_09770 3956 2748 gene locus_tag LOCUS_09780 3956 2748 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879197.1 protein_id gnl|my_center|LOCUS_09780 4542 3949 gene locus_tag LOCUS_09790 4542 3949 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_09790 4723 5838 gene locus_tag LOCUS_09800 4723 5838 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027268647.1 protein_id gnl|my_center|LOCUS_09800 5828 6655 gene locus_tag LOCUS_09810 5828 6655 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948171.1 protein_id gnl|my_center|LOCUS_09810 6658 7485 gene locus_tag LOCUS_09820 6658 7485 CDS product sulfhydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948170.1 protein_id gnl|my_center|LOCUS_09820 7475 8770 gene locus_tag LOCUS_09830 7475 8770 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948169.1 protein_id gnl|my_center|LOCUS_09830 8767 9303 gene locus_tag LOCUS_09840 8767 9303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 10231 9806 gene locus_tag LOCUS_09850 gene zntR 10231 9806 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174611.1 protein_id gnl|my_center|LOCUS_09850 11916 10264 gene locus_tag LOCUS_09860 gene merA 11916 10264 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281123.1 protein_id gnl|my_center|LOCUS_09860 >Feature sequence053 455 1714 gene locus_tag LOCUS_09870 455 1714 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135257956.1 protein_id gnl|my_center|LOCUS_09870 4481 2757 gene locus_tag LOCUS_09880 4481 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 5197 4484 gene locus_tag LOCUS_09890 5197 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 5766 5203 gene locus_tag LOCUS_09900 5766 5203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 8683 6371 gene locus_tag LOCUS_09910 8683 6371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 9177 8680 gene locus_tag LOCUS_09920 9177 8680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 10303 10013 gene locus_tag LOCUS_09930 10303 10013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 11154 10699 gene locus_tag LOCUS_09940 11154 10699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 11383 11688 gene locus_tag LOCUS_09950 11383 11688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 >Feature sequence054 1007 258 gene locus_tag LOCUS_09960 1007 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 1029 1361 gene locus_tag LOCUS_09970 1029 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 3172 1886 gene locus_tag LOCUS_09980 3172 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 3723 3313 gene locus_tag LOCUS_09990 3723 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 4737 3796 gene locus_tag LOCUS_10000 4737 3796 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812827.1 protein_id gnl|my_center|LOCUS_10000 5132 6133 gene locus_tag LOCUS_10010 5132 6133 CDS product PDC sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852871.1 protein_id gnl|my_center|LOCUS_10010 8417 7230 gene locus_tag LOCUS_10020 8417 7230 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943777.1 protein_id gnl|my_center|LOCUS_10020 9342 10574 gene locus_tag LOCUS_10030 gene lhgO 9342 10574 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546485.1 protein_id gnl|my_center|LOCUS_10030 10675 11406 gene locus_tag LOCUS_10040 10675 11406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 >Feature sequence055 265 1218 gene locus_tag LOCUS_10050 265 1218 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014254.1 protein_id gnl|my_center|LOCUS_10050 1954 1517 gene locus_tag LOCUS_10060 1954 1517 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970109.1 protein_id gnl|my_center|LOCUS_10060 2212 3579 gene locus_tag LOCUS_10070 2212 3579 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 protein_id gnl|my_center|LOCUS_10070 4124 3786 gene locus_tag LOCUS_10080 4124 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 4817 4245 gene locus_tag LOCUS_10090 4817 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 5572 5156 gene locus_tag LOCUS_10100 5572 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 6686 5814 gene locus_tag LOCUS_10110 6686 5814 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066520.1 protein_id gnl|my_center|LOCUS_10110 7037 6774 gene locus_tag LOCUS_10120 7037 6774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 7261 7034 gene locus_tag LOCUS_10130 7261 7034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 7455 8339 gene locus_tag LOCUS_10140 7455 8339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053699.1 protein_id gnl|my_center|LOCUS_10140 10326 8980 gene locus_tag LOCUS_10150 10326 8980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 10927 10658 gene locus_tag LOCUS_10160 10927 10658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 11194 10973 gene locus_tag LOCUS_10170 11194 10973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 11886 11140 gene locus_tag LOCUS_10180 11886 11140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 >Feature sequence056 837 2225 gene locus_tag LOCUS_10190 gene amrB 837 2225 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444593.1 protein_id gnl|my_center|LOCUS_10190 2222 3307 gene locus_tag LOCUS_10200 gene amrS 2222 3307 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444592.1 protein_id gnl|my_center|LOCUS_10200 3770 3324 gene locus_tag LOCUS_10210 3770 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 4303 5469 gene locus_tag LOCUS_10220 4303 5469 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309930.1 protein_id gnl|my_center|LOCUS_10220 5736 7106 gene locus_tag LOCUS_10230 gene serS 5736 7106 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391570.1 protein_id gnl|my_center|LOCUS_10230 7111 7482 gene locus_tag LOCUS_10240 7111 7482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 7490 8155 gene locus_tag LOCUS_10250 7490 8155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 8152 8388 gene locus_tag LOCUS_10260 8152 8388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 10266 11351 gene locus_tag LOCUS_10270 10266 11351 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943777.1 protein_id gnl|my_center|LOCUS_10270 >Feature sequence057 1490 1398 gene locus_tag LOCUS_t00110 1490 1398 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1879 1628 gene locus_tag LOCUS_10280 1879 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 2213 1890 gene locus_tag LOCUS_10290 2213 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 2553 2251 gene locus_tag LOCUS_10300 2553 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 3491 2565 gene locus_tag LOCUS_10310 3491 2565 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933671.1 protein_id gnl|my_center|LOCUS_10310 3709 4767 gene locus_tag LOCUS_10320 3709 4767 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072122.1 protein_id gnl|my_center|LOCUS_10320 4940 4848 gene locus_tag LOCUS_t00120 4940 4848 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5148 5063 gene locus_tag LOCUS_t00130 5148 5063 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6032 5112 gene locus_tag LOCUS_10330 6032 5112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 6101 6862 gene locus_tag LOCUS_10340 6101 6862 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142151.1 protein_id gnl|my_center|LOCUS_10340 6859 7335 gene locus_tag LOCUS_10350 gene tadA 6859 7335 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370298.1 protein_id gnl|my_center|LOCUS_10350 7589 7380 gene locus_tag LOCUS_10360 7589 7380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 9097 7730 gene locus_tag LOCUS_10370 9097 7730 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940219.1 protein_id gnl|my_center|LOCUS_10370 9237 9148 gene locus_tag LOCUS_t00140 9237 9148 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9508 9873 gene locus_tag LOCUS_10380 gene dksA 9508 9873 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940956.1 protein_id gnl|my_center|LOCUS_10380 9879 10595 gene locus_tag LOCUS_10390 9879 10595 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208030.1 protein_id gnl|my_center|LOCUS_10390 >Feature sequence058 315 127 gene locus_tag LOCUS_10400 315 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 335 550 gene locus_tag LOCUS_10410 335 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 544 756 gene locus_tag LOCUS_10420 544 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 957 1532 gene locus_tag LOCUS_10430 957 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 1827 1576 gene locus_tag LOCUS_10440 1827 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 2143 3387 gene locus_tag LOCUS_10450 2143 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 4433 3606 gene locus_tag LOCUS_10460 4433 3606 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742118.1 protein_id gnl|my_center|LOCUS_10460 4565 5107 gene locus_tag LOCUS_10470 4565 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 5265 5426 gene locus_tag LOCUS_10480 5265 5426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 5423 5611 gene locus_tag LOCUS_10490 5423 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 6287 5574 gene locus_tag LOCUS_10500 6287 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 6653 6862 gene locus_tag LOCUS_10510 6653 6862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 7433 6879 gene locus_tag LOCUS_10520 7433 6879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 8080 8532 gene locus_tag LOCUS_10530 8080 8532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 9030 8824 gene locus_tag LOCUS_10540 9030 8824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 9569 9084 gene locus_tag LOCUS_10550 9569 9084 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948596.1 protein_id gnl|my_center|LOCUS_10550 10506 9742 gene locus_tag LOCUS_10560 10506 9742 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257316.1 protein_id gnl|my_center|LOCUS_10560 >Feature sequence059 388 3552 gene locus_tag LOCUS_10570 388 3552 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_10570 3583 4212 gene locus_tag LOCUS_10580 3583 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 5077 4394 gene locus_tag LOCUS_10590 5077 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 5597 5205 gene locus_tag LOCUS_10600 5597 5205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 7669 5597 gene locus_tag LOCUS_10610 7669 5597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 8592 7690 gene locus_tag LOCUS_10620 8592 7690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 8771 8589 gene locus_tag LOCUS_10630 8771 8589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 9830 8889 gene locus_tag LOCUS_10640 9830 8889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 11035 9827 gene locus_tag LOCUS_10650 11035 9827 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938819.1 protein_id gnl|my_center|LOCUS_10650 >Feature sequence060 <1 665 gene locus_tag LOCUS_10660 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119486.1:DDE-type integrase/transposase/recombinase 1373 1290 gene locus_tag LOCUS_t00150 1373 1290 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2709 1483 gene locus_tag LOCUS_10670 2709 1483 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432948.1 protein_id gnl|my_center|LOCUS_10670 5114 2709 gene locus_tag LOCUS_10680 5114 2709 CDS product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528921.1 protein_id gnl|my_center|LOCUS_10680 5234 5593 gene locus_tag LOCUS_10690 5234 5593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 7123 5516 gene locus_tag LOCUS_10700 7123 5516 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957525.1 protein_id gnl|my_center|LOCUS_10700 8221 7130 gene locus_tag LOCUS_10710 gene pstS 8221 7130 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545084.1 protein_id gnl|my_center|LOCUS_10710 8500 8237 gene locus_tag LOCUS_10720 8500 8237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 8951 8493 gene locus_tag LOCUS_10730 8951 8493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 9679 8951 gene locus_tag LOCUS_10740 9679 8951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 9765 10736 gene locus_tag LOCUS_10750 9765 10736 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258268.1 protein_id gnl|my_center|LOCUS_10750 10930 10751 gene locus_tag LOCUS_10760 10930 10751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 >Feature sequence061 1665 259 gene locus_tag LOCUS_10770 1665 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 2741 1662 gene locus_tag LOCUS_10780 2741 1662 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838489.1 protein_id gnl|my_center|LOCUS_10780 5920 2738 gene locus_tag LOCUS_10790 5920 2738 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085718.1 protein_id gnl|my_center|LOCUS_10790 6456 6773 gene locus_tag LOCUS_10800 6456 6773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 7368 7880 gene locus_tag LOCUS_10810 7368 7880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10810 8255 9280 gene locus_tag LOCUS_10820 8255 9280 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421550.1 protein_id gnl|my_center|LOCUS_10820 9273 10028 gene locus_tag LOCUS_10830 9273 10028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 10082 11029 gene locus_tag LOCUS_10840 10082 11029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 >Feature sequence062 949 251 gene locus_tag LOCUS_10850 949 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 3504 970 gene locus_tag LOCUS_10860 3504 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 4563 3631 gene locus_tag LOCUS_10870 4563 3631 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545688.1 protein_id gnl|my_center|LOCUS_10870 5304 4600 gene locus_tag LOCUS_10880 5304 4600 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095848.1 protein_id gnl|my_center|LOCUS_10880 5674 5919 gene locus_tag LOCUS_10890 5674 5919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 5996 6478 gene locus_tag LOCUS_10900 5996 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 6581 7489 gene locus_tag LOCUS_10910 6581 7489 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_10910 11176 7523 gene locus_tag LOCUS_10920 11176 7523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 >Feature sequence063 1967 663 gene locus_tag LOCUS_10930 1967 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 1863 2225 gene locus_tag LOCUS_10940 1863 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 3357 2197 gene locus_tag LOCUS_10950 3357 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 3926 3588 gene locus_tag LOCUS_10960 3926 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 4812 3970 gene locus_tag LOCUS_10970 4812 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 5575 4835 gene locus_tag LOCUS_10980 5575 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 6047 5652 gene locus_tag LOCUS_10990 6047 5652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 6708 6163 gene locus_tag LOCUS_11000 6708 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 7432 6857 gene locus_tag LOCUS_11010 7432 6857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 8510 8328 gene locus_tag LOCUS_11020 8510 8328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 8509 9744 gene locus_tag LOCUS_11030 8509 9744 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113486.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence064 1469 69 gene locus_tag LOCUS_11040 gene nifE 1469 69 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084554.1 protein_id gnl|my_center|LOCUS_11040 615 541 gene locus_tag LOCUS_t00160 615 541 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3058 1520 gene locus_tag LOCUS_11050 gene nifK 3058 1520 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084553.1 protein_id gnl|my_center|LOCUS_11050 4555 3125 gene locus_tag LOCUS_11060 gene nifD 4555 3125 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084552.1 protein_id gnl|my_center|LOCUS_11060 5544 4669 gene locus_tag LOCUS_11070 gene nifH 5544 4669 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084578.1 protein_id gnl|my_center|LOCUS_11070 7048 5912 gene locus_tag LOCUS_11080 7048 5912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 8574 7108 gene locus_tag LOCUS_11090 8574 7108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 8980 9204 gene locus_tag LOCUS_11100 8980 9204 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227972.1 protein_id gnl|my_center|LOCUS_11100 9192 9419 gene locus_tag LOCUS_11110 9192 9419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11110 10427 9666 gene locus_tag LOCUS_11120 gene kdpE 10427 9666 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185947.1 protein_id gnl|my_center|LOCUS_11120 11093 10515 gene locus_tag LOCUS_11130 11093 10515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 >Feature sequence065 684 91 gene locus_tag LOCUS_11140 684 91 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_11140 851 1966 gene locus_tag LOCUS_11150 851 1966 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027268647.1 protein_id gnl|my_center|LOCUS_11150 1956 2786 gene locus_tag LOCUS_11160 1956 2786 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948171.1 protein_id gnl|my_center|LOCUS_11160 2789 3601 gene locus_tag LOCUS_11170 2789 3601 CDS product sulfhydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948170.1 protein_id gnl|my_center|LOCUS_11170 3606 4904 gene locus_tag LOCUS_11180 3606 4904 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948169.1 protein_id gnl|my_center|LOCUS_11180 5014 5442 gene locus_tag LOCUS_11190 5014 5442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 5893 5817 gene locus_tag LOCUS_t00170 5893 5817 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5995 7143 gene locus_tag LOCUS_11200 5995 7143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 7140 8108 gene locus_tag LOCUS_11210 7140 8108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 8089 8961 gene locus_tag LOCUS_11220 8089 8961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 9342 9043 gene locus_tag LOCUS_11230 9342 9043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 9628 10272 gene locus_tag LOCUS_11240 9628 10272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 >Feature sequence066 75 938 gene locus_tag LOCUS_11250 75 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 954 1823 gene locus_tag LOCUS_11260 gene dapF 954 1823 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583145.1 protein_id gnl|my_center|LOCUS_11260 2003 1842 gene locus_tag LOCUS_11270 2003 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 3330 2020 gene locus_tag LOCUS_11280 3330 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 3799 3590 gene locus_tag LOCUS_11290 3799 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 3872 4090 gene locus_tag LOCUS_11300 3872 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 4120 4419 gene locus_tag LOCUS_11310 4120 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 4630 4445 gene locus_tag LOCUS_11320 4630 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 4931 4587 gene locus_tag LOCUS_11330 4931 4587 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224094.1 protein_id gnl|my_center|LOCUS_11330 6414 4996 gene locus_tag LOCUS_11340 6414 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 6551 6760 gene locus_tag LOCUS_11350 6551 6760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 6846 7403 gene locus_tag LOCUS_11360 6846 7403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 7552 8010 gene locus_tag LOCUS_11370 7552 8010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 8300 9004 gene locus_tag LOCUS_11380 8300 9004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 9040 10161 gene locus_tag LOCUS_11390 gene gcvT 9040 10161 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732261.1 protein_id gnl|my_center|LOCUS_11390 10218 10616 gene locus_tag LOCUS_11400 gene gcvH 10218 10616 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228002.1 protein_id gnl|my_center|LOCUS_11400 >Feature sequence067 1439 1137 gene locus_tag LOCUS_11410 1439 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 2102 1626 gene locus_tag LOCUS_11420 2102 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 2595 2242 gene locus_tag LOCUS_11430 2595 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 4220 2676 gene locus_tag LOCUS_11440 4220 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 8103 4255 gene locus_tag LOCUS_11450 8103 4255 CDS product type VI secretion protein IcmF/TssM N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943786.1 protein_id gnl|my_center|LOCUS_11450 8796 8122 gene locus_tag LOCUS_11460 gene tssL 8796 8122 CDS product type VI secretion system protein TssL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184888.1 protein_id gnl|my_center|LOCUS_11460 10181 8796 gene locus_tag LOCUS_11470 gene tssK 10181 8796 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941098.1 protein_id gnl|my_center|LOCUS_11470 >Feature sequence068 1619 411 gene locus_tag LOCUS_11480 1619 411 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942560.1 protein_id gnl|my_center|LOCUS_11480 2465 1632 gene locus_tag LOCUS_11490 2465 1632 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392553.1 protein_id gnl|my_center|LOCUS_11490 3259 2465 gene locus_tag LOCUS_11500 3259 2465 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_11500 4935 3256 gene locus_tag LOCUS_11510 4935 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 6927 5248 gene locus_tag LOCUS_11520 6927 5248 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258493.1 protein_id gnl|my_center|LOCUS_11520 7795 7076 gene locus_tag LOCUS_11530 gene tatC 7795 7076 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545000.1 protein_id gnl|my_center|LOCUS_11530 8118 7828 gene locus_tag LOCUS_11540 8118 7828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 8334 8122 gene locus_tag LOCUS_11550 8334 8122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 8879 8337 gene locus_tag LOCUS_11560 8879 8337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 9687 8992 gene locus_tag LOCUS_11570 9687 8992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 <10422 9684 gene locus_tag LOCUS_11580 <10422 9684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004399687.1:DNA repair protein RadA >Feature sequence069 767 63 gene locus_tag LOCUS_11590 767 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 948 1883 gene locus_tag LOCUS_11600 948 1883 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262369.1 protein_id gnl|my_center|LOCUS_11600 5102 1890 gene locus_tag LOCUS_11610 5102 1890 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_11610 6239 5133 gene locus_tag LOCUS_11620 6239 5133 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928611.1 protein_id gnl|my_center|LOCUS_11620 7720 6236 gene locus_tag LOCUS_11630 7720 6236 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545697.1 protein_id gnl|my_center|LOCUS_11630 8521 7733 gene locus_tag LOCUS_11640 8521 7733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 9555 8815 gene locus_tag LOCUS_11650 9555 8815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 10118 9552 gene locus_tag LOCUS_11660 10118 9552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 >Feature sequence070 1649 465 gene locus_tag LOCUS_11670 gene tyrS 1649 465 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 protein_id gnl|my_center|LOCUS_11670 2909 1686 gene locus_tag LOCUS_11680 2909 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 3332 2913 gene locus_tag LOCUS_11690 gene ndk 3332 2913 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873861.1 protein_id gnl|my_center|LOCUS_11690 3780 4022 gene locus_tag LOCUS_11700 3780 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 4202 4301 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4393 4629 gene locus_tag LOCUS_11710 4393 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11710 4920 5531 gene locus_tag LOCUS_11720 4920 5531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 6014 5673 gene locus_tag LOCUS_11730 6014 5673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 6236 6078 gene locus_tag LOCUS_11740 6236 6078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 <9680 6414 gene locus_tag LOCUS_11750 <9680 6414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_183090287.1:EAL domain-containing protein >Feature sequence071 4018 494 gene locus_tag LOCUS_11760 4018 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 4312 7932 gene locus_tag LOCUS_11770 4312 7932 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445472.1 protein_id gnl|my_center|LOCUS_11770 8488 8670 gene locus_tag LOCUS_11780 8488 8670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 8997 8722 gene locus_tag LOCUS_11790 8997 8722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 >Feature sequence072 773 2437 gene locus_tag LOCUS_11800 gene sirA 773 2437 CDS product sulfite reductase SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972818.1 protein_id gnl|my_center|LOCUS_11800 2800 2546 gene locus_tag LOCUS_11810 2800 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 3002 3925 gene locus_tag LOCUS_11820 3002 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 4394 3984 gene locus_tag LOCUS_11830 4394 3984 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967235.1 protein_id gnl|my_center|LOCUS_11830 4615 4397 gene locus_tag LOCUS_11840 4615 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 5086 5553 gene locus_tag LOCUS_11850 5086 5553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 5571 5879 gene locus_tag LOCUS_11860 5571 5879 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303511.1 protein_id gnl|my_center|LOCUS_11860 <9193 6394 gene locus_tag LOCUS_11870 <9193 6394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140878.1:efflux RND transporter permease subunit >Feature sequence073 1099 818 gene locus_tag LOCUS_11880 1099 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 1350 1796 gene locus_tag LOCUS_11890 1350 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 1983 3050 gene locus_tag LOCUS_11900 1983 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 3876 3577 gene locus_tag LOCUS_11910 3876 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 4879 4067 gene locus_tag LOCUS_11920 4879 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 5034 5747 gene locus_tag LOCUS_11930 5034 5747 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258401.1 protein_id gnl|my_center|LOCUS_11930 6737 6096 gene locus_tag LOCUS_11940 6737 6096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 7595 6951 gene locus_tag LOCUS_11950 7595 6951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 8405 7731 gene locus_tag LOCUS_11960 8405 7731 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056544.1 protein_id gnl|my_center|LOCUS_11960 9126 8524 gene locus_tag LOCUS_11970 9126 8524 CDS product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092073.1 protein_id gnl|my_center|LOCUS_11970 >Feature sequence074 1561 341 gene locus_tag LOCUS_11980 1561 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 2466 1558 gene locus_tag LOCUS_11990 2466 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 3222 2569 gene locus_tag LOCUS_12000 3222 2569 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583881.1 protein_id gnl|my_center|LOCUS_12000 3594 3247 gene locus_tag LOCUS_12010 gene rplS 3594 3247 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814465.1 protein_id gnl|my_center|LOCUS_12010 4363 3635 gene locus_tag LOCUS_12020 gene trmD 4363 3635 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829466.1 protein_id gnl|my_center|LOCUS_12020 4728 4342 gene locus_tag LOCUS_12030 4728 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 4747 4983 gene locus_tag LOCUS_12040 4747 4983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 5239 4991 gene locus_tag LOCUS_12050 gene rpsP 5239 4991 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870158.1 protein_id gnl|my_center|LOCUS_12050 6625 5291 gene locus_tag LOCUS_12060 gene ffh 6625 5291 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_12060 6855 6631 gene locus_tag LOCUS_12070 6855 6631 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939150.1 protein_id gnl|my_center|LOCUS_12070 7842 6955 gene locus_tag LOCUS_12080 gene sppA 7842 6955 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545082.1 protein_id gnl|my_center|LOCUS_12080 9001 7970 gene locus_tag LOCUS_12090 9001 7970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 >Feature sequence075 205 17 gene locus_tag LOCUS_12100 205 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 396 1469 gene locus_tag LOCUS_12110 396 1469 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113836.1 protein_id gnl|my_center|LOCUS_12110 2007 1786 gene locus_tag LOCUS_12120 2007 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 2576 2800 gene locus_tag LOCUS_12130 2576 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 3090 4151 gene locus_tag LOCUS_12140 3090 4151 CDS product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963599.1 protein_id gnl|my_center|LOCUS_12140 4223 4867 gene locus_tag LOCUS_12150 4223 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 4867 5223 gene locus_tag LOCUS_12160 4867 5223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 5238 5612 gene locus_tag LOCUS_12170 5238 5612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 5615 5884 gene locus_tag LOCUS_12180 5615 5884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 6031 6741 gene locus_tag LOCUS_12190 6031 6741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 6738 7649 gene locus_tag LOCUS_12200 6738 7649 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289311.1 protein_id gnl|my_center|LOCUS_12200 8642 7665 gene locus_tag LOCUS_12210 8642 7665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 >Feature sequence076 1299 1093 gene locus_tag LOCUS_12220 1299 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 1869 1435 gene locus_tag LOCUS_12230 1869 1435 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258892.1 protein_id gnl|my_center|LOCUS_12230 3261 1873 gene locus_tag LOCUS_12240 gene atpD 3261 1873 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933887.1 protein_id gnl|my_center|LOCUS_12240 4222 3344 gene locus_tag LOCUS_12250 4222 3344 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258894.1 protein_id gnl|my_center|LOCUS_12250 5728 4226 gene locus_tag LOCUS_12260 gene atpA 5728 4226 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545369.1 protein_id gnl|my_center|LOCUS_12260 6421 5810 gene locus_tag LOCUS_12270 6421 5810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 6927 6421 gene locus_tag LOCUS_12280 6927 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 6848 7066 gene locus_tag LOCUS_12290 6848 7066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 7251 7021 gene locus_tag LOCUS_12300 7251 7021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 8023 7289 gene locus_tag LOCUS_12310 8023 7289 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390994.1 protein_id gnl|my_center|LOCUS_12310 8294 8067 gene locus_tag LOCUS_12320 8294 8067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 >Feature sequence077 1317 1829 gene locus_tag LOCUS_12330 1317 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1909 1983 gene locus_tag LOCUS_t00180 1909 1983 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3040 2030 gene locus_tag LOCUS_12340 3040 2030 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_12340 3119 4438 gene locus_tag LOCUS_12350 3119 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 4438 4884 gene locus_tag LOCUS_12360 4438 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12360 4772 5158 gene locus_tag LOCUS_12370 4772 5158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12370 5688 5392 gene locus_tag LOCUS_12380 5688 5392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 6278 5784 gene locus_tag LOCUS_12390 6278 5784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 7083 6262 gene locus_tag LOCUS_12400 7083 6262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 7531 7118 gene locus_tag LOCUS_12410 7531 7118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 8122 7535 gene locus_tag LOCUS_12420 8122 7535 CDS product DUF6036 family nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958464.1 protein_id gnl|my_center|LOCUS_12420 8814 8161 gene locus_tag LOCUS_12430 8814 8161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 >Feature sequence078 2174 1653 gene locus_tag LOCUS_12440 2174 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 2362 2171 gene locus_tag LOCUS_12450 2362 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 3269 2313 gene locus_tag LOCUS_12460 3269 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 4670 3372 gene locus_tag LOCUS_12470 4670 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 5309 4989 gene locus_tag LOCUS_12480 5309 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 5721 5455 gene locus_tag LOCUS_12490 5721 5455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 5982 5779 gene locus_tag LOCUS_12500 5982 5779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 6139 6735 gene locus_tag LOCUS_12510 6139 6735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 6746 7105 gene locus_tag LOCUS_12520 6746 7105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 7304 7717 gene locus_tag LOCUS_12530 7304 7717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 7914 8051 gene locus_tag LOCUS_12540 7914 8051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 8036 8218 gene locus_tag LOCUS_12550 8036 8218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 8206 8424 gene locus_tag LOCUS_12560 8206 8424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 8421 8639 gene locus_tag LOCUS_12570 8421 8639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 8639 8956 gene locus_tag LOCUS_12580 8639 8956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 >Feature sequence079 1454 243 gene locus_tag LOCUS_12590 1454 243 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965084.1 protein_id gnl|my_center|LOCUS_12590 2059 1451 gene locus_tag LOCUS_12600 2059 1451 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109619.1 protein_id gnl|my_center|LOCUS_12600 2215 2724 gene locus_tag LOCUS_12610 2215 2724 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095485158.1 protein_id gnl|my_center|LOCUS_12610 2726 3169 gene locus_tag LOCUS_12620 2726 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128261979.1 protein_id gnl|my_center|LOCUS_12620 3283 3708 gene locus_tag LOCUS_12630 3283 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 3705 4157 gene locus_tag LOCUS_12640 3705 4157 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529580.1 protein_id gnl|my_center|LOCUS_12640 4144 4599 gene locus_tag LOCUS_12650 4144 4599 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836391.1 protein_id gnl|my_center|LOCUS_12650 5085 4660 gene locus_tag LOCUS_12660 5085 4660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 5540 5082 gene locus_tag LOCUS_12670 5540 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 6029 5598 gene locus_tag LOCUS_12680 6029 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 6589 6176 gene locus_tag LOCUS_12690 6589 6176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 7211 6591 gene locus_tag LOCUS_12700 7211 6591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 <8945 7484 gene locus_tag LOCUS_12710 <8945 7484 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257894.1:DUF262 domain-containing protein >Feature sequence080 1613 234 gene locus_tag LOCUS_12720 1613 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 2788 2048 gene locus_tag LOCUS_12730 2788 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 2896 2822 gene locus_tag LOCUS_t00190 2896 2822 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4691 2919 gene locus_tag LOCUS_12740 gene rpoD 4691 2919 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_12740 6495 4705 gene locus_tag LOCUS_12750 6495 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 6921 6511 gene locus_tag LOCUS_12760 6921 6511 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943713.1 protein_id gnl|my_center|LOCUS_12760 7202 7005 gene locus_tag LOCUS_12770 7202 7005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 7642 7280 gene locus_tag LOCUS_12780 7642 7280 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948455.1 protein_id gnl|my_center|LOCUS_12780 8334 7639 gene locus_tag LOCUS_12790 gene hisIE 8334 7639 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257923.1 protein_id gnl|my_center|LOCUS_12790 <8936 8331 gene locus_tag LOCUS_12800 <8936 8331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880065.1:imidazole glycerol phosphate synthase subunit HisF >Feature sequence081 622 1383 gene locus_tag LOCUS_12810 622 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1475 1660 gene locus_tag LOCUS_12820 1475 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 1711 2040 gene locus_tag LOCUS_12830 1711 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 2151 3077 gene locus_tag LOCUS_12840 2151 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 4253 5476 gene locus_tag LOCUS_12850 4253 5476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 5888 7402 gene locus_tag LOCUS_12860 5888 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 >Feature sequence082 322 942 gene locus_tag LOCUS_12870 322 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 1185 856 gene locus_tag LOCUS_12880 1185 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 1491 1925 gene locus_tag LOCUS_12890 1491 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 2009 3433 gene locus_tag LOCUS_12900 2009 3433 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545053.1 protein_id gnl|my_center|LOCUS_12900 3508 4980 gene locus_tag LOCUS_12910 3508 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 5641 5180 gene locus_tag LOCUS_12920 5641 5180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 5869 5669 gene locus_tag LOCUS_12930 5869 5669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 6242 5913 gene locus_tag LOCUS_12940 6242 5913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 7532 6252 gene locus_tag LOCUS_12950 gene eno 7532 6252 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880276.1 protein_id gnl|my_center|LOCUS_12950 8028 7525 gene locus_tag LOCUS_12960 8028 7525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence083 <1 755 gene locus_tag LOCUS_12970 <1 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546259.1:galactose-1-phosphate uridylyltransferase 828 2198 gene locus_tag LOCUS_12980 828 2198 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546190.1 protein_id gnl|my_center|LOCUS_12980 2373 3962 gene locus_tag LOCUS_12990 2373 3962 CDS product DUF1957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393415.1 protein_id gnl|my_center|LOCUS_12990 4373 4005 gene locus_tag LOCUS_13000 4373 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 4860 4675 gene locus_tag LOCUS_13010 4860 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 4859 5647 gene locus_tag LOCUS_13020 4859 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 6035 7123 gene locus_tag LOCUS_13030 6035 7123 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_13030 >Feature sequence084 1127 2176 gene locus_tag LOCUS_13040 1127 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 3109 2567 gene locus_tag LOCUS_13050 3109 2567 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_13050 3443 3234 gene locus_tag LOCUS_13060 3443 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 3875 3456 gene locus_tag LOCUS_13070 3875 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 3533 3542 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4452 3886 gene locus_tag LOCUS_13080 4452 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 4652 5677 gene locus_tag LOCUS_13090 4652 5677 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035961988.1 protein_id gnl|my_center|LOCUS_13090 6029 5871 gene locus_tag LOCUS_13100 6029 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 6181 6378 gene locus_tag LOCUS_13110 6181 6378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 6594 6385 gene locus_tag LOCUS_13120 6594 6385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 6954 6604 gene locus_tag LOCUS_13130 6954 6604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 7338 6973 gene locus_tag LOCUS_13140 7338 6973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 7872 7501 gene locus_tag LOCUS_13150 7872 7501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 >Feature sequence085 279 578 gene locus_tag LOCUS_13160 279 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 672 2708 gene locus_tag LOCUS_13170 672 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 2825 4573 gene locus_tag LOCUS_13180 2825 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 4570 5772 gene locus_tag LOCUS_13190 4570 5772 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462207.1 protein_id gnl|my_center|LOCUS_13190 5769 6896 gene locus_tag LOCUS_13200 5769 6896 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_13200 7748 7548 gene locus_tag LOCUS_13210 7748 7548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 >Feature sequence086 1099 1377 gene locus_tag LOCUS_13220 1099 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 1396 1650 gene locus_tag LOCUS_13230 1396 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1909 2235 gene locus_tag LOCUS_13240 1909 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 2253 3095 gene locus_tag LOCUS_13250 2253 3095 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 protein_id gnl|my_center|LOCUS_13250 3936 3049 gene locus_tag LOCUS_13260 3936 3049 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141322.1 protein_id gnl|my_center|LOCUS_13260 4126 4668 gene locus_tag LOCUS_13270 4126 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 4712 6274 gene locus_tag LOCUS_13280 gene ppcA 4712 6274 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980180.1 protein_id gnl|my_center|LOCUS_13280 6313 6621 gene locus_tag LOCUS_13290 6313 6621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 >Feature sequence087 97 321 gene locus_tag LOCUS_13300 97 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 349 672 gene locus_tag LOCUS_13310 349 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 866 1387 gene locus_tag LOCUS_13320 866 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 1345 2394 gene locus_tag LOCUS_13330 gene rhuM 1345 2394 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_13330 2619 2891 gene locus_tag LOCUS_13340 2619 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 3085 3414 gene locus_tag LOCUS_13350 3085 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13350 4611 6008 gene locus_tag LOCUS_13360 4611 6008 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224497204.1 protein_id gnl|my_center|LOCUS_13360 6425 7795 gene locus_tag LOCUS_13370 gene ltrA 6425 7795 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235893157.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence088 624 1186 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttctcacccctgcacgcaggggaaa 3397 1190 gene locus_tag LOCUS_13380 3397 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 3588 4319 gene locus_tag LOCUS_13390 3588 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 4316 5035 gene locus_tag LOCUS_13400 4316 5035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 5069 6154 gene locus_tag LOCUS_13410 5069 6154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 6305 6955 gene locus_tag LOCUS_13420 6305 6955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 6966 7724 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccctgcgggccaggggtgaga >Feature sequence089 1557 307 gene locus_tag LOCUS_13430 1557 307 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135177312.1 protein_id gnl|my_center|LOCUS_13430 3098 1554 gene locus_tag LOCUS_13440 3098 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 5107 3095 gene locus_tag LOCUS_13450 5107 3095 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257045.1 protein_id gnl|my_center|LOCUS_13450 7435 5327 gene locus_tag LOCUS_13460 7435 5327 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941142.1 protein_id gnl|my_center|LOCUS_13460 >Feature sequence090 1534 473 gene locus_tag LOCUS_13470 gene hypE 1534 473 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 protein_id gnl|my_center|LOCUS_13470 2652 1531 gene locus_tag LOCUS_13480 gene hypD 2652 1531 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089666.1 protein_id gnl|my_center|LOCUS_13480 2882 2652 gene locus_tag LOCUS_13490 2882 2652 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948175.1 protein_id gnl|my_center|LOCUS_13490 5268 2902 gene locus_tag LOCUS_13500 gene hypF 5268 2902 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948176.1 protein_id gnl|my_center|LOCUS_13500 6091 5282 gene locus_tag LOCUS_13510 gene hypB 6091 5282 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940974.1 protein_id gnl|my_center|LOCUS_13510 6480 6091 gene locus_tag LOCUS_13520 gene hypA 6480 6091 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089670.1 protein_id gnl|my_center|LOCUS_13520 7432 6464 gene locus_tag LOCUS_13530 7432 6464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 >Feature sequence091 550 317 gene locus_tag LOCUS_13540 550 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 966 439 gene locus_tag LOCUS_13550 966 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 1146 1619 gene locus_tag LOCUS_13560 gene purE 1146 1619 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978802.1 protein_id gnl|my_center|LOCUS_13560 1641 2732 gene locus_tag LOCUS_13570 1641 2732 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978803.1 protein_id gnl|my_center|LOCUS_13570 2878 4347 gene locus_tag LOCUS_13580 2878 4347 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_13580 4782 5654 gene locus_tag LOCUS_13590 4782 5654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 6174 5818 gene locus_tag LOCUS_13600 6174 5818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 6507 6184 gene locus_tag LOCUS_13610 6507 6184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 6632 6952 gene locus_tag LOCUS_13620 6632 6952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 >Feature sequence092 2706 673 gene locus_tag LOCUS_13630 gene metG 2706 673 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391596.1 protein_id gnl|my_center|LOCUS_13630 3571 2699 gene locus_tag LOCUS_13640 3571 2699 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815014.1 protein_id gnl|my_center|LOCUS_13640 4631 3609 gene locus_tag LOCUS_13650 4631 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 5365 4628 gene locus_tag LOCUS_13660 gene tmk 5365 4628 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886759.1 protein_id gnl|my_center|LOCUS_13660 5759 6106 gene locus_tag LOCUS_13670 5759 6106 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045599895.1 protein_id gnl|my_center|LOCUS_13670 6099 6458 gene locus_tag LOCUS_13680 6099 6458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 6933 7343 gene locus_tag LOCUS_13690 6933 7343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 >Feature sequence093 1191 541 gene locus_tag LOCUS_13700 gene bioD 1191 541 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027666.1 protein_id gnl|my_center|LOCUS_13700 2332 1163 gene locus_tag LOCUS_13710 2332 1163 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_13710 4611 2335 gene locus_tag LOCUS_13720 4611 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 5319 4696 gene locus_tag LOCUS_13730 5319 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 6001 5471 gene locus_tag LOCUS_13740 6001 5471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 6210 6701 gene locus_tag LOCUS_13750 6210 6701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 >Feature sequence094 <1 939 gene locus_tag LOCUS_13760 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546798.1:phosphoglucosamine mutase 1267 986 gene locus_tag LOCUS_13770 1267 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 1361 2638 gene locus_tag LOCUS_13780 1361 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 2689 2859 gene locus_tag LOCUS_13790 2689 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 3539 2865 gene locus_tag LOCUS_13800 3539 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 3901 3551 gene locus_tag LOCUS_13810 3901 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 4024 5286 gene locus_tag LOCUS_13820 gene kch 4024 5286 CDS product voltage-gated potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005049683.1 protein_id gnl|my_center|LOCUS_13820 5638 6120 gene locus_tag LOCUS_13830 gene msrB 5638 6120 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057056.1 protein_id gnl|my_center|LOCUS_13830 6131 6790 gene locus_tag LOCUS_13840 gene msrA 6131 6790 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928865.1 protein_id gnl|my_center|LOCUS_13840 >Feature sequence095 1117 1293 gene locus_tag LOCUS_13850 1117 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 1424 2275 gene locus_tag LOCUS_13860 1424 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 2472 3038 gene locus_tag LOCUS_13870 2472 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 3127 3513 gene locus_tag LOCUS_13880 3127 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 4033 3788 gene locus_tag LOCUS_13890 4033 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 3953 4168 gene locus_tag LOCUS_13900 3953 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 5467 6552 gene locus_tag LOCUS_13910 5467 6552 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_13910 >Feature sequence096 141 1121 gene locus_tag LOCUS_13920 141 1121 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188980.1 protein_id gnl|my_center|LOCUS_13920 1154 3130 gene locus_tag LOCUS_13930 1154 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 3127 4572 gene locus_tag LOCUS_13940 3127 4572 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_13940 4587 5063 gene locus_tag LOCUS_13950 4587 5063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 5549 5202 gene locus_tag LOCUS_13960 5549 5202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13960 6584 5580 gene locus_tag LOCUS_13970 6584 5580 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774414.1 protein_id gnl|my_center|LOCUS_13970 >Feature sequence097 111 239 gene locus_tag LOCUS_13980 111 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 271 456 gene locus_tag LOCUS_13990 271 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 683 2056 gene locus_tag LOCUS_14000 683 2056 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400420.1 protein_id gnl|my_center|LOCUS_14000 2076 3101 gene locus_tag LOCUS_14010 2076 3101 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792329.1 protein_id gnl|my_center|LOCUS_14010 3124 4362 gene locus_tag LOCUS_14020 3124 4362 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546465.1 protein_id gnl|my_center|LOCUS_14020 4365 5297 gene locus_tag LOCUS_14030 gene argF 4365 5297 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_14030 5301 6533 gene locus_tag LOCUS_14040 5301 6533 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545761.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence098 1394 405 gene locus_tag LOCUS_14050 1394 405 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_14050 2853 1417 gene locus_tag LOCUS_14060 2853 1417 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057806.1 protein_id gnl|my_center|LOCUS_14060 3098 3571 gene locus_tag LOCUS_14070 3098 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 3754 4860 gene locus_tag LOCUS_14080 3754 4860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 4883 5461 gene locus_tag LOCUS_14090 4883 5461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 5834 5535 gene locus_tag LOCUS_14100 5834 5535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 6270 5824 gene locus_tag LOCUS_14110 6270 5824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 >Feature sequence099 1080 1262 gene locus_tag LOCUS_14120 1080 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 1240 1647 gene locus_tag LOCUS_14130 1240 1647 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_14130 4332 1738 gene locus_tag LOCUS_14140 4332 1738 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928589.1 protein_id gnl|my_center|LOCUS_14140 4809 4363 gene locus_tag LOCUS_14150 4809 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 4837 5571 gene locus_tag LOCUS_14160 4837 5571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 6400 5618 gene locus_tag LOCUS_14170 6400 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 >Feature sequence100 85 2058 gene locus_tag LOCUS_14180 85 2058 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424996.1 protein_id gnl|my_center|LOCUS_14180 2134 2631 gene locus_tag LOCUS_14190 2134 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 2642 4888 gene locus_tag LOCUS_14200 2642 4888 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533272.1 protein_id gnl|my_center|LOCUS_14200 5162 6514 gene locus_tag LOCUS_14210 5162 6514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 >Feature sequence101 504 274 gene locus_tag LOCUS_14220 504 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 990 562 gene locus_tag LOCUS_14230 990 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 1370 987 gene locus_tag LOCUS_14240 1370 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 2487 1393 gene locus_tag LOCUS_14250 gene ychF 2487 1393 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941325.1 protein_id gnl|my_center|LOCUS_14250 3046 2501 gene locus_tag LOCUS_14260 gene pth 3046 2501 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941324.1 protein_id gnl|my_center|LOCUS_14260 3672 3097 gene locus_tag LOCUS_14270 3672 3097 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941323.1 protein_id gnl|my_center|LOCUS_14270 4662 3724 gene locus_tag LOCUS_14280 4662 3724 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_14280 4834 4760 gene locus_tag LOCUS_t00200 4834 4760 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5788 4880 gene locus_tag LOCUS_14290 gene ispE 5788 4880 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260333.1 protein_id gnl|my_center|LOCUS_14290 <6513 5788 gene locus_tag LOCUS_14300 <6513 5788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942640.1:DUF512 domain-containing protein >Feature sequence102 558 1064 gene locus_tag LOCUS_14310 558 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1778 2620 gene locus_tag LOCUS_14320 1778 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 2731 3030 gene locus_tag LOCUS_14330 2731 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 3027 3329 gene locus_tag LOCUS_14340 3027 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 3215 4345 gene locus_tag LOCUS_14350 3215 4345 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062683015.1 protein_id gnl|my_center|LOCUS_14350 4840 4514 gene locus_tag LOCUS_14360 4840 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 5713 4841 gene locus_tag LOCUS_14370 5713 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 6080 5718 gene locus_tag LOCUS_14380 6080 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 >Feature sequence103 70 2511 gene locus_tag LOCUS_14390 70 2511 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545172.1 protein_id gnl|my_center|LOCUS_14390 2526 3530 gene locus_tag LOCUS_14400 gene tsaD 2526 3530 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393644.1 protein_id gnl|my_center|LOCUS_14400 3542 5314 gene locus_tag LOCUS_14410 gene argS 3542 5314 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546374.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence104 24 1088 gene locus_tag LOCUS_14420 24 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 2042 1158 gene locus_tag LOCUS_14430 2042 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 3388 2039 gene locus_tag LOCUS_14440 3388 2039 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036222.1 protein_id gnl|my_center|LOCUS_14440 3551 4168 gene locus_tag LOCUS_14450 3551 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 4376 5773 gene locus_tag LOCUS_14460 4376 5773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 5934 6008 gene locus_tag LOCUS_t00210 5934 6008 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence105 335 171 gene locus_tag LOCUS_14470 335 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 394 1656 gene locus_tag LOCUS_14480 394 1656 CDS product ISL3-like element ISMac21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022377.1 protein_id gnl|my_center|LOCUS_14480 1825 2394 gene locus_tag LOCUS_14490 gene ectA 1825 2394 CDS product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167512736.1 protein_id gnl|my_center|LOCUS_14490 2408 3685 gene locus_tag LOCUS_14500 gene ectB 2408 3685 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263924.1 protein_id gnl|my_center|LOCUS_14500 3709 4104 gene locus_tag LOCUS_14510 3709 4104 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637098.1 protein_id gnl|my_center|LOCUS_14510 4177 5094 gene locus_tag LOCUS_14520 gene thpD 4177 5094 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063968.1 protein_id gnl|my_center|LOCUS_14520 5337 5131 gene locus_tag LOCUS_14530 5337 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 5474 5707 gene locus_tag LOCUS_14540 5474 5707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 >Feature sequence106 452 1789 gene locus_tag LOCUS_14550 gene argA 452 1789 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192168.1 protein_id gnl|my_center|LOCUS_14550 2216 1836 gene locus_tag LOCUS_14560 2216 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 2455 3534 gene locus_tag LOCUS_14570 2455 3534 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768437.1 protein_id gnl|my_center|LOCUS_14570 3702 3626 gene locus_tag LOCUS_t00220 3702 3626 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4580 3759 gene locus_tag LOCUS_14580 gene ppk2 4580 3759 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921245.1 protein_id gnl|my_center|LOCUS_14580 4725 5963 gene locus_tag LOCUS_14590 4725 5963 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256548.1 protein_id gnl|my_center|LOCUS_14590 >Feature sequence107 346 585 gene locus_tag LOCUS_14600 346 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 854 1342 gene locus_tag LOCUS_14610 854 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 1815 1363 gene locus_tag LOCUS_14620 1815 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 1943 3769 gene locus_tag LOCUS_14630 1943 3769 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583146.1 protein_id gnl|my_center|LOCUS_14630 3854 4303 gene locus_tag LOCUS_14640 3854 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 4303 6003 gene locus_tag LOCUS_14650 4303 6003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14650 >Feature sequence108 616 221 gene locus_tag LOCUS_14660 616 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 1068 1445 gene locus_tag LOCUS_14670 1068 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 1485 1790 gene locus_tag LOCUS_14680 1485 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 2462 2130 gene locus_tag LOCUS_14690 2462 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 2547 2816 gene locus_tag LOCUS_14700 2547 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 3211 2909 gene locus_tag LOCUS_14710 3211 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 3501 3247 gene locus_tag LOCUS_14720 3501 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 3830 3630 gene locus_tag LOCUS_14730 3830 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 4450 4196 gene locus_tag LOCUS_14740 4450 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 4923 4510 gene locus_tag LOCUS_14750 4923 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 5927 5037 gene locus_tag LOCUS_14760 5927 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 >Feature sequence109 2240 9 gene locus_tag LOCUS_14770 2240 9 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_14770 3443 2244 gene locus_tag LOCUS_14780 3443 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 4090 3440 gene locus_tag LOCUS_14790 4090 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 4118 4720 gene locus_tag LOCUS_14800 4118 4720 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545352.1 protein_id gnl|my_center|LOCUS_14800 5024 5230 gene locus_tag LOCUS_14810 5024 5230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 5227 5604 gene locus_tag LOCUS_14820 5227 5604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 >Feature sequence110 <1 1567 gene locus_tag LOCUS_14830 <1 1567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705873.1:transcription-repair coupling factor 1622 2530 gene locus_tag LOCUS_14840 gene prsA 1622 2530 CDS product peptidylprolyl isomerase PrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245079.1 protein_id gnl|my_center|LOCUS_14840 2527 3459 gene locus_tag LOCUS_14850 2527 3459 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048382.1 protein_id gnl|my_center|LOCUS_14850 3555 4622 gene locus_tag LOCUS_14860 3555 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 5223 4594 gene locus_tag LOCUS_14870 gene yihA 5223 4594 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945886.1 protein_id gnl|my_center|LOCUS_14870 >Feature sequence111 1085 612 gene locus_tag LOCUS_14880 1085 612 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162839581.1 protein_id gnl|my_center|LOCUS_14880 1620 1042 gene locus_tag LOCUS_14890 1620 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 2084 3646 gene locus_tag LOCUS_14900 2084 3646 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391128.1 protein_id gnl|my_center|LOCUS_14900 3636 4643 gene locus_tag LOCUS_14910 gene cbiB 3636 4643 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943620.1 protein_id gnl|my_center|LOCUS_14910 4640 5737 gene locus_tag LOCUS_14920 4640 5737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 >Feature sequence112 1161 193 gene locus_tag LOCUS_14930 1161 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 2652 1627 gene locus_tag LOCUS_14940 gene gap 2652 1627 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880662.1 protein_id gnl|my_center|LOCUS_14940 2833 3612 gene locus_tag LOCUS_14950 2833 3612 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039970.1 protein_id gnl|my_center|LOCUS_14950 3609 4418 gene locus_tag LOCUS_14960 3609 4418 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103565.1 protein_id gnl|my_center|LOCUS_14960 5046 4420 gene locus_tag LOCUS_14970 5046 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 <5950 5149 gene locus_tag LOCUS_14980 <5950 5149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640352.1:penicillin-binding protein 1A >Feature sequence113 3104 4360 gene locus_tag LOCUS_14990 3104 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 4582 4346 gene locus_tag LOCUS_15000 4582 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 4960 4583 gene locus_tag LOCUS_15010 4960 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 5841 5485 gene locus_tag LOCUS_15020 5841 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 >Feature sequence114 299 1558 gene locus_tag LOCUS_15030 299 1558 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545857.1 protein_id gnl|my_center|LOCUS_15030 1530 2213 gene locus_tag LOCUS_15040 1530 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 2388 2855 gene locus_tag LOCUS_15050 2388 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 2852 4258 gene locus_tag LOCUS_15060 2852 4258 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546863.1 protein_id gnl|my_center|LOCUS_15060 4255 4971 gene locus_tag LOCUS_15070 4255 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 >Feature sequence115 2212 725 gene locus_tag LOCUS_15080 2212 725 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114106.1 protein_id gnl|my_center|LOCUS_15080 3162 3392 gene locus_tag LOCUS_15090 3162 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 3614 3417 gene locus_tag LOCUS_15100 3614 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 4559 3813 gene locus_tag LOCUS_15110 4559 3813 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388186.1 protein_id gnl|my_center|LOCUS_15110 4712 5716 gene locus_tag LOCUS_15120 gene era 4712 5716 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881305.1 protein_id gnl|my_center|LOCUS_15120 >Feature sequence116 891 250 gene locus_tag LOCUS_15130 891 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 1786 893 gene locus_tag LOCUS_15140 1786 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 3180 1807 gene locus_tag LOCUS_15150 3180 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 3295 4659 gene locus_tag LOCUS_15160 3295 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 5592 4669 gene locus_tag LOCUS_15170 5592 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 >Feature sequence117 1483 596 gene locus_tag LOCUS_15180 1483 596 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978575.1 protein_id gnl|my_center|LOCUS_15180 1670 1927 gene locus_tag LOCUS_15190 1670 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 2327 3232 gene locus_tag LOCUS_15200 2327 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 3778 4242 gene locus_tag LOCUS_15210 3778 4242 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201060.1 protein_id gnl|my_center|LOCUS_15210 4276 4689 gene locus_tag LOCUS_15220 4276 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 4686 5030 gene locus_tag LOCUS_15230 4686 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 >Feature sequence118 1708 992 gene locus_tag LOCUS_15240 1708 992 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172835.1 protein_id gnl|my_center|LOCUS_15240 2586 1705 gene locus_tag LOCUS_15250 2586 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 2844 4295 gene locus_tag LOCUS_15260 2844 4295 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941495.1 protein_id gnl|my_center|LOCUS_15260 4368 5489 gene locus_tag LOCUS_15270 4368 5489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence119 1529 237 gene locus_tag LOCUS_15280 1529 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 3096 2065 gene locus_tag LOCUS_15290 3096 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 3786 3427 gene locus_tag LOCUS_15300 3786 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence120 150 1769 gene locus_tag LOCUS_15310 150 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 3203 1821 gene locus_tag LOCUS_15320 gene rimO 3203 1821 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_15320 3303 3755 gene locus_tag LOCUS_15330 3303 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 3936 3769 gene locus_tag LOCUS_15340 3936 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 4142 3939 gene locus_tag LOCUS_15350 4142 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 4720 4175 gene locus_tag LOCUS_15360 4720 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence121 1430 1161 gene locus_tag LOCUS_15370 gene rpsO 1430 1161 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081540.1 protein_id gnl|my_center|LOCUS_15370 2468 1446 gene locus_tag LOCUS_15380 2468 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 2770 2465 gene locus_tag LOCUS_15390 2770 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 3036 2827 gene locus_tag LOCUS_15400 3036 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 <5597 3128 gene locus_tag LOCUS_15410 <5597 3128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546130.1:translation initiation factor IF-2 >Feature sequence122 546 226 gene locus_tag LOCUS_15420 546 226 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226731.1 protein_id gnl|my_center|LOCUS_15420 1187 546 gene locus_tag LOCUS_15430 1187 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15430 1461 1201 gene locus_tag LOCUS_15440 1461 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15440 1670 2506 gene locus_tag LOCUS_15450 1670 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 2557 3228 gene locus_tag LOCUS_15460 2557 3228 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963636.1 protein_id gnl|my_center|LOCUS_15460 3238 4488 gene locus_tag LOCUS_15470 3238 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 >Feature sequence123 54 659 gene locus_tag LOCUS_15480 54 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 745 1827 gene locus_tag LOCUS_15490 gene pstS 745 1827 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140448.1 protein_id gnl|my_center|LOCUS_15490 1838 3040 gene locus_tag LOCUS_15500 1838 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 3033 3938 gene locus_tag LOCUS_15510 gene pstA 3033 3938 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175158.1 protein_id gnl|my_center|LOCUS_15510 3948 4727 gene locus_tag LOCUS_15520 gene pstB 3948 4727 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391662.1 protein_id gnl|my_center|LOCUS_15520 4742 5395 gene locus_tag LOCUS_15530 gene phoU 4742 5395 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941756.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence124 261 434 gene locus_tag LOCUS_15540 261 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 955 2190 gene locus_tag LOCUS_15550 955 2190 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143177.1 protein_id gnl|my_center|LOCUS_15550 2476 2793 gene locus_tag LOCUS_15560 2476 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 2846 3082 gene locus_tag LOCUS_15570 2846 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 3082 3675 gene locus_tag LOCUS_15580 3082 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 4359 3760 gene locus_tag LOCUS_15590 4359 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 4609 4875 gene locus_tag LOCUS_15600 4609 4875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 >Feature sequence125 <1 2188 gene locus_tag LOCUS_15610 <1 2188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941827.1:tetratricopeptide repeat protein 2537 3328 gene locus_tag LOCUS_15620 2537 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 3325 4209 gene locus_tag LOCUS_15630 3325 4209 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412005.1 protein_id gnl|my_center|LOCUS_15630 >Feature sequence126 1233 301 gene locus_tag LOCUS_15640 gene fabD 1233 301 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_15640 2222 1230 gene locus_tag LOCUS_15650 2222 1230 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545989.1 protein_id gnl|my_center|LOCUS_15650 3238 2231 gene locus_tag LOCUS_15660 gene plsX 3238 2231 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545117.1 protein_id gnl|my_center|LOCUS_15660 3440 3258 gene locus_tag LOCUS_15670 gene rpmF 3440 3258 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389355.1 protein_id gnl|my_center|LOCUS_15670 4029 3541 gene locus_tag LOCUS_15680 4029 3541 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942243.1 protein_id gnl|my_center|LOCUS_15680 5334 4042 gene locus_tag LOCUS_15690 5334 4042 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919797.1 protein_id gnl|my_center|LOCUS_15690 >Feature sequence127 243 169 gene locus_tag LOCUS_t00230 243 169 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1331 327 gene locus_tag LOCUS_15700 1331 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 2515 1328 gene locus_tag LOCUS_15710 2515 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 3390 2557 gene locus_tag LOCUS_15720 3390 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 4330 3392 gene locus_tag LOCUS_15730 4330 3392 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_15730 5262 4327 gene locus_tag LOCUS_15740 gene mtnP 5262 4327 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence128 161 343 gene locus_tag LOCUS_15750 161 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 375 1391 gene locus_tag LOCUS_15760 375 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 1909 1778 gene locus_tag LOCUS_15770 1909 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 3870 1876 gene locus_tag LOCUS_15780 3870 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 4949 4086 gene locus_tag LOCUS_15790 4949 4086 CDS product IS110-like element IS1111A family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041952483.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15790 >Feature sequence129 2471 1074 gene locus_tag LOCUS_15800 2471 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15800 <5311 2468 gene locus_tag LOCUS_15810 <5311 2468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921648.1:YDG domain-containing protein >Feature sequence130 1 396 gene locus_tag LOCUS_15820 1 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 698 1834 gene locus_tag LOCUS_15830 698 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 3842 3021 gene locus_tag LOCUS_15840 3842 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 4935 4663 gene locus_tag LOCUS_15850 4935 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 >Feature sequence131 1042 515 gene locus_tag LOCUS_15860 1042 515 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971655.1 protein_id gnl|my_center|LOCUS_15860 1317 1039 gene locus_tag LOCUS_15870 1317 1039 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855694.1 protein_id gnl|my_center|LOCUS_15870 1977 2669 gene locus_tag LOCUS_15880 1977 2669 CDS product DUF4194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727561.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15880 >Feature sequence132 3550 2552 gene locus_tag LOCUS_15890 3550 2552 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360266.1 protein_id gnl|my_center|LOCUS_15890 4653 3547 gene locus_tag LOCUS_15900 gene carA 4653 3547 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660544.1 protein_id gnl|my_center|LOCUS_15900 >Feature sequence133 1069 692 gene locus_tag LOCUS_15910 1069 692 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102981.1 protein_id gnl|my_center|LOCUS_15910 1277 1092 gene locus_tag LOCUS_15920 1277 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 1347 1637 gene locus_tag LOCUS_15930 1347 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 3059 1689 gene locus_tag LOCUS_15940 3059 1689 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070939.1 protein_id gnl|my_center|LOCUS_15940 4008 3076 gene locus_tag LOCUS_15950 4008 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 4933 4112 gene locus_tag LOCUS_15960 4933 4112 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582796.1 protein_id gnl|my_center|LOCUS_15960 >Feature sequence134 113 817 gene locus_tag LOCUS_15970 gene queC 113 817 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932219.1 protein_id gnl|my_center|LOCUS_15970 875 2440 gene locus_tag LOCUS_15980 875 2440 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 protein_id gnl|my_center|LOCUS_15980 2459 2977 gene locus_tag LOCUS_15990 gene smpB 2459 2977 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356550.1 protein_id gnl|my_center|LOCUS_15990 2988 3344 gene locus_tag LOCUS_tm00010 2988 3344 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 <4992 3800 gene locus_tag LOCUS_16000 <4992 3800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_151614010.1:IS701 family transposase >Feature sequence135 1780 476 gene locus_tag LOCUS_16010 1780 476 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_16010 3659 1809 gene locus_tag LOCUS_16020 gene glmS 3659 1809 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838750.1 protein_id gnl|my_center|LOCUS_16020 >Feature sequence136 2513 387 gene locus_tag LOCUS_16030 gene prsK 2513 387 CDS product PEP-CTERM system histidine kinase PrsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390851.1 protein_id gnl|my_center|LOCUS_16030 2986 4215 gene locus_tag LOCUS_16040 2986 4215 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_16040 >Feature sequence137 1094 1864 gene locus_tag LOCUS_16050 1094 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 1961 2938 gene locus_tag LOCUS_16060 1961 2938 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence138 647 465 gene locus_tag LOCUS_16070 647 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 2525 1254 gene locus_tag LOCUS_16080 2525 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 2674 2889 gene locus_tag LOCUS_16090 2674 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 3023 3277 gene locus_tag LOCUS_16100 3023 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 3387 4136 gene locus_tag LOCUS_16110 3387 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 >Feature sequence139 318 656 gene locus_tag LOCUS_16120 318 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 1348 575 gene locus_tag LOCUS_16130 1348 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 3416 1335 gene locus_tag LOCUS_16140 3416 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 4576 3500 gene locus_tag LOCUS_16150 4576 3500 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262363.1 protein_id gnl|my_center|LOCUS_16150 >Feature sequence140 2300 1935 gene locus_tag LOCUS_16160 2300 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 3009 2305 gene locus_tag LOCUS_16170 3009 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 3486 3013 gene locus_tag LOCUS_16180 3486 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 3921 3490 gene locus_tag LOCUS_16190 3921 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 4639 3926 gene locus_tag LOCUS_16200 4639 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 >Feature sequence141 448 918 gene locus_tag LOCUS_16210 448 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 1103 3010 gene locus_tag LOCUS_16220 1103 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 >Feature sequence142 >Feature sequence143 2260 143 gene locus_tag LOCUS_16230 2260 143 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172647606.1 protein_id gnl|my_center|LOCUS_16230 2661 2407 gene locus_tag LOCUS_16240 2661 2407 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084760.1 protein_id gnl|my_center|LOCUS_16240 >Feature sequence144 <1 1079 gene locus_tag LOCUS_16250 <1 1079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039730.1:helicase RepA family protein 1063 2019 gene locus_tag LOCUS_16260 1063 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 2253 2459 gene locus_tag LOCUS_16270 2253 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 2505 2846 gene locus_tag LOCUS_16280 2505 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 2869 3300 gene locus_tag LOCUS_16290 2869 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 3297 3959 gene locus_tag LOCUS_16300 3297 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 >Feature sequence145 1949 1626 gene locus_tag LOCUS_16310 1949 1626 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966695.1 protein_id gnl|my_center|LOCUS_16310 2064 2786 gene locus_tag LOCUS_16320 2064 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 <4516 2901 gene locus_tag LOCUS_16330 <4516 2901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928589.1:M1 family metallopeptidase >Feature sequence146 102 464 gene locus_tag LOCUS_16340 102 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 495 1118 gene locus_tag LOCUS_16350 495 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 1125 1688 gene locus_tag LOCUS_16360 1125 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 1721 2143 gene locus_tag LOCUS_16370 1721 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 2958 2140 gene locus_tag LOCUS_16380 2958 2140 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842665.1 protein_id gnl|my_center|LOCUS_16380 3740 2955 gene locus_tag LOCUS_16390 3740 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 >Feature sequence147 361 5 gene locus_tag LOCUS_16400 361 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 744 409 gene locus_tag LOCUS_16410 744 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 1199 900 gene locus_tag LOCUS_16420 1199 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 2121 1273 gene locus_tag LOCUS_16430 2121 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 2447 3352 gene locus_tag LOCUS_16440 2447 3352 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066710.1 protein_id gnl|my_center|LOCUS_16440 3352 4032 gene locus_tag LOCUS_16450 3352 4032 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942828.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence148 168 1211 gene locus_tag LOCUS_16460 168 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 3184 2801 gene locus_tag LOCUS_16470 3184 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 3361 3627 gene locus_tag LOCUS_16480 3361 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16480 3644 4156 gene locus_tag LOCUS_16490 3644 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16490 >Feature sequence149 1721 957 gene locus_tag LOCUS_16500 1721 957 CDS product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942543.1 protein_id gnl|my_center|LOCUS_16500 2097 1726 gene locus_tag LOCUS_16510 2097 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 3311 2097 gene locus_tag LOCUS_16520 gene hpnI 3311 2097 CDS product bacteriohopanetetrol glucosamine biosynthesis glycosyltransferase HpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941358.1 protein_id gnl|my_center|LOCUS_16520 <4320 3328 gene locus_tag LOCUS_16530 <4320 3328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004196953.1:hopanoid biosynthesis associated radical SAM protein HpnJ >Feature sequence150 1065 1763 gene locus_tag LOCUS_16540 gene tmk 1065 1763 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867602.1 protein_id gnl|my_center|LOCUS_16540 1760 2422 gene locus_tag LOCUS_16550 gene tmk 1760 2422 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979593.1 protein_id gnl|my_center|LOCUS_16550 2912 2439 gene locus_tag LOCUS_16560 2912 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 3067 3531 gene locus_tag LOCUS_16570 gene rpiB 3067 3531 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722019.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence151 508 714 gene locus_tag LOCUS_16580 508 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 1290 2012 gene locus_tag LOCUS_16590 1290 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 2302 2871 gene locus_tag LOCUS_16600 2302 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 3289 3167 gene locus_tag LOCUS_16610 3289 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 3288 3557 gene locus_tag LOCUS_16620 3288 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence152 1722 1492 gene locus_tag LOCUS_16630 1722 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 >Feature sequence153 1758 2159 gene locus_tag LOCUS_16640 1758 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 3621 3280 gene locus_tag LOCUS_16650 gene pth2 3621 3280 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251250.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence154 <1 1107 gene locus_tag LOCUS_16660 <1 1107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001020801.1:ADP-forming succinate--CoA ligase subunit beta 1104 2027 gene locus_tag LOCUS_16670 gene sucD 1104 2027 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881050.1 protein_id gnl|my_center|LOCUS_16670 2057 2518 gene locus_tag LOCUS_16680 2057 2518 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888871.1 protein_id gnl|my_center|LOCUS_16680 3205 2594 gene locus_tag LOCUS_16690 3205 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 >Feature sequence155 551 1153 gene locus_tag LOCUS_16700 551 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 1250 1966 gene locus_tag LOCUS_16710 1250 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 2081 2896 gene locus_tag LOCUS_16720 2081 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 3716 2802 gene locus_tag LOCUS_16730 3716 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence156 2097 688 gene locus_tag LOCUS_16740 2097 688 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222807.1 protein_id gnl|my_center|LOCUS_16740 2790 3263 gene locus_tag LOCUS_16750 2790 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 >Feature sequence157 2779 251 gene locus_tag LOCUS_16760 gene leuS 2779 251 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938492.1 protein_id gnl|my_center|LOCUS_16760 2964 3041 gene locus_tag LOCUS_t00240 2964 3041 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3348 3049 gene locus_tag LOCUS_16770 3348 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 >Feature sequence158 1267 287 gene locus_tag LOCUS_16780 1267 287 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027713.1 protein_id gnl|my_center|LOCUS_16780 1915 2427 gene locus_tag LOCUS_16790 1915 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 2463 3560 gene locus_tag LOCUS_16800 2463 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 >Feature sequence159 1073 588 gene locus_tag LOCUS_16810 1073 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 2272 1091 gene locus_tag LOCUS_16820 2272 1091 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546563.1 protein_id gnl|my_center|LOCUS_16820 3205 2381 gene locus_tag LOCUS_16830 3205 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 <3956 3202 gene locus_tag LOCUS_16840 <3956 3202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005461189.1:4-hydroxy-tetrahydrodipicolinate reductase >Feature sequence160 1137 199 gene locus_tag LOCUS_16850 1137 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 1060 1254 gene locus_tag LOCUS_16860 1060 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 1347 1631 gene locus_tag LOCUS_16870 1347 1631 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064047.1 protein_id gnl|my_center|LOCUS_16870 1600 1896 gene locus_tag LOCUS_16880 1600 1896 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968708.1 protein_id gnl|my_center|LOCUS_16880 2535 2005 gene locus_tag LOCUS_16890 2535 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 2897 2532 gene locus_tag LOCUS_16900 2897 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 3379 2885 gene locus_tag LOCUS_16910 3379 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 3816 3376 gene locus_tag LOCUS_16920 3816 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 >Feature sequence161 759 929 gene locus_tag LOCUS_16930 759 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 956 2845 gene locus_tag LOCUS_16940 956 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16940 2763 3029 gene locus_tag LOCUS_16950 2763 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 3128 3298 gene locus_tag LOCUS_16960 3128 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 3639 3454 gene locus_tag LOCUS_16970 3639 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 >Feature sequence162 239 568 gene locus_tag LOCUS_16980 239 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 617 1198 gene locus_tag LOCUS_16990 617 1198 CDS product carbon monoxide dehydrogenase beta subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930681.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence163 878 225 gene locus_tag LOCUS_17000 878 225 CDS product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815980.1 protein_id gnl|my_center|LOCUS_17000 971 1204 gene locus_tag LOCUS_17010 971 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 1299 1622 gene locus_tag LOCUS_17020 1299 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 >Feature sequence164 2315 555 gene locus_tag LOCUS_17030 2315 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 3285 2650 gene locus_tag LOCUS_17040 3285 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence165 1238 282 gene locus_tag LOCUS_17050 1238 282 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256181.1 protein_id gnl|my_center|LOCUS_17050 1684 1376 gene locus_tag LOCUS_17060 1684 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 1634 1801 gene locus_tag LOCUS_17070 1634 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 1883 3343 gene locus_tag LOCUS_17080 1883 3343 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979769.1 protein_id gnl|my_center|LOCUS_17080 >Feature sequence166 1761 91 gene locus_tag LOCUS_17090 1761 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 2285 1758 gene locus_tag LOCUS_17100 2285 1758 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940698.1 protein_id gnl|my_center|LOCUS_17100 2419 3153 gene locus_tag LOCUS_17110 2419 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 3314 3640 gene locus_tag LOCUS_17120 3314 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 >Feature sequence167 203 412 gene locus_tag LOCUS_17130 203 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 416 1075 gene locus_tag LOCUS_17140 416 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 1075 1887 gene locus_tag LOCUS_17150 1075 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 1948 3471 gene locus_tag LOCUS_17160 1948 3471 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258022.1 protein_id gnl|my_center|LOCUS_17160 >Feature sequence168 608 1075 gene locus_tag LOCUS_17170 608 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 1330 1554 gene locus_tag LOCUS_17180 1330 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 1722 2003 gene locus_tag LOCUS_17190 1722 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 2038 2274 gene locus_tag LOCUS_17200 2038 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 2706 2939 gene locus_tag LOCUS_17210 2706 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 2988 3371 gene locus_tag LOCUS_17220 2988 3371 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_17220 >Feature sequence169 <1 1201 gene locus_tag LOCUS_17230 <1 1201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546759.1:IMP dehydrogenase 1239 2780 gene locus_tag LOCUS_17240 gene guaA 1239 2780 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_17240 >Feature sequence170 >Feature sequence171 2 259 gene locus_tag LOCUS_17250 2 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 308 1630 gene locus_tag LOCUS_17260 gene istA 308 1630 CDS product IS21-like element ISMac9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022071.1 protein_id gnl|my_center|LOCUS_17260 1630 2409 gene locus_tag LOCUS_17270 gene istB 1630 2409 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122401609.1 protein_id gnl|my_center|LOCUS_17270 >Feature sequence172 629 2065 gene locus_tag LOCUS_17280 629 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 2108 2782 gene locus_tag LOCUS_17290 2108 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 2770 3111 gene locus_tag LOCUS_17300 2770 3111 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966695.1 protein_id gnl|my_center|LOCUS_17300 3160 3525 gene locus_tag LOCUS_17310 3160 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17310 >Feature sequence173 302 493 gene locus_tag LOCUS_17320 302 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 520 1020 gene locus_tag LOCUS_17330 520 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 1124 1681 gene locus_tag LOCUS_17340 1124 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 1928 3415 gene locus_tag LOCUS_17350 1928 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 >Feature sequence174 1474 1737 gene locus_tag LOCUS_17360 1474 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 2438 2944 gene locus_tag LOCUS_17370 2438 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 >Feature sequence175 449 252 gene locus_tag LOCUS_17380 449 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 748 1410 gene locus_tag LOCUS_17390 gene tmk 748 1410 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173647.1 protein_id gnl|my_center|LOCUS_17390 1407 2447 gene locus_tag LOCUS_17400 1407 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 2483 3328 gene locus_tag LOCUS_17410 2483 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 >Feature sequence176 1206 715 gene locus_tag LOCUS_17420 gene coaD 1206 715 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704185.1 protein_id gnl|my_center|LOCUS_17420 1775 1203 gene locus_tag LOCUS_17430 gene rsmD 1775 1203 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009910569.1 protein_id gnl|my_center|LOCUS_17430 2208 1840 gene locus_tag LOCUS_17440 2208 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 >Feature sequence177 1377 157 gene locus_tag LOCUS_17450 1377 157 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226185.1 protein_id gnl|my_center|LOCUS_17450 1480 1773 gene locus_tag LOCUS_17460 1480 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 1824 2417 gene locus_tag LOCUS_17470 1824 2417 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391659.1 protein_id gnl|my_center|LOCUS_17470 2414 3478 gene locus_tag LOCUS_17480 gene rlmN 2414 3478 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391076.1 protein_id gnl|my_center|LOCUS_17480 >Feature sequence178 110 997 gene locus_tag LOCUS_17490 gene cysQ 110 997 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813481.1 protein_id gnl|my_center|LOCUS_17490 1040 1282 gene locus_tag LOCUS_17500 1040 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 1329 1829 gene locus_tag LOCUS_17510 1329 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 2021 1936 gene locus_tag LOCUS_t00250 2021 1936 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2201 3613 gene locus_tag LOCUS_17520 gene fumC 2201 3613 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057374.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence179 1216 155 gene locus_tag LOCUS_17530 1216 155 CDS product IS110-like element ISPa11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147159.1 protein_id gnl|my_center|LOCUS_17530 1535 2011 gene locus_tag LOCUS_17540 1535 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 3422 2040 gene locus_tag LOCUS_17550 3422 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 >Feature sequence180 752 453 gene locus_tag LOCUS_17560 752 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 1887 847 gene locus_tag LOCUS_17570 1887 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 2333 2407 gene locus_tag LOCUS_t00260 2333 2407 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2580 3203 gene locus_tag LOCUS_17580 2580 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 >Feature sequence181 <3480 2879 gene locus_tag LOCUS_17590 <3480 2879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249876.1:phenylalanine--tRNA ligase subunit beta >Feature sequence182 356 1624 gene locus_tag LOCUS_17600 356 1624 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941984.1 protein_id gnl|my_center|LOCUS_17600 1626 2828 gene locus_tag LOCUS_17610 1626 2828 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946829.1 protein_id gnl|my_center|LOCUS_17610 2916 3371 gene locus_tag LOCUS_17620 2916 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17620 >Feature sequence183 100 273 gene locus_tag LOCUS_17630 100 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 1751 270 gene locus_tag LOCUS_17640 gene glgA 1751 270 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_17640 2479 1748 gene locus_tag LOCUS_17650 2479 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 >Feature sequence184 1589 231 gene locus_tag LOCUS_17660 1589 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 1963 2208 gene locus_tag LOCUS_17670 1963 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 >Feature sequence185 190 1290 gene locus_tag LOCUS_17680 190 1290 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145958.1 protein_id gnl|my_center|LOCUS_17680 1283 1960 gene locus_tag LOCUS_17690 1283 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 1957 2580 gene locus_tag LOCUS_17700 1957 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 >Feature sequence186 1373 1098 gene locus_tag LOCUS_17710 gene rpsT 1373 1098 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391549.1 protein_id gnl|my_center|LOCUS_17710 1818 3368 gene locus_tag LOCUS_17720 gene murJ 1818 3368 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544918.1 protein_id gnl|my_center|LOCUS_17720 >Feature sequence187 1122 253 gene locus_tag LOCUS_17730 gene truA 1122 253 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403435.1 protein_id gnl|my_center|LOCUS_17730 1340 1092 gene locus_tag LOCUS_17740 1340 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 2522 1431 gene locus_tag LOCUS_17750 2522 1431 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928792.1 protein_id gnl|my_center|LOCUS_17750 2972 2550 gene locus_tag LOCUS_17760 2972 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 3157 2954 gene locus_tag LOCUS_17770 gene iscX 3157 2954 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142213.1 protein_id gnl|my_center|LOCUS_17770 >Feature sequence188 1684 659 gene locus_tag LOCUS_17780 gene gnd 1684 659 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528920.1 protein_id gnl|my_center|LOCUS_17780 2411 1866 gene locus_tag LOCUS_17790 2411 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17790 3231 2377 gene locus_tag LOCUS_17800 3231 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17800 >Feature sequence189 994 176 gene locus_tag LOCUS_17810 994 176 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545324.1 protein_id gnl|my_center|LOCUS_17810 1456 1097 gene locus_tag LOCUS_17820 1456 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 1769 2851 gene locus_tag LOCUS_17830 1769 2851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 >Feature sequence190 634 74 gene locus_tag LOCUS_17840 634 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 1668 658 gene locus_tag LOCUS_17850 1668 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 2366 1665 gene locus_tag LOCUS_17860 2366 1665 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977465.1 protein_id gnl|my_center|LOCUS_17860 <3345 2425 gene locus_tag LOCUS_17870 <3345 2425 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004526293.1:acetylornithine transaminase >Feature sequence191 484 885 gene locus_tag LOCUS_17880 484 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 1003 2106 gene locus_tag LOCUS_17890 1003 2106 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477386.1 protein_id gnl|my_center|LOCUS_17890 2249 3208 gene locus_tag LOCUS_17900 2249 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 >Feature sequence192 199 126 gene locus_tag LOCUS_t00270 199 126 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2844 322 gene locus_tag LOCUS_17910 2844 322 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086596.1 protein_id gnl|my_center|LOCUS_17910 >Feature sequence193 2158 1877 gene locus_tag LOCUS_17920 2158 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17920 2697 2209 gene locus_tag LOCUS_17930 2697 2209 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203374.1 protein_id gnl|my_center|LOCUS_17930 >Feature sequence194 <1 1013 gene locus_tag LOCUS_17940 <1 1013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000698357.1:DotA/TraY family protein 1019 2176 gene locus_tag LOCUS_17950 1019 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 2200 2805 gene locus_tag LOCUS_17960 2200 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 >Feature sequence195 <1 2276 gene locus_tag LOCUS_17970 <1 2276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057028.1:phosphoketolase family protein 2273 2917 gene locus_tag LOCUS_17980 2273 2917 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946602.1 protein_id gnl|my_center|LOCUS_17980 >Feature sequence196 893 1381 gene locus_tag LOCUS_17990 893 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 1833 1648 gene locus_tag LOCUS_18000 1833 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 1932 2510 gene locus_tag LOCUS_18010 1932 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 3197 2547 gene locus_tag LOCUS_18020 3197 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 >Feature sequence197 <1 1059 gene locus_tag LOCUS_18030 <1 1059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192776.1:MFS transporter 2280 1099 gene locus_tag LOCUS_18040 2280 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 2405 3088 gene locus_tag LOCUS_18050 2405 3088 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546652.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence198 152 1219 gene locus_tag LOCUS_18060 152 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 1246 2328 gene locus_tag LOCUS_18070 1246 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 >Feature sequence199 1246 122 gene locus_tag LOCUS_18080 1246 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 <3138 1709 gene locus_tag LOCUS_18090 <3138 1709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545144.1:caspase family protein >Feature sequence200 1065 409 gene locus_tag LOCUS_18100 1065 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 1864 1184 gene locus_tag LOCUS_18110 1864 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 1752 2405 gene locus_tag LOCUS_18120 1752 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence201 1092 115 gene locus_tag LOCUS_18130 1092 115 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546449.1 protein_id gnl|my_center|LOCUS_18130 2039 1080 gene locus_tag LOCUS_18140 gene murB 2039 1080 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460695.1 protein_id gnl|my_center|LOCUS_18140 <3099 1988 gene locus_tag LOCUS_18150 <3099 1988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943693.1:UDP-N-acetylmuramate--L-alanine ligase >Feature sequence202 1146 559 gene locus_tag LOCUS_18160 1146 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 1170 1694 gene locus_tag LOCUS_18170 1170 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18170 1694 2770 gene locus_tag LOCUS_18180 1694 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18180 >Feature sequence203 473 351 gene locus_tag LOCUS_18190 473 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 2827 932 gene locus_tag LOCUS_18200 2827 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 >Feature sequence204 1985 1263 gene locus_tag LOCUS_18210 1985 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 <3078 2562 gene locus_tag LOCUS_18220 <3078 2562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142246.1:IS1634 family transposase >Feature sequence205 3 77 gene locus_tag LOCUS_t00280 3 77 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1108 1833 gene locus_tag LOCUS_18230 1108 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 3018 2065 gene locus_tag LOCUS_18240 3018 2065 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943748.1 protein_id gnl|my_center|LOCUS_18240 >Feature sequence206 1 486 gene locus_tag LOCUS_18250 1 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 767 498 gene locus_tag LOCUS_18260 767 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 1263 1541 gene locus_tag LOCUS_18270 1263 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 1538 2920 gene locus_tag LOCUS_18280 1538 2920 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933704.1 protein_id gnl|my_center|LOCUS_18280 >Feature sequence207 356 6 gene locus_tag LOCUS_18290 356 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 2178 1102 gene locus_tag LOCUS_18300 2178 1102 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531761.1 protein_id gnl|my_center|LOCUS_18300 >Feature sequence208 372 1712 gene locus_tag LOCUS_18310 372 1712 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037495.1 protein_id gnl|my_center|LOCUS_18310 2723 2289 gene locus_tag LOCUS_18320 2723 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 2707 2940 gene locus_tag LOCUS_18330 2707 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 >Feature sequence209 806 387 gene locus_tag LOCUS_18340 806 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 1623 895 gene locus_tag LOCUS_18350 1623 895 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069550.1 protein_id gnl|my_center|LOCUS_18350 2347 2568 gene locus_tag LOCUS_18360 2347 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 2558 2986 gene locus_tag LOCUS_18370 2558 2986 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653660.1 protein_id gnl|my_center|LOCUS_18370 >Feature sequence210 609 534 gene locus_tag LOCUS_t00290 609 534 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1277 651 gene locus_tag LOCUS_18380 gene purN 1277 651 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_18380 2313 1264 gene locus_tag LOCUS_18390 gene purM 2313 1264 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942402.1 protein_id gnl|my_center|LOCUS_18390 >Feature sequence211 458 814 gene locus_tag LOCUS_18400 458 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 1016 1690 gene locus_tag LOCUS_18410 1016 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 1731 2843 gene locus_tag LOCUS_18420 1731 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 >Feature sequence212 2728 1148 gene locus_tag LOCUS_18430 2728 1148 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144112.1 protein_id gnl|my_center|LOCUS_18430 2940 2830 gene locus_tag LOCUS_r00010 2940 2830 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence213 717 421 gene locus_tag LOCUS_18440 717 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 1129 839 gene locus_tag LOCUS_18450 1129 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 1817 1245 gene locus_tag LOCUS_18460 1817 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 1963 2157 gene locus_tag LOCUS_18470 1963 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 2142 2666 gene locus_tag LOCUS_18480 2142 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 >Feature sequence214 1352 933 gene locus_tag LOCUS_18490 1352 933 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404325.1 protein_id gnl|my_center|LOCUS_18490 1591 1349 gene locus_tag LOCUS_18500 1591 1349 CDS product DUF6364 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404326.1 protein_id gnl|my_center|LOCUS_18500 2128 1703 gene locus_tag LOCUS_18510 2128 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 <2929 2162 gene locus_tag LOCUS_18520 <2929 2162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261475.1:methyl-accepting chemotaxis protein >Feature sequence215 1292 414 gene locus_tag LOCUS_18530 1292 414 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942085.1 protein_id gnl|my_center|LOCUS_18530 1947 1285 gene locus_tag LOCUS_18540 1947 1285 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083424.1 protein_id gnl|my_center|LOCUS_18540 2358 2050 gene locus_tag LOCUS_18550 2358 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 2833 2297 gene locus_tag LOCUS_18560 2833 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence216 611 2764 gene locus_tag LOCUS_18570 611 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 >Feature sequence217 1552 542 gene locus_tag LOCUS_18580 1552 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18580 <2897 2394 gene locus_tag LOCUS_18590 <2897 2394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545847.1:flagellar motor switch protein FliM >Feature sequence218 226 1002 gene locus_tag LOCUS_18600 226 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 1501 983 gene locus_tag LOCUS_18610 1501 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 >Feature sequence219 <1 1916 gene locus_tag LOCUS_18620 <1 1916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388790.1:EAL domain-containing protein 2085 2744 gene locus_tag LOCUS_18630 2085 2744 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 protein_id gnl|my_center|LOCUS_18630 >Feature sequence220 441 1118 gene locus_tag LOCUS_18640 441 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 1220 2230 gene locus_tag LOCUS_18650 1220 2230 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421550.1 protein_id gnl|my_center|LOCUS_18650 >Feature sequence221 1168 374 gene locus_tag LOCUS_18660 1168 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 2298 1168 gene locus_tag LOCUS_18670 2298 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 >Feature sequence222 1207 791 gene locus_tag LOCUS_18680 1207 791 CDS product membrane lipoprotein lipid attachment site-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131636489.1 protein_id gnl|my_center|LOCUS_18680 2204 1593 gene locus_tag LOCUS_18690 2204 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 >Feature sequence223 <1 615 gene locus_tag LOCUS_18700 <1 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942876.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase 634 1542 gene locus_tag LOCUS_18710 634 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 1586 1819 gene locus_tag LOCUS_18720 1586 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 <2761 1869 gene locus_tag LOCUS_18730 <2761 1869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869372.1:heat-inducible transcriptional repressor HrcA >Feature sequence224 1241 543 gene locus_tag LOCUS_18740 1241 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 2405 1416 gene locus_tag LOCUS_18750 2405 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 >Feature sequence225 49 261 gene locus_tag LOCUS_18760 49 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 263 1612 gene locus_tag LOCUS_18770 263 1612 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022343.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence226 415 1125 gene locus_tag LOCUS_18780 415 1125 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391259.1 protein_id gnl|my_center|LOCUS_18780 1136 2524 gene locus_tag LOCUS_18790 1136 2524 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403680.1 protein_id gnl|my_center|LOCUS_18790 2715 2464 gene locus_tag LOCUS_18800 2715 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 >Feature sequence227 661 359 gene locus_tag LOCUS_18810 661 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 1248 1048 gene locus_tag LOCUS_18820 1248 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 2193 1357 gene locus_tag LOCUS_18830 2193 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 >Feature sequence228 749 366 gene locus_tag LOCUS_18840 749 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 1107 793 gene locus_tag LOCUS_18850 1107 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 2011 1079 gene locus_tag LOCUS_18860 2011 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 2639 2067 gene locus_tag LOCUS_18870 2639 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 >Feature sequence229 720 1262 gene locus_tag LOCUS_18880 720 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 2505 2086 gene locus_tag LOCUS_18890 2505 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 >Feature sequence230 551 180 gene locus_tag LOCUS_18900 551 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 1377 652 gene locus_tag LOCUS_18910 1377 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 2244 1699 gene locus_tag LOCUS_18920 2244 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 >Feature sequence231 <1 1587 gene locus_tag LOCUS_18930 <1 1587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034284603.1:proteasome ATPase >Feature sequence232 <1 645 gene locus_tag LOCUS_18940 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225022.1:response regulator transcription factor 642 2066 gene locus_tag LOCUS_18950 642 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 >Feature sequence233 >Feature sequence234 442 1374 gene locus_tag LOCUS_18960 442 1374 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528372.1 protein_id gnl|my_center|LOCUS_18960 1377 2054 gene locus_tag LOCUS_18970 1377 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004542749.1 protein_id gnl|my_center|LOCUS_18970 2058 2618 gene locus_tag LOCUS_18980 2058 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 >Feature sequence235 140 1153 gene locus_tag LOCUS_18990 140 1153 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940611.1 protein_id gnl|my_center|LOCUS_18990 >Feature sequence236 1366 2208 gene locus_tag LOCUS_19000 1366 2208 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765220.1 protein_id gnl|my_center|LOCUS_19000 >Feature sequence237 <2585 341 gene locus_tag LOCUS_19010 <2585 341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003115288.1:two-partner secretion system exoprotein TpsA4 >Feature sequence238 1180 500 gene locus_tag LOCUS_19020 1180 500 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546865.1 protein_id gnl|my_center|LOCUS_19020 1502 1972 gene locus_tag LOCUS_19030 1502 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 >Feature sequence239 196 23 gene locus_tag LOCUS_19040 196 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 >Feature sequence240 253 585 gene locus_tag LOCUS_19050 253 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 769 954 gene locus_tag LOCUS_19060 769 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 1116 1850 gene locus_tag LOCUS_19070 1116 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 1847 2317 gene locus_tag LOCUS_19080 1847 2317 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328750.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence241 177 1370 gene locus_tag LOCUS_19090 gene istA 177 1370 CDS product IS21-like element IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952372.1 protein_id gnl|my_center|LOCUS_19090 1361 2155 gene locus_tag LOCUS_19100 gene istB 1361 2155 CDS product IS21-like element IS21 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544830.1 protein_id gnl|my_center|LOCUS_19100 >Feature sequence242 2 361 gene locus_tag LOCUS_19110 2 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 818 2059 gene locus_tag LOCUS_19120 gene lysA 818 2059 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_19120 2056 2538 gene locus_tag LOCUS_19130 2056 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 >Feature sequence243 1076 726 gene locus_tag LOCUS_19140 1076 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 2065 1073 gene locus_tag LOCUS_19150 2065 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 >Feature sequence244 1276 521 gene locus_tag LOCUS_19160 1276 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 1395 2297 gene locus_tag LOCUS_19170 1395 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 >Feature sequence245 1524 2126 gene locus_tag LOCUS_19180 1524 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 >Feature sequence246 2101 569 gene locus_tag LOCUS_19190 2101 569 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212583.1 protein_id gnl|my_center|LOCUS_19190 >Feature sequence247 431 883 gene locus_tag LOCUS_19200 431 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 1074 1925 gene locus_tag LOCUS_19210 gene murI 1074 1925 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_19210 >Feature sequence248 1733 1401 gene locus_tag LOCUS_19220 gene trxA 1733 1401 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545412.1 protein_id gnl|my_center|LOCUS_19220 <2492 1919 gene locus_tag LOCUS_19230 <2492 1919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392083.1:chaperonin GroEL >Feature sequence249 92 520 gene locus_tag LOCUS_19240 92 520 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085738.1 protein_id gnl|my_center|LOCUS_19240 750 556 gene locus_tag LOCUS_19250 750 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 1855 800 gene locus_tag LOCUS_19260 1855 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 >Feature sequence250 1821 85 gene locus_tag LOCUS_19270 1821 85 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459240.1 protein_id gnl|my_center|LOCUS_19270 >Feature sequence251 <1 2445 gene locus_tag LOCUS_19280 <1 2445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461428.1:InlB B-repeat-containing protein >Feature sequence252 300 809 gene locus_tag LOCUS_19290 300 809 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881216.1 protein_id gnl|my_center|LOCUS_19290 875 1252 gene locus_tag LOCUS_19300 gene fliN 875 1252 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937357.1 protein_id gnl|my_center|LOCUS_19300 1294 1782 gene locus_tag LOCUS_19310 1294 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 >Feature sequence253 189 545 gene locus_tag LOCUS_19320 189 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 549 1793 gene locus_tag LOCUS_19330 549 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 >Feature sequence254 598 1263 gene locus_tag LOCUS_19340 598 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 1273 2382 gene locus_tag LOCUS_19350 1273 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 >Feature sequence255 1765 362 gene locus_tag LOCUS_19360 gene der 1765 362 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942865.1 protein_id gnl|my_center|LOCUS_19360 >Feature sequence256 <1 1291 gene locus_tag LOCUS_19370 <1 1291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002338264.1:single-stranded-DNA-specific exonuclease RecJ >Feature sequence257 211 2010 gene locus_tag LOCUS_19380 gene ftsH 211 2010 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_19380 1997 2356 gene locus_tag LOCUS_19390 1997 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 >Feature sequence258 1713 1468 gene locus_tag LOCUS_19400 1713 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 <2362 1742 gene locus_tag LOCUS_19410 <2362 1742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545268.1:16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH >Feature sequence259 268 786 gene locus_tag LOCUS_19420 268 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 783 1628 gene locus_tag LOCUS_19430 783 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 >Feature sequence260 779 1606 gene locus_tag LOCUS_19440 779 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 >Feature sequence261 1189 1515 gene locus_tag LOCUS_19450 1189 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 1567 2157 gene locus_tag LOCUS_19460 1567 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 >Feature sequence262 376 448 gene locus_tag LOCUS_t00300 376 448 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 491 709 gene locus_tag LOCUS_19470 491 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 1440 1039 gene locus_tag LOCUS_19480 1440 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 1664 1437 gene locus_tag LOCUS_19490 1664 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 1861 2016 gene locus_tag LOCUS_19500 1861 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 >Feature sequence263 <2339 838 gene locus_tag LOCUS_19510 <2339 838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930590.1:diguanylate cyclase >Feature sequence264 693 181 gene locus_tag LOCUS_19520 693 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 885 1886 gene locus_tag LOCUS_19530 885 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 >Feature sequence265 1218 559 gene locus_tag LOCUS_19540 1218 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 >Feature sequence266 214 795 gene locus_tag LOCUS_19550 214 795 CDS product carbon monoxide dehydrogenase beta subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930681.1 protein_id gnl|my_center|LOCUS_19550 >Feature sequence267 346 1104 gene locus_tag LOCUS_19560 gene pdxJ 346 1104 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001571773.1 protein_id gnl|my_center|LOCUS_19560 1101 1478 gene locus_tag LOCUS_19570 1101 1478 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939195.1 protein_id gnl|my_center|LOCUS_19570 >Feature sequence268 2094 1840 gene locus_tag LOCUS_19580 2094 1840 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084760.1 protein_id gnl|my_center|LOCUS_19580 >Feature sequence269 <1 507 gene locus_tag LOCUS_19590 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082506.1:dihydropteroate synthase 500 1378 gene locus_tag LOCUS_19600 gene cdaA 500 1378 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_19600 1375 2067 gene locus_tag LOCUS_19610 1375 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 >Feature sequence270 <1 1147 gene locus_tag LOCUS_19620 <1 1147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057307.1:radical SAM protein 1171 1677 gene locus_tag LOCUS_19630 1171 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 >Feature sequence271 <1 699 gene locus_tag LOCUS_19640 <1 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940717.1:SOS response-associated peptidase 979 2091 gene locus_tag LOCUS_19650 979 2091 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091813.1 protein_id gnl|my_center|LOCUS_19650 >Feature sequence272 1370 744 gene locus_tag LOCUS_19660 1370 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 1792 1959 gene locus_tag LOCUS_19670 1792 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 >Feature sequence273 553 1728 gene locus_tag LOCUS_19680 553 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 >Feature sequence274 116 736 gene locus_tag LOCUS_19690 116 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 1102 1254 gene locus_tag LOCUS_19700 1102 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 <2187 1345 gene locus_tag LOCUS_19710 <2187 1345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_175517123.1:alkene reductase >Feature sequence275 <1 1131 gene locus_tag LOCUS_19720 <1 1131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000281123.1:mercury(II) reductase 1158 1565 gene locus_tag LOCUS_19730 gene zntR 1158 1565 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456436.1 protein_id gnl|my_center|LOCUS_19730 1733 1912 gene locus_tag LOCUS_19740 1733 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 >Feature sequence276 484 1944 gene locus_tag LOCUS_19750 gene proP 484 1944 CDS product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035341.1 protein_id gnl|my_center|LOCUS_19750 >Feature sequence277 77 2 gene locus_tag LOCUS_t00310 77 2 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 352 1509 gene locus_tag LOCUS_19760 gene metK 352 1509 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546806.1 protein_id gnl|my_center|LOCUS_19760 >Feature sequence278 7 801 gene locus_tag LOCUS_19770 7 801 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731237.1 protein_id gnl|my_center|LOCUS_19770 828 1559 gene locus_tag LOCUS_19780 828 1559 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702850.1 protein_id gnl|my_center|LOCUS_19780 1759 1628 gene locus_tag LOCUS_19790 1759 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 1850 2056 gene locus_tag LOCUS_19800 1850 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 >Feature sequence279 830 1810 gene locus_tag LOCUS_19810 830 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 >Feature sequence280 >Feature sequence281 >Feature sequence282 <1 1134 gene locus_tag LOCUS_19820 <1 1134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392357.1:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase >Feature sequence283 333 833 gene locus_tag LOCUS_19830 333 833 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141481.1 protein_id gnl|my_center|LOCUS_19830 1092 730 gene locus_tag LOCUS_19840 1092 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 1760 1260 gene locus_tag LOCUS_19850 1760 1260 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141481.1 protein_id gnl|my_center|LOCUS_19850 >Feature sequence284 741 1805 gene locus_tag LOCUS_19860 741 1805 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444878.1 protein_id gnl|my_center|LOCUS_19860 >Feature sequence285 146 874 gene locus_tag LOCUS_19870 146 874 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008948140.1 protein_id gnl|my_center|LOCUS_19870 1814 855 gene locus_tag LOCUS_19880 1814 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 >Feature sequence286 <1 834 gene locus_tag LOCUS_19890 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046237212.1:diguanylate cyclase 963 1472 gene locus_tag LOCUS_19900 963 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 <2077 1480 gene locus_tag LOCUS_19910 <2077 1480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012289730.1:arsenite methyltransferase >Feature sequence287 1016 1056 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <2055 1173 gene locus_tag LOCUS_19920 <2055 1173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546822.1:DNA polymerase III subunit beta >Feature sequence288 1062 43 gene locus_tag LOCUS_19930 1062 43 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144109.1 protein_id gnl|my_center|LOCUS_19930 1445 1062 gene locus_tag LOCUS_19940 gene queD 1445 1062 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546681.1 protein_id gnl|my_center|LOCUS_19940 >Feature sequence289 95 829 gene locus_tag LOCUS_19950 gene asrB 95 829 CDS product anaerobic sulfite reductase subunit AsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392683.1 protein_id gnl|my_center|LOCUS_19950 861 1883 gene locus_tag LOCUS_19960 861 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 >Feature sequence290 1913 180 gene locus_tag LOCUS_19970 1913 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 >Feature sequence291 <1 1680 gene locus_tag LOCUS_19980 <1 1680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942109.1:aspartate--tRNA ligase >Feature sequence292 540 1460 gene locus_tag LOCUS_19990 gene rfaD 540 1460 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880173.1 protein_id gnl|my_center|LOCUS_19990 >Feature sequence293 1893 724 gene locus_tag LOCUS_20000 1893 724 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230480.1 protein_id gnl|my_center|LOCUS_20000 >Feature sequence294 1044 781 gene locus_tag LOCUS_20010 1044 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 <2001 1041 gene locus_tag LOCUS_20020 <2001 1041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004197190.1:AAA family ATPase >Feature sequence295 1992 1918 gene locus_tag LOCUS_t00320 1992 1918 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence296 <1 747 gene locus_tag LOCUS_20030 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108412.1:tyrosine-type recombinase/integrase 1439 777 gene locus_tag LOCUS_20040 1439 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 >Feature sequence297 1181 1257 gene locus_tag LOCUS_t00330 1181 1257 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1547 1969 gene locus_tag LOCUS_20050 gene tolR 1547 1969 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_20050 >Feature sequence298 546 1823 gene locus_tag LOCUS_20060 gene tolB 546 1823 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_20060 >Feature sequence299 <1 537 gene locus_tag LOCUS_20070 <1 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005480625.1:HD-GYP domain-containing protein 851 603 gene locus_tag LOCUS_20080 851 603 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878063.1 protein_id gnl|my_center|LOCUS_20080 1271 879 gene locus_tag LOCUS_20090 1271 879 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878062.1 protein_id gnl|my_center|LOCUS_20090 >Feature sequence300 442 1071 gene locus_tag LOCUS_20100 442 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 <1964 1040 gene locus_tag LOCUS_20110 <1964 1040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941036.1:BamA/TamA family outer membrane protein >Feature sequence301 694 1392 gene locus_tag LOCUS_20120 694 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 >Feature sequence302 696 1610 gene locus_tag LOCUS_20130 gene hpnD 696 1610 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930256.1 protein_id gnl|my_center|LOCUS_20130 >Feature sequence303 1271 396 gene locus_tag LOCUS_20140 1271 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 1849 1268 gene locus_tag LOCUS_20150 1849 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 >Feature sequence304 >Feature sequence305 <1 1196 gene locus_tag LOCUS_20160 <1 1196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546485.1:L-2-hydroxyglutarate oxidase <1927 1422 gene locus_tag LOCUS_20170 <1927 1422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097853.1:undecaprenyl-phosphate galactose phosphotransferase WbaP >Feature sequence306 886 1266 gene locus_tag LOCUS_20180 886 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 <1920 1155 gene locus_tag LOCUS_20190 <1920 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881407.1:thioredoxin domain-containing protein >Feature sequence307 >Feature sequence308 1016 453 gene locus_tag LOCUS_20200 1016 453 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392680.1 protein_id gnl|my_center|LOCUS_20200 1490 1122 gene locus_tag LOCUS_20210 1490 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 >Feature sequence309 >Feature sequence310 <1 639 gene locus_tag LOCUS_20220 <1 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_101778793.1:DnaJ C-terminal domain-containing protein 688 1008 gene locus_tag LOCUS_20230 688 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 >Feature sequence311 194 1294 gene locus_tag LOCUS_20240 194 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 >Feature sequence312 395 1249 gene locus_tag LOCUS_20250 395 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 1611 1811 gene locus_tag LOCUS_20260 1611 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 >Feature sequence313 <1 546 gene locus_tag LOCUS_20270 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918581.1:DNA mismatch repair endonuclease MutL 1466 543 gene locus_tag LOCUS_20280 1466 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 1836 1471 gene locus_tag LOCUS_20290 1836 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 >Feature sequence314 590 138 gene locus_tag LOCUS_20300 590 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 566 841 gene locus_tag LOCUS_20310 566 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 1367 1089 gene locus_tag LOCUS_20320 1367 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20320 >Feature sequence315 1213 152 gene locus_tag LOCUS_20330 1213 152 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_20330 1802 1206 gene locus_tag LOCUS_20340 1802 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 >Feature sequence316 >Feature sequence317 <1861 952 gene locus_tag LOCUS_20350 <1861 952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868277.1:glycosyltransferase >Feature sequence318 222 1589 gene locus_tag LOCUS_20360 gene fliI 222 1589 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392295.1 protein_id gnl|my_center|LOCUS_20360 >Feature sequence319 793 176 gene locus_tag LOCUS_20370 793 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 859 1452 gene locus_tag LOCUS_20380 859 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 1424 1672 gene locus_tag LOCUS_20390 1424 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 >Feature sequence320 1638 544 gene locus_tag LOCUS_20400 1638 544 CDS product IS110-like element ISPa11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147159.1 protein_id gnl|my_center|LOCUS_20400 >Feature sequence321 269 613 gene locus_tag LOCUS_20410 269 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 636 1073 gene locus_tag LOCUS_20420 636 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 >Feature sequence322 427 801 gene locus_tag LOCUS_20430 427 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 830 1750 gene locus_tag LOCUS_20440 830 1750 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939346.1 protein_id gnl|my_center|LOCUS_20440 >Feature sequence323 443 790 gene locus_tag LOCUS_20450 443 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 >Feature sequence324 1043 96 gene locus_tag LOCUS_20460 gene secF 1043 96 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545001.1 protein_id gnl|my_center|LOCUS_20460 <1810 1071 gene locus_tag LOCUS_20470 <1810 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546364.1:protein translocase subunit SecD >Feature sequence325 1113 496 gene locus_tag LOCUS_20480 1113 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20480 <1801 1040 gene locus_tag LOCUS_20490 <1801 1040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_177221404.1:preprotein translocase subunit SecA note possible pseudo, frameshifted >Feature sequence326 1400 57 gene locus_tag LOCUS_20500 gene nusA 1400 57 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083607.1 protein_id gnl|my_center|LOCUS_20500 >Feature sequence327 1429 155 gene locus_tag LOCUS_20510 1429 155 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117066.1 protein_id gnl|my_center|LOCUS_20510 >Feature sequence328 660 502 gene locus_tag LOCUS_20520 660 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 1125 1439 gene locus_tag LOCUS_20530 1125 1439 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015097.1 protein_id gnl|my_center|LOCUS_20530 1464 1691 gene locus_tag LOCUS_20540 1464 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 >Feature sequence329 832 26 gene locus_tag LOCUS_20550 832 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 1311 1030 gene locus_tag LOCUS_20560 1311 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 >Feature sequence330 661 8 gene locus_tag LOCUS_20570 gene leuD 661 8 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222556.1 protein_id gnl|my_center|LOCUS_20570 1763 684 gene locus_tag LOCUS_20580 gene leuC 1763 684 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140684.1 protein_id gnl|my_center|LOCUS_20580 >Feature sequence331 463 1647 gene locus_tag LOCUS_20590 gene tyrS 463 1647 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 protein_id gnl|my_center|LOCUS_20590 >Feature sequence332 >Feature sequence333 450 1388 gene locus_tag LOCUS_20600 gene cas1f 450 1388 CDS product type I-F CRISPR-associated endonuclease Cas1f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210191.1 protein_id gnl|my_center|LOCUS_20600 1496 1704 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttatccaccgtgtaggtggcttagaag >Feature sequence334 190 765 gene locus_tag LOCUS_20610 190 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 822 1040 gene locus_tag LOCUS_20620 822 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 1688 921 gene locus_tag LOCUS_20630 1688 921 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038172.1 protein_id gnl|my_center|LOCUS_20630 >Feature sequence335 >Feature sequence336 324 43 gene locus_tag LOCUS_20640 324 43 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015101.1 protein_id gnl|my_center|LOCUS_20640 1528 347 gene locus_tag LOCUS_20650 gene thrC 1528 347 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880362.1 protein_id gnl|my_center|LOCUS_20650 >Feature sequence337 <1 606 gene locus_tag LOCUS_20660 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037026.1:ATP-binding protein 599 1129 gene locus_tag LOCUS_20670 599 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 >Feature sequence338 <1 1593 gene locus_tag LOCUS_20680 <1 1593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015444632.1:CusA/CzcA family heavy metal efflux RND transporter >Feature sequence339 >Feature sequence340 >Feature sequence341 <1 784 gene locus_tag LOCUS_20690 <1 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063868.1:c-type cytochrome >Feature sequence342 >Feature sequence343 478 852 gene locus_tag LOCUS_20700 gene flgB 478 852 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546345.1 protein_id gnl|my_center|LOCUS_20700 855 1292 gene locus_tag LOCUS_20710 gene flgC 855 1292 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941076.1 protein_id gnl|my_center|LOCUS_20710 >Feature sequence344 <1 1100 gene locus_tag LOCUS_20720 <1 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545828.1:S41 family peptidase 1265 1528 gene locus_tag LOCUS_20730 1265 1528 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546861.1 protein_id gnl|my_center|LOCUS_20730 >Feature sequence345 208 1110 gene locus_tag LOCUS_20740 208 1110 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762659.1 protein_id gnl|my_center|LOCUS_20740 1236 1409 gene locus_tag LOCUS_20750 1236 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 >Feature sequence346 <1608 403 gene locus_tag LOCUS_20760 <1608 403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975689.1:group II intron reverse transcriptase/maturase >Feature sequence347 405 806 gene locus_tag LOCUS_20770 405 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20770 >Feature sequence348 >Feature sequence349 1218 544 gene locus_tag LOCUS_20780 1218 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 1576 1241 gene locus_tag LOCUS_20790 1576 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 >Feature sequence350 >Feature sequence351 77 1 gene locus_tag LOCUS_t00340 77 1 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence352 <1 538 gene locus_tag LOCUS_20800 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946784.1:F0F1 ATP synthase subunit delta >Feature sequence353 448 933 gene locus_tag LOCUS_20810 448 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 1363 938 gene locus_tag LOCUS_20820 1363 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 >Feature sequence354 1368 886 gene locus_tag LOCUS_20830 1368 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 >Feature sequence355 >Feature sequence356 >Feature sequence357 <1 889 gene locus_tag LOCUS_20840 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142294.1:transketolase >Feature sequence358 <1 673 gene locus_tag LOCUS_20850 <1 673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942559.1:RIP metalloprotease RseP >Feature sequence359 >Feature sequence360 <1543 543 gene locus_tag LOCUS_20860 <1543 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016356999.1:RtcB family protein >Feature sequence361 278 1405 gene locus_tag LOCUS_20870 278 1405 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061218454.1 protein_id gnl|my_center|LOCUS_20870 >Feature sequence362 454 954 gene locus_tag LOCUS_20880 454 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20880 1066 1308 gene locus_tag LOCUS_20890 1066 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20890 >Feature sequence363 <1527 372 gene locus_tag LOCUS_20900 <1527 372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933392.1:DEAD/DEAH box helicase family protein >Feature sequence364 >Feature sequence365 1164 922 gene locus_tag LOCUS_20910 1164 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 1430 1164 gene locus_tag LOCUS_20920 1430 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 >Feature sequence366 1130 459 gene locus_tag LOCUS_20930 1130 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 >Feature sequence367 1491 538 gene locus_tag LOCUS_20940 1491 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 >Feature sequence368 244 1473 gene locus_tag LOCUS_20950 244 1473 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775668.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence369 243 731 gene locus_tag LOCUS_20960 gene mscL 243 731 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932912.1 protein_id gnl|my_center|LOCUS_20960 >Feature sequence370 967 512 gene locus_tag LOCUS_20970 967 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 >Feature sequence371 1265 381 gene locus_tag LOCUS_20980 gene htpX 1265 381 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360263.1 protein_id gnl|my_center|LOCUS_20980 >Feature sequence372 902 375 gene locus_tag LOCUS_20990 902 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 1416 919 gene locus_tag LOCUS_21000 1416 919 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941007.1 protein_id gnl|my_center|LOCUS_21000 >Feature sequence373 87 932 gene locus_tag LOCUS_21010 87 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 >Feature sequence374 560 75 gene locus_tag LOCUS_21020 560 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 >Feature sequence375 1489 512 gene locus_tag LOCUS_21030 1489 512 CDS product RelA/SpoT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031334.1 protein_id gnl|my_center|LOCUS_21030 >Feature sequence376 >Feature sequence377 >Feature sequence378 <1461 422 gene locus_tag LOCUS_21040 <1461 422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963917.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence379 182 619 gene locus_tag LOCUS_21050 182 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 719 643 gene locus_tag LOCUS_t00350 719 643 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1272 835 gene locus_tag LOCUS_21060 1272 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 >Feature sequence380 <1 612 gene locus_tag LOCUS_21070 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545144.1:caspase family protein >Feature sequence381 1 195 gene locus_tag LOCUS_21080 1 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 >Feature sequence382 65 418 gene locus_tag LOCUS_21090 65 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 >Feature sequence383 <1 1116 gene locus_tag LOCUS_21100 <1 1116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948598.1:ATP-binding protein >Feature sequence384 1380 79 gene locus_tag LOCUS_21110 1380 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 >Feature sequence385 256 963 gene locus_tag LOCUS_21120 256 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 1293 1117 gene locus_tag LOCUS_21130 1293 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 >Feature sequence386 705 1061 gene locus_tag LOCUS_21140 705 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 >Feature sequence387 >Feature sequence388 356 45 gene locus_tag LOCUS_21150 356 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 1371 685 gene locus_tag LOCUS_21160 1371 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 >Feature sequence389 397 1206 gene locus_tag LOCUS_21170 gene thyX 397 1206 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099542.1 protein_id gnl|my_center|LOCUS_21170 >Feature sequence390 <1413 754 gene locus_tag LOCUS_21180 <1413 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080226.1:glucose-6-phosphate dehydrogenase >Feature sequence391 <1 692 gene locus_tag LOCUS_21190 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027480022.1:triose-phosphate isomerase 749 1078 gene locus_tag LOCUS_21200 gene secG 749 1078 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942271.1 protein_id gnl|my_center|LOCUS_21200 >Feature sequence392 <1 902 gene locus_tag LOCUS_21210 <1 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012544945.1:hemolysin family protein >Feature sequence393 428 1102 gene locus_tag LOCUS_21220 428 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 >Feature sequence394 433 143 gene locus_tag LOCUS_21230 433 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21230 956 510 gene locus_tag LOCUS_21240 956 510 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533874.1 protein_id gnl|my_center|LOCUS_21240 1285 1031 gene locus_tag LOCUS_21250 1285 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 >Feature sequence395 624 97 gene locus_tag LOCUS_21260 624 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 <1392 621 gene locus_tag LOCUS_21270 <1392 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_208002277.1:acetylglutamate kinase >Feature sequence396 <1 875 gene locus_tag LOCUS_21280 <1 875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460796.1:flagellar hook-associated protein FlgL >Feature sequence397 746 354 gene locus_tag LOCUS_21290 746 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 <1383 739 gene locus_tag LOCUS_21300 <1383 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009968448.1:thioredoxin domain-containing protein >Feature sequence398 1051 602 gene locus_tag LOCUS_21310 1051 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 >Feature sequence399 1 237 gene locus_tag LOCUS_21320 1 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 234 713 gene locus_tag LOCUS_21330 234 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 >Feature sequence400 737 414 gene locus_tag LOCUS_21340 737 414 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123488.1 protein_id gnl|my_center|LOCUS_21340 1325 798 gene locus_tag LOCUS_21350 1325 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 >Feature sequence401 >Feature sequence402 <1 1048 gene locus_tag LOCUS_21360 <1 1048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405513.1:ABC-F family ATP-binding cassette domain-containing protein >Feature sequence403 855 1022 gene locus_tag LOCUS_21370 855 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 >Feature sequence404 <1 906 gene locus_tag LOCUS_21380 <1 906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973320.1:sensor histidine kinase KdpD >Feature sequence405 194 604 gene locus_tag LOCUS_21390 194 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 <1338 582 gene locus_tag LOCUS_21400 <1338 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583045.1:glucodextranase DOMON-like domain-containing protein >Feature sequence406 >Feature sequence407 733 506 gene locus_tag LOCUS_21410 733 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 882 1241 gene locus_tag LOCUS_21420 882 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21420 >Feature sequence408 438 193 gene locus_tag LOCUS_21430 438 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 580 392 gene locus_tag LOCUS_21440 580 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 1331 819 gene locus_tag LOCUS_21450 1331 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 >Feature sequence409 <1 735 gene locus_tag LOCUS_21460 <1 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946754.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence410 415 996 gene locus_tag LOCUS_21470 415 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 >Feature sequence411 3 371 gene locus_tag LOCUS_21480 3 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 >Feature sequence412 <1324 403 gene locus_tag LOCUS_21490 <1324 403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010944063.1:uroporphyrinogen decarboxylase >Feature sequence413 <1313 379 gene locus_tag LOCUS_21500 <1313 379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958257.1:nodulation protein NfeD >Feature sequence414 <1310 247 gene locus_tag LOCUS_21510 <1310 247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041914012.1:polyribonucleotide nucleotidyltransferase >Feature sequence415 <1 1179 gene locus_tag LOCUS_21520 <1 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947353.1:copper-translocating P-type ATPase >Feature sequence416 >Feature sequence417 726 926 gene locus_tag LOCUS_21530 726 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 >Feature sequence418 <1301 747 gene locus_tag LOCUS_21540 <1301 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011173830.1:DNA-formamidopyrimidine glycosylase >Feature sequence419 598 92 gene locus_tag LOCUS_21550 gene mec 598 92 CDS product CysO-cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898830.1 protein_id gnl|my_center|LOCUS_21550 <1299 517 gene locus_tag LOCUS_21560 <1299 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880850.1:thiazole biosynthesis adenylyltransferase ThiF >Feature sequence420 479 1183 gene locus_tag LOCUS_21570 479 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 >Feature sequence421 421 1029 gene locus_tag LOCUS_21580 421 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 >Feature sequence422 >Feature sequence423 >Feature sequence424 1247 924 gene locus_tag LOCUS_21590 1247 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 >Feature sequence425 >Feature sequence426 <1 776 gene locus_tag LOCUS_21600 <1 776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546247.1:CRISPR-associated endonuclease Cas1 >Feature sequence427 >Feature sequence428 1252 422 gene locus_tag LOCUS_21610 1252 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 >Feature sequence429 <1 593 gene locus_tag LOCUS_21620 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140029.1:primosomal protein N' >Feature sequence430 <1 711 gene locus_tag LOCUS_21630 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546576.1:ATP-binding protein >Feature sequence431 <1 935 gene locus_tag LOCUS_21640 <1 935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942467.1:DNA mismatch repair protein MutS >Feature sequence432 >Feature sequence433 920 189 gene locus_tag LOCUS_21650 920 189 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545472.1 protein_id gnl|my_center|LOCUS_21650 >Feature sequence434 >Feature sequence435 551 321 gene locus_tag LOCUS_21660 551 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 1000 560 gene locus_tag LOCUS_21670 1000 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 >Feature sequence436 <1202 546 gene locus_tag LOCUS_21680 <1202 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224566.1:AAA family ATPase >Feature sequence437 <1198 382 gene locus_tag LOCUS_21690 <1198 382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942556.1:biosynthetic-type acetolactate synthase large subunit >Feature sequence438 278 424 gene locus_tag LOCUS_21700 278 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 470 742 gene locus_tag LOCUS_21710 470 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 >Feature sequence439 935 177 gene locus_tag LOCUS_21720 gene rsmA 935 177 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337834.1 protein_id gnl|my_center|LOCUS_21720 >Feature sequence440 989 189 gene locus_tag LOCUS_21730 989 189 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768488.1 protein_id gnl|my_center|LOCUS_21730 >Feature sequence441 <1 1034 gene locus_tag LOCUS_21740 <1 1034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074377.1:site-specific integrase >Feature sequence442 >Feature sequence443 863 66 gene locus_tag LOCUS_21750 863 66 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057619.1 protein_id gnl|my_center|LOCUS_21750 >Feature sequence444 >Feature sequence445 <1 720 gene locus_tag LOCUS_21760 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000204917.1:phage antirepressor Ant >Feature sequence446 >Feature sequence447 465 178 gene locus_tag LOCUS_21770 465 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 >Feature sequence448 132 815 gene locus_tag LOCUS_21780 132 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 >Feature sequence449 1074 397 gene locus_tag LOCUS_21790 1074 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 >Feature sequence450 >Feature sequence451 >Feature sequence452 1119 418 gene locus_tag LOCUS_21800 1119 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 >Feature sequence453 >Feature sequence454 >Feature sequence455 <1 861 gene locus_tag LOCUS_21810 <1 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943777.1:methyl-accepting chemotaxis protein 925 1083 gene locus_tag LOCUS_21820 925 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 >Feature sequence456 <1 1056 gene locus_tag LOCUS_21830 <1 1056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_106726897.1:Ti-type conjugative transfer relaxase TraA >Feature sequence457 74 766 gene locus_tag LOCUS_21840 74 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 >Feature sequence458 922 425 gene locus_tag LOCUS_21850 922 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 >Feature sequence459 >Feature sequence460 >Feature sequence461 872 189 gene locus_tag LOCUS_21860 872 189 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522757.1 protein_id gnl|my_center|LOCUS_21860 >Feature sequence462 >Feature sequence463 249 46 gene locus_tag LOCUS_21870 249 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 658 242 gene locus_tag LOCUS_21880 658 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 >Feature sequence464 693 896 gene locus_tag LOCUS_21890 693 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 >Feature sequence465 >Feature sequence466 >Feature sequence467 >Feature sequence468 <1061 273 gene locus_tag LOCUS_21900 <1061 273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965007.1:response regulator transcription factor >Feature sequence469 <1 569 gene locus_tag LOCUS_21910 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002724487.1:FAD-dependent oxidoreductase 1059 673 gene locus_tag LOCUS_21920 1059 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 >Feature sequence470 >Feature sequence471 <1057 366 gene locus_tag LOCUS_21930 <1057 366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272501.1:chemotaxis protein CheA >Feature sequence472 <1 509 gene locus_tag LOCUS_21940 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016350746.1:adenine phosphoribosyltransferase 518 826 gene locus_tag LOCUS_21950 518 826 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262427.1 protein_id gnl|my_center|LOCUS_21950 >Feature sequence473 >Feature sequence474 >Feature sequence475 239 700 gene locus_tag LOCUS_21960 239 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21960 1012 695 gene locus_tag LOCUS_21970 1012 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 >Feature sequence476 >Feature sequence477 >Feature sequence478 >Feature sequence479 242 994 gene locus_tag LOCUS_21980 242 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 >Feature sequence480 <1 999 gene locus_tag LOCUS_21990 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013364052.1:CCA tRNA nucleotidyltransferase >Feature sequence481 <1022 198 gene locus_tag LOCUS_22000 <1022 198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000614448.1:LysR substrate-binding domain-containing protein >Feature sequence482 >Feature sequence483 250 519 gene locus_tag LOCUS_22010 250 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 >Feature sequence484 868 119 gene locus_tag LOCUS_22020 868 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 >Feature sequence485 123 311 gene locus_tag LOCUS_22030 123 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 308 937 gene locus_tag LOCUS_22040 308 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 >Feature sequence486 392 709 gene locus_tag LOCUS_22050 392 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 1003 734 gene locus_tag LOCUS_22060 1003 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 >Feature sequence487 >Feature sequence488 159 527 gene locus_tag LOCUS_22070 159 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 524 706 gene locus_tag LOCUS_22080 524 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 >Feature sequence489 >Feature sequence490 <1 652 gene locus_tag LOCUS_22090 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943678.1:FliA/WhiG family RNA polymerase sigma factor >Feature sequence491 <1011 257 gene locus_tag LOCUS_22100 <1011 257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974853.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence492 311 772 gene locus_tag LOCUS_22110 311 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 >Feature sequence493 >Feature sequence494 <1 515 gene locus_tag LOCUS_22120 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001079544.1:cytochrome c peroxidase >Feature sequence495 281 42 gene locus_tag LOCUS_22130 281 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 682 278 gene locus_tag LOCUS_22140 682 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 >Feature sequence496 >Feature sequence497 <1 805 gene locus_tag LOCUS_22150 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527590.1:UDP-glucose 4-epimerase GalE >Feature sequence498 >Feature sequence499 84 854 gene locus_tag LOCUS_22160 84 854 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391996.1 protein_id gnl|my_center|LOCUS_22160 >Feature sequence500 >Feature sequence501 <1 918 gene locus_tag LOCUS_22170 <1 918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937822.1:flagellar basal body P-ring protein FlgI >Feature sequence502 304 663 gene locus_tag LOCUS_22180 304 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 >Feature sequence503 >Feature sequence504 <1 888 gene locus_tag LOCUS_22190 <1 888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070427.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence505 163 780 gene locus_tag LOCUS_22200 gene infC 163 780 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498574.1 protein_id gnl|my_center|LOCUS_22200 >Feature sequence506 164 289 gene locus_tag LOCUS_22210 164 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 414 731 gene locus_tag LOCUS_22220 414 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 >Feature sequence507 456 827 gene locus_tag LOCUS_22230 456 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 >Feature sequence508 >Feature sequence509 342 776 gene locus_tag LOCUS_22240 342 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22240 >Feature sequence510 >Feature sequence511 >Feature sequence512 <865 61 gene locus_tag LOCUS_22250 <865 61 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024468.1:prephenate dehydrogenase >Feature sequence513 309 61 gene locus_tag LOCUS_22260 309 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 >Feature sequence514 >Feature sequence515 418 343 gene locus_tag LOCUS_t00360 418 343 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence516 >Feature sequence517 >Feature sequence518 609 181 gene locus_tag LOCUS_22270 gene tnpA 609 181 CDS product IS200/IS605-like element ISAzo20 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011236150.1 protein_id gnl|my_center|LOCUS_22270 >Feature sequence519 632 820 gene locus_tag LOCUS_22280 632 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 >Feature sequence520 40 426 gene locus_tag LOCUS_22290 40 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 490 565 gene locus_tag LOCUS_t00370 490 565 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence521 468 659 gene locus_tag LOCUS_22300 468 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 >Feature sequence522 >Feature sequence523 >Feature sequence524 636 202 gene locus_tag LOCUS_22310 636 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 >Feature sequence525 237 312 gene locus_tag LOCUS_t00380 237 312 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence526 <1 730 gene locus_tag LOCUS_22320 <1 730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000932524.1:phospholipase D-like domain-containing protein >Feature sequence527 >Feature sequence528 >Feature sequence529 >Feature sequence530 >Feature sequence531 189 368 gene locus_tag LOCUS_22330 189 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 499 666 gene locus_tag LOCUS_22340 499 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 >Feature sequence532 >Feature sequence533 >Feature sequence534 >Feature sequence535 361 292 gene locus_tag LOCUS_t00390 361 292 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence536 <731 215 gene locus_tag LOCUS_22350 <731 215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001309930.1:RNA-guided endonuclease TnpB family protein note possible pseudo, frameshifted >Feature sequence537 <729 89 gene locus_tag LOCUS_22360 <729 89 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528921.1:glucan 1,4-alpha-glucosidase >Feature sequence538 >Feature sequence539 >Feature sequence540 447 371 gene locus_tag LOCUS_t00400 447 371 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 551 685 gene locus_tag LOCUS_22370 551 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 >Feature sequence541 >Feature sequence542 >Feature sequence543 >Feature sequence544 262 337 gene locus_tag LOCUS_t00410 262 337 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 673 338 gene locus_tag LOCUS_22380 673 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 >Feature sequence545 >Feature sequence546 >Feature sequence547 375 172 gene locus_tag LOCUS_22390 375 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 >Feature sequence548 >Feature sequence549 >Feature sequence550 >Feature sequence551 >Feature sequence552 361 666 gene locus_tag LOCUS_22400 gene fdx 361 666 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124187.1 protein_id gnl|my_center|LOCUS_22400 >Feature sequence553 >Feature sequence554 >Feature sequence555 >Feature sequence556 355 280 gene locus_tag LOCUS_t00420 355 280 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence557 >Feature sequence558 >Feature sequence559 >Feature sequence560 >Feature sequence561 >Feature sequence562 >Feature sequence563 >Feature sequence564 >Feature sequence565 572 336 gene locus_tag LOCUS_22410 572 336 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528289.1 protein_id gnl|my_center|LOCUS_22410 >Feature sequence566 >Feature sequence567 >Feature sequence568 >Feature sequence569 >Feature sequence570 3 560 gene locus_tag LOCUS_22420 3 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 >Feature sequence571 >Feature sequence572 >Feature sequence573 >Feature sequence574 >Feature sequence575 >Feature sequence576 <1 537 gene locus_tag LOCUS_22430 <1 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003118644.1:methyltransferase domain-containing protein >Feature sequence577 307 468 gene locus_tag LOCUS_22440 307 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 >Feature sequence578 >Feature sequence579 >Feature sequence580 >Feature sequence581 78 491 gene locus_tag LOCUS_22450 78 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 >Feature sequence582 470 12 gene locus_tag LOCUS_22460 470 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 >Feature sequence583 >Feature sequence584 >Feature sequence585 >Feature sequence586 >Feature sequence587 >Feature sequence588 >Feature sequence589 >Feature sequence590 >Feature sequence591 >Feature sequence592 >Feature sequence593 >Feature sequence594 >Feature sequence595 >Feature sequence596 >Feature sequence597 >Feature sequence598 >Feature sequence599 >Feature sequence600 >Feature sequence601 >Feature sequence602 >Feature sequence603 >Feature sequence604 >Feature sequence605 >Feature sequence606 >Feature sequence607 321 10 gene locus_tag LOCUS_22470 321 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 510 435 gene locus_tag LOCUS_t00430 510 435 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence608 >Feature sequence609 >Feature sequence610 138 353 gene locus_tag LOCUS_22480 138 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 >Feature sequence611 >Feature sequence612 285 512 gene locus_tag LOCUS_22490 285 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 >Feature sequence613 >Feature sequence614 >Feature sequence615 >Feature sequence616 >Feature sequence617 >Feature sequence618 >Feature sequence619 >Feature sequence620 <505 4 gene locus_tag LOCUS_22500 <505 4 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_057443212.1:tyrosine-type recombinase/integrase >Feature sequence621 >Feature sequence622 >Feature sequence623 >Feature sequence624 >Feature sequence625