>Feature sequence001 <1 641 gene locus_tag LOCUS_00010 <1 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919871.1:ScpA family protein 638 1294 gene locus_tag LOCUS_00020 gene scpB 638 1294 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919870.1 protein_id gnl|my_center|LOCUS_00020 1410 1622 gene locus_tag LOCUS_00030 1410 1622 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919869.1 protein_id gnl|my_center|LOCUS_00030 1673 2173 gene locus_tag LOCUS_00040 1673 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00040 2170 3072 gene locus_tag LOCUS_00050 gene tatC 2170 3072 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919867.1 protein_id gnl|my_center|LOCUS_00050 3167 4447 gene locus_tag LOCUS_00060 gene serS 3167 4447 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389523.1 protein_id gnl|my_center|LOCUS_00060 4447 5238 gene locus_tag LOCUS_00070 gene surE 4447 5238 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919864.1 protein_id gnl|my_center|LOCUS_00070 5235 5900 gene locus_tag LOCUS_00080 5235 5900 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919863.1 protein_id gnl|my_center|LOCUS_00080 6398 6093 gene locus_tag LOCUS_00090 6398 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 6337 7461 gene locus_tag LOCUS_00100 6337 7461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00100 8307 7450 gene locus_tag LOCUS_00110 8307 7450 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640385.1 protein_id gnl|my_center|LOCUS_00110 8440 8814 gene locus_tag LOCUS_00120 8440 8814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 8830 11373 gene locus_tag LOCUS_00130 gene secDF 8830 11373 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531306.1 protein_id gnl|my_center|LOCUS_00130 11377 11736 gene locus_tag LOCUS_00140 11377 11736 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919855.1 protein_id gnl|my_center|LOCUS_00140 11855 12475 gene locus_tag LOCUS_00150 11855 12475 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919854.1 protein_id gnl|my_center|LOCUS_00150 12804 12463 gene locus_tag LOCUS_00160 12804 12463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 12853 13194 gene locus_tag LOCUS_00170 12853 13194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 14601 13222 gene locus_tag LOCUS_00180 gene trmFO 14601 13222 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920452.1 protein_id gnl|my_center|LOCUS_00180 14686 15447 gene locus_tag LOCUS_00190 14686 15447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 15447 16361 gene locus_tag LOCUS_00200 15447 16361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 16980 16369 gene locus_tag LOCUS_00210 16980 16369 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640531.1 protein_id gnl|my_center|LOCUS_00210 18334 17126 gene locus_tag LOCUS_00220 18334 17126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00220 20176 18359 gene locus_tag LOCUS_00230 20176 18359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00230 20206 20409 gene locus_tag LOCUS_00240 gene thiS 20206 20409 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919747.1 protein_id gnl|my_center|LOCUS_00240 20409 21200 gene locus_tag LOCUS_00250 20409 21200 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919746.1 protein_id gnl|my_center|LOCUS_00250 21294 22040 gene locus_tag LOCUS_00260 gene fabG 21294 22040 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762708.1 protein_id gnl|my_center|LOCUS_00260 22046 22939 gene locus_tag LOCUS_00270 22046 22939 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037755.1 protein_id gnl|my_center|LOCUS_00270 >Feature sequence002 676 1578 gene locus_tag LOCUS_00280 676 1578 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918675.1 protein_id gnl|my_center|LOCUS_00280 2347 1628 gene locus_tag LOCUS_00290 2347 1628 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388218.1 protein_id gnl|my_center|LOCUS_00290 3519 2371 gene locus_tag LOCUS_00300 3519 2371 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918315.1 protein_id gnl|my_center|LOCUS_00300 3631 5832 gene locus_tag LOCUS_00310 3631 5832 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986774.1 protein_id gnl|my_center|LOCUS_00310 5829 6302 gene locus_tag LOCUS_00320 5829 6302 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919948.1 protein_id gnl|my_center|LOCUS_00320 7008 6316 gene locus_tag LOCUS_00330 7008 6316 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919949.1 protein_id gnl|my_center|LOCUS_00330 8257 6974 gene locus_tag LOCUS_00340 8257 6974 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919950.1 protein_id gnl|my_center|LOCUS_00340 8433 9635 gene locus_tag LOCUS_00350 8433 9635 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640274.1 protein_id gnl|my_center|LOCUS_00350 9768 10673 gene locus_tag LOCUS_00360 9768 10673 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919954.1 protein_id gnl|my_center|LOCUS_00360 10819 12258 gene locus_tag LOCUS_00370 10819 12258 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_00370 12382 13842 gene locus_tag LOCUS_00380 12382 13842 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920866.1 protein_id gnl|my_center|LOCUS_00380 13866 14693 gene locus_tag LOCUS_00390 13866 14693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921334.1 protein_id gnl|my_center|LOCUS_00390 15833 14706 gene locus_tag LOCUS_00400 15833 14706 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919956.1 protein_id gnl|my_center|LOCUS_00400 18705 15880 gene locus_tag LOCUS_00410 18705 15880 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920490.1 protein_id gnl|my_center|LOCUS_00410 18997 19455 gene locus_tag LOCUS_00420 18997 19455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 19487 20224 gene locus_tag LOCUS_00430 19487 20224 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381155.1 protein_id gnl|my_center|LOCUS_00430 20214 21569 gene locus_tag LOCUS_00440 20214 21569 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246072.1 protein_id gnl|my_center|LOCUS_00440 <22634 21594 gene locus_tag LOCUS_00450 <22634 21594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004196794.1:efflux transporter outer membrane subunit >Feature sequence003 268 1203 gene locus_tag LOCUS_00460 268 1203 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258980.1 protein_id gnl|my_center|LOCUS_00460 1196 1915 gene locus_tag LOCUS_00470 1196 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 2132 1902 gene locus_tag LOCUS_00480 2132 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 2013 3083 gene locus_tag LOCUS_00490 2013 3083 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764054.1 protein_id gnl|my_center|LOCUS_00490 3145 4389 gene locus_tag LOCUS_00500 3145 4389 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006095218.1 protein_id gnl|my_center|LOCUS_00500 5635 4445 gene locus_tag LOCUS_00510 5635 4445 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528000.1 protein_id gnl|my_center|LOCUS_00510 7578 5632 gene locus_tag LOCUS_00520 7578 5632 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085964.1 protein_id gnl|my_center|LOCUS_00520 7791 9380 gene locus_tag LOCUS_00530 gene glpD 7791 9380 CDS product aerobic glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672801.1 protein_id gnl|my_center|LOCUS_00530 9377 10774 gene locus_tag LOCUS_00540 9377 10774 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729741.1 protein_id gnl|my_center|LOCUS_00540 10767 12194 gene locus_tag LOCUS_00550 gene glpK 10767 12194 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229157.1 protein_id gnl|my_center|LOCUS_00550 12248 14305 gene locus_tag LOCUS_00560 12248 14305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 14608 14775 gene locus_tag LOCUS_00570 14608 14775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 14765 15175 gene locus_tag LOCUS_00580 14765 15175 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387746.1 protein_id gnl|my_center|LOCUS_00580 15166 15294 gene locus_tag LOCUS_00590 15166 15294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 15426 16202 gene locus_tag LOCUS_00600 15426 16202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 16255 17397 gene locus_tag LOCUS_00610 16255 17397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 18467 17574 gene locus_tag LOCUS_00620 18467 17574 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087072.1 protein_id gnl|my_center|LOCUS_00620 18672 21776 gene locus_tag LOCUS_00630 18672 21776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_00630 <22436 21884 gene locus_tag LOCUS_00640 <22436 21884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012639983.1:type II toxin-antitoxin system HipA family toxin >Feature sequence004 <1 831 gene locus_tag LOCUS_00650 <1 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918380.1:prolipoprotein diacylglyceryl transferase 828 1910 gene locus_tag LOCUS_00660 828 1910 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918379.1 protein_id gnl|my_center|LOCUS_00660 1907 2683 gene locus_tag LOCUS_00670 gene pgeF 1907 2683 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918378.1 protein_id gnl|my_center|LOCUS_00670 3072 2641 gene locus_tag LOCUS_00680 3072 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 3270 4205 gene locus_tag LOCUS_00690 3270 4205 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918375.1 protein_id gnl|my_center|LOCUS_00690 4310 5419 gene locus_tag LOCUS_00700 4310 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918374.1 protein_id gnl|my_center|LOCUS_00700 5582 6190 gene locus_tag LOCUS_00710 5582 6190 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918373.1 protein_id gnl|my_center|LOCUS_00710 6205 6831 gene locus_tag LOCUS_00720 gene pth 6205 6831 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918372.1 protein_id gnl|my_center|LOCUS_00720 6836 7603 gene locus_tag LOCUS_00730 6836 7603 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918371.1 protein_id gnl|my_center|LOCUS_00730 7625 8722 gene locus_tag LOCUS_00740 gene ychF 7625 8722 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918367.1 protein_id gnl|my_center|LOCUS_00740 9437 8910 gene locus_tag LOCUS_00750 9437 8910 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972163.1 protein_id gnl|my_center|LOCUS_00750 10320 9451 gene locus_tag LOCUS_00760 10320 9451 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337020.1 protein_id gnl|my_center|LOCUS_00760 10669 10484 gene locus_tag LOCUS_00770 10669 10484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 10619 11251 gene locus_tag LOCUS_00780 10619 11251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 12139 11273 gene locus_tag LOCUS_00790 12139 11273 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918362.1 protein_id gnl|my_center|LOCUS_00790 13440 12148 gene locus_tag LOCUS_00800 13440 12148 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918361.1 protein_id gnl|my_center|LOCUS_00800 13996 13451 gene locus_tag LOCUS_00810 gene petA 13996 13451 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639988.1 protein_id gnl|my_center|LOCUS_00810 15390 14173 gene locus_tag LOCUS_00820 15390 14173 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532385.1 protein_id gnl|my_center|LOCUS_00820 15573 16424 gene locus_tag LOCUS_00830 15573 16424 CDS product Kdo hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522262.1 protein_id gnl|my_center|LOCUS_00830 16421 17794 gene locus_tag LOCUS_00840 16421 17794 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640321.1 protein_id gnl|my_center|LOCUS_00840 17956 18699 gene locus_tag LOCUS_00850 17956 18699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 20532 18712 gene locus_tag LOCUS_00860 20532 18712 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 protein_id gnl|my_center|LOCUS_00860 <21472 20663 gene locus_tag LOCUS_00870 <21472 20663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920048.1:P1 family peptidase >Feature sequence005 494 1120 gene locus_tag LOCUS_00880 494 1120 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918263.1 protein_id gnl|my_center|LOCUS_00880 1193 4633 gene locus_tag LOCUS_00890 gene smc 1193 4633 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918261.1 protein_id gnl|my_center|LOCUS_00890 4803 5183 gene locus_tag LOCUS_00900 4803 5183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 5183 5980 gene locus_tag LOCUS_00910 5183 5980 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918256.1 protein_id gnl|my_center|LOCUS_00910 6025 6255 gene locus_tag LOCUS_00920 6025 6255 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004615714.1 protein_id gnl|my_center|LOCUS_00920 6287 6826 gene locus_tag LOCUS_00930 6287 6826 CDS product ATP synthase F0 subunit B' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918255.1 protein_id gnl|my_center|LOCUS_00930 6847 7350 gene locus_tag LOCUS_00940 6847 7350 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918254.1 protein_id gnl|my_center|LOCUS_00940 7727 7410 gene locus_tag LOCUS_00950 7727 7410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 9397 7844 gene locus_tag LOCUS_00960 9397 7844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 9615 10775 gene locus_tag LOCUS_00970 9615 10775 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918413.1 protein_id gnl|my_center|LOCUS_00970 10772 11386 gene locus_tag LOCUS_00980 gene metW 10772 11386 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918412.1 protein_id gnl|my_center|LOCUS_00980 12132 11377 gene locus_tag LOCUS_00990 12132 11377 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639996.1 protein_id gnl|my_center|LOCUS_00990 12257 13024 gene locus_tag LOCUS_01000 gene gloB 12257 13024 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918407.1 protein_id gnl|my_center|LOCUS_01000 13747 13034 gene locus_tag LOCUS_01010 13747 13034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 14603 13878 gene locus_tag LOCUS_01020 14603 13878 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918399.1 protein_id gnl|my_center|LOCUS_01020 15903 14728 gene locus_tag LOCUS_01030 15903 14728 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918398.1 protein_id gnl|my_center|LOCUS_01030 16078 16674 gene locus_tag LOCUS_01040 gene phaR 16078 16674 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918397.1 protein_id gnl|my_center|LOCUS_01040 17506 16724 gene locus_tag LOCUS_01050 17506 16724 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921209.1 protein_id gnl|my_center|LOCUS_01050 19131 17731 gene locus_tag LOCUS_01060 19131 17731 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923265.1 protein_id gnl|my_center|LOCUS_01060 20145 19141 gene locus_tag LOCUS_01070 20145 19141 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921219.1 protein_id gnl|my_center|LOCUS_01070 20687 20073 gene locus_tag LOCUS_01080 20687 20073 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037976.1 protein_id gnl|my_center|LOCUS_01080 21259 20684 gene locus_tag LOCUS_01090 21259 20684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 >Feature sequence006 224 300 gene locus_tag LOCUS_t00010 224 300 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 821 618 gene locus_tag LOCUS_01100 821 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 1935 1030 gene locus_tag LOCUS_01110 1935 1030 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083373.1 protein_id gnl|my_center|LOCUS_01110 1979 2269 gene locus_tag LOCUS_01120 1979 2269 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729587.1 protein_id gnl|my_center|LOCUS_01120 3744 2434 gene locus_tag LOCUS_01130 3744 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966440.1 protein_id gnl|my_center|LOCUS_01130 6156 3757 gene locus_tag LOCUS_01140 6156 3757 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918342.1 protein_id gnl|my_center|LOCUS_01140 6389 7132 gene locus_tag LOCUS_01150 6389 7132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 7168 8214 gene locus_tag LOCUS_01160 7168 8214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 8840 8211 gene locus_tag LOCUS_01170 8840 8211 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083803.1 protein_id gnl|my_center|LOCUS_01170 9029 10270 gene locus_tag LOCUS_01180 9029 10270 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_01180 12160 10496 gene locus_tag LOCUS_01190 12160 10496 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918841.1 protein_id gnl|my_center|LOCUS_01190 12987 12157 gene locus_tag LOCUS_01200 gene hutG 12987 12157 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918842.1 protein_id gnl|my_center|LOCUS_01200 14534 12984 gene locus_tag LOCUS_01210 gene hutH 14534 12984 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640105.1 protein_id gnl|my_center|LOCUS_01210 15736 14531 gene locus_tag LOCUS_01220 gene hutI 15736 14531 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918844.1 protein_id gnl|my_center|LOCUS_01220 15781 17154 gene locus_tag LOCUS_01230 15781 17154 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088984.1 protein_id gnl|my_center|LOCUS_01230 17164 17868 gene locus_tag LOCUS_01240 gene hutC 17164 17868 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918846.1 protein_id gnl|my_center|LOCUS_01240 17946 18719 gene locus_tag LOCUS_01250 17946 18719 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018207865.1 protein_id gnl|my_center|LOCUS_01250 18818 20248 gene locus_tag LOCUS_01260 18818 20248 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207317.1 protein_id gnl|my_center|LOCUS_01260 >Feature sequence007 2 352 gene locus_tag LOCUS_01270 2 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 1482 349 gene locus_tag LOCUS_01280 gene lldD 1482 349 CDS product FMN-dependent L-lactate dehydrogenase LldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919035.1 protein_id gnl|my_center|LOCUS_01280 3419 1479 gene locus_tag LOCUS_01290 gene cobT 3419 1479 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918558.1 protein_id gnl|my_center|LOCUS_01290 4172 3468 gene locus_tag LOCUS_01300 gene rpe 4172 3468 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088426.1 protein_id gnl|my_center|LOCUS_01300 5215 4169 gene locus_tag LOCUS_01310 5215 4169 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669849.1 protein_id gnl|my_center|LOCUS_01310 6535 5393 gene locus_tag LOCUS_01320 gene dinB 6535 5393 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970234.1 protein_id gnl|my_center|LOCUS_01320 8136 6532 gene locus_tag LOCUS_01330 8136 6532 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918029.1 protein_id gnl|my_center|LOCUS_01330 9159 8212 gene locus_tag LOCUS_01340 gene gshB 9159 8212 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918030.1 protein_id gnl|my_center|LOCUS_01340 9570 9190 gene locus_tag LOCUS_01350 9570 9190 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918032.1 protein_id gnl|my_center|LOCUS_01350 10502 9567 gene locus_tag LOCUS_01360 gene rsmI 10502 9567 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918033.1 protein_id gnl|my_center|LOCUS_01360 11467 10682 gene locus_tag LOCUS_01370 11467 10682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 11611 13488 gene locus_tag LOCUS_01380 11611 13488 CDS product alkyl/aryl-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900750.1 protein_id gnl|my_center|LOCUS_01380 14105 13503 gene locus_tag LOCUS_01390 14105 13503 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194252.1 protein_id gnl|my_center|LOCUS_01390 14525 14175 gene locus_tag LOCUS_01400 14525 14175 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921255.1 protein_id gnl|my_center|LOCUS_01400 15658 14720 gene locus_tag LOCUS_01410 15658 14720 CDS product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265954.1 protein_id gnl|my_center|LOCUS_01410 16577 15705 gene locus_tag LOCUS_01420 16577 15705 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917983.1 protein_id gnl|my_center|LOCUS_01420 17607 16609 gene locus_tag LOCUS_01430 17607 16609 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917985.1 protein_id gnl|my_center|LOCUS_01430 17720 18592 gene locus_tag LOCUS_01440 17720 18592 CDS product isoaspartyl peptidase/L-asparaginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917986.1 protein_id gnl|my_center|LOCUS_01440 19605 18649 gene locus_tag LOCUS_01450 19605 18649 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265509.1 protein_id gnl|my_center|LOCUS_01450 19765 20016 gene locus_tag LOCUS_01460 19765 20016 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918078.1 protein_id gnl|my_center|LOCUS_01460 20087 20431 gene locus_tag LOCUS_01470 20087 20431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 >Feature sequence008 1215 202 gene locus_tag LOCUS_01480 gene nagZ 1215 202 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640386.1 protein_id gnl|my_center|LOCUS_01480 2051 1212 gene locus_tag LOCUS_01490 gene ftsN 2051 1212 CDS product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919873.1 protein_id gnl|my_center|LOCUS_01490 3393 2218 gene locus_tag LOCUS_01500 3393 2218 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919874.1 protein_id gnl|my_center|LOCUS_01500 3488 3850 gene locus_tag LOCUS_01510 gene erpA 3488 3850 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919875.1 protein_id gnl|my_center|LOCUS_01510 3873 4652 gene locus_tag LOCUS_01520 gene xth 3873 4652 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919877.1 protein_id gnl|my_center|LOCUS_01520 4773 4697 gene locus_tag LOCUS_t00020 4773 4697 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7240 4838 gene locus_tag LOCUS_01530 gene lon 7240 4838 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919826.1 protein_id gnl|my_center|LOCUS_01530 7596 7414 gene locus_tag LOCUS_01540 7596 7414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01540 8919 7657 gene locus_tag LOCUS_01550 8919 7657 CDS product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967081.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01550 9332 8946 gene locus_tag LOCUS_01560 9332 8946 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532891.1 protein_id gnl|my_center|LOCUS_01560 10600 9338 gene locus_tag LOCUS_01570 gene clpX 10600 9338 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919827.1 protein_id gnl|my_center|LOCUS_01570 10811 11455 gene locus_tag LOCUS_01580 10811 11455 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640373.1 protein_id gnl|my_center|LOCUS_01580 11625 11428 gene locus_tag LOCUS_01590 11625 11428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 12945 11737 gene locus_tag LOCUS_01600 12945 11737 CDS product DUF3089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918560.1 protein_id gnl|my_center|LOCUS_01600 13735 13109 gene locus_tag LOCUS_01610 13735 13109 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640374.1 protein_id gnl|my_center|LOCUS_01610 15436 13862 gene locus_tag LOCUS_01620 gene tig 15436 13862 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919830.1 protein_id gnl|my_center|LOCUS_01620 15788 17143 gene locus_tag LOCUS_01630 15788 17143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 17229 17723 gene locus_tag LOCUS_01640 17229 17723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 17934 18866 gene locus_tag LOCUS_01650 17934 18866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 18984 19068 gene locus_tag LOCUS_t00030 18984 19068 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 19114 19497 gene locus_tag LOCUS_01660 19114 19497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 >Feature sequence009 <1 512 gene locus_tag LOCUS_01670 <1 512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_035257975.1:5-aminolevulinate synthase 1443 529 gene locus_tag LOCUS_01680 1443 529 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532051.1 protein_id gnl|my_center|LOCUS_01680 1485 2603 gene locus_tag LOCUS_01690 1485 2603 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969552.1 protein_id gnl|my_center|LOCUS_01690 2614 3492 gene locus_tag LOCUS_01700 2614 3492 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085368.1 protein_id gnl|my_center|LOCUS_01700 3531 4991 gene locus_tag LOCUS_01710 3531 4991 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975100.1 protein_id gnl|my_center|LOCUS_01710 5015 5434 gene locus_tag LOCUS_01720 5015 5434 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532057.1 protein_id gnl|my_center|LOCUS_01720 5427 6332 gene locus_tag LOCUS_01730 gene cbbX 5427 6332 CDS product CbbX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969558.1 protein_id gnl|my_center|LOCUS_01730 6479 8407 gene locus_tag LOCUS_01740 6479 8407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 8407 9711 gene locus_tag LOCUS_01750 8407 9711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 9881 10591 gene locus_tag LOCUS_01760 9881 10591 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957730.1 protein_id gnl|my_center|LOCUS_01760 13882 10802 gene locus_tag LOCUS_01770 13882 10802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 18766 13931 gene locus_tag LOCUS_01780 18766 13931 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917977.1 protein_id gnl|my_center|LOCUS_01780 19890 18835 gene locus_tag LOCUS_01790 19890 18835 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639875.1 protein_id gnl|my_center|LOCUS_01790 >Feature sequence010 <1 922 gene locus_tag LOCUS_01800 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090530.1:acetyl-CoA C-acetyltransferase 998 1708 gene locus_tag LOCUS_01810 gene trmD 998 1708 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918087.1 protein_id gnl|my_center|LOCUS_01810 1736 2122 gene locus_tag LOCUS_01820 gene rplS 1736 2122 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918086.1 protein_id gnl|my_center|LOCUS_01820 3727 2312 gene locus_tag LOCUS_01830 3727 2312 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201008.1 protein_id gnl|my_center|LOCUS_01830 3726 4568 gene locus_tag LOCUS_01840 3726 4568 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265741.1 protein_id gnl|my_center|LOCUS_01840 4672 5181 gene locus_tag LOCUS_01850 4672 5181 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918414.1 protein_id gnl|my_center|LOCUS_01850 5253 5537 gene locus_tag LOCUS_01860 5253 5537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 5534 6595 gene locus_tag LOCUS_01870 5534 6595 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918416.1 protein_id gnl|my_center|LOCUS_01870 6818 8152 gene locus_tag LOCUS_01880 6818 8152 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918418.1 protein_id gnl|my_center|LOCUS_01880 9223 8159 gene locus_tag LOCUS_01890 9223 8159 CDS product DUF2332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970239.1 protein_id gnl|my_center|LOCUS_01890 10563 9295 gene locus_tag LOCUS_01900 10563 9295 CDS product UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639881.1 protein_id gnl|my_center|LOCUS_01900 11378 10560 gene locus_tag LOCUS_01910 11378 10560 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265997.1 protein_id gnl|my_center|LOCUS_01910 12451 11462 gene locus_tag LOCUS_01920 12451 11462 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921431.1 protein_id gnl|my_center|LOCUS_01920 12907 12993 gene locus_tag LOCUS_t00040 12907 12993 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14238 13096 gene locus_tag LOCUS_01930 gene dnaJ 14238 13096 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917901.1 protein_id gnl|my_center|LOCUS_01930 16238 14343 gene locus_tag LOCUS_01940 gene dnaK 16238 14343 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917900.1 protein_id gnl|my_center|LOCUS_01940 16481 17149 gene locus_tag LOCUS_01950 16481 17149 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639854.1 protein_id gnl|my_center|LOCUS_01950 17210 18118 gene locus_tag LOCUS_01960 17210 18118 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446869.1 protein_id gnl|my_center|LOCUS_01960 18773 18129 gene locus_tag LOCUS_01970 18773 18129 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406312.1 protein_id gnl|my_center|LOCUS_01970 19119 19481 gene locus_tag LOCUS_01980 19119 19481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 >Feature sequence011 1626 661 gene locus_tag LOCUS_01990 1626 661 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088879.1 protein_id gnl|my_center|LOCUS_01990 2822 1695 gene locus_tag LOCUS_02000 2822 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919038.1 protein_id gnl|my_center|LOCUS_02000 5137 2828 gene locus_tag LOCUS_02010 5137 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 6367 5144 gene locus_tag LOCUS_02020 6367 5144 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919046.1 protein_id gnl|my_center|LOCUS_02020 6660 6364 gene locus_tag LOCUS_02030 6660 6364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 7831 6896 gene locus_tag LOCUS_02040 7831 6896 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919048.1 protein_id gnl|my_center|LOCUS_02040 9583 7853 gene locus_tag LOCUS_02050 9583 7853 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640164.1 protein_id gnl|my_center|LOCUS_02050 9762 11603 gene locus_tag LOCUS_02060 9762 11603 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923241.1 protein_id gnl|my_center|LOCUS_02060 11628 13199 gene locus_tag LOCUS_02070 11628 13199 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144406.1 protein_id gnl|my_center|LOCUS_02070 13780 13208 gene locus_tag LOCUS_02080 13780 13208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 14955 13954 gene locus_tag LOCUS_02090 14955 13954 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528459.1 protein_id gnl|my_center|LOCUS_02090 15032 16462 gene locus_tag LOCUS_02100 15032 16462 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_02100 16581 17150 gene locus_tag LOCUS_02110 16581 17150 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525069.1 protein_id gnl|my_center|LOCUS_02110 17952 17176 gene locus_tag LOCUS_02120 17952 17176 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533693.1 protein_id gnl|my_center|LOCUS_02120 19037 17979 gene locus_tag LOCUS_02130 19037 17979 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919229.1 protein_id gnl|my_center|LOCUS_02130 >Feature sequence012 598 1794 gene locus_tag LOCUS_02140 gene nhaA 598 1794 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528071.1 protein_id gnl|my_center|LOCUS_02140 2729 1791 gene locus_tag LOCUS_02150 2729 1791 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480227.1 protein_id gnl|my_center|LOCUS_02150 2956 4755 gene locus_tag LOCUS_02160 2956 4755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 4986 6521 gene locus_tag LOCUS_02170 gene ffh 4986 6521 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921480.1 protein_id gnl|my_center|LOCUS_02170 6571 7026 gene locus_tag LOCUS_02180 6571 7026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 7038 7562 gene locus_tag LOCUS_02190 gene rimM 7038 7562 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921478.1 protein_id gnl|my_center|LOCUS_02190 9659 7566 gene locus_tag LOCUS_02200 9659 7566 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404763.1 protein_id gnl|my_center|LOCUS_02200 12193 10256 gene locus_tag LOCUS_02210 gene thrS 12193 10256 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918352.1 protein_id gnl|my_center|LOCUS_02210 12487 12206 gene locus_tag LOCUS_02220 12487 12206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 12959 12498 gene locus_tag LOCUS_02230 12959 12498 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918350.1 protein_id gnl|my_center|LOCUS_02230 13444 13001 gene locus_tag LOCUS_02240 13444 13001 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918349.1 protein_id gnl|my_center|LOCUS_02240 14840 13455 gene locus_tag LOCUS_02250 gene cysS 14840 13455 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918348.1 protein_id gnl|my_center|LOCUS_02250 14890 15315 gene locus_tag LOCUS_02260 gene hisI 14890 15315 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918345.1 protein_id gnl|my_center|LOCUS_02260 15308 16306 gene locus_tag LOCUS_02270 15308 16306 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918341.1 protein_id gnl|my_center|LOCUS_02270 16440 17330 gene locus_tag LOCUS_02280 gene rpoH 16440 17330 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920934.1 protein_id gnl|my_center|LOCUS_02280 18743 17454 gene locus_tag LOCUS_02290 18743 17454 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920939.1 protein_id gnl|my_center|LOCUS_02290 >Feature sequence013 2031 1120 gene locus_tag LOCUS_02300 2031 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 3057 2047 gene locus_tag LOCUS_02310 3057 2047 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252964.1 protein_id gnl|my_center|LOCUS_02310 3178 4734 gene locus_tag LOCUS_02320 3178 4734 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625965.1 protein_id gnl|my_center|LOCUS_02320 5078 4713 gene locus_tag LOCUS_02330 5078 4713 CDS product CHY zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405189.1 protein_id gnl|my_center|LOCUS_02330 5374 6252 gene locus_tag LOCUS_02340 5374 6252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 6242 7051 gene locus_tag LOCUS_02350 6242 7051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 7682 7281 gene locus_tag LOCUS_02360 7682 7281 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970383.1 protein_id gnl|my_center|LOCUS_02360 8411 7776 gene locus_tag LOCUS_02370 8411 7776 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087542.1 protein_id gnl|my_center|LOCUS_02370 11188 8408 gene locus_tag LOCUS_02380 11188 8408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 11849 11361 gene locus_tag LOCUS_02390 11849 11361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 11970 11895 gene locus_tag LOCUS_t00050 11970 11895 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 12181 13269 gene locus_tag LOCUS_02400 12181 13269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 13983 13300 gene locus_tag LOCUS_02410 13983 13300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 14097 14024 gene locus_tag LOCUS_t00060 14097 14024 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 14279 14851 gene locus_tag LOCUS_02420 14279 14851 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919194.1 protein_id gnl|my_center|LOCUS_02420 15207 15929 gene locus_tag LOCUS_02430 15207 15929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 >Feature sequence014 296 1453 gene locus_tag LOCUS_02440 296 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 4003 1469 gene locus_tag LOCUS_02450 4003 1469 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085792.1 protein_id gnl|my_center|LOCUS_02450 3927 4184 gene locus_tag LOCUS_02460 3927 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 4473 4096 gene locus_tag LOCUS_02470 4473 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 4912 4484 gene locus_tag LOCUS_02480 4912 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 6176 5064 gene locus_tag LOCUS_02490 6176 5064 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193979.1 protein_id gnl|my_center|LOCUS_02490 7060 6206 gene locus_tag LOCUS_02500 gene hpnK 7060 6206 CDS product hopanoid biosynthesis-associated protein HpnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192157.1 protein_id gnl|my_center|LOCUS_02500 8487 7057 gene locus_tag LOCUS_02510 gene hpnJ 8487 7057 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196953.1 protein_id gnl|my_center|LOCUS_02510 9698 8544 gene locus_tag LOCUS_02520 gene hpnI 9698 8544 CDS product bacteriohopanetetrol glucosamine biosynthesis glycosyltransferase HpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197829.1 protein_id gnl|my_center|LOCUS_02520 10848 9862 gene locus_tag LOCUS_02530 10848 9862 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085392.1 protein_id gnl|my_center|LOCUS_02530 11125 11838 gene locus_tag LOCUS_02540 11125 11838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 13274 11973 gene locus_tag LOCUS_02550 13274 11973 CDS product pilus assembly protein TadG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531999.1 protein_id gnl|my_center|LOCUS_02550 13729 13307 gene locus_tag LOCUS_02560 13729 13307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 14223 13729 gene locus_tag LOCUS_02570 14223 13729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 14496 16019 gene locus_tag LOCUS_02580 14496 16019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 <17313 15986 gene locus_tag LOCUS_02590 <17313 15986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941614.1:EAL domain-containing protein >Feature sequence015 <1 1812 gene locus_tag LOCUS_02600 <1 1812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918391.1:DNA-directed RNA polymerase subunit beta' 2352 1888 gene locus_tag LOCUS_02610 2352 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 3256 2333 gene locus_tag LOCUS_02620 3256 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 4401 3385 gene locus_tag LOCUS_02630 gene virB11 4401 3385 CDS product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920281.1 protein_id gnl|my_center|LOCUS_02630 5501 4398 gene locus_tag LOCUS_02640 5501 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 6271 5498 gene locus_tag LOCUS_02650 gene virB9 6271 5498 CDS product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920279.1 protein_id gnl|my_center|LOCUS_02650 6999 6289 gene locus_tag LOCUS_02660 6999 6289 CDS product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971093.1 protein_id gnl|my_center|LOCUS_02660 8237 6996 gene locus_tag LOCUS_02670 8237 6996 CDS product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920278.1 protein_id gnl|my_center|LOCUS_02670 10570 8237 gene locus_tag LOCUS_02680 10570 8237 CDS product VirB4 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920277.1 protein_id gnl|my_center|LOCUS_02680 10910 10623 gene locus_tag LOCUS_02690 10910 10623 CDS product type IV secretion system protein VirB3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920276.1 protein_id gnl|my_center|LOCUS_02690 11165 10914 gene locus_tag LOCUS_02700 11165 10914 CDS product TrbC/VirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920275.1 protein_id gnl|my_center|LOCUS_02700 11821 11240 gene locus_tag LOCUS_02710 11821 11240 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920274.1 protein_id gnl|my_center|LOCUS_02710 12378 12686 gene locus_tag LOCUS_02720 gene rpsJ 12378 12686 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004616952.1 protein_id gnl|my_center|LOCUS_02720 12699 13472 gene locus_tag LOCUS_02730 gene rplC 12699 13472 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640190.1 protein_id gnl|my_center|LOCUS_02730 13472 14110 gene locus_tag LOCUS_02740 gene rplD 13472 14110 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919128.1 protein_id gnl|my_center|LOCUS_02740 14113 14409 gene locus_tag LOCUS_02750 14113 14409 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919129.1 protein_id gnl|my_center|LOCUS_02750 14415 15251 gene locus_tag LOCUS_02760 gene rplB 14415 15251 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919130.1 protein_id gnl|my_center|LOCUS_02760 15256 15534 gene locus_tag LOCUS_02770 gene rpsS 15256 15534 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919131.1 protein_id gnl|my_center|LOCUS_02770 15537 15917 gene locus_tag LOCUS_02780 gene rplV 15537 15917 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919132.1 protein_id gnl|my_center|LOCUS_02780 15917 16672 gene locus_tag LOCUS_02790 gene rpsC 15917 16672 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919133.1 protein_id gnl|my_center|LOCUS_02790 >Feature sequence016 509 991 gene locus_tag LOCUS_02800 509 991 CDS product 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704876.1 protein_id gnl|my_center|LOCUS_02800 1057 1395 gene locus_tag LOCUS_02810 1057 1395 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226526.1 protein_id gnl|my_center|LOCUS_02810 1426 2379 gene locus_tag LOCUS_02820 1426 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 3381 2491 gene locus_tag LOCUS_02830 3381 2491 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206875.1 protein_id gnl|my_center|LOCUS_02830 3664 5835 gene locus_tag LOCUS_02840 3664 5835 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140331.1 protein_id gnl|my_center|LOCUS_02840 5914 7512 gene locus_tag LOCUS_02850 5914 7512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 7569 8255 gene locus_tag LOCUS_02860 7569 8255 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265528.1 protein_id gnl|my_center|LOCUS_02860 9900 8269 gene locus_tag LOCUS_02870 9900 8269 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366380.1 protein_id gnl|my_center|LOCUS_02870 11147 9897 gene locus_tag LOCUS_02880 11147 9897 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918225.1 protein_id gnl|my_center|LOCUS_02880 11193 11384 gene locus_tag LOCUS_02890 11193 11384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 13278 11563 gene locus_tag LOCUS_02900 13278 11563 CDS product tetratricopeptide repeat-containing glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388308.1 protein_id gnl|my_center|LOCUS_02900 13894 13424 gene locus_tag LOCUS_02910 13894 13424 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965898.1 protein_id gnl|my_center|LOCUS_02910 13968 14723 gene locus_tag LOCUS_02920 13968 14723 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085391.1 protein_id gnl|my_center|LOCUS_02920 14720 15346 gene locus_tag LOCUS_02930 14720 15346 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174966.1 protein_id gnl|my_center|LOCUS_02930 16206 15463 gene locus_tag LOCUS_02940 16206 15463 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_02940 <16834 16209 gene locus_tag LOCUS_02950 <16834 16209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338795.1:D-amino acid aminotransferase >Feature sequence017 <1 1017 gene locus_tag LOCUS_02960 <1 1017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921162.1:protein adenylyltransferase SelO family protein 1720 1052 gene locus_tag LOCUS_02970 1720 1052 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532164.1 protein_id gnl|my_center|LOCUS_02970 1824 2219 gene locus_tag LOCUS_02980 1824 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 2203 2679 gene locus_tag LOCUS_02990 2203 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 3821 2826 gene locus_tag LOCUS_03000 3821 2826 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921037.1 protein_id gnl|my_center|LOCUS_03000 4573 4013 gene locus_tag LOCUS_03010 4573 4013 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920061.1 protein_id gnl|my_center|LOCUS_03010 5143 5817 gene locus_tag LOCUS_03020 5143 5817 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265774.1 protein_id gnl|my_center|LOCUS_03020 5814 6683 gene locus_tag LOCUS_03030 gene gluQRS 5814 6683 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640436.1 protein_id gnl|my_center|LOCUS_03030 6824 7306 gene locus_tag LOCUS_03040 6824 7306 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061809.1 protein_id gnl|my_center|LOCUS_03040 7303 7653 gene locus_tag LOCUS_03050 gene arsC 7303 7653 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919377.1 protein_id gnl|my_center|LOCUS_03050 8236 7661 gene locus_tag LOCUS_03060 8236 7661 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920071.1 protein_id gnl|my_center|LOCUS_03060 8337 9665 gene locus_tag LOCUS_03070 gene argH 8337 9665 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640438.1 protein_id gnl|my_center|LOCUS_03070 9662 10030 gene locus_tag LOCUS_03080 9662 10030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 10027 11316 gene locus_tag LOCUS_03090 gene lysA 10027 11316 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920074.1 protein_id gnl|my_center|LOCUS_03090 11876 11346 gene locus_tag LOCUS_03100 11876 11346 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640439.1 protein_id gnl|my_center|LOCUS_03100 12444 11869 gene locus_tag LOCUS_03110 12444 11869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 12564 13211 gene locus_tag LOCUS_03120 gene ftsE 12564 13211 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265777.1 protein_id gnl|my_center|LOCUS_03120 13268 14086 gene locus_tag LOCUS_03130 13268 14086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 14316 14092 gene locus_tag LOCUS_03140 14316 14092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 14203 14706 gene locus_tag LOCUS_03150 14203 14706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 14703 15410 gene locus_tag LOCUS_03160 14703 15410 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920080.1 protein_id gnl|my_center|LOCUS_03160 16074 15475 gene locus_tag LOCUS_03170 16074 15475 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640440.1 protein_id gnl|my_center|LOCUS_03170 >Feature sequence018 879 2228 gene locus_tag LOCUS_03180 879 2228 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918178.1 protein_id gnl|my_center|LOCUS_03180 2260 3540 gene locus_tag LOCUS_03190 gene purD 2260 3540 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918186.1 protein_id gnl|my_center|LOCUS_03190 3582 4658 gene locus_tag LOCUS_03200 3582 4658 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918188.1 protein_id gnl|my_center|LOCUS_03200 4866 4714 gene locus_tag LOCUS_03210 4866 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 5774 5052 gene locus_tag LOCUS_03220 5774 5052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 6247 5780 gene locus_tag LOCUS_03230 6247 5780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 8150 6240 gene locus_tag LOCUS_03240 gene cckA 8150 6240 CDS product cell cycle histidine kinase CckA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918962.1 protein_id gnl|my_center|LOCUS_03240 10095 8170 gene locus_tag LOCUS_03250 gene dxs 10095 8170 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919929.1 protein_id gnl|my_center|LOCUS_03250 11077 10178 gene locus_tag LOCUS_03260 11077 10178 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919930.1 protein_id gnl|my_center|LOCUS_03260 11331 11074 gene locus_tag LOCUS_03270 11331 11074 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919931.1 protein_id gnl|my_center|LOCUS_03270 12111 11449 gene locus_tag LOCUS_03280 12111 11449 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919932.1 protein_id gnl|my_center|LOCUS_03280 13024 12104 gene locus_tag LOCUS_03290 13024 12104 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640401.1 protein_id gnl|my_center|LOCUS_03290 13117 13644 gene locus_tag LOCUS_03300 13117 13644 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919934.1 protein_id gnl|my_center|LOCUS_03300 13746 14933 gene locus_tag LOCUS_03310 13746 14933 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919935.1 protein_id gnl|my_center|LOCUS_03310 15078 15770 gene locus_tag LOCUS_03320 15078 15770 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919941.1 protein_id gnl|my_center|LOCUS_03320 >Feature sequence019 638 1540 gene locus_tag LOCUS_03330 638 1540 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921173.1 protein_id gnl|my_center|LOCUS_03330 1477 2583 gene locus_tag LOCUS_03340 1477 2583 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921174.1 protein_id gnl|my_center|LOCUS_03340 3551 2613 gene locus_tag LOCUS_03350 3551 2613 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639972.1 protein_id gnl|my_center|LOCUS_03350 3731 3564 gene locus_tag LOCUS_03360 3731 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 4211 4086 gene locus_tag LOCUS_03370 gene ykgO 4211 4086 CDS product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004616427.1 protein_id gnl|my_center|LOCUS_03370 4483 6663 gene locus_tag LOCUS_03380 gene katG 4483 6663 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119918646.1 protein_id gnl|my_center|LOCUS_03380 7755 6736 gene locus_tag LOCUS_03390 7755 6736 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813493.1 protein_id gnl|my_center|LOCUS_03390 9510 7780 gene locus_tag LOCUS_03400 9510 7780 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_03400 10228 10815 gene locus_tag LOCUS_03410 10228 10815 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530142.1 protein_id gnl|my_center|LOCUS_03410 12536 10833 gene locus_tag LOCUS_03420 12536 10833 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917973.1 protein_id gnl|my_center|LOCUS_03420 12709 14562 gene locus_tag LOCUS_03430 12709 14562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 >Feature sequence020 848 2722 gene locus_tag LOCUS_03440 848 2722 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918141.1 protein_id gnl|my_center|LOCUS_03440 2809 3867 gene locus_tag LOCUS_03450 gene hemE 2809 3867 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391363.1 protein_id gnl|my_center|LOCUS_03450 4342 3881 gene locus_tag LOCUS_03460 4342 3881 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919737.1 protein_id gnl|my_center|LOCUS_03460 5622 4339 gene locus_tag LOCUS_03470 gene tyrS 5622 4339 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265745.1 protein_id gnl|my_center|LOCUS_03470 5784 6944 gene locus_tag LOCUS_03480 5784 6944 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164513078.1 protein_id gnl|my_center|LOCUS_03480 8171 6951 gene locus_tag LOCUS_03490 gene glcF 8171 6951 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114370.1 protein_id gnl|my_center|LOCUS_03490 9200 8172 gene locus_tag LOCUS_03500 gene glcE 9200 8172 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194396.1 protein_id gnl|my_center|LOCUS_03500 10785 9235 gene locus_tag LOCUS_03510 gene glcD 10785 9235 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765139.1 protein_id gnl|my_center|LOCUS_03510 10863 12290 gene locus_tag LOCUS_03520 10863 12290 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528760.1 protein_id gnl|my_center|LOCUS_03520 13439 12297 gene locus_tag LOCUS_03530 13439 12297 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085742.1 protein_id gnl|my_center|LOCUS_03530 13844 13443 gene locus_tag LOCUS_03540 13844 13443 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965765.1 protein_id gnl|my_center|LOCUS_03540 14068 15663 gene locus_tag LOCUS_03550 14068 15663 CDS product alpha glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640457.1 protein_id gnl|my_center|LOCUS_03550 >Feature sequence021 567 400 gene locus_tag LOCUS_03560 567 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 566 2065 gene locus_tag LOCUS_03570 566 2065 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920125.1 protein_id gnl|my_center|LOCUS_03570 2776 2102 gene locus_tag LOCUS_03580 2776 2102 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966804.1 protein_id gnl|my_center|LOCUS_03580 3096 3350 gene locus_tag LOCUS_03590 3096 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265875.1 protein_id gnl|my_center|LOCUS_03590 3414 4268 gene locus_tag LOCUS_03600 3414 4268 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265874.1 protein_id gnl|my_center|LOCUS_03600 4265 5041 gene locus_tag LOCUS_03610 4265 5041 CDS product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920743.1 protein_id gnl|my_center|LOCUS_03610 6520 5165 gene locus_tag LOCUS_03620 gene glmM 6520 5165 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918006.1 protein_id gnl|my_center|LOCUS_03620 6915 6637 gene locus_tag LOCUS_03630 6915 6637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 6802 8523 gene locus_tag LOCUS_03640 gene glmS 6802 8523 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918007.1 protein_id gnl|my_center|LOCUS_03640 8556 9440 gene locus_tag LOCUS_03650 8556 9440 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923328.1 protein_id gnl|my_center|LOCUS_03650 9444 10670 gene locus_tag LOCUS_03660 9444 10670 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640128.1 protein_id gnl|my_center|LOCUS_03660 10667 11635 gene locus_tag LOCUS_03670 10667 11635 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918935.1 protein_id gnl|my_center|LOCUS_03670 11682 12266 gene locus_tag LOCUS_03680 gene infC 11682 12266 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918933.1 protein_id gnl|my_center|LOCUS_03680 12353 13558 gene locus_tag LOCUS_03690 12353 13558 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918931.1 protein_id gnl|my_center|LOCUS_03690 >Feature sequence022 883 1497 gene locus_tag LOCUS_03700 gene ccmA 883 1497 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921495.1 protein_id gnl|my_center|LOCUS_03700 1494 2159 gene locus_tag LOCUS_03710 gene ccmB 1494 2159 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921496.1 protein_id gnl|my_center|LOCUS_03710 2338 3033 gene locus_tag LOCUS_03720 2338 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 3147 3731 gene locus_tag LOCUS_03730 3147 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 3803 4525 gene locus_tag LOCUS_03740 3803 4525 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921499.1 protein_id gnl|my_center|LOCUS_03740 4522 4707 gene locus_tag LOCUS_03750 4522 4707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 5669 4698 gene locus_tag LOCUS_03760 5669 4698 CDS product WD40 repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639937.1 protein_id gnl|my_center|LOCUS_03760 5808 6263 gene locus_tag LOCUS_03770 5808 6263 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918211.1 protein_id gnl|my_center|LOCUS_03770 7500 6403 gene locus_tag LOCUS_03780 7500 6403 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918210.1 protein_id gnl|my_center|LOCUS_03780 8917 7490 gene locus_tag LOCUS_03790 8917 7490 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388455.1 protein_id gnl|my_center|LOCUS_03790 8968 9132 gene locus_tag LOCUS_03800 8968 9132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 9260 10300 gene locus_tag LOCUS_03810 9260 10300 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_03810 11899 10325 gene locus_tag LOCUS_03820 11899 10325 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809544.1 protein_id gnl|my_center|LOCUS_03820 12678 11899 gene locus_tag LOCUS_03830 12678 11899 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522439.1 protein_id gnl|my_center|LOCUS_03830 13296 12703 gene locus_tag LOCUS_03840 13296 12703 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228210.1 protein_id gnl|my_center|LOCUS_03840 14090 13464 gene locus_tag LOCUS_03850 14090 13464 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940085.1 protein_id gnl|my_center|LOCUS_03850 >Feature sequence023 619 1578 gene locus_tag LOCUS_03860 619 1578 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141423.1 protein_id gnl|my_center|LOCUS_03860 2190 1711 gene locus_tag LOCUS_03870 2190 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 2531 2241 gene locus_tag LOCUS_03880 2531 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 2412 2651 gene locus_tag LOCUS_03890 2412 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 3303 2839 gene locus_tag LOCUS_03900 3303 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 4656 3331 gene locus_tag LOCUS_03910 4656 3331 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921283.1 protein_id gnl|my_center|LOCUS_03910 5086 4697 gene locus_tag LOCUS_03920 5086 4697 CDS product DUF6285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085729.1 protein_id gnl|my_center|LOCUS_03920 6105 5089 gene locus_tag LOCUS_03930 6105 5089 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085728.1 protein_id gnl|my_center|LOCUS_03930 6878 6225 gene locus_tag LOCUS_03940 6878 6225 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920739.1 protein_id gnl|my_center|LOCUS_03940 8062 6875 gene locus_tag LOCUS_03950 8062 6875 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391635.1 protein_id gnl|my_center|LOCUS_03950 9262 8084 gene locus_tag LOCUS_03960 9262 8084 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087741.1 protein_id gnl|my_center|LOCUS_03960 9586 9371 gene locus_tag LOCUS_03970 9586 9371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 9657 11453 gene locus_tag LOCUS_03980 gene mdoH 9657 11453 CDS product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038607.1 protein_id gnl|my_center|LOCUS_03980 13147 11624 gene locus_tag LOCUS_03990 13147 11624 CDS product glucan biosynthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440221.1 protein_id gnl|my_center|LOCUS_03990 >Feature sequence024 99 602 gene locus_tag LOCUS_04000 99 602 CDS product ClpXP protease specificity-enhancing factor SspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919963.1 protein_id gnl|my_center|LOCUS_04000 605 1066 gene locus_tag LOCUS_04010 605 1066 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919964.1 protein_id gnl|my_center|LOCUS_04010 1159 2553 gene locus_tag LOCUS_04020 gene fumC 1159 2553 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919970.1 protein_id gnl|my_center|LOCUS_04020 3019 2588 gene locus_tag LOCUS_04030 3019 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 3317 3108 gene locus_tag LOCUS_04040 3317 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 4072 3428 gene locus_tag LOCUS_04050 4072 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 4464 4745 gene locus_tag LOCUS_04060 4464 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 5837 4752 gene locus_tag LOCUS_04070 5837 4752 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265764.1 protein_id gnl|my_center|LOCUS_04070 5865 6596 gene locus_tag LOCUS_04080 5865 6596 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919975.1 protein_id gnl|my_center|LOCUS_04080 7122 6616 gene locus_tag LOCUS_04090 7122 6616 CDS product protein tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206995.1 protein_id gnl|my_center|LOCUS_04090 8149 7130 gene locus_tag LOCUS_04100 gene ilvC 8149 7130 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919981.1 protein_id gnl|my_center|LOCUS_04100 8995 8327 gene locus_tag LOCUS_04110 8995 8327 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943032.1 protein_id gnl|my_center|LOCUS_04110 9284 10099 gene locus_tag LOCUS_04120 9284 10099 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919985.1 protein_id gnl|my_center|LOCUS_04120 10125 10643 gene locus_tag LOCUS_04130 10125 10643 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919987.1 protein_id gnl|my_center|LOCUS_04130 10640 11455 gene locus_tag LOCUS_04140 10640 11455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 11547 12347 gene locus_tag LOCUS_04150 11547 12347 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570845.1 protein_id gnl|my_center|LOCUS_04150 12372 13088 gene locus_tag LOCUS_04160 12372 13088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 >Feature sequence025 328 696 gene locus_tag LOCUS_04170 328 696 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640095.1 protein_id gnl|my_center|LOCUS_04170 1295 840 gene locus_tag LOCUS_04180 gene rnhA 1295 840 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921194.1 protein_id gnl|my_center|LOCUS_04180 2296 1292 gene locus_tag LOCUS_04190 gene thrB 2296 1292 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921193.1 protein_id gnl|my_center|LOCUS_04190 2445 3116 gene locus_tag LOCUS_04200 2445 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265947.1 protein_id gnl|my_center|LOCUS_04200 3113 4909 gene locus_tag LOCUS_04210 gene argS 3113 4909 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921188.1 protein_id gnl|my_center|LOCUS_04210 5009 5224 gene locus_tag LOCUS_04220 5009 5224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 5752 6951 gene locus_tag LOCUS_04230 gene gcvT 5752 6951 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921184.1 protein_id gnl|my_center|LOCUS_04230 6955 7320 gene locus_tag LOCUS_04240 gene gcvH 6955 7320 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921183.1 protein_id gnl|my_center|LOCUS_04240 7326 8684 gene locus_tag LOCUS_04250 gene gcvPA 7326 8684 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921182.1 protein_id gnl|my_center|LOCUS_04250 8681 10231 gene locus_tag LOCUS_04260 gene gcvPB 8681 10231 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923258.1 protein_id gnl|my_center|LOCUS_04260 10266 11357 gene locus_tag LOCUS_04270 10266 11357 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966295.1 protein_id gnl|my_center|LOCUS_04270 12223 11363 gene locus_tag LOCUS_04280 12223 11363 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172619.1 protein_id gnl|my_center|LOCUS_04280 12646 12320 gene locus_tag LOCUS_04290 12646 12320 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639925.1 protein_id gnl|my_center|LOCUS_04290 <14187 12668 gene locus_tag LOCUS_04300 <14187 12668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918156.1:DNA polymerase III subunit gamma/tau >Feature sequence026 1004 2527 gene locus_tag LOCUS_04310 1004 2527 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265670.1 protein_id gnl|my_center|LOCUS_04310 4029 2854 gene locus_tag LOCUS_04320 gene gdhA 4029 2854 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_04320 4470 6116 gene locus_tag LOCUS_04330 4470 6116 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101357.1 protein_id gnl|my_center|LOCUS_04330 6140 7606 gene locus_tag LOCUS_04340 6140 7606 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525043.1 protein_id gnl|my_center|LOCUS_04340 7611 9959 gene locus_tag LOCUS_04350 7611 9959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 9956 11809 gene locus_tag LOCUS_04360 9956 11809 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640015.1 protein_id gnl|my_center|LOCUS_04360 >Feature sequence027 3614 1626 gene locus_tag LOCUS_04370 3614 1626 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640291.1 protein_id gnl|my_center|LOCUS_04370 5599 3665 gene locus_tag LOCUS_04380 5599 3665 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639885.1 protein_id gnl|my_center|LOCUS_04380 5940 7160 gene locus_tag LOCUS_04390 5940 7160 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224717.1 protein_id gnl|my_center|LOCUS_04390 7157 8176 gene locus_tag LOCUS_04400 7157 8176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 9671 8220 gene locus_tag LOCUS_04410 9671 8220 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931634.1 protein_id gnl|my_center|LOCUS_04410 <13208 9682 gene locus_tag LOCUS_04420 <13208 9682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970207.1:glutamate synthase large subunit >Feature sequence028 3815 2289 gene locus_tag LOCUS_04430 3815 2289 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919225.1 protein_id gnl|my_center|LOCUS_04430 6005 3966 gene locus_tag LOCUS_04440 gene parE 6005 3966 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919840.1 protein_id gnl|my_center|LOCUS_04440 7023 6070 gene locus_tag LOCUS_04450 7023 6070 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534169.1 protein_id gnl|my_center|LOCUS_04450 7942 7175 gene locus_tag LOCUS_04460 7942 7175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04460 8599 7964 gene locus_tag LOCUS_04470 8599 7964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04470 8963 8625 gene locus_tag LOCUS_04480 8963 8625 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919834.1 protein_id gnl|my_center|LOCUS_04480 9179 9757 gene locus_tag LOCUS_04490 9179 9757 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919832.1 protein_id gnl|my_center|LOCUS_04490 9803 11305 gene locus_tag LOCUS_04500 9803 11305 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919831.1 protein_id gnl|my_center|LOCUS_04500 11721 11374 gene locus_tag LOCUS_04510 11721 11374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 12712 11891 gene locus_tag LOCUS_04520 gene pyrF 12712 11891 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194144.1 protein_id gnl|my_center|LOCUS_04520 >Feature sequence029 316 954 gene locus_tag LOCUS_04530 316 954 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919214.1 protein_id gnl|my_center|LOCUS_04530 980 1429 gene locus_tag LOCUS_04540 gene mmcB 980 1429 CDS product DNA repair putative endonuclease MmcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921296.1 protein_id gnl|my_center|LOCUS_04540 1583 2140 gene locus_tag LOCUS_04550 1583 2140 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084586.1 protein_id gnl|my_center|LOCUS_04550 2215 2745 gene locus_tag LOCUS_04560 2215 2745 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921525.1 protein_id gnl|my_center|LOCUS_04560 4367 2856 gene locus_tag LOCUS_04570 4367 2856 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918804.1 protein_id gnl|my_center|LOCUS_04570 4359 5693 gene locus_tag LOCUS_04580 4359 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 6038 5730 gene locus_tag LOCUS_04590 6038 5730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 7821 6349 gene locus_tag LOCUS_04600 7821 6349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 9312 7897 gene locus_tag LOCUS_04610 gene dnaA 9312 7897 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917898.1 protein_id gnl|my_center|LOCUS_04610 10145 9876 gene locus_tag LOCUS_04620 gene rpsT 10145 9876 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004617408.1 protein_id gnl|my_center|LOCUS_04620 10586 10245 gene locus_tag LOCUS_04630 10586 10245 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919384.1 protein_id gnl|my_center|LOCUS_04630 11033 10590 gene locus_tag LOCUS_04640 11033 10590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 12080 11208 gene locus_tag LOCUS_04650 12080 11208 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087073.1 protein_id gnl|my_center|LOCUS_04650 >Feature sequence030 986 489 gene locus_tag LOCUS_04660 gene nuoI 986 489 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919808.1 protein_id gnl|my_center|LOCUS_04660 2066 990 gene locus_tag LOCUS_04670 gene nuoH 2066 990 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919811.1 protein_id gnl|my_center|LOCUS_04670 4144 2072 gene locus_tag LOCUS_04680 gene nuoG 4144 2072 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919812.1 protein_id gnl|my_center|LOCUS_04680 6030 4318 gene locus_tag LOCUS_04690 gene metG 6030 4318 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919354.1 protein_id gnl|my_center|LOCUS_04690 6326 6826 gene locus_tag LOCUS_04700 6326 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 7086 7160 gene locus_tag LOCUS_t00070 7086 7160 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7676 8884 gene locus_tag LOCUS_04710 7676 8884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 10059 8893 gene locus_tag LOCUS_04720 10059 8893 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640425.1 protein_id gnl|my_center|LOCUS_04720 10193 10109 gene locus_tag LOCUS_t00080 10193 10109 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10263 10985 gene locus_tag LOCUS_04730 gene lipB 10263 10985 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640426.1 protein_id gnl|my_center|LOCUS_04730 11074 12207 gene locus_tag LOCUS_04740 gene lptF 11074 12207 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919561.1 protein_id gnl|my_center|LOCUS_04740 >Feature sequence031 1189 875 gene locus_tag LOCUS_04750 1189 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 1297 2424 gene locus_tag LOCUS_04760 1297 2424 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530336.1 protein_id gnl|my_center|LOCUS_04760 2685 4004 gene locus_tag LOCUS_04770 2685 4004 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394859.1 protein_id gnl|my_center|LOCUS_04770 4038 4769 gene locus_tag LOCUS_04780 4038 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 4861 6324 gene locus_tag LOCUS_04790 4861 6324 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920866.1 protein_id gnl|my_center|LOCUS_04790 7197 6343 gene locus_tag LOCUS_04800 7197 6343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 8076 7231 gene locus_tag LOCUS_04810 8076 7231 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973992.1 protein_id gnl|my_center|LOCUS_04810 8810 8073 gene locus_tag LOCUS_04820 8810 8073 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338043.1 protein_id gnl|my_center|LOCUS_04820 9585 9007 gene locus_tag LOCUS_04830 9585 9007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 10694 9693 gene locus_tag LOCUS_04840 10694 9693 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728382.1 protein_id gnl|my_center|LOCUS_04840 10847 12085 gene locus_tag LOCUS_04850 10847 12085 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083717.1 protein_id gnl|my_center|LOCUS_04850 >Feature sequence032 <1 662 gene locus_tag LOCUS_04860 <1 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005770815.1:phosphate ABC transporter permease subunit PstC 665 1507 gene locus_tag LOCUS_04870 gene pstA 665 1507 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407464.1 protein_id gnl|my_center|LOCUS_04870 1504 2310 gene locus_tag LOCUS_04880 gene pstB 1504 2310 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553918.1 protein_id gnl|my_center|LOCUS_04880 2307 3161 gene locus_tag LOCUS_04890 gene pstB 2307 3161 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930167.1 protein_id gnl|my_center|LOCUS_04890 3249 3965 gene locus_tag LOCUS_04900 gene phoU 3249 3965 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918182.1 protein_id gnl|my_center|LOCUS_04900 3977 4684 gene locus_tag LOCUS_04910 gene phoB 3977 4684 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918183.1 protein_id gnl|my_center|LOCUS_04910 5054 4719 gene locus_tag LOCUS_04920 5054 4719 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919891.1 protein_id gnl|my_center|LOCUS_04920 5100 5723 gene locus_tag LOCUS_04930 5100 5723 CDS product DUF2239 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113820.1 protein_id gnl|my_center|LOCUS_04930 5797 7218 gene locus_tag LOCUS_04940 5797 7218 CDS product methylmalonyl-CoA mutase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920231.1 protein_id gnl|my_center|LOCUS_04940 7215 9374 gene locus_tag LOCUS_04950 gene scpA 7215 9374 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920232.1 protein_id gnl|my_center|LOCUS_04950 9917 9378 gene locus_tag LOCUS_04960 9917 9378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 10835 9996 gene locus_tag LOCUS_04970 gene rlmJ 10835 9996 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918980.1 protein_id gnl|my_center|LOCUS_04970 12783 10843 gene locus_tag LOCUS_04980 12783 10843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 >Feature sequence033 105 1271 gene locus_tag LOCUS_04990 105 1271 CDS product sarcosine oxidase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532907.1 protein_id gnl|my_center|LOCUS_04990 1273 2958 gene locus_tag LOCUS_05000 1273 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 3891 3004 gene locus_tag LOCUS_05010 gene hpnD 3891 3004 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085786.1 protein_id gnl|my_center|LOCUS_05010 4763 3900 gene locus_tag LOCUS_05020 gene hpnC 4763 3900 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965749.1 protein_id gnl|my_center|LOCUS_05020 5911 4760 gene locus_tag LOCUS_05030 5911 4760 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188250.1 protein_id gnl|my_center|LOCUS_05030 6929 5922 gene locus_tag LOCUS_05040 6929 5922 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198871.1 protein_id gnl|my_center|LOCUS_05040 7033 8163 gene locus_tag LOCUS_05050 7033 8163 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043078326.1 protein_id gnl|my_center|LOCUS_05050 8353 9279 gene locus_tag LOCUS_05060 gene ispH 8353 9279 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085791.1 protein_id gnl|my_center|LOCUS_05060 9324 10478 gene locus_tag LOCUS_05070 gene hpnH 9324 10478 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187762.1 protein_id gnl|my_center|LOCUS_05070 11175 10489 gene locus_tag LOCUS_05080 11175 10489 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545403.1 protein_id gnl|my_center|LOCUS_05080 <12741 11172 gene locus_tag LOCUS_05090 <12741 11172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004529547.1:squalene--hopene cyclase >Feature sequence034 54 1871 gene locus_tag LOCUS_05100 54 1871 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919399.1 protein_id gnl|my_center|LOCUS_05100 2816 1881 gene locus_tag LOCUS_05110 2816 1881 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538089.1 protein_id gnl|my_center|LOCUS_05110 2937 3632 gene locus_tag LOCUS_05120 2937 3632 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920406.1 protein_id gnl|my_center|LOCUS_05120 5749 3605 gene locus_tag LOCUS_05130 gene ligA 5749 3605 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966438.1 protein_id gnl|my_center|LOCUS_05130 7445 5742 gene locus_tag LOCUS_05140 gene recN 7445 5742 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919849.1 protein_id gnl|my_center|LOCUS_05140 8473 7475 gene locus_tag LOCUS_05150 8473 7475 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640381.1 protein_id gnl|my_center|LOCUS_05150 9483 8593 gene locus_tag LOCUS_05160 gene lpxC 9483 8593 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640382.1 protein_id gnl|my_center|LOCUS_05160 11115 9682 gene locus_tag LOCUS_05170 gene ftsZ 11115 9682 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920397.1 protein_id gnl|my_center|LOCUS_05170 <12409 11348 gene locus_tag LOCUS_05180 <12409 11348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640521.1:cell division protein FtsA >Feature sequence035 861 1187 gene locus_tag LOCUS_05190 861 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05190 1253 2446 gene locus_tag LOCUS_05200 1253 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 2449 3492 gene locus_tag LOCUS_05210 2449 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 3489 4964 gene locus_tag LOCUS_05220 3489 4964 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525350.1 protein_id gnl|my_center|LOCUS_05220 5296 5018 gene locus_tag LOCUS_05230 5296 5018 CDS product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525351.1 protein_id gnl|my_center|LOCUS_05230 5673 5293 gene locus_tag LOCUS_05240 5673 5293 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082826795.1 protein_id gnl|my_center|LOCUS_05240 5769 6989 gene locus_tag LOCUS_05250 5769 6989 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928864.1 protein_id gnl|my_center|LOCUS_05250 6993 7832 gene locus_tag LOCUS_05260 6993 7832 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918268.1 protein_id gnl|my_center|LOCUS_05260 8036 8368 gene locus_tag LOCUS_05270 8036 8368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 8585 9358 gene locus_tag LOCUS_05280 8585 9358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 11174 9372 gene locus_tag LOCUS_05290 11174 9372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 >Feature sequence036 831 466 gene locus_tag LOCUS_05300 831 466 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917946.1 protein_id gnl|my_center|LOCUS_05300 1893 937 gene locus_tag LOCUS_05310 1893 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 2642 2037 gene locus_tag LOCUS_05320 2642 2037 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917950.1 protein_id gnl|my_center|LOCUS_05320 3249 2674 gene locus_tag LOCUS_05330 3249 2674 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639868.1 protein_id gnl|my_center|LOCUS_05330 4529 3447 gene locus_tag LOCUS_05340 gene trpS 4529 3447 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917953.1 protein_id gnl|my_center|LOCUS_05340 7428 4609 gene locus_tag LOCUS_05350 7428 4609 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917903.1 protein_id gnl|my_center|LOCUS_05350 7551 8102 gene locus_tag LOCUS_05360 7551 8102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 8726 8145 gene locus_tag LOCUS_05370 8726 8145 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919780.1 protein_id gnl|my_center|LOCUS_05370 11663 8832 gene locus_tag LOCUS_05380 11663 8832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05380 11656 11865 gene locus_tag LOCUS_05390 11656 11865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 >Feature sequence037 477 614 gene locus_tag LOCUS_05400 477 614 CDS product entericidin A/B family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921302.1 protein_id gnl|my_center|LOCUS_05400 1158 604 gene locus_tag LOCUS_05410 1158 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 1350 2141 gene locus_tag LOCUS_05420 gene cysQ 1350 2141 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921298.1 protein_id gnl|my_center|LOCUS_05420 3375 2176 gene locus_tag LOCUS_05430 3375 2176 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728068.1 protein_id gnl|my_center|LOCUS_05430 3923 3402 gene locus_tag LOCUS_05440 gene ripB 3923 3402 CDS product (R)-specific enoyl-CoA hydratase RipB/Ich inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188105.1 protein_id gnl|my_center|LOCUS_05440 4070 5260 gene locus_tag LOCUS_05450 4070 5260 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389758.1 protein_id gnl|my_center|LOCUS_05450 5272 6951 gene locus_tag LOCUS_05460 5272 6951 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917915.1 protein_id gnl|my_center|LOCUS_05460 7848 6958 gene locus_tag LOCUS_05470 7848 6958 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073004.1 protein_id gnl|my_center|LOCUS_05470 8046 8927 gene locus_tag LOCUS_05480 8046 8927 CDS product bifunctional regulator KidO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923314.1 protein_id gnl|my_center|LOCUS_05480 10894 8948 gene locus_tag LOCUS_05490 10894 8948 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470598.1 protein_id gnl|my_center|LOCUS_05490 >Feature sequence038 443 1579 gene locus_tag LOCUS_05500 443 1579 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706477.1 protein_id gnl|my_center|LOCUS_05500 1576 2583 gene locus_tag LOCUS_05510 1576 2583 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920388.1 protein_id gnl|my_center|LOCUS_05510 3355 2690 gene locus_tag LOCUS_05520 3355 2690 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112933.1 protein_id gnl|my_center|LOCUS_05520 4862 3432 gene locus_tag LOCUS_05530 4862 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 4990 5076 gene locus_tag LOCUS_t00090 4990 5076 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6630 5083 gene locus_tag LOCUS_05540 6630 5083 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227051.1 protein_id gnl|my_center|LOCUS_05540 6805 9252 gene locus_tag LOCUS_05550 6805 9252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 10072 9275 gene locus_tag LOCUS_05560 10072 9275 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727098.1 protein_id gnl|my_center|LOCUS_05560 10306 10890 gene locus_tag LOCUS_05570 10306 10890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 >Feature sequence039 2183 312 gene locus_tag LOCUS_05580 2183 312 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921242.1 protein_id gnl|my_center|LOCUS_05580 3055 2234 gene locus_tag LOCUS_05590 3055 2234 CDS product CDP-diacylglycerol diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036871.1 protein_id gnl|my_center|LOCUS_05590 4425 3052 gene locus_tag LOCUS_05600 4425 3052 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921243.1 protein_id gnl|my_center|LOCUS_05600 5238 4498 gene locus_tag LOCUS_05610 5238 4498 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921244.1 protein_id gnl|my_center|LOCUS_05610 6662 5235 gene locus_tag LOCUS_05620 6662 5235 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920791.1 protein_id gnl|my_center|LOCUS_05620 7087 6677 gene locus_tag LOCUS_05630 7087 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 7343 7699 gene locus_tag LOCUS_05640 7343 7699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 8278 7715 gene locus_tag LOCUS_05650 8278 7715 CDS product DUF3035 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640037.1 protein_id gnl|my_center|LOCUS_05650 8855 8355 gene locus_tag LOCUS_05660 gene lspA 8855 8355 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918586.1 protein_id gnl|my_center|LOCUS_05660 <11429 8852 gene locus_tag LOCUS_05670 <11429 8852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918587.1:isoleucine--tRNA ligase >Feature sequence040 701 1075 gene locus_tag LOCUS_05680 701 1075 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172377.1 protein_id gnl|my_center|LOCUS_05680 4369 1151 gene locus_tag LOCUS_05690 4369 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_05690 5765 4500 gene locus_tag LOCUS_05700 5765 4500 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918225.1 protein_id gnl|my_center|LOCUS_05700 5910 7307 gene locus_tag LOCUS_05710 5910 7307 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528635.1 protein_id gnl|my_center|LOCUS_05710 7304 7702 gene locus_tag LOCUS_05720 7304 7702 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039401.1 protein_id gnl|my_center|LOCUS_05720 7699 9102 gene locus_tag LOCUS_05730 gene gabP 7699 9102 CDS product GABA permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360123.1 protein_id gnl|my_center|LOCUS_05730 9128 10012 gene locus_tag LOCUS_05740 9128 10012 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065174.1 protein_id gnl|my_center|LOCUS_05740 10041 10727 gene locus_tag LOCUS_05750 10041 10727 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391054.1 protein_id gnl|my_center|LOCUS_05750 11277 10738 gene locus_tag LOCUS_05760 11277 10738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 >Feature sequence041 486 2054 gene locus_tag LOCUS_05770 486 2054 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090039.1 protein_id gnl|my_center|LOCUS_05770 2239 2703 gene locus_tag LOCUS_05780 2239 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 3394 2744 gene locus_tag LOCUS_05790 3394 2744 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038852.1 protein_id gnl|my_center|LOCUS_05790 3561 3959 gene locus_tag LOCUS_05800 3561 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 3968 4561 gene locus_tag LOCUS_05810 3968 4561 CDS product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291519.1 protein_id gnl|my_center|LOCUS_05810 5077 4736 gene locus_tag LOCUS_05820 5077 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 5415 5083 gene locus_tag LOCUS_05830 5415 5083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 5384 5650 gene locus_tag LOCUS_05840 5384 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 5887 6240 gene locus_tag LOCUS_05850 5887 6240 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640254.1 protein_id gnl|my_center|LOCUS_05850 6250 6765 gene locus_tag LOCUS_05860 6250 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 6762 7823 gene locus_tag LOCUS_05870 gene arsB 6762 7823 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164747183.1 protein_id gnl|my_center|LOCUS_05870 7824 8987 gene locus_tag LOCUS_05880 7824 8987 CDS product gamma-butyrobetaine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531043.1 protein_id gnl|my_center|LOCUS_05880 8984 9532 gene locus_tag LOCUS_05890 8984 9532 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531044.1 protein_id gnl|my_center|LOCUS_05890 9562 10578 gene locus_tag LOCUS_05900 9562 10578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 10913 10587 gene locus_tag LOCUS_05910 10913 10587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 >Feature sequence042 1834 461 gene locus_tag LOCUS_05920 1834 461 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265823.1 protein_id gnl|my_center|LOCUS_05920 2205 1831 gene locus_tag LOCUS_05930 2205 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 2101 2673 gene locus_tag LOCUS_05940 2101 2673 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388480.1 protein_id gnl|my_center|LOCUS_05940 2670 3344 gene locus_tag LOCUS_05950 gene chrR 2670 3344 CDS product anti-sigma-E factor ChrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338712.1 protein_id gnl|my_center|LOCUS_05950 3483 4517 gene locus_tag LOCUS_05960 3483 4517 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920455.1 protein_id gnl|my_center|LOCUS_05960 4542 4961 gene locus_tag LOCUS_05970 4542 4961 CDS product DUF2177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640534.1 protein_id gnl|my_center|LOCUS_05970 5458 4952 gene locus_tag LOCUS_05980 5458 4952 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640456.1 protein_id gnl|my_center|LOCUS_05980 5631 5921 gene locus_tag LOCUS_05990 5631 5921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 5947 6264 gene locus_tag LOCUS_06000 5947 6264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 7150 6272 gene locus_tag LOCUS_06010 gene bla 7150 6272 CDS product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965202.1 protein_id gnl|my_center|LOCUS_06010 7827 7210 gene locus_tag LOCUS_06020 7827 7210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 8543 7824 gene locus_tag LOCUS_06030 8543 7824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 9061 8549 gene locus_tag LOCUS_06040 9061 8549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 9359 10363 gene locus_tag LOCUS_06050 9359 10363 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762776.1 protein_id gnl|my_center|LOCUS_06050 10846 10376 gene locus_tag LOCUS_06060 10846 10376 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919097.1 protein_id gnl|my_center|LOCUS_06060 10964 10890 gene locus_tag LOCUS_t00100 10964 10890 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence043 <1 893 gene locus_tag LOCUS_06070 <1 893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640392.1:ATP-dependent DNA helicase 1788 931 gene locus_tag LOCUS_06080 1788 931 CDS product TylF/MycF family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296730.1 protein_id gnl|my_center|LOCUS_06080 2090 2668 gene locus_tag LOCUS_06090 2090 2668 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919903.1 protein_id gnl|my_center|LOCUS_06090 3997 2798 gene locus_tag LOCUS_06100 gene rlmN 3997 2798 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918023.1 protein_id gnl|my_center|LOCUS_06100 4919 4050 gene locus_tag LOCUS_06110 gene fghA 4919 4050 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920372.1 protein_id gnl|my_center|LOCUS_06110 5011 6732 gene locus_tag LOCUS_06120 gene ggt 5011 6732 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965496.1 protein_id gnl|my_center|LOCUS_06120 7390 6770 gene locus_tag LOCUS_06130 7390 6770 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257775.1 protein_id gnl|my_center|LOCUS_06130 7568 8662 gene locus_tag LOCUS_06140 7568 8662 CDS product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398691.1 protein_id gnl|my_center|LOCUS_06140 10031 8685 gene locus_tag LOCUS_06150 10031 8685 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980514.1 protein_id gnl|my_center|LOCUS_06150 10825 10175 gene locus_tag LOCUS_06160 10825 10175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 >Feature sequence044 257 138 gene locus_tag LOCUS_06170 gene cydX 257 138 CDS product cytochrome bd-I oxidase subunit CydX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640056.1 protein_id gnl|my_center|LOCUS_06170 1429 281 gene locus_tag LOCUS_06180 gene cydB 1429 281 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918649.1 protein_id gnl|my_center|LOCUS_06180 3011 1443 gene locus_tag LOCUS_06190 3011 1443 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918648.1 protein_id gnl|my_center|LOCUS_06190 3140 4807 gene locus_tag LOCUS_06200 gene cydD 3140 4807 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918647.1 protein_id gnl|my_center|LOCUS_06200 4804 6423 gene locus_tag LOCUS_06210 4804 6423 CDS product amino acid ABC transporter ATP-binding/permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918646.1 protein_id gnl|my_center|LOCUS_06210 6429 7211 gene locus_tag LOCUS_06220 6429 7211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 7219 7947 gene locus_tag LOCUS_06230 7219 7947 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172351.1 protein_id gnl|my_center|LOCUS_06230 9109 7919 gene locus_tag LOCUS_06240 9109 7919 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707887.1 protein_id gnl|my_center|LOCUS_06240 10141 9113 gene locus_tag LOCUS_06250 gene tdh 10141 9113 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074264.1 protein_id gnl|my_center|LOCUS_06250 10216 10779 gene locus_tag LOCUS_06260 10216 10779 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194572.1 protein_id gnl|my_center|LOCUS_06260 >Feature sequence045 186 395 gene locus_tag LOCUS_06270 186 395 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173969.1 protein_id gnl|my_center|LOCUS_06270 734 1843 gene locus_tag LOCUS_06280 734 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 3916 1961 gene locus_tag LOCUS_06290 3916 1961 CDS product M61 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640643.1 protein_id gnl|my_center|LOCUS_06290 4630 3974 gene locus_tag LOCUS_06300 gene pgsA 4630 3974 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920746.1 protein_id gnl|my_center|LOCUS_06300 4816 4892 gene locus_tag LOCUS_t00110 4816 4892 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 6240 5011 gene locus_tag LOCUS_06310 6240 5011 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920336.1 protein_id gnl|my_center|LOCUS_06310 7459 6344 gene locus_tag LOCUS_06320 7459 6344 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640506.1 protein_id gnl|my_center|LOCUS_06320 7883 8584 gene locus_tag LOCUS_06330 7883 8584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 9537 8647 gene locus_tag LOCUS_06340 9537 8647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 10020 10175 gene locus_tag LOCUS_06350 10020 10175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 10487 10209 gene locus_tag LOCUS_06360 10487 10209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 >Feature sequence046 479 2032 gene locus_tag LOCUS_06370 479 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 3326 2001 gene locus_tag LOCUS_06380 3326 2001 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163308.1 protein_id gnl|my_center|LOCUS_06380 3879 3427 gene locus_tag LOCUS_06390 3879 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 4190 4846 gene locus_tag LOCUS_06400 4190 4846 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404247.1 protein_id gnl|my_center|LOCUS_06400 5316 4843 gene locus_tag LOCUS_06410 5316 4843 CDS product DUF2141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265794.1 protein_id gnl|my_center|LOCUS_06410 5495 7330 gene locus_tag LOCUS_06420 gene mutL 5495 7330 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918581.1 protein_id gnl|my_center|LOCUS_06420 7894 7337 gene locus_tag LOCUS_06430 gene rsmD 7894 7337 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918116.1 protein_id gnl|my_center|LOCUS_06430 7979 8971 gene locus_tag LOCUS_06440 7979 8971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 9908 8979 gene locus_tag LOCUS_06450 9908 8979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 10014 10472 gene locus_tag LOCUS_06460 gene tadA 10014 10472 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918120.1 protein_id gnl|my_center|LOCUS_06460 >Feature sequence047 974 1396 gene locus_tag LOCUS_06470 974 1396 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528562.1 protein_id gnl|my_center|LOCUS_06470 2121 1393 gene locus_tag LOCUS_06480 2121 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 2286 3698 gene locus_tag LOCUS_06490 gene leuC 2286 3698 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918085.1 protein_id gnl|my_center|LOCUS_06490 3695 4468 gene locus_tag LOCUS_06500 3695 4468 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174812.1 protein_id gnl|my_center|LOCUS_06500 4465 5076 gene locus_tag LOCUS_06510 gene leuD 4465 5076 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918084.1 protein_id gnl|my_center|LOCUS_06510 5073 6122 gene locus_tag LOCUS_06520 gene leuB 5073 6122 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918082.1 protein_id gnl|my_center|LOCUS_06520 6208 7122 gene locus_tag LOCUS_06530 6208 7122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 7119 8417 gene locus_tag LOCUS_06540 7119 8417 CDS product citrate-proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170457.1 protein_id gnl|my_center|LOCUS_06540 9636 8401 gene locus_tag LOCUS_06550 gene hsnB 9636 8401 CDS product host-specificity nodulation protein HsnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967448.1 protein_id gnl|my_center|LOCUS_06550 9889 9641 gene locus_tag LOCUS_06560 9889 9641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 <10690 9976 gene locus_tag LOCUS_06570 <10690 9976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088880.1:VWA domain-containing protein >Feature sequence048 746 1309 gene locus_tag LOCUS_06580 746 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 1845 1288 gene locus_tag LOCUS_06590 1845 1288 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640141.1 protein_id gnl|my_center|LOCUS_06590 3821 1842 gene locus_tag LOCUS_06600 3821 1842 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920964.1 protein_id gnl|my_center|LOCUS_06600 4994 4014 gene locus_tag LOCUS_06610 gene pufM 4994 4014 CDS product photosynthetic reaction center subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390722.1 protein_id gnl|my_center|LOCUS_06610 5779 4955 gene locus_tag LOCUS_06620 gene pufL 5779 4955 CDS product photosynthetic reaction center subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390723.1 protein_id gnl|my_center|LOCUS_06620 6145 5936 gene locus_tag LOCUS_06630 6145 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 6380 6162 gene locus_tag LOCUS_06640 gene pufB 6380 6162 CDS product light-harvesting antenna LH1, beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126701591.1 protein_id gnl|my_center|LOCUS_06640 7976 6522 gene locus_tag LOCUS_06650 gene bchZ 7976 6522 CDS product chlorophyllide a reductase subunit Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390726.1 protein_id gnl|my_center|LOCUS_06650 9502 7973 gene locus_tag LOCUS_06660 gene bchY 9502 7973 CDS product chlorophyllide a reductase subunit Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390727.1 protein_id gnl|my_center|LOCUS_06660 10495 9506 gene locus_tag LOCUS_06670 10495 9506 CDS product chlorophyllide a reductase iron protein subunit X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390728.1 protein_id gnl|my_center|LOCUS_06670 >Feature sequence049 433 2577 gene locus_tag LOCUS_06680 433 2577 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919427.1 protein_id gnl|my_center|LOCUS_06680 2712 3206 gene locus_tag LOCUS_06690 gene pyrE 2712 3206 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919429.1 protein_id gnl|my_center|LOCUS_06690 3203 3976 gene locus_tag LOCUS_06700 3203 3976 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919431.1 protein_id gnl|my_center|LOCUS_06700 3973 4410 gene locus_tag LOCUS_06710 gene acpS 3973 4410 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919432.1 protein_id gnl|my_center|LOCUS_06710 4440 5285 gene locus_tag LOCUS_06720 gene lepB 4440 5285 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919433.1 protein_id gnl|my_center|LOCUS_06720 5299 5997 gene locus_tag LOCUS_06730 gene rnc 5299 5997 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383415.1 protein_id gnl|my_center|LOCUS_06730 5994 6920 gene locus_tag LOCUS_06740 gene era 5994 6920 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640271.1 protein_id gnl|my_center|LOCUS_06740 6922 7653 gene locus_tag LOCUS_06750 gene recO 6922 7653 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640273.1 protein_id gnl|my_center|LOCUS_06750 8589 7663 gene locus_tag LOCUS_06760 8589 7663 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919953.1 protein_id gnl|my_center|LOCUS_06760 9289 8594 gene locus_tag LOCUS_06770 9289 8594 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919952.1 protein_id gnl|my_center|LOCUS_06770 10440 9304 gene locus_tag LOCUS_06780 10440 9304 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265760.1 protein_id gnl|my_center|LOCUS_06780 >Feature sequence050 <1 2116 gene locus_tag LOCUS_06790 <1 2116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640689.1:indolepyruvate ferredoxin oxidoreductase family protein 2167 3291 gene locus_tag LOCUS_06800 2167 3291 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921010.1 protein_id gnl|my_center|LOCUS_06800 5203 3341 gene locus_tag LOCUS_06810 gene uvrC 5203 3341 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920721.1 protein_id gnl|my_center|LOCUS_06810 5355 6803 gene locus_tag LOCUS_06820 5355 6803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265539.1 protein_id gnl|my_center|LOCUS_06820 7838 6822 gene locus_tag LOCUS_06830 7838 6822 CDS product retropepsin-like aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919590.1 protein_id gnl|my_center|LOCUS_06830 7964 8587 gene locus_tag LOCUS_06840 7964 8587 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921310.1 protein_id gnl|my_center|LOCUS_06840 8580 9257 gene locus_tag LOCUS_06850 8580 9257 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401129.1 protein_id gnl|my_center|LOCUS_06850 9801 9274 gene locus_tag LOCUS_06860 9801 9274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 <10462 9861 gene locus_tag LOCUS_06870 <10462 9861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919895.1:phosphomethylpyrimidine synthase ThiC >Feature sequence051 <1 884 gene locus_tag LOCUS_06880 <1 884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921088.1:DUF692 domain-containing protein 877 1659 gene locus_tag LOCUS_06890 877 1659 CDS product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921089.1 protein_id gnl|my_center|LOCUS_06890 1656 2111 gene locus_tag LOCUS_06900 1656 2111 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921090.1 protein_id gnl|my_center|LOCUS_06900 2261 3283 gene locus_tag LOCUS_06910 2261 3283 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087744.1 protein_id gnl|my_center|LOCUS_06910 3300 4220 gene locus_tag LOCUS_06920 3300 4220 CDS product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532571.1 protein_id gnl|my_center|LOCUS_06920 4243 5460 gene locus_tag LOCUS_06930 4243 5460 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970959.1 protein_id gnl|my_center|LOCUS_06930 5539 6006 gene locus_tag LOCUS_06940 5539 6006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 6014 6694 gene locus_tag LOCUS_06950 6014 6694 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920607.1 protein_id gnl|my_center|LOCUS_06950 6763 8100 gene locus_tag LOCUS_06960 6763 8100 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920606.1 protein_id gnl|my_center|LOCUS_06960 8148 8660 gene locus_tag LOCUS_06970 gene ccmE 8148 8660 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920602.1 protein_id gnl|my_center|LOCUS_06970 8849 10420 gene locus_tag LOCUS_06980 8849 10420 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920599.1 protein_id gnl|my_center|LOCUS_06980 >Feature sequence052 431 1717 gene locus_tag LOCUS_06990 431 1717 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919845.1 protein_id gnl|my_center|LOCUS_06990 2514 1744 gene locus_tag LOCUS_07000 2514 1744 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965747.1 protein_id gnl|my_center|LOCUS_07000 3727 2600 gene locus_tag LOCUS_07010 3727 2600 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697701.1 protein_id gnl|my_center|LOCUS_07010 3841 5556 gene locus_tag LOCUS_07020 3841 5556 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015051728.1 protein_id gnl|my_center|LOCUS_07020 6548 5589 gene locus_tag LOCUS_07030 6548 5589 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919846.1 protein_id gnl|my_center|LOCUS_07030 7288 6548 gene locus_tag LOCUS_07040 7288 6548 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919163.1 protein_id gnl|my_center|LOCUS_07040 8619 7288 gene locus_tag LOCUS_07050 8619 7288 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919162.1 protein_id gnl|my_center|LOCUS_07050 8756 9577 gene locus_tag LOCUS_07060 8756 9577 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143646.1 protein_id gnl|my_center|LOCUS_07060 >Feature sequence053 <1 918 gene locus_tag LOCUS_07070 <1 918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265753.1:amidohydrolase 918 2219 gene locus_tag LOCUS_07080 918 2219 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919839.1 protein_id gnl|my_center|LOCUS_07080 2330 4132 gene locus_tag LOCUS_07090 2330 4132 CDS product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920889.1 protein_id gnl|my_center|LOCUS_07090 4171 5001 gene locus_tag LOCUS_07100 4171 5001 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064413.1 protein_id gnl|my_center|LOCUS_07100 5091 5420 gene locus_tag LOCUS_07110 gene hspQ 5091 5420 CDS product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919487.1 protein_id gnl|my_center|LOCUS_07110 5441 6355 gene locus_tag LOCUS_07120 gene phhA 5441 6355 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919486.1 protein_id gnl|my_center|LOCUS_07120 6564 7973 gene locus_tag LOCUS_07130 6564 7973 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265725.1 protein_id gnl|my_center|LOCUS_07130 7970 8908 gene locus_tag LOCUS_07140 7970 8908 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919475.1 protein_id gnl|my_center|LOCUS_07140 8905 9888 gene locus_tag LOCUS_07150 8905 9888 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919474.1 protein_id gnl|my_center|LOCUS_07150 >Feature sequence054 215 865 gene locus_tag LOCUS_07160 215 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919463.1 protein_id gnl|my_center|LOCUS_07160 1986 862 gene locus_tag LOCUS_07170 gene tgt 1986 862 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919462.1 protein_id gnl|my_center|LOCUS_07170 3044 1983 gene locus_tag LOCUS_07180 gene queA 3044 1983 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919461.1 protein_id gnl|my_center|LOCUS_07180 3585 3112 gene locus_tag LOCUS_07190 3585 3112 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921571.1 protein_id gnl|my_center|LOCUS_07190 4322 3642 gene locus_tag LOCUS_07200 4322 3642 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167574.1 protein_id gnl|my_center|LOCUS_07200 4814 4386 gene locus_tag LOCUS_07210 4814 4386 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920633.1 protein_id gnl|my_center|LOCUS_07210 6427 4820 gene locus_tag LOCUS_07220 6427 4820 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275275.1 protein_id gnl|my_center|LOCUS_07220 7051 6596 gene locus_tag LOCUS_07230 7051 6596 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919458.1 protein_id gnl|my_center|LOCUS_07230 7971 7060 gene locus_tag LOCUS_07240 7971 7060 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640279.1 protein_id gnl|my_center|LOCUS_07240 8624 8127 gene locus_tag LOCUS_07250 gene coaD 8624 8127 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919455.1 protein_id gnl|my_center|LOCUS_07250 <9867 8621 gene locus_tag LOCUS_07260 <9867 8621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919454.1:DNA gyrase subunit A >Feature sequence055 <1 777 gene locus_tag LOCUS_07270 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919912.1:acyl-CoA dehydrogenase family protein 1325 795 gene locus_tag LOCUS_07280 1325 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 1610 1960 gene locus_tag LOCUS_07290 1610 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 2088 3533 gene locus_tag LOCUS_07300 2088 3533 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920595.1 protein_id gnl|my_center|LOCUS_07300 4608 3715 gene locus_tag LOCUS_07310 4608 3715 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530541.1 protein_id gnl|my_center|LOCUS_07310 4717 5733 gene locus_tag LOCUS_07320 4717 5733 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967414.1 protein_id gnl|my_center|LOCUS_07320 6967 5747 gene locus_tag LOCUS_07330 6967 5747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 7177 8577 gene locus_tag LOCUS_07340 7177 8577 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226082.1 protein_id gnl|my_center|LOCUS_07340 >Feature sequence056 1351 101 gene locus_tag LOCUS_07350 1351 101 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857525.1 protein_id gnl|my_center|LOCUS_07350 1402 1791 gene locus_tag LOCUS_07360 1402 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 2235 3632 gene locus_tag LOCUS_07370 2235 3632 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142346.1 protein_id gnl|my_center|LOCUS_07370 3800 4687 gene locus_tag LOCUS_07380 3800 4687 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_07380 4916 4701 gene locus_tag LOCUS_07390 4916 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 5077 6084 gene locus_tag LOCUS_07400 5077 6084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 6096 6293 gene locus_tag LOCUS_07410 6096 6293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 6290 6475 gene locus_tag LOCUS_07420 6290 6475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 6472 7458 gene locus_tag LOCUS_07430 6472 7458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07430 7410 8525 gene locus_tag LOCUS_07440 7410 8525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07440 >Feature sequence057 1 378 gene locus_tag LOCUS_07450 1 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 495 1022 gene locus_tag LOCUS_07460 495 1022 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921374.1 protein_id gnl|my_center|LOCUS_07460 1074 2315 gene locus_tag LOCUS_07470 gene trpB 1074 2315 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265976.1 protein_id gnl|my_center|LOCUS_07470 2312 3145 gene locus_tag LOCUS_07480 gene trpA 2312 3145 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921372.1 protein_id gnl|my_center|LOCUS_07480 3138 4034 gene locus_tag LOCUS_07490 3138 4034 CDS product acetyl-CoA carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921371.1 protein_id gnl|my_center|LOCUS_07490 4042 5382 gene locus_tag LOCUS_07500 4042 5382 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921370.1 protein_id gnl|my_center|LOCUS_07500 5798 5457 gene locus_tag LOCUS_07510 gene trxA 5798 5457 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921368.1 protein_id gnl|my_center|LOCUS_07510 9563 6075 gene locus_tag LOCUS_07520 gene addA 9563 6075 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923305.1 protein_id gnl|my_center|LOCUS_07520 >Feature sequence058 4341 2362 gene locus_tag LOCUS_07530 4341 2362 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626303.1 protein_id gnl|my_center|LOCUS_07530 5156 4347 gene locus_tag LOCUS_07540 5156 4347 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921476.1 protein_id gnl|my_center|LOCUS_07540 5394 6275 gene locus_tag LOCUS_07550 5394 6275 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920090.1 protein_id gnl|my_center|LOCUS_07550 7777 6296 gene locus_tag LOCUS_07560 gene glpK 7777 6296 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259133.1 protein_id gnl|my_center|LOCUS_07560 8433 7855 gene locus_tag LOCUS_07570 8433 7855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 <9672 8430 gene locus_tag LOCUS_07580 <9672 8430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005766330.1:MlaD family protein >Feature sequence059 1230 169 gene locus_tag LOCUS_07590 1230 169 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265893.1 protein_id gnl|my_center|LOCUS_07590 2212 1295 gene locus_tag LOCUS_07600 2212 1295 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920842.1 protein_id gnl|my_center|LOCUS_07600 2338 2889 gene locus_tag LOCUS_07610 2338 2889 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920844.1 protein_id gnl|my_center|LOCUS_07610 2886 3998 gene locus_tag LOCUS_07620 gene aroB 2886 3998 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920845.1 protein_id gnl|my_center|LOCUS_07620 4033 5325 gene locus_tag LOCUS_07630 4033 5325 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640633.1 protein_id gnl|my_center|LOCUS_07630 5379 5771 gene locus_tag LOCUS_07640 5379 5771 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920851.1 protein_id gnl|my_center|LOCUS_07640 6180 5884 gene locus_tag LOCUS_07650 6180 5884 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083017.1 protein_id gnl|my_center|LOCUS_07650 6231 6854 gene locus_tag LOCUS_07660 6231 6854 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920846.1 protein_id gnl|my_center|LOCUS_07660 6914 7924 gene locus_tag LOCUS_07670 gene cobS 6914 7924 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920857.1 protein_id gnl|my_center|LOCUS_07670 8052 9248 gene locus_tag LOCUS_07680 8052 9248 CDS product DUF3089 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918560.1 protein_id gnl|my_center|LOCUS_07680 >Feature sequence060 350 970 gene locus_tag LOCUS_07690 gene timA 350 970 CDS product TIM44-related membrane protein TimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266001.1 protein_id gnl|my_center|LOCUS_07690 970 2097 gene locus_tag LOCUS_07700 970 2097 CDS product MltA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921567.1 protein_id gnl|my_center|LOCUS_07700 2121 2603 gene locus_tag LOCUS_07710 2121 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 2932 2600 gene locus_tag LOCUS_07720 2932 2600 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921565.1 protein_id gnl|my_center|LOCUS_07720 3716 2934 gene locus_tag LOCUS_07730 gene hisF 3716 2934 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921564.1 protein_id gnl|my_center|LOCUS_07730 4438 3716 gene locus_tag LOCUS_07740 gene hisA 4438 3716 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923355.1 protein_id gnl|my_center|LOCUS_07740 5085 4435 gene locus_tag LOCUS_07750 gene hisH 5085 4435 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921562.1 protein_id gnl|my_center|LOCUS_07750 5708 5118 gene locus_tag LOCUS_07760 gene hisB 5708 5118 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921561.1 protein_id gnl|my_center|LOCUS_07760 6703 5705 gene locus_tag LOCUS_07770 6703 5705 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266000.1 protein_id gnl|my_center|LOCUS_07770 7522 6836 gene locus_tag LOCUS_07780 gene nth 7522 6836 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921558.1 protein_id gnl|my_center|LOCUS_07780 7532 8038 gene locus_tag LOCUS_07790 7532 8038 CDS product DUF2244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921557.1 protein_id gnl|my_center|LOCUS_07790 8113 9126 gene locus_tag LOCUS_07800 8113 9126 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036394.1 protein_id gnl|my_center|LOCUS_07800 >Feature sequence061 <1 700 gene locus_tag LOCUS_07810 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640657.1:low specificity L-threonine aldolase 1562 768 gene locus_tag LOCUS_07820 1562 768 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090527.1 protein_id gnl|my_center|LOCUS_07820 2562 1567 gene locus_tag LOCUS_07830 2562 1567 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085927.1 protein_id gnl|my_center|LOCUS_07830 4839 2635 gene locus_tag LOCUS_07840 gene divL 4839 2635 CDS product cell cycle protein kinase DivL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921313.1 protein_id gnl|my_center|LOCUS_07840 4950 5354 gene locus_tag LOCUS_07850 4950 5354 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918016.1 protein_id gnl|my_center|LOCUS_07850 5519 6082 gene locus_tag LOCUS_07860 5519 6082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265501.1 protein_id gnl|my_center|LOCUS_07860 6962 6180 gene locus_tag LOCUS_07870 6962 6180 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918013.1 protein_id gnl|my_center|LOCUS_07870 7540 7046 gene locus_tag LOCUS_07880 7540 7046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07880 8383 7568 gene locus_tag LOCUS_07890 8383 7568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07890 <9590 8385 gene locus_tag LOCUS_07900 <9590 8385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921378.1:NADP-dependent malic enzyme >Feature sequence062 441 1097 gene locus_tag LOCUS_07910 441 1097 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918213.1 protein_id gnl|my_center|LOCUS_07910 1882 1187 gene locus_tag LOCUS_07920 1882 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 2547 1948 gene locus_tag LOCUS_07930 2547 1948 CDS product inner membrane-spanning protein YciB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923335.1 protein_id gnl|my_center|LOCUS_07930 3485 2544 gene locus_tag LOCUS_07940 gene ftsY 3485 2544 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921506.1 protein_id gnl|my_center|LOCUS_07940 4834 3497 gene locus_tag LOCUS_07950 gene mtaB 4834 3497 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921511.1 protein_id gnl|my_center|LOCUS_07950 5687 4839 gene locus_tag LOCUS_07960 5687 4839 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530979.1 protein_id gnl|my_center|LOCUS_07960 6520 5684 gene locus_tag LOCUS_07970 gene dapF 6520 5684 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921513.1 protein_id gnl|my_center|LOCUS_07970 7443 6517 gene locus_tag LOCUS_07980 7443 6517 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921524.1 protein_id gnl|my_center|LOCUS_07980 8422 7571 gene locus_tag LOCUS_07990 8422 7571 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265994.1 protein_id gnl|my_center|LOCUS_07990 >Feature sequence063 1234 2718 gene locus_tag LOCUS_08000 1234 2718 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529293.1 protein_id gnl|my_center|LOCUS_08000 2732 3364 gene locus_tag LOCUS_08010 gene nthA 2732 3364 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066879389.1 protein_id gnl|my_center|LOCUS_08010 3361 4011 gene locus_tag LOCUS_08020 gene nthB 3361 4011 CDS product nitrile hydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969705.1 protein_id gnl|my_center|LOCUS_08020 3998 4333 gene locus_tag LOCUS_08030 3998 4333 CDS product nitrile hydratase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531054.1 protein_id gnl|my_center|LOCUS_08030 4411 5733 gene locus_tag LOCUS_08040 4411 5733 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086508.1 protein_id gnl|my_center|LOCUS_08040 5971 5753 gene locus_tag LOCUS_08050 5971 5753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 6053 7564 gene locus_tag LOCUS_08060 6053 7564 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918202.1 protein_id gnl|my_center|LOCUS_08060 7626 8084 gene locus_tag LOCUS_08070 gene rbfA 7626 8084 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917927.1 protein_id gnl|my_center|LOCUS_08070 8084 9010 gene locus_tag LOCUS_08080 gene truB 8084 9010 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917926.1 protein_id gnl|my_center|LOCUS_08080 >Feature sequence064 <1 582 gene locus_tag LOCUS_08090 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337621.1:heme lyase CcmF/NrfE family subunit 579 1037 gene locus_tag LOCUS_08100 579 1037 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241025.1 protein_id gnl|my_center|LOCUS_08100 1263 979 gene locus_tag LOCUS_08110 1263 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 1241 1999 gene locus_tag LOCUS_08120 1241 1999 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929635.1 protein_id gnl|my_center|LOCUS_08120 2628 2029 gene locus_tag LOCUS_08130 2628 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 2764 4611 gene locus_tag LOCUS_08140 2764 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 4674 5798 gene locus_tag LOCUS_08150 gene ccmI 4674 5798 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085909.1 protein_id gnl|my_center|LOCUS_08150 9057 5914 gene locus_tag LOCUS_08160 9057 5914 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918488.1 protein_id gnl|my_center|LOCUS_08160 >Feature sequence065 580 236 gene locus_tag LOCUS_08170 580 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967945.1 protein_id gnl|my_center|LOCUS_08170 1677 577 gene locus_tag LOCUS_08180 1677 577 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188583328.1 protein_id gnl|my_center|LOCUS_08180 2249 1881 gene locus_tag LOCUS_08190 2249 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08190 2635 2288 gene locus_tag LOCUS_08200 2635 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08200 5084 2751 gene locus_tag LOCUS_08210 gene clpA 5084 2751 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920326.1 protein_id gnl|my_center|LOCUS_08210 5337 5095 gene locus_tag LOCUS_08220 5337 5095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 6488 5586 gene locus_tag LOCUS_08230 6488 5586 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920323.1 protein_id gnl|my_center|LOCUS_08230 7192 6515 gene locus_tag LOCUS_08240 7192 6515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920322.1 protein_id gnl|my_center|LOCUS_08240 7298 7690 gene locus_tag LOCUS_08250 gene divK 7298 7690 CDS product cell-cycle response regulator DivK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640499.1 protein_id gnl|my_center|LOCUS_08250 7850 7683 gene locus_tag LOCUS_08260 gene rpmG 7850 7683 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920317.1 protein_id gnl|my_center|LOCUS_08260 8539 7955 gene locus_tag LOCUS_08270 8539 7955 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265812.1 protein_id gnl|my_center|LOCUS_08270 >Feature sequence066 2944 1643 gene locus_tag LOCUS_08280 gene aceA 2944 1643 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974516.1 protein_id gnl|my_center|LOCUS_08280 3104 4528 gene locus_tag LOCUS_08290 3104 4528 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640327.1 protein_id gnl|my_center|LOCUS_08290 6151 4538 gene locus_tag LOCUS_08300 6151 4538 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966434.1 protein_id gnl|my_center|LOCUS_08300 >Feature sequence067 <1 1235 gene locus_tag LOCUS_08310 <1 1235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087688.1:MFS transporter 3816 1312 gene locus_tag LOCUS_08320 3816 1312 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928446.1 protein_id gnl|my_center|LOCUS_08320 3815 4921 gene locus_tag LOCUS_08330 3815 4921 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172666.1 protein_id gnl|my_center|LOCUS_08330 4918 8106 gene locus_tag LOCUS_08340 4918 8106 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393635.1 protein_id gnl|my_center|LOCUS_08340 >Feature sequence068 952 347 gene locus_tag LOCUS_08350 952 347 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921398.1 protein_id gnl|my_center|LOCUS_08350 2228 975 gene locus_tag LOCUS_08360 2228 975 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_08360 3073 2288 gene locus_tag LOCUS_08370 3073 2288 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920118.1 protein_id gnl|my_center|LOCUS_08370 3242 3922 gene locus_tag LOCUS_08380 3242 3922 CDS product DnaA/Hda family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720965.1 protein_id gnl|my_center|LOCUS_08380 3954 6332 gene locus_tag LOCUS_08390 3954 6332 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265738.1 protein_id gnl|my_center|LOCUS_08390 6313 7839 gene locus_tag LOCUS_08400 6313 7839 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919577.1 protein_id gnl|my_center|LOCUS_08400 <8677 7843 gene locus_tag LOCUS_08410 <8677 7843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919573.1:ribonuclease D >Feature sequence069 167 649 gene locus_tag LOCUS_08420 167 649 CDS product type II toxin-antitoxin system YhaV family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084500.1 protein_id gnl|my_center|LOCUS_08420 1767 925 gene locus_tag LOCUS_08430 1767 925 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673299.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08430 3327 2116 gene locus_tag LOCUS_08440 3327 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 3803 3324 gene locus_tag LOCUS_08450 3803 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 5448 4261 gene locus_tag LOCUS_08460 5448 4261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 6888 5533 gene locus_tag LOCUS_08470 6888 5533 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481488.1 protein_id gnl|my_center|LOCUS_08470 7274 8107 gene locus_tag LOCUS_08480 7274 8107 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171568.1 protein_id gnl|my_center|LOCUS_08480 8597 8118 gene locus_tag LOCUS_08490 8597 8118 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651091.1 protein_id gnl|my_center|LOCUS_08490 >Feature sequence070 2541 502 gene locus_tag LOCUS_08500 2541 502 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933610.1 protein_id gnl|my_center|LOCUS_08500 2504 2719 gene locus_tag LOCUS_08510 2504 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 2892 3875 gene locus_tag LOCUS_08520 2892 3875 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976409.1 protein_id gnl|my_center|LOCUS_08520 3904 4422 gene locus_tag LOCUS_08530 3904 4422 CDS product DUF1993 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083593.1 protein_id gnl|my_center|LOCUS_08530 4469 4879 gene locus_tag LOCUS_08540 4469 4879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 5145 4984 gene locus_tag LOCUS_08550 5145 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 5105 5986 gene locus_tag LOCUS_08560 5105 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 6592 6002 gene locus_tag LOCUS_08570 gene ilvN 6592 6002 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919962.1 protein_id gnl|my_center|LOCUS_08570 8415 6592 gene locus_tag LOCUS_08580 8415 6592 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640408.1 protein_id gnl|my_center|LOCUS_08580 >Feature sequence071 352 2655 gene locus_tag LOCUS_08590 352 2655 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920015.1 protein_id gnl|my_center|LOCUS_08590 2732 4249 gene locus_tag LOCUS_08600 2732 4249 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921409.1 protein_id gnl|my_center|LOCUS_08600 4267 4611 gene locus_tag LOCUS_08610 4267 4611 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532871.1 protein_id gnl|my_center|LOCUS_08610 5195 4608 gene locus_tag LOCUS_08620 5195 4608 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921055.1 protein_id gnl|my_center|LOCUS_08620 5992 5192 gene locus_tag LOCUS_08630 gene thiD 5992 5192 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921056.1 protein_id gnl|my_center|LOCUS_08630 6872 5985 gene locus_tag LOCUS_08640 gene folP 6872 5985 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921057.1 protein_id gnl|my_center|LOCUS_08640 <8581 6974 gene locus_tag LOCUS_08650 <8581 6974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921059.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence072 962 621 gene locus_tag LOCUS_08660 962 621 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210342306.1 protein_id gnl|my_center|LOCUS_08660 1138 2412 gene locus_tag LOCUS_08670 1138 2412 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088518.1 protein_id gnl|my_center|LOCUS_08670 2422 2871 gene locus_tag LOCUS_08680 gene trxC 2422 2871 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088519.1 protein_id gnl|my_center|LOCUS_08680 2906 3109 gene locus_tag LOCUS_08690 2906 3109 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088520.1 protein_id gnl|my_center|LOCUS_08690 3106 4371 gene locus_tag LOCUS_08700 3106 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 6128 4614 gene locus_tag LOCUS_08710 6128 4614 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921351.1 protein_id gnl|my_center|LOCUS_08710 6365 7267 gene locus_tag LOCUS_08720 6365 7267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 8277 7264 gene locus_tag LOCUS_08730 8277 7264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 >Feature sequence073 281 1750 gene locus_tag LOCUS_08740 281 1750 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265924.1 protein_id gnl|my_center|LOCUS_08740 1747 2841 gene locus_tag LOCUS_08750 1747 2841 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921032.1 protein_id gnl|my_center|LOCUS_08750 2838 6038 gene locus_tag LOCUS_08760 2838 6038 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921033.1 protein_id gnl|my_center|LOCUS_08760 6668 6144 gene locus_tag LOCUS_08770 6668 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08770 7597 6644 gene locus_tag LOCUS_08780 7597 6644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08780 7703 8296 gene locus_tag LOCUS_08790 7703 8296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 >Feature sequence074 1344 1883 gene locus_tag LOCUS_08800 1344 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 1968 3206 gene locus_tag LOCUS_08810 1968 3206 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_08810 4392 3268 gene locus_tag LOCUS_08820 4392 3268 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923292.1 protein_id gnl|my_center|LOCUS_08820 5753 4527 gene locus_tag LOCUS_08830 5753 4527 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918018.1 protein_id gnl|my_center|LOCUS_08830 7826 5856 gene locus_tag LOCUS_08840 7826 5856 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639885.1 protein_id gnl|my_center|LOCUS_08840 8361 8146 gene locus_tag LOCUS_08850 8361 8146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 >Feature sequence075 633 1058 gene locus_tag LOCUS_08860 633 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 1105 1386 gene locus_tag LOCUS_08870 gene rpmA 1105 1386 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918207.1 protein_id gnl|my_center|LOCUS_08870 1594 2262 gene locus_tag LOCUS_08880 gene rimP 1594 2262 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639861.1 protein_id gnl|my_center|LOCUS_08880 2259 3938 gene locus_tag LOCUS_08890 gene nusA 2259 3938 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917934.1 protein_id gnl|my_center|LOCUS_08890 4030 4662 gene locus_tag LOCUS_08900 4030 4662 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917933.1 protein_id gnl|my_center|LOCUS_08900 4769 7921 gene locus_tag LOCUS_08910 gene infB 4769 7921 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265492.1 protein_id gnl|my_center|LOCUS_08910 >Feature sequence076 726 562 gene locus_tag LOCUS_08920 726 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 1375 2787 gene locus_tag LOCUS_08930 1375 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 2933 4123 gene locus_tag LOCUS_08940 2933 4123 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730842.1 protein_id gnl|my_center|LOCUS_08940 4276 4097 gene locus_tag LOCUS_08950 4276 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 4819 5121 gene locus_tag LOCUS_08960 4819 5121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 5164 6228 gene locus_tag LOCUS_08970 5164 6228 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528974.1 protein_id gnl|my_center|LOCUS_08970 <8336 6233 gene locus_tag LOCUS_08980 <8336 6233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265504.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence077 3615 1402 gene locus_tag LOCUS_08990 gene uvrB 3615 1402 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920818.1 protein_id gnl|my_center|LOCUS_08990 3750 4400 gene locus_tag LOCUS_09000 3750 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 4706 5719 gene locus_tag LOCUS_09010 4706 5719 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337355.1 protein_id gnl|my_center|LOCUS_09010 5901 6593 gene locus_tag LOCUS_09020 5901 6593 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265913.1 protein_id gnl|my_center|LOCUS_09020 <8318 6684 gene locus_tag LOCUS_09030 <8318 6684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265771.1:patatin-like phospholipase family protein >Feature sequence078 323 1006 gene locus_tag LOCUS_09040 gene lexA 323 1006 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265748.1 protein_id gnl|my_center|LOCUS_09040 3239 987 gene locus_tag LOCUS_09050 3239 987 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919770.1 protein_id gnl|my_center|LOCUS_09050 3268 4623 gene locus_tag LOCUS_09060 gene gltX 3268 4623 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919771.1 protein_id gnl|my_center|LOCUS_09060 4688 5971 gene locus_tag LOCUS_09070 gene gltA 4688 5971 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919772.1 protein_id gnl|my_center|LOCUS_09070 7137 5944 gene locus_tag LOCUS_09080 gene lpxB 7137 5944 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919775.1 protein_id gnl|my_center|LOCUS_09080 7970 7134 gene locus_tag LOCUS_09090 7970 7134 CDS product LpxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919776.1 protein_id gnl|my_center|LOCUS_09090 >Feature sequence079 507 193 gene locus_tag LOCUS_09100 507 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 2203 488 gene locus_tag LOCUS_09110 2203 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 2483 3226 gene locus_tag LOCUS_09120 2483 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 3347 3496 gene locus_tag LOCUS_09130 3347 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 4688 3579 gene locus_tag LOCUS_09140 4688 3579 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919913.1 protein_id gnl|my_center|LOCUS_09140 5980 4769 gene locus_tag LOCUS_09150 5980 4769 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 protein_id gnl|my_center|LOCUS_09150 7211 6021 gene locus_tag LOCUS_09160 7211 6021 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 protein_id gnl|my_center|LOCUS_09160 <8018 7336 gene locus_tag LOCUS_09170 <8018 7336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919912.1:acyl-CoA dehydrogenase family protein >Feature sequence080 <1 1229 gene locus_tag LOCUS_09180 <1 1229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919262.1:single-stranded-DNA-specific exonuclease RecJ 1295 1369 gene locus_tag LOCUS_t00120 1295 1369 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1577 2155 gene locus_tag LOCUS_09190 gene cspD 1577 2155 CDS product stationary phase survival protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640225.1 protein_id gnl|my_center|LOCUS_09190 2228 2719 gene locus_tag LOCUS_09200 2228 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 2716 3138 gene locus_tag LOCUS_09210 2716 3138 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090561.1 protein_id gnl|my_center|LOCUS_09210 3212 3288 gene locus_tag LOCUS_t00130 3212 3288 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3320 3625 gene locus_tag LOCUS_09220 3320 3625 CDS product ETC complex I subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919265.1 protein_id gnl|my_center|LOCUS_09220 3638 3714 gene locus_tag LOCUS_t00140 3638 3714 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3847 5082 gene locus_tag LOCUS_09230 3847 5082 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918154.1 protein_id gnl|my_center|LOCUS_09230 5211 6650 gene locus_tag LOCUS_09240 5211 6650 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144234.1 protein_id gnl|my_center|LOCUS_09240 7861 6704 gene locus_tag LOCUS_09250 gene metC 7861 6704 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919300.1 protein_id gnl|my_center|LOCUS_09250 >Feature sequence081 <1 2200 gene locus_tag LOCUS_09260 <1 2200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388635.1:TonB-dependent receptor 2266 3249 gene locus_tag LOCUS_09270 gene ycjG 2266 3249 CDS product L-Ala-D/L-Glu epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705659.1 protein_id gnl|my_center|LOCUS_09270 4824 3418 gene locus_tag LOCUS_09280 4824 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 6253 4856 gene locus_tag LOCUS_09290 6253 4856 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879446.1 protein_id gnl|my_center|LOCUS_09290 <7953 6262 gene locus_tag LOCUS_09300 <7953 6262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267176.1:aminopeptidase N >Feature sequence082 <1 581 gene locus_tag LOCUS_09310 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967584.1:divalent metal cation transporter 633 1307 gene locus_tag LOCUS_09320 633 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 2133 1351 gene locus_tag LOCUS_09330 2133 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 2854 2120 gene locus_tag LOCUS_09340 2854 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 3036 4034 gene locus_tag LOCUS_09350 gene dusA 3036 4034 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919183.1 protein_id gnl|my_center|LOCUS_09350 4532 4314 gene locus_tag LOCUS_09360 4532 4314 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919185.1 protein_id gnl|my_center|LOCUS_09360 4747 5127 gene locus_tag LOCUS_09370 4747 5127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 5359 6636 gene locus_tag LOCUS_09380 5359 6636 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919187.1 protein_id gnl|my_center|LOCUS_09380 6709 7854 gene locus_tag LOCUS_09390 6709 7854 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265695.1 protein_id gnl|my_center|LOCUS_09390 >Feature sequence083 406 1377 gene locus_tag LOCUS_09400 406 1377 CDS product mitochondrial fission ELM1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389733.1 protein_id gnl|my_center|LOCUS_09400 1991 1350 gene locus_tag LOCUS_09410 1991 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 3575 2160 gene locus_tag LOCUS_09420 3575 2160 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017586463.1 protein_id gnl|my_center|LOCUS_09420 4190 3762 gene locus_tag LOCUS_09430 gene arfB 4190 3762 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635559.1 protein_id gnl|my_center|LOCUS_09430 4973 4203 gene locus_tag LOCUS_09440 4973 4203 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640174.1 protein_id gnl|my_center|LOCUS_09440 5124 5309 gene locus_tag LOCUS_09450 5124 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 5354 6142 gene locus_tag LOCUS_09460 5354 6142 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919103.1 protein_id gnl|my_center|LOCUS_09460 6173 7138 gene locus_tag LOCUS_09470 6173 7138 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918286.1 protein_id gnl|my_center|LOCUS_09470 <7882 7337 gene locus_tag LOCUS_09480 <7882 7337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920181.1:NUDIX hydrolase >Feature sequence084 303 548 gene locus_tag LOCUS_09490 303 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 539 1762 gene locus_tag LOCUS_09500 539 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 2939 3466 gene locus_tag LOCUS_09510 2939 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 5167 3854 gene locus_tag LOCUS_09520 5167 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 5373 6701 gene locus_tag LOCUS_09530 5373 6701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 6774 7571 gene locus_tag LOCUS_09540 6774 7571 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086826.1 protein_id gnl|my_center|LOCUS_09540 >Feature sequence085 1616 2734 gene locus_tag LOCUS_09550 1616 2734 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120868.1 protein_id gnl|my_center|LOCUS_09550 2736 3335 gene locus_tag LOCUS_09560 gene recR 2736 3335 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639926.1 protein_id gnl|my_center|LOCUS_09560 3371 4591 gene locus_tag LOCUS_09570 3371 4591 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918160.1 protein_id gnl|my_center|LOCUS_09570 4601 5122 gene locus_tag LOCUS_09580 gene def 4601 5122 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918161.1 protein_id gnl|my_center|LOCUS_09580 5167 6093 gene locus_tag LOCUS_09590 gene fmt 5167 6093 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918168.1 protein_id gnl|my_center|LOCUS_09590 6097 6855 gene locus_tag LOCUS_09600 gene truA 6097 6855 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918167.1 protein_id gnl|my_center|LOCUS_09600 <7832 6828 gene locus_tag LOCUS_09610 <7832 6828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918164.1:succinyl-diaminopimelate desuccinylase >Feature sequence086 2438 948 gene locus_tag LOCUS_09620 2438 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 2563 3453 gene locus_tag LOCUS_09630 2563 3453 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544619.1 protein_id gnl|my_center|LOCUS_09630 3467 4342 gene locus_tag LOCUS_09640 3467 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 4339 6510 gene locus_tag LOCUS_09650 4339 6510 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004546333.1 protein_id gnl|my_center|LOCUS_09650 <7822 6400 gene locus_tag LOCUS_09660 <7822 6400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_111158892.1:chloride channel protein >Feature sequence087 <1 980 gene locus_tag LOCUS_09670 <1 980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920418.1:16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH 977 1438 gene locus_tag LOCUS_09680 977 1438 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920417.1 protein_id gnl|my_center|LOCUS_09680 1435 3291 gene locus_tag LOCUS_09690 1435 3291 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920416.1 protein_id gnl|my_center|LOCUS_09690 3288 4736 gene locus_tag LOCUS_09700 3288 4736 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920415.1 protein_id gnl|my_center|LOCUS_09700 4729 6150 gene locus_tag LOCUS_09710 4729 6150 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920414.1 protein_id gnl|my_center|LOCUS_09710 6150 7265 gene locus_tag LOCUS_09720 gene mraY 6150 7265 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640523.1 protein_id gnl|my_center|LOCUS_09720 >Feature sequence088 250 1587 gene locus_tag LOCUS_09730 250 1587 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192776.1 protein_id gnl|my_center|LOCUS_09730 1828 1607 gene locus_tag LOCUS_09740 1828 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 2535 1825 gene locus_tag LOCUS_09750 2535 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 3115 2609 gene locus_tag LOCUS_09760 3115 2609 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265581.1 protein_id gnl|my_center|LOCUS_09760 3707 3366 gene locus_tag LOCUS_09770 3707 3366 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918540.1 protein_id gnl|my_center|LOCUS_09770 4218 3856 gene locus_tag LOCUS_09780 4218 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 6830 4215 gene locus_tag LOCUS_09790 6830 4215 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640026.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence089 2400 664 gene locus_tag LOCUS_09800 gene ilvD 2400 664 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087531.1 protein_id gnl|my_center|LOCUS_09800 3393 2467 gene locus_tag LOCUS_09810 3393 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 3583 3783 gene locus_tag LOCUS_09820 3583 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 5913 3898 gene locus_tag LOCUS_09830 5913 3898 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640158.1 protein_id gnl|my_center|LOCUS_09830 6012 6719 gene locus_tag LOCUS_09840 gene msrA 6012 6719 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528688.1 protein_id gnl|my_center|LOCUS_09840 6740 7477 gene locus_tag LOCUS_09850 6740 7477 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967135.1 protein_id gnl|my_center|LOCUS_09850 >Feature sequence090 1676 2113 gene locus_tag LOCUS_09860 1676 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 2922 2122 gene locus_tag LOCUS_09870 2922 2122 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206428.1 protein_id gnl|my_center|LOCUS_09870 4070 2919 gene locus_tag LOCUS_09880 4070 2919 CDS product TIGR03364 family FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813122.1 protein_id gnl|my_center|LOCUS_09880 6153 4045 gene locus_tag LOCUS_09890 6153 4045 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920964.1 protein_id gnl|my_center|LOCUS_09890 <7692 6165 gene locus_tag LOCUS_09900 <7692 6165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920963.1:TonB-dependent receptor >Feature sequence091 947 750 gene locus_tag LOCUS_09910 947 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 946 2325 gene locus_tag LOCUS_09920 946 2325 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226082.1 protein_id gnl|my_center|LOCUS_09920 3252 2341 gene locus_tag LOCUS_09930 3252 2341 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919989.1 protein_id gnl|my_center|LOCUS_09930 4733 3354 gene locus_tag LOCUS_09940 4733 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 5309 4755 gene locus_tag LOCUS_09950 5309 4755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 6674 5391 gene locus_tag LOCUS_09960 6674 5391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 <7671 6649 gene locus_tag LOCUS_09970 <7671 6649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004525086.1:polysaccharide biosynthesis tyrosine autokinase >Feature sequence092 <1 681 gene locus_tag LOCUS_09980 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205616.1:DUF2827 domain-containing protein 1006 2727 gene locus_tag LOCUS_09990 gene kdpA 1006 2727 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919465.1 protein_id gnl|my_center|LOCUS_09990 2730 4856 gene locus_tag LOCUS_10000 gene kdpB 2730 4856 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919466.1 protein_id gnl|my_center|LOCUS_10000 4886 5452 gene locus_tag LOCUS_10010 gene kdpC 4886 5452 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919467.1 protein_id gnl|my_center|LOCUS_10010 >Feature sequence093 <1 1009 gene locus_tag LOCUS_10020 <1 1009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086677.1:arylsulfatase 1670 1050 gene locus_tag LOCUS_10030 1670 1050 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919061.1 protein_id gnl|my_center|LOCUS_10030 2771 1734 gene locus_tag LOCUS_10040 2771 1734 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265781.1 protein_id gnl|my_center|LOCUS_10040 2953 4137 gene locus_tag LOCUS_10050 gene metZ 2953 4137 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640446.1 protein_id gnl|my_center|LOCUS_10050 5035 4142 gene locus_tag LOCUS_10060 5035 4142 CDS product Hsp33 family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920102.1 protein_id gnl|my_center|LOCUS_10060 6028 5090 gene locus_tag LOCUS_10070 gene argF 6028 5090 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920103.1 protein_id gnl|my_center|LOCUS_10070 7236 6025 gene locus_tag LOCUS_10080 7236 6025 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920104.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence094 2036 537 gene locus_tag LOCUS_10090 2036 537 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920135.1 protein_id gnl|my_center|LOCUS_10090 2286 2777 gene locus_tag LOCUS_10100 gene purE 2286 2777 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921116.1 protein_id gnl|my_center|LOCUS_10100 2774 3856 gene locus_tag LOCUS_10110 2774 3856 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921115.1 protein_id gnl|my_center|LOCUS_10110 4060 6402 gene locus_tag LOCUS_10120 4060 6402 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919391.1 protein_id gnl|my_center|LOCUS_10120 7076 6441 gene locus_tag LOCUS_10130 7076 6441 CDS product COQ9 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921128.1 protein_id gnl|my_center|LOCUS_10130 7150 7500 gene locus_tag LOCUS_10140 7150 7500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 >Feature sequence095 638 979 gene locus_tag LOCUS_10150 638 979 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224553.1 protein_id gnl|my_center|LOCUS_10150 976 1440 gene locus_tag LOCUS_10160 976 1440 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037386442.1 protein_id gnl|my_center|LOCUS_10160 1456 2109 gene locus_tag LOCUS_10170 1456 2109 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969298.1 protein_id gnl|my_center|LOCUS_10170 3277 2156 gene locus_tag LOCUS_10180 3277 2156 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994140.1 protein_id gnl|my_center|LOCUS_10180 3970 3344 gene locus_tag LOCUS_10190 3970 3344 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920342.1 protein_id gnl|my_center|LOCUS_10190 4054 5541 gene locus_tag LOCUS_10200 4054 5541 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265814.1 protein_id gnl|my_center|LOCUS_10200 6723 5554 gene locus_tag LOCUS_10210 6723 5554 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257883.1 protein_id gnl|my_center|LOCUS_10210 >Feature sequence096 799 1323 gene locus_tag LOCUS_10220 gene gcrA 799 1323 CDS product cell cycle sigma 70 cofactor GcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265783.1 protein_id gnl|my_center|LOCUS_10220 1382 2833 gene locus_tag LOCUS_10230 gene xseA 1382 2833 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920107.1 protein_id gnl|my_center|LOCUS_10230 3559 2864 gene locus_tag LOCUS_10240 3559 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 3743 3976 gene locus_tag LOCUS_10250 3743 3976 CDS product DUF2093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640448.1 protein_id gnl|my_center|LOCUS_10250 4821 3955 gene locus_tag LOCUS_10260 4821 3955 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920111.1 protein_id gnl|my_center|LOCUS_10260 4942 5793 gene locus_tag LOCUS_10270 gene hisN 4942 5793 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920113.1 protein_id gnl|my_center|LOCUS_10270 6743 5790 gene locus_tag LOCUS_10280 6743 5790 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920114.1 protein_id gnl|my_center|LOCUS_10280 7058 6750 gene locus_tag LOCUS_10290 7058 6750 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920115.1 protein_id gnl|my_center|LOCUS_10290 >Feature sequence097 <1 1736 gene locus_tag LOCUS_10300 <1 1736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919998.1:methionine synthase 2462 1740 gene locus_tag LOCUS_10310 2462 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 2904 3224 gene locus_tag LOCUS_10320 2904 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 3377 3667 gene locus_tag LOCUS_10330 3377 3667 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919993.1 protein_id gnl|my_center|LOCUS_10330 4320 3751 gene locus_tag LOCUS_10340 4320 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 4537 5637 gene locus_tag LOCUS_10350 4537 5637 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919990.1 protein_id gnl|my_center|LOCUS_10350 >Feature sequence098 <1 902 gene locus_tag LOCUS_10360 <1 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528130.1:aminotransferase class III-fold pyridoxal phosphate-dependent enzyme 1103 2086 gene locus_tag LOCUS_10370 gene galE 1103 2086 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533607.1 protein_id gnl|my_center|LOCUS_10370 2279 3376 gene locus_tag LOCUS_10380 2279 3376 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188583328.1 protein_id gnl|my_center|LOCUS_10380 3373 3693 gene locus_tag LOCUS_10390 3373 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 6167 3690 gene locus_tag LOCUS_10400 gene hrpB 6167 3690 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640169.1 protein_id gnl|my_center|LOCUS_10400 <7515 6174 gene locus_tag LOCUS_10410 <7515 6174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265679.1:amino acid permease >Feature sequence099 2043 175 gene locus_tag LOCUS_10420 2043 175 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_10420 3669 2161 gene locus_tag LOCUS_10430 3669 2161 CDS product AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926880.1 protein_id gnl|my_center|LOCUS_10430 5203 3674 gene locus_tag LOCUS_10440 5203 3674 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528502.1 protein_id gnl|my_center|LOCUS_10440 6349 5288 gene locus_tag LOCUS_10450 6349 5288 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088998.1 protein_id gnl|my_center|LOCUS_10450 7151 6369 gene locus_tag LOCUS_10460 7151 6369 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083902.1 protein_id gnl|my_center|LOCUS_10460 >Feature sequence100 <1 936 gene locus_tag LOCUS_10470 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919326.1:NAD regulator 1931 939 gene locus_tag LOCUS_10480 1931 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 2639 2217 gene locus_tag LOCUS_10490 2639 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10490 3022 2615 gene locus_tag LOCUS_10500 3022 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10500 3145 4425 gene locus_tag LOCUS_10510 3145 4425 CDS product folate/biopterin family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055871.1 protein_id gnl|my_center|LOCUS_10510 5807 4467 gene locus_tag LOCUS_10520 5807 4467 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 protein_id gnl|my_center|LOCUS_10520 6682 5891 gene locus_tag LOCUS_10530 6682 5891 CDS product enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919717.1 protein_id gnl|my_center|LOCUS_10530 >Feature sequence101 341 1072 gene locus_tag LOCUS_10540 341 1072 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932760.1 protein_id gnl|my_center|LOCUS_10540 1400 1741 gene locus_tag LOCUS_10550 1400 1741 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069457965.1 protein_id gnl|my_center|LOCUS_10550 1738 3333 gene locus_tag LOCUS_10560 1738 3333 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167540391.1 protein_id gnl|my_center|LOCUS_10560 3330 3956 gene locus_tag LOCUS_10570 3330 3956 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388104.1 protein_id gnl|my_center|LOCUS_10570 4264 5544 gene locus_tag LOCUS_10580 4264 5544 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494209.1 protein_id gnl|my_center|LOCUS_10580 5541 6194 gene locus_tag LOCUS_10590 5541 6194 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086324.1 protein_id gnl|my_center|LOCUS_10590 7154 6375 gene locus_tag LOCUS_10600 7154 6375 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920702.1 protein_id gnl|my_center|LOCUS_10600 >Feature sequence102 <1 2104 gene locus_tag LOCUS_10610 <1 2104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391431.1:sulfotransferase 2141 2809 gene locus_tag LOCUS_10620 2141 2809 CDS product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073659.1 protein_id gnl|my_center|LOCUS_10620 3860 2835 gene locus_tag LOCUS_10630 3860 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 5029 3863 gene locus_tag LOCUS_10640 5029 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 6531 5038 gene locus_tag LOCUS_10650 gene sppA 6531 5038 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918811.1 protein_id gnl|my_center|LOCUS_10650 6454 6900 gene locus_tag LOCUS_10660 6454 6900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 6977 7053 gene locus_tag LOCUS_t00150 6977 7053 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence103 1264 980 gene locus_tag LOCUS_10670 1264 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 3094 1460 gene locus_tag LOCUS_10680 gene murJ 3094 1460 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946821.1 protein_id gnl|my_center|LOCUS_10680 3919 3137 gene locus_tag LOCUS_10690 3919 3137 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921431.1 protein_id gnl|my_center|LOCUS_10690 4488 3961 gene locus_tag LOCUS_10700 4488 3961 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920495.1 protein_id gnl|my_center|LOCUS_10700 4825 5583 gene locus_tag LOCUS_10710 4825 5583 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640545.1 protein_id gnl|my_center|LOCUS_10710 6438 5611 gene locus_tag LOCUS_10720 6438 5611 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070939922.1 protein_id gnl|my_center|LOCUS_10720 7312 6569 gene locus_tag LOCUS_10730 7312 6569 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907545.1 protein_id gnl|my_center|LOCUS_10730 >Feature sequence104 3 548 gene locus_tag LOCUS_10740 3 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 601 1368 gene locus_tag LOCUS_10750 601 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 1909 1388 gene locus_tag LOCUS_10760 1909 1388 CDS product DUF1993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192577.1 protein_id gnl|my_center|LOCUS_10760 2711 1947 gene locus_tag LOCUS_10770 2711 1947 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089986.1 protein_id gnl|my_center|LOCUS_10770 4075 2738 gene locus_tag LOCUS_10780 4075 2738 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218080540.1 protein_id gnl|my_center|LOCUS_10780 5211 4075 gene locus_tag LOCUS_10790 5211 4075 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087559.1 protein_id gnl|my_center|LOCUS_10790 6589 5339 gene locus_tag LOCUS_10800 6589 5339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 >Feature sequence105 445 2895 gene locus_tag LOCUS_10810 445 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 2900 3772 gene locus_tag LOCUS_10820 2900 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 3776 5812 gene locus_tag LOCUS_10830 3776 5812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 >Feature sequence106 >Feature sequence107 1595 972 gene locus_tag LOCUS_10840 1595 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 1925 2524 gene locus_tag LOCUS_10850 1925 2524 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640203.1 protein_id gnl|my_center|LOCUS_10850 4186 2525 gene locus_tag LOCUS_10860 4186 2525 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396632.1 protein_id gnl|my_center|LOCUS_10860 4702 4274 gene locus_tag LOCUS_10870 gene dksA 4702 4274 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920436.1 protein_id gnl|my_center|LOCUS_10870 >Feature sequence108 169 1116 gene locus_tag LOCUS_10880 gene dusB 169 1116 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640316.1 protein_id gnl|my_center|LOCUS_10880 1113 2198 gene locus_tag LOCUS_10890 1113 2198 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640317.1 protein_id gnl|my_center|LOCUS_10890 2214 3629 gene locus_tag LOCUS_10900 2214 3629 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919609.1 protein_id gnl|my_center|LOCUS_10900 3694 5919 gene locus_tag LOCUS_10910 3694 5919 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640318.1 protein_id gnl|my_center|LOCUS_10910 >Feature sequence109 421 3582 gene locus_tag LOCUS_10920 421 3582 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086679.1 protein_id gnl|my_center|LOCUS_10920 4149 3640 gene locus_tag LOCUS_10930 4149 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 4756 4349 gene locus_tag LOCUS_10940 4756 4349 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391320.1 protein_id gnl|my_center|LOCUS_10940 >Feature sequence110 327 2057 gene locus_tag LOCUS_10950 gene ggt 327 2057 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639997.1 protein_id gnl|my_center|LOCUS_10950 2510 2079 gene locus_tag LOCUS_10960 2510 2079 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479700.1 protein_id gnl|my_center|LOCUS_10960 4331 2523 gene locus_tag LOCUS_10970 4331 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 5663 4500 gene locus_tag LOCUS_10980 gene hemW 5663 4500 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918034.1 protein_id gnl|my_center|LOCUS_10980 6309 5656 gene locus_tag LOCUS_10990 gene rdgB 6309 5656 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639888.1 protein_id gnl|my_center|LOCUS_10990 >Feature sequence111 1016 387 gene locus_tag LOCUS_11000 1016 387 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967669.1 protein_id gnl|my_center|LOCUS_11000 2182 1013 gene locus_tag LOCUS_11010 2182 1013 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640419.1 protein_id gnl|my_center|LOCUS_11010 2931 2179 gene locus_tag LOCUS_11020 2931 2179 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920018.1 protein_id gnl|my_center|LOCUS_11020 3389 2928 gene locus_tag LOCUS_11030 3389 2928 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640420.1 protein_id gnl|my_center|LOCUS_11030 3950 3516 gene locus_tag LOCUS_11040 gene phaP 3950 3516 CDS product TIGR01841 family phasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640421.1 protein_id gnl|my_center|LOCUS_11040 4250 5491 gene locus_tag LOCUS_11050 4250 5491 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920022.1 protein_id gnl|my_center|LOCUS_11050 5939 5520 gene locus_tag LOCUS_11060 5939 5520 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920025.1 protein_id gnl|my_center|LOCUS_11060 6724 5951 gene locus_tag LOCUS_11070 gene mipZ 6724 5951 CDS product division plane-positioning ATPase MipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920026.1 protein_id gnl|my_center|LOCUS_11070 >Feature sequence112 1218 61 gene locus_tag LOCUS_11080 gene ispG 1218 61 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918736.1 protein_id gnl|my_center|LOCUS_11080 2225 1335 gene locus_tag LOCUS_11090 2225 1335 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918735.1 protein_id gnl|my_center|LOCUS_11090 4899 2611 gene locus_tag LOCUS_11100 gene ptsP 4899 2611 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918734.1 protein_id gnl|my_center|LOCUS_11100 6695 5091 gene locus_tag LOCUS_11110 6695 5091 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640504.1 protein_id gnl|my_center|LOCUS_11110 6990 6709 gene locus_tag LOCUS_11120 6990 6709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 >Feature sequence113 513 1340 gene locus_tag LOCUS_11130 513 1340 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808863.1 protein_id gnl|my_center|LOCUS_11130 2019 1378 gene locus_tag LOCUS_11140 2019 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 2267 2016 gene locus_tag LOCUS_11150 2267 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 2346 2675 gene locus_tag LOCUS_11160 2346 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 3795 2755 gene locus_tag LOCUS_11170 3795 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 5390 3873 gene locus_tag LOCUS_11180 5390 3873 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815057.1 protein_id gnl|my_center|LOCUS_11180 5836 5390 gene locus_tag LOCUS_11190 5836 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 6436 6029 gene locus_tag LOCUS_11200 6436 6029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 6884 6444 gene locus_tag LOCUS_11210 6884 6444 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918475.1 protein_id gnl|my_center|LOCUS_11210 >Feature sequence114 432 145 gene locus_tag LOCUS_11220 gene gatC 432 145 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920296.1 protein_id gnl|my_center|LOCUS_11220 549 1010 gene locus_tag LOCUS_11230 gene ruvX 549 1010 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920297.1 protein_id gnl|my_center|LOCUS_11230 1122 2111 gene locus_tag LOCUS_11240 1122 2111 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920301.1 protein_id gnl|my_center|LOCUS_11240 2108 3421 gene locus_tag LOCUS_11250 gene pyrC 2108 3421 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920302.1 protein_id gnl|my_center|LOCUS_11250 3476 4120 gene locus_tag LOCUS_11260 gene plsY 3476 4120 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920304.1 protein_id gnl|my_center|LOCUS_11260 4117 5271 gene locus_tag LOCUS_11270 gene dprA 4117 5271 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920305.1 protein_id gnl|my_center|LOCUS_11270 >Feature sequence115 1804 2658 gene locus_tag LOCUS_11280 1804 2658 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920195.1 protein_id gnl|my_center|LOCUS_11280 2668 3111 gene locus_tag LOCUS_11290 2668 3111 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920194.1 protein_id gnl|my_center|LOCUS_11290 3108 3827 gene locus_tag LOCUS_11300 3108 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 3943 4347 gene locus_tag LOCUS_11310 3943 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 4397 4750 gene locus_tag LOCUS_11320 4397 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 4821 4897 gene locus_tag LOCUS_t00160 4821 4897 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 5990 4947 gene locus_tag LOCUS_11330 5990 4947 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639933.1 protein_id gnl|my_center|LOCUS_11330 >Feature sequence116 <1 584 gene locus_tag LOCUS_11340 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920345.1:adenylosuccinate lyase 1121 606 gene locus_tag LOCUS_11350 1121 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 1807 1142 gene locus_tag LOCUS_11360 1807 1142 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920931.1 protein_id gnl|my_center|LOCUS_11360 3070 1892 gene locus_tag LOCUS_11370 3070 1892 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258129.1 protein_id gnl|my_center|LOCUS_11370 3467 3081 gene locus_tag LOCUS_11380 3467 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 4326 3454 gene locus_tag LOCUS_11390 4326 3454 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534169.1 protein_id gnl|my_center|LOCUS_11390 4523 5278 gene locus_tag LOCUS_11400 4523 5278 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920349.1 protein_id gnl|my_center|LOCUS_11400 5275 5526 gene locus_tag LOCUS_11410 gene purS 5275 5526 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920350.1 protein_id gnl|my_center|LOCUS_11410 5526 6200 gene locus_tag LOCUS_11420 gene purQ 5526 6200 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920354.1 protein_id gnl|my_center|LOCUS_11420 6672 6337 gene locus_tag LOCUS_11430 6672 6337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 >Feature sequence117 1640 111 gene locus_tag LOCUS_11440 1640 111 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920751.1 protein_id gnl|my_center|LOCUS_11440 2729 1641 gene locus_tag LOCUS_11450 gene nadA 2729 1641 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265876.1 protein_id gnl|my_center|LOCUS_11450 3014 3751 gene locus_tag LOCUS_11460 3014 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 4530 3748 gene locus_tag LOCUS_11470 4530 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 5713 4682 gene locus_tag LOCUS_11480 gene trxB 5713 4682 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265863.1 protein_id gnl|my_center|LOCUS_11480 6162 5704 gene locus_tag LOCUS_11490 gene greA 6162 5704 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920688.1 protein_id gnl|my_center|LOCUS_11490 6198 6413 gene locus_tag LOCUS_11500 6198 6413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 >Feature sequence118 1454 663 gene locus_tag LOCUS_11510 1454 663 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920771.1 protein_id gnl|my_center|LOCUS_11510 1718 2266 gene locus_tag LOCUS_11520 1718 2266 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920772.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11520 2266 2781 gene locus_tag LOCUS_11530 2266 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 3261 2839 gene locus_tag LOCUS_11540 3261 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265559.1 protein_id gnl|my_center|LOCUS_11540 4082 3261 gene locus_tag LOCUS_11550 4082 3261 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918357.1 protein_id gnl|my_center|LOCUS_11550 4459 6156 gene locus_tag LOCUS_11560 4459 6156 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918356.1 protein_id gnl|my_center|LOCUS_11560 >Feature sequence119 1060 110 gene locus_tag LOCUS_11570 1060 110 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918583.1 protein_id gnl|my_center|LOCUS_11570 2883 1057 gene locus_tag LOCUS_11580 2883 1057 CDS product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920889.1 protein_id gnl|my_center|LOCUS_11580 3048 3689 gene locus_tag LOCUS_11590 3048 3689 CDS product TIGR02466 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265868.1 protein_id gnl|my_center|LOCUS_11590 3772 5787 gene locus_tag LOCUS_11600 3772 5787 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918820.1 protein_id gnl|my_center|LOCUS_11600 5784 6311 gene locus_tag LOCUS_11610 5784 6311 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640097.1 protein_id gnl|my_center|LOCUS_11610 >Feature sequence120 568 344 gene locus_tag LOCUS_11620 568 344 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640261.1 protein_id gnl|my_center|LOCUS_11620 1779 577 gene locus_tag LOCUS_11630 1779 577 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919408.1 protein_id gnl|my_center|LOCUS_11630 1944 2834 gene locus_tag LOCUS_11640 1944 2834 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563824.1 protein_id gnl|my_center|LOCUS_11640 2847 3509 gene locus_tag LOCUS_11650 2847 3509 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919412.1 protein_id gnl|my_center|LOCUS_11650 3597 5132 gene locus_tag LOCUS_11660 3597 5132 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730593.1 protein_id gnl|my_center|LOCUS_11660 5160 6293 gene locus_tag LOCUS_11670 5160 6293 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085721.1 protein_id gnl|my_center|LOCUS_11670 >Feature sequence121 626 114 gene locus_tag LOCUS_11680 gene rplJ 626 114 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918384.1 protein_id gnl|my_center|LOCUS_11680 1636 947 gene locus_tag LOCUS_11690 gene rplA 1636 947 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918526.1 protein_id gnl|my_center|LOCUS_11690 2072 1638 gene locus_tag LOCUS_11700 gene rplK 2072 1638 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918527.1 protein_id gnl|my_center|LOCUS_11700 2749 2189 gene locus_tag LOCUS_11710 gene nusG 2749 2189 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921038.1 protein_id gnl|my_center|LOCUS_11710 3040 2759 gene locus_tag LOCUS_11720 gene secE 3040 2759 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640697.1 protein_id gnl|my_center|LOCUS_11720 3249 3174 gene locus_tag LOCUS_t00170 3249 3174 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 4530 3340 gene locus_tag LOCUS_11730 gene tuf 4530 3340 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919120.1 protein_id gnl|my_center|LOCUS_11730 <6683 4593 gene locus_tag LOCUS_11740 <6683 4593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921035.1:elongation factor G >Feature sequence122 1425 589 gene locus_tag LOCUS_11750 gene puhE 1425 589 CDS product putative photosynthetic complex assembly protein PuhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388372.1 protein_id gnl|my_center|LOCUS_11750 2534 1434 gene locus_tag LOCUS_11760 gene acsF 2534 1434 CDS product magnesium-protoporphyrin IX monomethyl ester (oxidative) cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338129.1 protein_id gnl|my_center|LOCUS_11760 2836 2531 gene locus_tag LOCUS_11770 2836 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720458.1 protein_id gnl|my_center|LOCUS_11770 3300 2833 gene locus_tag LOCUS_11780 3300 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 3967 3320 gene locus_tag LOCUS_11790 gene puhB 3967 3320 CDS product photosynthetic complex putative assembly protein PuhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388374.1 protein_id gnl|my_center|LOCUS_11790 4734 3964 gene locus_tag LOCUS_11800 gene puhA 4734 3964 CDS product photosynthetic reaction center subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388375.1 protein_id gnl|my_center|LOCUS_11800 6154 4727 gene locus_tag LOCUS_11810 6154 4727 CDS product BCD family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388376.1 protein_id gnl|my_center|LOCUS_11810 >Feature sequence123 1041 2198 gene locus_tag LOCUS_11820 1041 2198 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923330.1 protein_id gnl|my_center|LOCUS_11820 3072 2218 gene locus_tag LOCUS_11830 3072 2218 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640188.1 protein_id gnl|my_center|LOCUS_11830 3430 3236 gene locus_tag LOCUS_11840 3430 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 3648 5081 gene locus_tag LOCUS_11850 3648 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 6653 5088 gene locus_tag LOCUS_11860 gene serA 6653 5088 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921048.1 protein_id gnl|my_center|LOCUS_11860 >Feature sequence124 <1 975 gene locus_tag LOCUS_11870 <1 975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918149.1:ribonucleotide-diphosphate reductase subunit beta 1083 1862 gene locus_tag LOCUS_11880 1083 1862 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920792.1 protein_id gnl|my_center|LOCUS_11880 2564 1878 gene locus_tag LOCUS_11890 2564 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 3094 2561 gene locus_tag LOCUS_11900 3094 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 3853 3134 gene locus_tag LOCUS_11910 3853 3134 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917928.1 protein_id gnl|my_center|LOCUS_11910 6652 4016 gene locus_tag LOCUS_11920 6652 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 >Feature sequence125 1640 423 gene locus_tag LOCUS_11930 1640 423 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085719.1 protein_id gnl|my_center|LOCUS_11930 4869 1630 gene locus_tag LOCUS_11940 4869 1630 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085718.1 protein_id gnl|my_center|LOCUS_11940 5814 6239 gene locus_tag LOCUS_11950 5814 6239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 >Feature sequence126 1383 250 gene locus_tag LOCUS_11960 1383 250 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923248.1 protein_id gnl|my_center|LOCUS_11960 1658 1410 gene locus_tag LOCUS_11970 1658 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 3367 1847 gene locus_tag LOCUS_11980 3367 1847 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145161935.1 protein_id gnl|my_center|LOCUS_11980 4395 3445 gene locus_tag LOCUS_11990 4395 3445 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258703.1 protein_id gnl|my_center|LOCUS_11990 5676 4435 gene locus_tag LOCUS_12000 gene kynU 5676 4435 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189663.1 protein_id gnl|my_center|LOCUS_12000 5970 6470 gene locus_tag LOCUS_12010 5970 6470 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918973.1 protein_id gnl|my_center|LOCUS_12010 >Feature sequence127 235 888 gene locus_tag LOCUS_12020 235 888 CDS product LptA/OstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923319.1 protein_id gnl|my_center|LOCUS_12020 917 1681 gene locus_tag LOCUS_12030 gene lptB 917 1681 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921427.1 protein_id gnl|my_center|LOCUS_12030 1742 2368 gene locus_tag LOCUS_12040 gene raiA 1742 2368 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921424.1 protein_id gnl|my_center|LOCUS_12040 2510 2971 gene locus_tag LOCUS_12050 gene ptsN 2510 2971 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921423.1 protein_id gnl|my_center|LOCUS_12050 3225 2983 gene locus_tag LOCUS_12060 3225 2983 CDS product DUF1150 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921422.1 protein_id gnl|my_center|LOCUS_12060 3728 3312 gene locus_tag LOCUS_12070 3728 3312 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923318.1 protein_id gnl|my_center|LOCUS_12070 4490 3912 gene locus_tag LOCUS_12080 4490 3912 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084272.1 protein_id gnl|my_center|LOCUS_12080 4672 4597 gene locus_tag LOCUS_t00180 4672 4597 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5243 4773 gene locus_tag LOCUS_12090 5243 4773 CDS product TIGR02300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265982.1 protein_id gnl|my_center|LOCUS_12090 >Feature sequence128 750 1775 gene locus_tag LOCUS_12100 750 1775 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978086.1 protein_id gnl|my_center|LOCUS_12100 1873 3015 gene locus_tag LOCUS_12110 1873 3015 CDS product TQO small subunit DoxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765036.1 protein_id gnl|my_center|LOCUS_12110 6363 3064 gene locus_tag LOCUS_12120 gene carB 6363 3064 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920738.1 protein_id gnl|my_center|LOCUS_12120 >Feature sequence129 2245 605 gene locus_tag LOCUS_12130 2245 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 2391 4031 gene locus_tag LOCUS_12140 2391 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 4116 4370 gene locus_tag LOCUS_12150 4116 4370 CDS product Arc family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974671.1 protein_id gnl|my_center|LOCUS_12150 4367 4810 gene locus_tag LOCUS_12160 4367 4810 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160608.1 protein_id gnl|my_center|LOCUS_12160 5780 4917 gene locus_tag LOCUS_12170 5780 4917 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096857.1 protein_id gnl|my_center|LOCUS_12170 <6556 5924 gene locus_tag LOCUS_12180 <6556 5924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089011.1:alpha/beta hydrolase >Feature sequence130 1618 554 gene locus_tag LOCUS_12190 1618 554 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267493.1 protein_id gnl|my_center|LOCUS_12190 3000 1615 gene locus_tag LOCUS_12200 3000 1615 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146571912.1 protein_id gnl|my_center|LOCUS_12200 3152 3463 gene locus_tag LOCUS_12210 3152 3463 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921019.1 protein_id gnl|my_center|LOCUS_12210 3559 3984 gene locus_tag LOCUS_12220 3559 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 3999 4991 gene locus_tag LOCUS_12230 3999 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 5231 5139 gene locus_tag LOCUS_t00190 5231 5139 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5424 6014 gene locus_tag LOCUS_12240 5424 6014 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892027.1 protein_id gnl|my_center|LOCUS_12240 >Feature sequence131 <1 839 gene locus_tag LOCUS_12250 <1 839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919715.1:coniferyl aldehyde dehydrogenase 2488 857 gene locus_tag LOCUS_12260 2488 857 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919713.1 protein_id gnl|my_center|LOCUS_12260 3568 2588 gene locus_tag LOCUS_12270 3568 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 3714 5570 gene locus_tag LOCUS_12280 gene dnaG 3714 5570 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920885.1 protein_id gnl|my_center|LOCUS_12280 >Feature sequence132 1 822 gene locus_tag LOCUS_12290 1 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 1485 940 gene locus_tag LOCUS_12300 1485 940 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083737.1 protein_id gnl|my_center|LOCUS_12300 2978 1482 gene locus_tag LOCUS_12310 2978 1482 CDS product DNA-3-methyladenine glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391104.1 protein_id gnl|my_center|LOCUS_12310 4115 3054 gene locus_tag LOCUS_12320 4115 3054 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921105.1 protein_id gnl|my_center|LOCUS_12320 4946 4149 gene locus_tag LOCUS_12330 4946 4149 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640711.1 protein_id gnl|my_center|LOCUS_12330 5735 5046 gene locus_tag LOCUS_12340 gene thiE 5735 5046 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921097.1 protein_id gnl|my_center|LOCUS_12340 <6486 5708 gene locus_tag LOCUS_12350 <6486 5708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098401.1:MFS transporter >Feature sequence133 1432 647 gene locus_tag LOCUS_12360 1432 647 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113379.1 protein_id gnl|my_center|LOCUS_12360 2979 1588 gene locus_tag LOCUS_12370 gene ahcY 2979 1588 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918146.1 protein_id gnl|my_center|LOCUS_12370 3365 3093 gene locus_tag LOCUS_12380 3365 3093 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918130.1 protein_id gnl|my_center|LOCUS_12380 3766 3362 gene locus_tag LOCUS_12390 3766 3362 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639920.1 protein_id gnl|my_center|LOCUS_12390 4327 3854 gene locus_tag LOCUS_12400 4327 3854 CDS product HPr kinase/phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918128.1 protein_id gnl|my_center|LOCUS_12400 5886 4333 gene locus_tag LOCUS_12410 5886 4333 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918127.1 protein_id gnl|my_center|LOCUS_12410 6337 5948 gene locus_tag LOCUS_12420 6337 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 >Feature sequence134 301 1173 gene locus_tag LOCUS_12430 301 1173 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921486.1 protein_id gnl|my_center|LOCUS_12430 1170 1688 gene locus_tag LOCUS_12440 1170 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 1744 2706 gene locus_tag LOCUS_12450 gene mdh 1744 2706 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921482.1 protein_id gnl|my_center|LOCUS_12450 2857 6216 gene locus_tag LOCUS_12460 2857 6216 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414323.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence135 1853 21 gene locus_tag LOCUS_12470 1853 21 CDS product feruloyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918279.1 protein_id gnl|my_center|LOCUS_12470 3184 1850 gene locus_tag LOCUS_12480 3184 1850 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918276.1 protein_id gnl|my_center|LOCUS_12480 4199 3189 gene locus_tag LOCUS_12490 4199 3189 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918274.1 protein_id gnl|my_center|LOCUS_12490 3622 3547 gene locus_tag LOCUS_t00200 3622 3547 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4271 5104 gene locus_tag LOCUS_12500 4271 5104 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918273.1 protein_id gnl|my_center|LOCUS_12500 6166 5093 gene locus_tag LOCUS_12510 6166 5093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 >Feature sequence136 668 1444 gene locus_tag LOCUS_12520 gene dapB 668 1444 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532457.1 protein_id gnl|my_center|LOCUS_12520 1989 1534 gene locus_tag LOCUS_12530 gene dut 1989 1534 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083581.1 protein_id gnl|my_center|LOCUS_12530 3230 1986 gene locus_tag LOCUS_12540 gene coaBC 3230 1986 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923348.1 protein_id gnl|my_center|LOCUS_12540 3320 3856 gene locus_tag LOCUS_12550 3320 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923347.1 protein_id gnl|my_center|LOCUS_12550 5312 3876 gene locus_tag LOCUS_12560 gene ubiB 5312 3876 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921536.1 protein_id gnl|my_center|LOCUS_12560 6077 5319 gene locus_tag LOCUS_12570 6077 5319 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921535.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence137 619 1503 gene locus_tag LOCUS_12580 619 1503 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918831.1 protein_id gnl|my_center|LOCUS_12580 1712 2128 gene locus_tag LOCUS_12590 1712 2128 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640101.1 protein_id gnl|my_center|LOCUS_12590 2699 2250 gene locus_tag LOCUS_12600 2699 2250 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918945.1 protein_id gnl|my_center|LOCUS_12600 3271 2750 gene locus_tag LOCUS_12610 3271 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 3741 3268 gene locus_tag LOCUS_12620 3741 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 4911 3805 gene locus_tag LOCUS_12630 4911 3805 CDS product beta-eliminating lyase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478461.1 protein_id gnl|my_center|LOCUS_12630 5665 4964 gene locus_tag LOCUS_12640 5665 4964 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640281.1 protein_id gnl|my_center|LOCUS_12640 <6307 5662 gene locus_tag LOCUS_12650 <6307 5662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919468.1:sensor histidine kinase KdpD >Feature sequence138 531 109 gene locus_tag LOCUS_12660 531 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 1367 699 gene locus_tag LOCUS_12670 1367 699 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921260.1 protein_id gnl|my_center|LOCUS_12670 2503 1364 gene locus_tag LOCUS_12680 gene proB 2503 1364 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918203.1 protein_id gnl|my_center|LOCUS_12680 3528 2491 gene locus_tag LOCUS_12690 gene obgE 3528 2491 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918204.1 protein_id gnl|my_center|LOCUS_12690 4294 3620 gene locus_tag LOCUS_12700 gene trmB 4294 3620 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639863.1 protein_id gnl|my_center|LOCUS_12700 5892 4291 gene locus_tag LOCUS_12710 gene lnt 5892 4291 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917942.1 protein_id gnl|my_center|LOCUS_12710 >Feature sequence139 <1 1315 gene locus_tag LOCUS_12720 <1 1315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083435016.1:solute:sodium symporter family transporter 1925 1296 gene locus_tag LOCUS_12730 1925 1296 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918669.1 protein_id gnl|my_center|LOCUS_12730 2821 1922 gene locus_tag LOCUS_12740 2821 1922 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704306.1 protein_id gnl|my_center|LOCUS_12740 3587 2838 gene locus_tag LOCUS_12750 3587 2838 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201787933.1 protein_id gnl|my_center|LOCUS_12750 5311 3587 gene locus_tag LOCUS_12760 5311 3587 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974638.1 protein_id gnl|my_center|LOCUS_12760 <6246 5332 gene locus_tag LOCUS_12770 <6246 5332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080133.1:beta-galactosidase >Feature sequence140 <1 565 gene locus_tag LOCUS_12780 <1 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061805.1:glutathione S-transferase family protein 1342 581 gene locus_tag LOCUS_12790 1342 581 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966801.1 protein_id gnl|my_center|LOCUS_12790 1358 2371 gene locus_tag LOCUS_12800 1358 2371 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530651.1 protein_id gnl|my_center|LOCUS_12800 2494 3525 gene locus_tag LOCUS_12810 2494 3525 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339018.1 protein_id gnl|my_center|LOCUS_12810 3601 5328 gene locus_tag LOCUS_12820 3601 5328 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167528371.1 protein_id gnl|my_center|LOCUS_12820 5394 5759 gene locus_tag LOCUS_12830 5394 5759 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311774.1 protein_id gnl|my_center|LOCUS_12830 >Feature sequence141 328 1026 gene locus_tag LOCUS_12840 328 1026 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920768.1 protein_id gnl|my_center|LOCUS_12840 1023 2393 gene locus_tag LOCUS_12850 1023 2393 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920769.1 protein_id gnl|my_center|LOCUS_12850 3390 2416 gene locus_tag LOCUS_12860 3390 2416 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923246.1 protein_id gnl|my_center|LOCUS_12860 3628 3858 gene locus_tag LOCUS_12870 3628 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 3840 4505 gene locus_tag LOCUS_12880 3840 4505 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918195.1 protein_id gnl|my_center|LOCUS_12880 4731 4492 gene locus_tag LOCUS_12890 4731 4492 CDS product DUF4170 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639934.1 protein_id gnl|my_center|LOCUS_12890 6005 4743 gene locus_tag LOCUS_12900 6005 4743 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918198.1 protein_id gnl|my_center|LOCUS_12900 5892 6146 gene locus_tag LOCUS_12910 5892 6146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 >Feature sequence142 <1 963 gene locus_tag LOCUS_12920 <1 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918560.1:DUF3089 domain-containing protein 960 1898 gene locus_tag LOCUS_12930 960 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 1918 3351 gene locus_tag LOCUS_12940 1918 3351 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705057.1 protein_id gnl|my_center|LOCUS_12940 4333 3377 gene locus_tag LOCUS_12950 4333 3377 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920085.1 protein_id gnl|my_center|LOCUS_12950 5463 4330 gene locus_tag LOCUS_12960 gene hisC 5463 4330 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640441.1 protein_id gnl|my_center|LOCUS_12960 <6181 5660 gene locus_tag LOCUS_12970 <6181 5660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920082.1:DUF2125 domain-containing protein >Feature sequence143 1770 3494 gene locus_tag LOCUS_12980 1770 3494 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389978.1 protein_id gnl|my_center|LOCUS_12980 4523 3573 gene locus_tag LOCUS_12990 4523 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 5337 4600 gene locus_tag LOCUS_13000 5337 4600 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920676.1 protein_id gnl|my_center|LOCUS_13000 5520 6002 gene locus_tag LOCUS_13010 5520 6002 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087264.1 protein_id gnl|my_center|LOCUS_13010 6177 6010 gene locus_tag LOCUS_13020 6177 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 >Feature sequence144 1022 345 gene locus_tag LOCUS_13030 1022 345 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_13030 2299 1019 gene locus_tag LOCUS_13040 2299 1019 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265494.1 protein_id gnl|my_center|LOCUS_13040 3632 2412 gene locus_tag LOCUS_13050 3632 2412 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921453.1 protein_id gnl|my_center|LOCUS_13050 3762 4448 gene locus_tag LOCUS_13060 3762 4448 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921316.1 protein_id gnl|my_center|LOCUS_13060 4473 5735 gene locus_tag LOCUS_13070 4473 5735 CDS product PqiA/YebS family transporter subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820402.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence145 1082 675 gene locus_tag LOCUS_13080 1082 675 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975642.1 protein_id gnl|my_center|LOCUS_13080 1314 1075 gene locus_tag LOCUS_13090 1314 1075 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081467701.1 protein_id gnl|my_center|LOCUS_13090 1578 2177 gene locus_tag LOCUS_13100 1578 2177 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957729.1 protein_id gnl|my_center|LOCUS_13100 2159 2803 gene locus_tag LOCUS_13110 2159 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 4416 2800 gene locus_tag LOCUS_13120 gene purH 4416 2800 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917975.1 protein_id gnl|my_center|LOCUS_13120 4785 5069 gene locus_tag LOCUS_13130 4785 5069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 <6131 5589 gene locus_tag LOCUS_13140 <6131 5589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010917991.1:RsmB/NOP family class I SAM-dependent RNA methyltransferase >Feature sequence146 2301 1435 gene locus_tag LOCUS_13150 2301 1435 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388246.1 protein_id gnl|my_center|LOCUS_13150 4075 2303 gene locus_tag LOCUS_13160 4075 2303 CDS product magnesium chelatase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388245.1 protein_id gnl|my_center|LOCUS_13160 5103 4072 gene locus_tag LOCUS_13170 gene bchI 5103 4072 CDS product magnesium chelatase ATPase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625950.1 protein_id gnl|my_center|LOCUS_13170 5434 5150 gene locus_tag LOCUS_13180 5434 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 <6077 5448 gene locus_tag LOCUS_13190 <6077 5448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388387.1:geranylgeranyl diphosphate reductase >Feature sequence147 757 1149 gene locus_tag LOCUS_13200 757 1149 CDS product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639910.1 protein_id gnl|my_center|LOCUS_13200 2173 1361 gene locus_tag LOCUS_13210 2173 1361 CDS product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639909.1 protein_id gnl|my_center|LOCUS_13210 3098 2340 gene locus_tag LOCUS_13220 3098 2340 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640673.1 protein_id gnl|my_center|LOCUS_13220 4138 3095 gene locus_tag LOCUS_13230 4138 3095 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920970.1 protein_id gnl|my_center|LOCUS_13230 4953 4135 gene locus_tag LOCUS_13240 4953 4135 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640674.1 protein_id gnl|my_center|LOCUS_13240 5864 4950 gene locus_tag LOCUS_13250 5864 4950 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265910.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence148 638 1033 gene locus_tag LOCUS_13260 638 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266004.1 protein_id gnl|my_center|LOCUS_13260 1119 1403 gene locus_tag LOCUS_13270 1119 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 1670 2377 gene locus_tag LOCUS_13280 1670 2377 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921572.1 protein_id gnl|my_center|LOCUS_13280 2514 3215 gene locus_tag LOCUS_13290 2514 3215 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721035.1 protein_id gnl|my_center|LOCUS_13290 4027 3224 gene locus_tag LOCUS_13300 4027 3224 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921533.1 protein_id gnl|my_center|LOCUS_13300 4671 4060 gene locus_tag LOCUS_13310 4671 4060 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921532.1 protein_id gnl|my_center|LOCUS_13310 <6043 4722 gene locus_tag LOCUS_13320 <6043 4722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015923345.1:DNA translocase FtsK 4TM domain-containing protein >Feature sequence149 156 887 gene locus_tag LOCUS_13330 156 887 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919802.1 protein_id gnl|my_center|LOCUS_13330 2472 898 gene locus_tag LOCUS_13340 2472 898 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105432.1 protein_id gnl|my_center|LOCUS_13340 2617 3447 gene locus_tag LOCUS_13350 2617 3447 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919801.1 protein_id gnl|my_center|LOCUS_13350 3444 5132 gene locus_tag LOCUS_13360 3444 5132 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919800.1 protein_id gnl|my_center|LOCUS_13360 5162 5599 gene locus_tag LOCUS_13370 gene mce 5162 5599 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919799.1 protein_id gnl|my_center|LOCUS_13370 5596 5862 gene locus_tag LOCUS_13380 5596 5862 CDS product DUF1467 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919798.1 protein_id gnl|my_center|LOCUS_13380 >Feature sequence150 <1 802 gene locus_tag LOCUS_13390 <1 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920883.1:RNA polymerase sigma factor RpoD 890 3082 gene locus_tag LOCUS_13400 890 3082 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532683.1 protein_id gnl|my_center|LOCUS_13400 3471 3259 gene locus_tag LOCUS_13410 3471 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 3355 4275 gene locus_tag LOCUS_13420 3355 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 5524 4280 gene locus_tag LOCUS_13430 5524 4280 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728774.1 protein_id gnl|my_center|LOCUS_13430 >Feature sequence151 1155 427 gene locus_tag LOCUS_13440 1155 427 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921365.1 protein_id gnl|my_center|LOCUS_13440 2243 1152 gene locus_tag LOCUS_13450 2243 1152 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921364.1 protein_id gnl|my_center|LOCUS_13450 2748 2233 gene locus_tag LOCUS_13460 gene tsaE 2748 2233 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921363.1 protein_id gnl|my_center|LOCUS_13460 2821 3942 gene locus_tag LOCUS_13470 gene zapE 2821 3942 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921360.1 protein_id gnl|my_center|LOCUS_13470 4121 4528 gene locus_tag LOCUS_13480 gene sdhC 4121 4528 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921358.1 protein_id gnl|my_center|LOCUS_13480 4534 4923 gene locus_tag LOCUS_13490 gene sdhD 4534 4923 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923304.1 protein_id gnl|my_center|LOCUS_13490 >Feature sequence152 3 353 gene locus_tag LOCUS_13500 3 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 1508 438 gene locus_tag LOCUS_13510 1508 438 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639875.1 protein_id gnl|my_center|LOCUS_13510 2428 1550 gene locus_tag LOCUS_13520 2428 1550 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967074.1 protein_id gnl|my_center|LOCUS_13520 2605 4899 gene locus_tag LOCUS_13530 2605 4899 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265516.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence153 3185 585 gene locus_tag LOCUS_13540 3185 585 CDS product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171190.1 protein_id gnl|my_center|LOCUS_13540 3303 3830 gene locus_tag LOCUS_13550 3303 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 >Feature sequence154 1972 1019 gene locus_tag LOCUS_13560 1972 1019 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083933.1 protein_id gnl|my_center|LOCUS_13560 3515 2106 gene locus_tag LOCUS_13570 3515 2106 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920944.1 protein_id gnl|my_center|LOCUS_13570 4036 3557 gene locus_tag LOCUS_13580 4036 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 4800 4069 gene locus_tag LOCUS_13590 4800 4069 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140602.1 protein_id gnl|my_center|LOCUS_13590 <5929 4805 gene locus_tag LOCUS_13600 <5929 4805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141163.1:GMC family oxidoreductase >Feature sequence155 1405 521 gene locus_tag LOCUS_13610 gene rpsB 1405 521 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919789.1 protein_id gnl|my_center|LOCUS_13610 5026 1601 gene locus_tag LOCUS_13620 gene dnaE 5026 1601 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919792.1 protein_id gnl|my_center|LOCUS_13620 5479 5219 gene locus_tag LOCUS_13630 5479 5219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13630 >Feature sequence156 2 1612 gene locus_tag LOCUS_13640 2 1612 CDS product S10 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921247.1 protein_id gnl|my_center|LOCUS_13640 3204 1546 gene locus_tag LOCUS_13650 3204 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 3868 3269 gene locus_tag LOCUS_13660 gene wrbA 3868 3269 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918676.1 protein_id gnl|my_center|LOCUS_13660 4035 4907 gene locus_tag LOCUS_13670 4035 4907 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173512409.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence157 385 930 gene locus_tag LOCUS_13680 385 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 1378 1109 gene locus_tag LOCUS_13690 1378 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 2901 2509 gene locus_tag LOCUS_13700 2901 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 3853 2903 gene locus_tag LOCUS_13710 3853 2903 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088722.1 protein_id gnl|my_center|LOCUS_13710 4973 3903 gene locus_tag LOCUS_13720 4973 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 <5831 4991 gene locus_tag LOCUS_13730 <5831 4991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009956704.1:SLBB domain-containing protein >Feature sequence158 476 228 gene locus_tag LOCUS_13740 476 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 903 466 gene locus_tag LOCUS_13750 903 466 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072164.1 protein_id gnl|my_center|LOCUS_13750 902 1039 gene locus_tag LOCUS_13760 902 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 3389 1104 gene locus_tag LOCUS_13770 3389 1104 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265961.1 protein_id gnl|my_center|LOCUS_13770 4566 3547 gene locus_tag LOCUS_13780 4566 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 5191 4667 gene locus_tag LOCUS_13790 5191 4667 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388638.1 protein_id gnl|my_center|LOCUS_13790 5576 5184 gene locus_tag LOCUS_13800 5576 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 >Feature sequence159 <1 747 gene locus_tag LOCUS_13810 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037397626.1:DUF72 domain-containing protein 815 1714 gene locus_tag LOCUS_13820 815 1714 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085733.1 protein_id gnl|my_center|LOCUS_13820 2242 1724 gene locus_tag LOCUS_13830 2242 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 2376 3041 gene locus_tag LOCUS_13840 2376 3041 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265622.1 protein_id gnl|my_center|LOCUS_13840 3050 4033 gene locus_tag LOCUS_13850 3050 4033 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640058.1 protein_id gnl|my_center|LOCUS_13850 4499 4041 gene locus_tag LOCUS_13860 4499 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 >Feature sequence160 <1 1202 gene locus_tag LOCUS_13870 <1 1202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918829.1:choline dehydrogenase 1202 2752 gene locus_tag LOCUS_13880 1202 2752 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918828.1 protein_id gnl|my_center|LOCUS_13880 2778 3227 gene locus_tag LOCUS_13890 2778 3227 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918826.1 protein_id gnl|my_center|LOCUS_13890 3888 3259 gene locus_tag LOCUS_13900 3888 3259 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918344.1 protein_id gnl|my_center|LOCUS_13900 4558 3917 gene locus_tag LOCUS_13910 4558 3917 CDS product NrsF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126828495.1 protein_id gnl|my_center|LOCUS_13910 5108 4548 gene locus_tag LOCUS_13920 5108 4548 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168301328.1 protein_id gnl|my_center|LOCUS_13920 5354 5659 gene locus_tag LOCUS_13930 5354 5659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 >Feature sequence161 1009 3105 gene locus_tag LOCUS_13940 1009 3105 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791176.1 protein_id gnl|my_center|LOCUS_13940 4968 3112 gene locus_tag LOCUS_13950 gene recQ 4968 3112 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921294.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence162 3086 1557 gene locus_tag LOCUS_13960 3086 1557 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808082.1 protein_id gnl|my_center|LOCUS_13960 4203 3091 gene locus_tag LOCUS_13970 4203 3091 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528745.1 protein_id gnl|my_center|LOCUS_13970 4326 4751 gene locus_tag LOCUS_13980 4326 4751 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438075.1 protein_id gnl|my_center|LOCUS_13980 4816 5625 gene locus_tag LOCUS_13990 4816 5625 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971976.1 protein_id gnl|my_center|LOCUS_13990 >Feature sequence163 93 548 gene locus_tag LOCUS_14000 93 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 1195 674 gene locus_tag LOCUS_14010 1195 674 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920882.1 protein_id gnl|my_center|LOCUS_14010 2202 1192 gene locus_tag LOCUS_14020 gene pip 2202 1192 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640184.1 protein_id gnl|my_center|LOCUS_14020 2615 3721 gene locus_tag LOCUS_14030 2615 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 4244 3861 gene locus_tag LOCUS_14040 4244 3861 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919113.1 protein_id gnl|my_center|LOCUS_14040 4315 5541 gene locus_tag LOCUS_14050 4315 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919114.1 protein_id gnl|my_center|LOCUS_14050 >Feature sequence164 365 727 gene locus_tag LOCUS_14060 365 727 CDS product DUF2849 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640151.1 protein_id gnl|my_center|LOCUS_14060 741 2417 gene locus_tag LOCUS_14070 741 2417 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919003.1 protein_id gnl|my_center|LOCUS_14070 2395 2913 gene locus_tag LOCUS_14080 2395 2913 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919004.1 protein_id gnl|my_center|LOCUS_14080 2840 3655 gene locus_tag LOCUS_14090 2840 3655 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919005.1 protein_id gnl|my_center|LOCUS_14090 3723 4541 gene locus_tag LOCUS_14100 3723 4541 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191307.1 protein_id gnl|my_center|LOCUS_14100 5611 4568 gene locus_tag LOCUS_14110 5611 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 >Feature sequence165 103 852 gene locus_tag LOCUS_14120 103 852 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918613.1 protein_id gnl|my_center|LOCUS_14120 855 1799 gene locus_tag LOCUS_14130 855 1799 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918612.1 protein_id gnl|my_center|LOCUS_14130 1916 2797 gene locus_tag LOCUS_14140 1916 2797 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918601.1 protein_id gnl|my_center|LOCUS_14140 2812 3696 gene locus_tag LOCUS_14150 2812 3696 CDS product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265598.1 protein_id gnl|my_center|LOCUS_14150 3760 4185 gene locus_tag LOCUS_14160 3760 4185 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265597.1 protein_id gnl|my_center|LOCUS_14160 4193 5125 gene locus_tag LOCUS_14170 4193 5125 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918589.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence166 3089 1656 gene locus_tag LOCUS_14180 gene nuoN 3089 1656 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640367.1 protein_id gnl|my_center|LOCUS_14180 4581 3097 gene locus_tag LOCUS_14190 4581 3097 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640368.1 protein_id gnl|my_center|LOCUS_14190 <5628 4578 gene locus_tag LOCUS_14200 <5628 4578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919805.1:NADH-quinone oxidoreductase subunit L >Feature sequence167 633 1109 gene locus_tag LOCUS_14210 633 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 1826 1170 gene locus_tag LOCUS_14220 1826 1170 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998217.1 protein_id gnl|my_center|LOCUS_14220 2586 2203 gene locus_tag LOCUS_14230 2586 2203 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010015189.1 protein_id gnl|my_center|LOCUS_14230 2970 2881 gene locus_tag LOCUS_t00210 2970 2881 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3126 4214 gene locus_tag LOCUS_14240 3126 4214 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640340.1 protein_id gnl|my_center|LOCUS_14240 4294 4938 gene locus_tag LOCUS_14250 gene tmk 4294 4938 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919690.1 protein_id gnl|my_center|LOCUS_14250 >Feature sequence168 <1 568 gene locus_tag LOCUS_14260 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338519.1:serine hydroxymethyltransferase 806 1081 gene locus_tag LOCUS_14270 806 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 1108 1533 gene locus_tag LOCUS_14280 gene nusB 1108 1533 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919237.1 protein_id gnl|my_center|LOCUS_14280 1517 2500 gene locus_tag LOCUS_14290 gene thiL 1517 2500 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919238.1 protein_id gnl|my_center|LOCUS_14290 2693 4834 gene locus_tag LOCUS_14300 2693 4834 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919240.1 protein_id gnl|my_center|LOCUS_14300 >Feature sequence169 491 1921 gene locus_tag LOCUS_14310 491 1921 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919742.1 protein_id gnl|my_center|LOCUS_14310 1997 4393 gene locus_tag LOCUS_14320 1997 4393 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640352.1 protein_id gnl|my_center|LOCUS_14320 4751 4572 gene locus_tag LOCUS_14330 4751 4572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 >Feature sequence170 1740 277 gene locus_tag LOCUS_14340 gene guaB 1740 277 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919491.1 protein_id gnl|my_center|LOCUS_14340 2171 2395 gene locus_tag LOCUS_14350 2171 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 2379 3545 gene locus_tag LOCUS_14360 2379 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 3973 3500 gene locus_tag LOCUS_14370 3973 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14370 5320 4214 gene locus_tag LOCUS_14380 5320 4214 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265726.1 protein_id gnl|my_center|LOCUS_14380 >Feature sequence171 <1 2020 gene locus_tag LOCUS_14390 <1 2020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919402.1:UvrD-helicase domain-containing protein 2296 2087 gene locus_tag LOCUS_14400 2296 2087 CDS product DUF3126 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640547.1 protein_id gnl|my_center|LOCUS_14400 3108 2362 gene locus_tag LOCUS_14410 gene cysE 3108 2362 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920503.1 protein_id gnl|my_center|LOCUS_14410 3342 3956 gene locus_tag LOCUS_14420 3342 3956 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640549.1 protein_id gnl|my_center|LOCUS_14420 4413 3961 gene locus_tag LOCUS_14430 gene queF 4413 3961 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920506.1 protein_id gnl|my_center|LOCUS_14430 4506 5309 gene locus_tag LOCUS_14440 4506 5309 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640550.1 protein_id gnl|my_center|LOCUS_14440 >Feature sequence172 <1 710 gene locus_tag LOCUS_14450 <1 710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265494.1:cytochrome P450 818 1906 gene locus_tag LOCUS_14460 818 1906 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195328.1 protein_id gnl|my_center|LOCUS_14460 1941 2867 gene locus_tag LOCUS_14470 1941 2867 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092916.1 protein_id gnl|my_center|LOCUS_14470 2989 4509 gene locus_tag LOCUS_14480 2989 4509 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640065.1 protein_id gnl|my_center|LOCUS_14480 5373 4516 gene locus_tag LOCUS_14490 5373 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 >Feature sequence173 1672 662 gene locus_tag LOCUS_14500 1672 662 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919302.1 protein_id gnl|my_center|LOCUS_14500 2951 1716 gene locus_tag LOCUS_14510 2951 1716 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640238.1 protein_id gnl|my_center|LOCUS_14510 4375 2948 gene locus_tag LOCUS_14520 4375 2948 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919304.1 protein_id gnl|my_center|LOCUS_14520 4470 5336 gene locus_tag LOCUS_14530 gene kdsA 4470 5336 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919305.1 protein_id gnl|my_center|LOCUS_14530 >Feature sequence174 <1 797 gene locus_tag LOCUS_14540 <1 797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920774.1:M17 family metallopeptidase 794 1648 gene locus_tag LOCUS_14550 794 1648 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920773.1 protein_id gnl|my_center|LOCUS_14550 2629 1640 gene locus_tag LOCUS_14560 2629 1640 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920941.1 protein_id gnl|my_center|LOCUS_14560 3054 2626 gene locus_tag LOCUS_14570 3054 2626 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894320.1 protein_id gnl|my_center|LOCUS_14570 3181 4395 gene locus_tag LOCUS_14580 3181 4395 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230672.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence175 3195 2530 gene locus_tag LOCUS_14590 3195 2530 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259454.1 protein_id gnl|my_center|LOCUS_14590 4288 3281 gene locus_tag LOCUS_14600 4288 3281 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920230.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence176 196 942 gene locus_tag LOCUS_14610 196 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 1424 1113 gene locus_tag LOCUS_14620 1424 1113 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131963.1 protein_id gnl|my_center|LOCUS_14620 3596 2658 gene locus_tag LOCUS_14630 3596 2658 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090177.1 protein_id gnl|my_center|LOCUS_14630 3478 4086 gene locus_tag LOCUS_14640 3478 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 <5455 4092 gene locus_tag LOCUS_14650 <5455 4092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529040.1:mannitol dehydrogenase family protein >Feature sequence177 <1 2426 gene locus_tag LOCUS_14660 <1 2426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085816.1:CusA/CzcA family heavy metal efflux RND transporter 2754 2680 gene locus_tag LOCUS_t00220 2754 2680 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2776 3018 gene locus_tag LOCUS_14670 2776 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 3095 4366 gene locus_tag LOCUS_14680 gene murA 3095 4366 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920208.1 protein_id gnl|my_center|LOCUS_14680 4380 4841 gene locus_tag LOCUS_14690 4380 4841 CDS product DUF2948 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265795.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence178 812 1639 gene locus_tag LOCUS_14700 812 1639 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085734.1 protein_id gnl|my_center|LOCUS_14700 2988 1675 gene locus_tag LOCUS_14710 2988 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 3667 3089 gene locus_tag LOCUS_14720 3667 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875281.1 protein_id gnl|my_center|LOCUS_14720 3722 4918 gene locus_tag LOCUS_14730 3722 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 >Feature sequence179 1562 714 gene locus_tag LOCUS_14740 1562 714 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921580.1 protein_id gnl|my_center|LOCUS_14740 2196 1549 gene locus_tag LOCUS_14750 gene rsmG 2196 1549 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923358.1 protein_id gnl|my_center|LOCUS_14750 4075 2174 gene locus_tag LOCUS_14760 gene mnmG 4075 2174 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266007.1 protein_id gnl|my_center|LOCUS_14760 <5410 4128 gene locus_tag LOCUS_14770 <5410 4128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015923359.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE >Feature sequence180 3038 462 gene locus_tag LOCUS_14780 gene clpB 3038 462 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918763.1 protein_id gnl|my_center|LOCUS_14780 4292 3234 gene locus_tag LOCUS_14790 4292 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 <5382 4560 gene locus_tag LOCUS_14800 <5382 4560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640077.1:peptide chain release factor N(5)-glutamine methyltransferase >Feature sequence181 3200 99 gene locus_tag LOCUS_14810 3200 99 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036532.1 protein_id gnl|my_center|LOCUS_14810 4180 3512 gene locus_tag LOCUS_14820 4180 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 4400 5308 gene locus_tag LOCUS_14830 gene miaA 4400 5308 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265761.1 protein_id gnl|my_center|LOCUS_14830 >Feature sequence182 <1 1772 gene locus_tag LOCUS_14840 <1 1772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089915.1:hydantoinase/oxoprolinase family protein 1769 3385 gene locus_tag LOCUS_14850 1769 3385 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089914.1 protein_id gnl|my_center|LOCUS_14850 4856 3390 gene locus_tag LOCUS_14860 4856 3390 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204730.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14860 <5375 4869 gene locus_tag LOCUS_14870 <5375 4869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001210089.1:multidrug efflux RND transporter permease subunit MdtC >Feature sequence183 <1 737 gene locus_tag LOCUS_14880 <1 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039220.1:tetracycline resistance MFS efflux pump 2228 774 gene locus_tag LOCUS_14890 2228 774 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110175.1 protein_id gnl|my_center|LOCUS_14890 2342 3457 gene locus_tag LOCUS_14900 2342 3457 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069456661.1 protein_id gnl|my_center|LOCUS_14900 3485 5293 gene locus_tag LOCUS_14910 3485 5293 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920412.1 protein_id gnl|my_center|LOCUS_14910 >Feature sequence184 1032 3077 gene locus_tag LOCUS_14920 1032 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 >Feature sequence185 1101 1328 gene locus_tag LOCUS_14930 gene rpmE 1101 1328 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004616338.1 protein_id gnl|my_center|LOCUS_14930 1444 3249 gene locus_tag LOCUS_14940 1444 3249 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918194.1 protein_id gnl|my_center|LOCUS_14940 3246 5186 gene locus_tag LOCUS_14950 3246 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 >Feature sequence186 <1 2000 gene locus_tag LOCUS_14960 <1 2000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088515.1:efflux RND transporter permease subunit 1993 2418 gene locus_tag LOCUS_14970 1993 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 3263 2355 gene locus_tag LOCUS_14980 3263 2355 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971057.1 protein_id gnl|my_center|LOCUS_14980 3346 4452 gene locus_tag LOCUS_14990 3346 4452 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085973.1 protein_id gnl|my_center|LOCUS_14990 >Feature sequence187 <1 737 gene locus_tag LOCUS_15000 <1 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640168.1:MBL fold metallo-hydrolase 771 1799 gene locus_tag LOCUS_15010 771 1799 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640427.1 protein_id gnl|my_center|LOCUS_15010 2000 2749 gene locus_tag LOCUS_15020 2000 2749 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090610.1 protein_id gnl|my_center|LOCUS_15020 2772 3404 gene locus_tag LOCUS_15030 2772 3404 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920406.1 protein_id gnl|my_center|LOCUS_15030 4047 3565 gene locus_tag LOCUS_15040 4047 3565 CDS product type II toxin-antitoxin system YhaV family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037275395.1 protein_id gnl|my_center|LOCUS_15040 4550 4047 gene locus_tag LOCUS_15050 4550 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 4804 5166 gene locus_tag LOCUS_15060 4804 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 >Feature sequence188 <1 943 gene locus_tag LOCUS_15070 <1 943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920413.1:UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase 940 2106 gene locus_tag LOCUS_15080 gene ftsW 940 2106 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920409.1 protein_id gnl|my_center|LOCUS_15080 2118 3197 gene locus_tag LOCUS_15090 gene murG 2118 3197 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920408.1 protein_id gnl|my_center|LOCUS_15090 >Feature sequence189 <1 980 gene locus_tag LOCUS_15100 <1 980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919191.1:ABC transporter ATP-binding protein/permease 1010 1450 gene locus_tag LOCUS_15110 gene gloA 1010 1450 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531328.1 protein_id gnl|my_center|LOCUS_15110 2365 1457 gene locus_tag LOCUS_15120 2365 1457 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265936.1 protein_id gnl|my_center|LOCUS_15120 2582 2379 gene locus_tag LOCUS_15130 2582 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 2659 3390 gene locus_tag LOCUS_15140 2659 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 <5093 3404 gene locus_tag LOCUS_15150 <5093 3404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640065.1:carboxylesterase/lipase family protein >Feature sequence190 <1 1137 gene locus_tag LOCUS_15160 <1 1137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640395.1:bifunctional lysylphosphatidylglycerol flippase/synthetase MprF 1137 2063 gene locus_tag LOCUS_15170 1137 2063 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173642.1 protein_id gnl|my_center|LOCUS_15170 4703 2100 gene locus_tag LOCUS_15180 gene pepN 4703 2100 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920339.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence191 1564 299 gene locus_tag LOCUS_15190 1564 299 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919203.1 protein_id gnl|my_center|LOCUS_15190 3374 1620 gene locus_tag LOCUS_15200 3374 1620 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_15200 3530 3895 gene locus_tag LOCUS_15210 3530 3895 CDS product STAS/SEC14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021993.1 protein_id gnl|my_center|LOCUS_15210 <5087 3892 gene locus_tag LOCUS_15220 <5087 3892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919197.1:valine--tRNA ligase >Feature sequence192 17 1504 gene locus_tag LOCUS_15230 gene purF 17 1504 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919531.1 protein_id gnl|my_center|LOCUS_15230 1501 2268 gene locus_tag LOCUS_15240 1501 2268 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919529.1 protein_id gnl|my_center|LOCUS_15240 3844 2213 gene locus_tag LOCUS_15250 gene der 3844 2213 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919527.1 protein_id gnl|my_center|LOCUS_15250 5006 3864 gene locus_tag LOCUS_15260 gene bamB 5006 3864 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261368.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence193 351 590 gene locus_tag LOCUS_15270 351 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1228 650 gene locus_tag LOCUS_15280 gene rplI 1228 650 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919540.1 protein_id gnl|my_center|LOCUS_15280 1502 1239 gene locus_tag LOCUS_15290 gene rpsR 1502 1239 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004615089.1 protein_id gnl|my_center|LOCUS_15290 1889 1527 gene locus_tag LOCUS_15300 gene rpsF 1889 1527 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919541.1 protein_id gnl|my_center|LOCUS_15300 1883 2068 gene locus_tag LOCUS_15310 1883 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 2748 2206 gene locus_tag LOCUS_15320 2748 2206 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521881.1 protein_id gnl|my_center|LOCUS_15320 3115 2816 gene locus_tag LOCUS_15330 3115 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 3038 3937 gene locus_tag LOCUS_15340 gene fabD 3038 3937 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919546.1 protein_id gnl|my_center|LOCUS_15340 3971 4711 gene locus_tag LOCUS_15350 gene fabG 3971 4711 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919547.1 protein_id gnl|my_center|LOCUS_15350 >Feature sequence194 <1 1468 gene locus_tag LOCUS_15360 <1 1468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920386.1:alanine--tRNA ligase 1509 1961 gene locus_tag LOCUS_15370 1509 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 3317 2103 gene locus_tag LOCUS_15380 3317 2103 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920379.1 protein_id gnl|my_center|LOCUS_15380 4582 3536 gene locus_tag LOCUS_15390 4582 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 >Feature sequence195 104 778 gene locus_tag LOCUS_15400 104 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 1403 801 gene locus_tag LOCUS_15410 1403 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 1548 3077 gene locus_tag LOCUS_15420 1548 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 3144 3677 gene locus_tag LOCUS_15430 3144 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 3819 4571 gene locus_tag LOCUS_15440 3819 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 4571 4942 gene locus_tag LOCUS_15450 4571 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 >Feature sequence196 <1 523 gene locus_tag LOCUS_15460 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037401354.1:SDR family oxidoreductase 1306 533 gene locus_tag LOCUS_15470 1306 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 2338 1463 gene locus_tag LOCUS_15480 2338 1463 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210976.1 protein_id gnl|my_center|LOCUS_15480 3801 2353 gene locus_tag LOCUS_15490 3801 2353 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331255.1 protein_id gnl|my_center|LOCUS_15490 4569 3844 gene locus_tag LOCUS_15500 4569 3844 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196014.1 protein_id gnl|my_center|LOCUS_15500 >Feature sequence197 587 1318 gene locus_tag LOCUS_15510 587 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 3759 1375 gene locus_tag LOCUS_15520 3759 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 <4984 4118 gene locus_tag LOCUS_15530 <4984 4118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104203.1:amidohydrolase family protein >Feature sequence198 731 507 gene locus_tag LOCUS_15540 731 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 615 1187 gene locus_tag LOCUS_15550 615 1187 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921224.1 protein_id gnl|my_center|LOCUS_15550 1811 1221 gene locus_tag LOCUS_15560 1811 1221 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921226.1 protein_id gnl|my_center|LOCUS_15560 3119 1851 gene locus_tag LOCUS_15570 3119 1851 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921227.1 protein_id gnl|my_center|LOCUS_15570 4507 3116 gene locus_tag LOCUS_15580 gene thrC 4507 3116 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921228.1 protein_id gnl|my_center|LOCUS_15580 >Feature sequence199 <1 1172 gene locus_tag LOCUS_15590 <1 1172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337543.1:acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha 1176 1586 gene locus_tag LOCUS_15600 1176 1586 CDS product DUF1489 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920028.1 protein_id gnl|my_center|LOCUS_15600 1827 3974 gene locus_tag LOCUS_15610 1827 3974 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529009.1 protein_id gnl|my_center|LOCUS_15610 <4940 3995 gene locus_tag LOCUS_15620 <4940 3995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920797.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA >Feature sequence200 1022 1945 gene locus_tag LOCUS_15630 1022 1945 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919881.1 protein_id gnl|my_center|LOCUS_15630 1964 2440 gene locus_tag LOCUS_15640 1964 2440 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389616.1 protein_id gnl|my_center|LOCUS_15640 3312 2437 gene locus_tag LOCUS_15650 gene rfbA 3312 2437 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857520.1 protein_id gnl|my_center|LOCUS_15650 4423 3326 gene locus_tag LOCUS_15660 gene rfbB 4423 3326 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870348.1 protein_id gnl|my_center|LOCUS_15660 4868 4434 gene locus_tag LOCUS_15670 4868 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15670 >Feature sequence201 476 1282 gene locus_tag LOCUS_15680 476 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 1284 1970 gene locus_tag LOCUS_15690 1284 1970 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406246.1 protein_id gnl|my_center|LOCUS_15690 2085 3638 gene locus_tag LOCUS_15700 2085 3638 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083171434.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence202 1270 482 gene locus_tag LOCUS_15710 gene radC 1270 482 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532006.1 protein_id gnl|my_center|LOCUS_15710 1437 2420 gene locus_tag LOCUS_15720 1437 2420 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087814.1 protein_id gnl|my_center|LOCUS_15720 3283 2465 gene locus_tag LOCUS_15730 gene map 3283 2465 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920527.1 protein_id gnl|my_center|LOCUS_15730 4038 3280 gene locus_tag LOCUS_15740 gene sfsA 4038 3280 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920525.1 protein_id gnl|my_center|LOCUS_15740 4441 4049 gene locus_tag LOCUS_15750 4441 4049 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209605909.1 protein_id gnl|my_center|LOCUS_15750 4698 4441 gene locus_tag LOCUS_15760 4698 4441 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533689.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence203 2493 814 gene locus_tag LOCUS_15770 gene ctaD 2493 814 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921235.1 protein_id gnl|my_center|LOCUS_15770 3375 2518 gene locus_tag LOCUS_15780 gene coxB 3375 2518 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921236.1 protein_id gnl|my_center|LOCUS_15780 >Feature sequence204 1149 340 gene locus_tag LOCUS_15790 1149 340 CDS product ImuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640700.1 protein_id gnl|my_center|LOCUS_15790 1843 1217 gene locus_tag LOCUS_15800 1843 1217 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929057.1 protein_id gnl|my_center|LOCUS_15800 >Feature sequence205 <1 2042 gene locus_tag LOCUS_15810 <1 2042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114848.1:TonB-dependent receptor 3132 2128 gene locus_tag LOCUS_15820 3132 2128 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679067.1 protein_id gnl|my_center|LOCUS_15820 3811 3119 gene locus_tag LOCUS_15830 3811 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 4818 3823 gene locus_tag LOCUS_15840 4818 3823 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921140.1 protein_id gnl|my_center|LOCUS_15840 >Feature sequence206 374 57 gene locus_tag LOCUS_15850 374 57 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969960.1 protein_id gnl|my_center|LOCUS_15850 758 486 gene locus_tag LOCUS_15860 758 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15860 1945 1292 gene locus_tag LOCUS_15870 1945 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 2664 2491 gene locus_tag LOCUS_15880 2664 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 3719 2772 gene locus_tag LOCUS_15890 3719 2772 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967225.1 protein_id gnl|my_center|LOCUS_15890 4305 3709 gene locus_tag LOCUS_15900 4305 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 4560 4832 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggctcatccccgcgcaggcggggaacag >Feature sequence207 445 1173 gene locus_tag LOCUS_15910 445 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 2310 1225 gene locus_tag LOCUS_15920 2310 1225 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195328.1 protein_id gnl|my_center|LOCUS_15920 2699 2379 gene locus_tag LOCUS_15930 2699 2379 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975686.1 protein_id gnl|my_center|LOCUS_15930 3032 3961 gene locus_tag LOCUS_15940 3032 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 >Feature sequence208 <1 871 gene locus_tag LOCUS_15950 <1 871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090811.1:UvrD-helicase domain-containing protein 885 4226 gene locus_tag LOCUS_15960 885 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 >Feature sequence209 538 1023 gene locus_tag LOCUS_15970 538 1023 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812075.1 protein_id gnl|my_center|LOCUS_15970 3019 1043 gene locus_tag LOCUS_15980 3019 1043 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920498.1 protein_id gnl|my_center|LOCUS_15980 3739 3131 gene locus_tag LOCUS_15990 3739 3131 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224131.1 protein_id gnl|my_center|LOCUS_15990 <4821 3745 gene locus_tag LOCUS_16000 <4821 3745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265494.1:cytochrome P450 >Feature sequence210 1893 499 gene locus_tag LOCUS_16010 gene lpdA 1893 499 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265532.1 protein_id gnl|my_center|LOCUS_16010 3158 1938 gene locus_tag LOCUS_16020 gene odhB 3158 1938 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918229.1 protein_id gnl|my_center|LOCUS_16020 <4812 3245 gene locus_tag LOCUS_16030 <4812 3245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918228.1:2-oxoglutarate dehydrogenase E1 component >Feature sequence211 3 980 gene locus_tag LOCUS_16040 3 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 1890 988 gene locus_tag LOCUS_16050 1890 988 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_16050 2037 2342 gene locus_tag LOCUS_16060 2037 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 2783 2382 gene locus_tag LOCUS_16070 2783 2382 CDS product TIGR01244 family sulfur transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918808.1 protein_id gnl|my_center|LOCUS_16070 3349 2816 gene locus_tag LOCUS_16080 3349 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920662.1 protein_id gnl|my_center|LOCUS_16080 >Feature sequence212 <1 1741 gene locus_tag LOCUS_16090 <1 1741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010917902.1:DNA mismatch repair protein MutS 2265 1738 gene locus_tag LOCUS_16100 2265 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 3937 2279 gene locus_tag LOCUS_16110 3937 2279 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205614.1 protein_id gnl|my_center|LOCUS_16110 <4773 3953 gene locus_tag LOCUS_16120 <4773 3953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205614.1:tetratricopeptide repeat protein >Feature sequence213 <1 653 gene locus_tag LOCUS_16130 <1 653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004528742.1:DUF2827 domain-containing protein 706 1830 gene locus_tag LOCUS_16140 706 1830 CDS product DUF2827 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201025.1 protein_id gnl|my_center|LOCUS_16140 >Feature sequence214 1447 656 gene locus_tag LOCUS_16150 1447 656 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967134.1 protein_id gnl|my_center|LOCUS_16150 2305 1544 gene locus_tag LOCUS_16160 2305 1544 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087483.1 protein_id gnl|my_center|LOCUS_16160 2519 3580 gene locus_tag LOCUS_16170 gene mnmH 2519 3580 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339449.1 protein_id gnl|my_center|LOCUS_16170 3577 4632 gene locus_tag LOCUS_16180 gene selD 3577 4632 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551284.1 protein_id gnl|my_center|LOCUS_16180 >Feature sequence215 1809 157 gene locus_tag LOCUS_16190 gene groL 1809 157 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918571.1 protein_id gnl|my_center|LOCUS_16190 2156 1869 gene locus_tag LOCUS_16200 gene groES 2156 1869 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975443.1 protein_id gnl|my_center|LOCUS_16200 3925 2627 gene locus_tag LOCUS_16210 3925 2627 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918576.1 protein_id gnl|my_center|LOCUS_16210 <4734 4012 gene locus_tag LOCUS_16220 <4734 4012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967075.1:SDR family oxidoreductase >Feature sequence216 <1 1579 gene locus_tag LOCUS_16230 <1 1579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919559.1:LPS-assembly protein LptD 1764 2957 gene locus_tag LOCUS_16240 1764 2957 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640302.1 protein_id gnl|my_center|LOCUS_16240 2954 3847 gene locus_tag LOCUS_16250 gene rsmA 2954 3847 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265733.1 protein_id gnl|my_center|LOCUS_16250 4511 3855 gene locus_tag LOCUS_16260 gene gmk 4511 3855 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919552.1 protein_id gnl|my_center|LOCUS_16260 >Feature sequence217 2304 16 gene locus_tag LOCUS_16270 2304 16 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 protein_id gnl|my_center|LOCUS_16270 3324 2428 gene locus_tag LOCUS_16280 3324 2428 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532966.1 protein_id gnl|my_center|LOCUS_16280 4111 3308 gene locus_tag LOCUS_16290 4111 3308 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201787933.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence218 >Feature sequence219 1539 1183 gene locus_tag LOCUS_16300 gene rplT 1539 1183 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918929.1 protein_id gnl|my_center|LOCUS_16300 1769 1569 gene locus_tag LOCUS_16310 gene rpmI 1769 1569 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918930.1 protein_id gnl|my_center|LOCUS_16310 3776 1926 gene locus_tag LOCUS_16320 3776 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 >Feature sequence220 <1 824 gene locus_tag LOCUS_16330 <1 824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919760.1:peptidylprolyl isomerase 827 2356 gene locus_tag LOCUS_16340 gene trpE 827 2356 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919761.1 protein_id gnl|my_center|LOCUS_16340 2384 3004 gene locus_tag LOCUS_16350 2384 3004 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919763.1 protein_id gnl|my_center|LOCUS_16350 3010 4071 gene locus_tag LOCUS_16360 gene trpD 3010 4071 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919764.1 protein_id gnl|my_center|LOCUS_16360 >Feature sequence221 <1 544 gene locus_tag LOCUS_16370 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089112.1:SDR family oxidoreductase 544 1332 gene locus_tag LOCUS_16380 544 1332 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088192.1 protein_id gnl|my_center|LOCUS_16380 1329 2795 gene locus_tag LOCUS_16390 1329 2795 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079233.1 protein_id gnl|my_center|LOCUS_16390 3579 2815 gene locus_tag LOCUS_16400 3579 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 <4658 3570 gene locus_tag LOCUS_16410 <4658 3570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099096086.1:CoA transferase >Feature sequence222 <1 1500 gene locus_tag LOCUS_16420 <1 1500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532054.1:transketolase 2662 1493 gene locus_tag LOCUS_16430 2662 1493 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674607.1 protein_id gnl|my_center|LOCUS_16430 3164 2721 gene locus_tag LOCUS_16440 3164 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 4062 3277 gene locus_tag LOCUS_16450 4062 3277 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084304.1 protein_id gnl|my_center|LOCUS_16450 <4637 4062 gene locus_tag LOCUS_16460 <4637 4062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084303.1:patatin-like phospholipase family protein >Feature sequence223 886 113 gene locus_tag LOCUS_16470 886 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 1323 892 gene locus_tag LOCUS_16480 1323 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389554.1 protein_id gnl|my_center|LOCUS_16480 1602 1333 gene locus_tag LOCUS_16490 1602 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 2577 1741 gene locus_tag LOCUS_16500 2577 1741 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528258.1 protein_id gnl|my_center|LOCUS_16500 3010 2585 gene locus_tag LOCUS_16510 3010 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 3369 3022 gene locus_tag LOCUS_16520 3369 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 3764 3366 gene locus_tag LOCUS_16530 3764 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 <4631 4039 gene locus_tag LOCUS_16540 <4631 4039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921014.1:pirin family protein >Feature sequence224 220 29 gene locus_tag LOCUS_16550 220 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 1328 282 gene locus_tag LOCUS_16560 gene holA 1328 282 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923357.1 protein_id gnl|my_center|LOCUS_16560 1840 1325 gene locus_tag LOCUS_16570 gene lptE 1840 1325 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921577.1 protein_id gnl|my_center|LOCUS_16570 4407 1837 gene locus_tag LOCUS_16580 gene leuS 4407 1837 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921576.1 protein_id gnl|my_center|LOCUS_16580 >Feature sequence225 542 1429 gene locus_tag LOCUS_16590 gene dapA 542 1429 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919078.1 protein_id gnl|my_center|LOCUS_16590 1426 1878 gene locus_tag LOCUS_16600 gene smpB 1426 1878 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919079.1 protein_id gnl|my_center|LOCUS_16600 2035 3231 gene locus_tag LOCUS_16610 2035 3231 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920184.1 protein_id gnl|my_center|LOCUS_16610 3872 3219 gene locus_tag LOCUS_16620 3872 3219 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919423.1 protein_id gnl|my_center|LOCUS_16620 3859 4407 gene locus_tag LOCUS_16630 gene folK 3859 4407 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640266.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence226 1332 2441 gene locus_tag LOCUS_16640 1332 2441 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393296.1 protein_id gnl|my_center|LOCUS_16640 3372 2479 gene locus_tag LOCUS_16650 gene hemF 3372 2479 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918394.1 protein_id gnl|my_center|LOCUS_16650 3904 3470 gene locus_tag LOCUS_16660 3904 3470 CDS product DUF6491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639924.1 protein_id gnl|my_center|LOCUS_16660 4374 4030 gene locus_tag LOCUS_16670 4374 4030 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932868.1 protein_id gnl|my_center|LOCUS_16670 >Feature sequence227 30 776 gene locus_tag LOCUS_16680 30 776 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066860.1 protein_id gnl|my_center|LOCUS_16680 849 1367 gene locus_tag LOCUS_16690 gene ruvC 849 1367 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640705.1 protein_id gnl|my_center|LOCUS_16690 1364 1984 gene locus_tag LOCUS_16700 gene ruvA 1364 1984 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921070.1 protein_id gnl|my_center|LOCUS_16700 1981 3030 gene locus_tag LOCUS_16710 gene ruvB 1981 3030 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921069.1 protein_id gnl|my_center|LOCUS_16710 3017 3511 gene locus_tag LOCUS_16720 gene ybgC 3017 3511 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921067.1 protein_id gnl|my_center|LOCUS_16720 3638 4360 gene locus_tag LOCUS_16730 gene tolQ 3638 4360 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921066.1 protein_id gnl|my_center|LOCUS_16730 >Feature sequence228 1263 331 gene locus_tag LOCUS_16740 1263 331 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640580.1 protein_id gnl|my_center|LOCUS_16740 1875 1411 gene locus_tag LOCUS_16750 1875 1411 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921108.1 protein_id gnl|my_center|LOCUS_16750 1957 3777 gene locus_tag LOCUS_16760 1957 3777 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920483.1 protein_id gnl|my_center|LOCUS_16760 >Feature sequence229 832 74 gene locus_tag LOCUS_16770 832 74 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836202.1 protein_id gnl|my_center|LOCUS_16770 2378 846 gene locus_tag LOCUS_16780 2378 846 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919841.1 protein_id gnl|my_center|LOCUS_16780 3354 2635 gene locus_tag LOCUS_16790 3354 2635 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919843.1 protein_id gnl|my_center|LOCUS_16790 >Feature sequence230 737 42 gene locus_tag LOCUS_16800 737 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 2645 825 gene locus_tag LOCUS_16810 gene mnmD 2645 825 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265612.1 protein_id gnl|my_center|LOCUS_16810 2967 2755 gene locus_tag LOCUS_16820 2967 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 <4393 3082 gene locus_tag LOCUS_16830 <4393 3082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921153.1:lytic murein transglycosylase >Feature sequence231 256 522 gene locus_tag LOCUS_16840 256 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 626 1006 gene locus_tag LOCUS_16850 626 1006 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920994.1 protein_id gnl|my_center|LOCUS_16850 1721 1023 gene locus_tag LOCUS_16860 1721 1023 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919348.1 protein_id gnl|my_center|LOCUS_16860 2167 1886 gene locus_tag LOCUS_16870 2167 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 2608 2324 gene locus_tag LOCUS_16880 2608 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 3829 2705 gene locus_tag LOCUS_16890 gene aroC 3829 2705 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920990.1 protein_id gnl|my_center|LOCUS_16890 >Feature sequence232 1019 186 gene locus_tag LOCUS_16900 gene dapD 1019 186 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639928.1 protein_id gnl|my_center|LOCUS_16900 1694 1029 gene locus_tag LOCUS_16910 1694 1029 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918171.1 protein_id gnl|my_center|LOCUS_16910 2680 1691 gene locus_tag LOCUS_16920 gene argB 2680 1691 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918172.1 protein_id gnl|my_center|LOCUS_16920 3356 2673 gene locus_tag LOCUS_16930 gene yihA 3356 2673 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265621.1 protein_id gnl|my_center|LOCUS_16930 <4337 3360 gene locus_tag LOCUS_16940 <4337 3360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918653.1:membrane protein insertase YidC >Feature sequence233 529 116 gene locus_tag LOCUS_16950 529 116 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640349.1 protein_id gnl|my_center|LOCUS_16950 888 529 gene locus_tag LOCUS_16960 888 529 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919725.1 protein_id gnl|my_center|LOCUS_16960 2105 888 gene locus_tag LOCUS_16970 2105 888 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919726.1 protein_id gnl|my_center|LOCUS_16970 3166 2102 gene locus_tag LOCUS_16980 gene sufD 3166 2102 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919727.1 protein_id gnl|my_center|LOCUS_16980 3926 3168 gene locus_tag LOCUS_16990 gene sufC 3926 3168 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919728.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence234 1322 1720 gene locus_tag LOCUS_17000 gene mutT 1322 1720 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918718.1 protein_id gnl|my_center|LOCUS_17000 2701 1748 gene locus_tag LOCUS_17010 2701 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 >Feature sequence235 <1 1207 gene locus_tag LOCUS_17020 <1 1207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010925892.1:acetyl-CoA C-acetyltransferase 1231 2493 gene locus_tag LOCUS_17030 1231 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 3041 2538 gene locus_tag LOCUS_17040 3041 2538 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705212.1 protein_id gnl|my_center|LOCUS_17040 3140 3619 gene locus_tag LOCUS_17050 3140 3619 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626340.1 protein_id gnl|my_center|LOCUS_17050 <4310 3755 gene locus_tag LOCUS_17060 <4310 3755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640513.1:DUF1254 domain-containing protein >Feature sequence236 <1 1008 gene locus_tag LOCUS_17070 <1 1008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083782.1:S-methyl-5-thioribose-1-phosphate isomerase 1070 1474 gene locus_tag LOCUS_17080 1070 1474 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227914.1 protein_id gnl|my_center|LOCUS_17080 3367 1499 gene locus_tag LOCUS_17090 3367 1499 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923295.1 protein_id gnl|my_center|LOCUS_17090 >Feature sequence237 <1 760 gene locus_tag LOCUS_17100 <1 760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004195805.1:GMC family oxidoreductase N-terminal domain-containing protein 2131 767 gene locus_tag LOCUS_17110 2131 767 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_17110 4045 2240 gene locus_tag LOCUS_17120 gene lepA 4045 2240 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640125.1 protein_id gnl|my_center|LOCUS_17120 >Feature sequence238 681 1853 gene locus_tag LOCUS_17130 681 1853 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090135.1 protein_id gnl|my_center|LOCUS_17130 1980 3359 gene locus_tag LOCUS_17140 1980 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 >Feature sequence239 <1 912 gene locus_tag LOCUS_17150 <1 912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921468.1:cation diffusion facilitator family transporter 989 1675 gene locus_tag LOCUS_17160 gene fzlA 989 1675 CDS product FtsZ-binding protein FzlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921466.1 protein_id gnl|my_center|LOCUS_17160 1713 2750 gene locus_tag LOCUS_17170 gene queG 1713 2750 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921465.1 protein_id gnl|my_center|LOCUS_17170 3906 2704 gene locus_tag LOCUS_17180 3906 2704 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921462.1 protein_id gnl|my_center|LOCUS_17180 >Feature sequence240 1470 523 gene locus_tag LOCUS_17190 gene argC 1470 523 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919254.1 protein_id gnl|my_center|LOCUS_17190 1998 1528 gene locus_tag LOCUS_17200 gene rpsI 1998 1528 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004624294.1 protein_id gnl|my_center|LOCUS_17200 2476 2003 gene locus_tag LOCUS_17210 gene rplM 2476 2003 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919253.1 protein_id gnl|my_center|LOCUS_17210 3713 2649 gene locus_tag LOCUS_17220 3713 2649 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919251.1 protein_id gnl|my_center|LOCUS_17220 3846 3770 gene locus_tag LOCUS_t00230 3846 3770 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence241 377 484 gene locus_tag LOCUS_r00010 377 484 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 571 647 gene locus_tag LOCUS_t00240 571 647 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2205 703 gene locus_tag LOCUS_17230 2205 703 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878019.1 protein_id gnl|my_center|LOCUS_17230 3035 2268 gene locus_tag LOCUS_17240 3035 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 <4231 3105 gene locus_tag LOCUS_17250 <4231 3105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793715.1:S41 family peptidase >Feature sequence242 2791 548 gene locus_tag LOCUS_17260 gene parC 2791 548 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919440.1 protein_id gnl|my_center|LOCUS_17260 >Feature sequence243 2 1576 gene locus_tag LOCUS_17270 gene aspS 2 1576 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640360.1 protein_id gnl|my_center|LOCUS_17270 2359 1586 gene locus_tag LOCUS_17280 2359 1586 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640359.1 protein_id gnl|my_center|LOCUS_17280 2489 2716 gene locus_tag LOCUS_17290 2489 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 >Feature sequence244 1200 322 gene locus_tag LOCUS_17300 gene aguB 1200 322 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918101.1 protein_id gnl|my_center|LOCUS_17300 2204 1200 gene locus_tag LOCUS_17310 2204 1200 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639908.1 protein_id gnl|my_center|LOCUS_17310 <4215 2201 gene locus_tag LOCUS_17320 <4215 2201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141702.1:S9 family peptidase >Feature sequence245 <1 828 gene locus_tag LOCUS_17330 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265974.1:succinate dehydrogenase flavoprotein subunit 839 1621 gene locus_tag LOCUS_17340 839 1621 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921355.1 protein_id gnl|my_center|LOCUS_17340 1767 3167 gene locus_tag LOCUS_17350 1767 3167 CDS product acyclic terpene utilization AtuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227202.1 protein_id gnl|my_center|LOCUS_17350 3160 3468 gene locus_tag LOCUS_17360 3160 3468 CDS product DUF4387 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227201.1 protein_id gnl|my_center|LOCUS_17360 >Feature sequence246 529 197 gene locus_tag LOCUS_17370 529 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 1113 664 gene locus_tag LOCUS_17380 1113 664 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921288.1 protein_id gnl|my_center|LOCUS_17380 1332 1886 gene locus_tag LOCUS_17390 1332 1886 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921279.1 protein_id gnl|my_center|LOCUS_17390 1900 3435 gene locus_tag LOCUS_17400 gene atpA 1900 3435 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921278.1 protein_id gnl|my_center|LOCUS_17400 >Feature sequence247 461 1408 gene locus_tag LOCUS_17410 gene gcvA 461 1408 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640150.1 protein_id gnl|my_center|LOCUS_17410 1799 1431 gene locus_tag LOCUS_17420 1799 1431 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349423.1 protein_id gnl|my_center|LOCUS_17420 2223 1783 gene locus_tag LOCUS_17430 2223 1783 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880218.1 protein_id gnl|my_center|LOCUS_17430 4160 2418 gene locus_tag LOCUS_17440 4160 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 >Feature sequence248 293 2728 gene locus_tag LOCUS_17450 293 2728 CDS product DUF3772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064141.1 protein_id gnl|my_center|LOCUS_17450 2818 3255 gene locus_tag LOCUS_17460 2818 3255 CDS product CHRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088650.1 protein_id gnl|my_center|LOCUS_17460 >Feature sequence249 746 492 gene locus_tag LOCUS_17470 gene grxC 746 492 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918714.1 protein_id gnl|my_center|LOCUS_17470 1524 787 gene locus_tag LOCUS_17480 1524 787 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918715.1 protein_id gnl|my_center|LOCUS_17480 1720 2640 gene locus_tag LOCUS_17490 1720 2640 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918716.1 protein_id gnl|my_center|LOCUS_17490 >Feature sequence250 1586 231 gene locus_tag LOCUS_17500 1586 231 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090620.1 protein_id gnl|my_center|LOCUS_17500 2975 1668 gene locus_tag LOCUS_17510 gene tolB 2975 1668 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640704.1 protein_id gnl|my_center|LOCUS_17510 3802 3002 gene locus_tag LOCUS_17520 3802 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 >Feature sequence251 <4103 2938 gene locus_tag LOCUS_17530 <4103 2938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921045.1:DNA polymerase Y family protein >Feature sequence252 1342 32 gene locus_tag LOCUS_17540 1342 32 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919597.1 protein_id gnl|my_center|LOCUS_17540 1746 1339 gene locus_tag LOCUS_17550 1746 1339 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530041.1 protein_id gnl|my_center|LOCUS_17550 3089 1743 gene locus_tag LOCUS_17560 3089 1743 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919595.1 protein_id gnl|my_center|LOCUS_17560 <4100 3089 gene locus_tag LOCUS_17570 <4100 3089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919594.1:pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha >Feature sequence253 261 1427 gene locus_tag LOCUS_17580 261 1427 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086088.1 protein_id gnl|my_center|LOCUS_17580 1474 2271 gene locus_tag LOCUS_17590 1474 2271 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082972.1 protein_id gnl|my_center|LOCUS_17590 2394 3710 gene locus_tag LOCUS_17600 2394 3710 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730116.1 protein_id gnl|my_center|LOCUS_17600 >Feature sequence254 1636 32 gene locus_tag LOCUS_17610 gene bchE 1636 32 CDS product magnesium-protoporphyrin IX monomethyl ester anaerobic oxidative cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391295.1 protein_id gnl|my_center|LOCUS_17610 1810 2793 gene locus_tag LOCUS_17620 1810 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 2873 3946 gene locus_tag LOCUS_17630 2873 3946 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528582.1 protein_id gnl|my_center|LOCUS_17630 >Feature sequence255 792 109 gene locus_tag LOCUS_17640 792 109 CDS product DUF1013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923245.1 protein_id gnl|my_center|LOCUS_17640 1644 829 gene locus_tag LOCUS_17650 1644 829 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921054.1 protein_id gnl|my_center|LOCUS_17650 2364 1663 gene locus_tag LOCUS_17660 2364 1663 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813013.1 protein_id gnl|my_center|LOCUS_17660 2853 2368 gene locus_tag LOCUS_17670 2853 2368 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688008.1 protein_id gnl|my_center|LOCUS_17670 3106 3906 gene locus_tag LOCUS_17680 3106 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 >Feature sequence256 115 2880 gene locus_tag LOCUS_17690 gene ppdK 115 2880 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640245.1 protein_id gnl|my_center|LOCUS_17690 2901 3050 gene locus_tag LOCUS_17700 2901 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 3061 3627 gene locus_tag LOCUS_17710 3061 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 >Feature sequence257 3 1469 gene locus_tag LOCUS_17720 3 1469 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265821.1 protein_id gnl|my_center|LOCUS_17720 2573 1491 gene locus_tag LOCUS_17730 2573 1491 CDS product lysine-2,3-aminomutase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398801.1 protein_id gnl|my_center|LOCUS_17730 3538 2546 gene locus_tag LOCUS_17740 gene epmA 3538 2546 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918606.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence258 100 2118 gene locus_tag LOCUS_17750 100 2118 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972911.1 protein_id gnl|my_center|LOCUS_17750 2130 3344 gene locus_tag LOCUS_17760 2130 3344 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919382.1 protein_id gnl|my_center|LOCUS_17760 >Feature sequence259 2173 431 gene locus_tag LOCUS_17770 2173 431 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858956.1 protein_id gnl|my_center|LOCUS_17770 2684 2178 gene locus_tag LOCUS_17780 2684 2178 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034856088.1 protein_id gnl|my_center|LOCUS_17780 3514 2708 gene locus_tag LOCUS_17790 3514 2708 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082975.1 protein_id gnl|my_center|LOCUS_17790 >Feature sequence260 <3987 3047 gene locus_tag LOCUS_17800 <3987 3047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918190.1:tetraacyldisaccharide 4'-kinase >Feature sequence261 399 1016 gene locus_tag LOCUS_17810 399 1016 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397160.1 protein_id gnl|my_center|LOCUS_17810 >Feature sequence262 <1 2307 gene locus_tag LOCUS_17820 <1 2307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928597.1:M14 family metallopeptidase 2490 3545 gene locus_tag LOCUS_17830 2490 3545 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526892.1 protein_id gnl|my_center|LOCUS_17830 >Feature sequence263 <1 792 gene locus_tag LOCUS_17840 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919112.1:multidrug effflux MFS transporter 1687 773 gene locus_tag LOCUS_17850 1687 773 CDS product helix-turn-helix domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081161075.1 protein_id gnl|my_center|LOCUS_17850 1800 2153 gene locus_tag LOCUS_17860 1800 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 2977 2168 gene locus_tag LOCUS_17870 2977 2168 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965766.1 protein_id gnl|my_center|LOCUS_17870 <3919 2974 gene locus_tag LOCUS_17880 <3919 2974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099096086.1:CoA transferase >Feature sequence264 35 1609 gene locus_tag LOCUS_17890 gene crtI 35 1609 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390732.1 protein_id gnl|my_center|LOCUS_17890 1537 2439 gene locus_tag LOCUS_17900 1537 2439 CDS product carotenoid 1,2-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390733.1 protein_id gnl|my_center|LOCUS_17900 2627 2436 gene locus_tag LOCUS_17910 2627 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 3731 2664 gene locus_tag LOCUS_17920 3731 2664 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388253.1 protein_id gnl|my_center|LOCUS_17920 >Feature sequence265 961 215 gene locus_tag LOCUS_17930 961 215 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728517.1 protein_id gnl|my_center|LOCUS_17930 1959 1024 gene locus_tag LOCUS_17940 1959 1024 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090157.1 protein_id gnl|my_center|LOCUS_17940 2133 3542 gene locus_tag LOCUS_17950 2133 3542 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388738.1 protein_id gnl|my_center|LOCUS_17950 >Feature sequence266 1916 3058 gene locus_tag LOCUS_17960 1916 3058 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973447.1 protein_id gnl|my_center|LOCUS_17960 <3834 3107 gene locus_tag LOCUS_17970 <3834 3107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003407276.1:alpha/beta hydrolase >Feature sequence267 361 1392 gene locus_tag LOCUS_17980 361 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919009.1 protein_id gnl|my_center|LOCUS_17980 1392 2285 gene locus_tag LOCUS_17990 gene folD 1392 2285 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640180.1 protein_id gnl|my_center|LOCUS_17990 2928 2296 gene locus_tag LOCUS_18000 2928 2296 CDS product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920180.1 protein_id gnl|my_center|LOCUS_18000 <3829 2925 gene locus_tag LOCUS_18010 <3829 2925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920179.1:MlaD family protein >Feature sequence268 3 1256 gene locus_tag LOCUS_18020 3 1256 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064882.1 protein_id gnl|my_center|LOCUS_18020 1315 1893 gene locus_tag LOCUS_18030 1315 1893 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086626.1 protein_id gnl|my_center|LOCUS_18030 1890 2966 gene locus_tag LOCUS_18040 1890 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 <3825 2948 gene locus_tag LOCUS_18050 <3825 2948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114855.1:amino acid permease >Feature sequence269 1882 1319 gene locus_tag LOCUS_18060 1882 1319 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918383.1 protein_id gnl|my_center|LOCUS_18060 2697 1879 gene locus_tag LOCUS_18070 gene proC 2697 1879 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918382.1 protein_id gnl|my_center|LOCUS_18070 3247 2738 gene locus_tag LOCUS_18080 3247 2738 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918381.1 protein_id gnl|my_center|LOCUS_18080 3693 3364 gene locus_tag LOCUS_18090 3693 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 >Feature sequence270 <3780 1218 gene locus_tag LOCUS_18100 <3780 1218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918390.1:DNA-directed RNA polymerase subunit beta >Feature sequence271 <1 998 gene locus_tag LOCUS_18110 <1 998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918711.1:class I SAM-dependent DNA methyltransferase 1158 2384 gene locus_tag LOCUS_18120 1158 2384 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143177.1 protein_id gnl|my_center|LOCUS_18120 3740 2397 gene locus_tag LOCUS_18130 3740 2397 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265852.1 protein_id gnl|my_center|LOCUS_18130 >Feature sequence272 225 557 gene locus_tag LOCUS_18140 225 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 651 1091 gene locus_tag LOCUS_18150 gene aroQ 651 1091 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919748.1 protein_id gnl|my_center|LOCUS_18150 1133 1627 gene locus_tag LOCUS_18160 gene accB 1133 1627 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919749.1 protein_id gnl|my_center|LOCUS_18160 1647 2990 gene locus_tag LOCUS_18170 gene accC 1647 2990 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919750.1 protein_id gnl|my_center|LOCUS_18170 <3777 2998 gene locus_tag LOCUS_18180 <3777 2998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978608.1:M20/M25/M40 family metallo-hydrolase >Feature sequence273 102 29 gene locus_tag LOCUS_t00250 102 29 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 227 142 gene locus_tag LOCUS_t00260 227 142 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 340 1158 gene locus_tag LOCUS_18190 gene rlmB 340 1158 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919119.1 protein_id gnl|my_center|LOCUS_18190 3020 1155 gene locus_tag LOCUS_18200 gene ggt 3020 1155 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140682.1 protein_id gnl|my_center|LOCUS_18200 <3772 3202 gene locus_tag LOCUS_18210 <3772 3202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919813.1:NADH-quinone oxidoreductase subunit NuoF >Feature sequence274 1720 191 gene locus_tag LOCUS_18220 1720 191 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063168296.1 protein_id gnl|my_center|LOCUS_18220 <3770 1942 gene locus_tag LOCUS_18230 <3770 1942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919676.1:TonB-dependent receptor >Feature sequence275 <3762 245 gene locus_tag LOCUS_18240 <3762 245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388379.1:magnesium chelatase subunit H >Feature sequence276 1518 367 gene locus_tag LOCUS_18250 1518 367 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920927.1 protein_id gnl|my_center|LOCUS_18250 1931 1515 gene locus_tag LOCUS_18260 1931 1515 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918905.1 protein_id gnl|my_center|LOCUS_18260 3441 2029 gene locus_tag LOCUS_18270 3441 2029 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence277 987 487 gene locus_tag LOCUS_18280 987 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 1095 1889 gene locus_tag LOCUS_18290 1095 1889 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971721.1 protein_id gnl|my_center|LOCUS_18290 2535 1912 gene locus_tag LOCUS_18300 2535 1912 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406575.1 protein_id gnl|my_center|LOCUS_18300 2634 2843 gene locus_tag LOCUS_18310 2634 2843 CDS product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265605.1 protein_id gnl|my_center|LOCUS_18310 2919 3491 gene locus_tag LOCUS_18320 2919 3491 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084194.1 protein_id gnl|my_center|LOCUS_18320 3719 3495 gene locus_tag LOCUS_18330 3719 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 >Feature sequence278 2053 1865 gene locus_tag LOCUS_18340 2053 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 <3753 2286 gene locus_tag LOCUS_18350 <3753 2286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064252802.1:cytochrome c biogenesis protein DipZ >Feature sequence279 3055 3441 gene locus_tag LOCUS_18360 3055 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 >Feature sequence280 1794 2213 gene locus_tag LOCUS_18370 gene ndk 1794 2213 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919569.1 protein_id gnl|my_center|LOCUS_18370 3269 2241 gene locus_tag LOCUS_18380 gene purM 3269 2241 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919572.1 protein_id gnl|my_center|LOCUS_18380 >Feature sequence281 548 54 gene locus_tag LOCUS_18390 548 54 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265689.1 protein_id gnl|my_center|LOCUS_18390 873 550 gene locus_tag LOCUS_18400 873 550 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919159.1 protein_id gnl|my_center|LOCUS_18400 1342 1001 gene locus_tag LOCUS_18410 1342 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18410 2008 1598 gene locus_tag LOCUS_18420 gene rplQ 2008 1598 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919152.1 protein_id gnl|my_center|LOCUS_18420 3098 2082 gene locus_tag LOCUS_18430 3098 2082 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919151.1 protein_id gnl|my_center|LOCUS_18430 3581 3192 gene locus_tag LOCUS_18440 gene rpsK 3581 3192 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919150.1 protein_id gnl|my_center|LOCUS_18440 >Feature sequence282 2628 430 gene locus_tag LOCUS_18450 2628 430 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919006.1 protein_id gnl|my_center|LOCUS_18450 >Feature sequence283 835 560 gene locus_tag LOCUS_18460 835 560 CDS product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921151.1 protein_id gnl|my_center|LOCUS_18460 979 1545 gene locus_tag LOCUS_18470 gene folE 979 1545 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388024.1 protein_id gnl|my_center|LOCUS_18470 2357 1611 gene locus_tag LOCUS_18480 gene phnE 2357 1611 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918252.1 protein_id gnl|my_center|LOCUS_18480 3471 2437 gene locus_tag LOCUS_18490 gene phnD 3471 2437 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918251.1 protein_id gnl|my_center|LOCUS_18490 >Feature sequence284 <1 1526 gene locus_tag LOCUS_18500 <1 1526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921437.1:cisplatin damage response ATP-dependent DNA ligase 2665 1514 gene locus_tag LOCUS_18510 2665 1514 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921438.1 protein_id gnl|my_center|LOCUS_18510 >Feature sequence285 >Feature sequence286 2262 1048 gene locus_tag LOCUS_18520 2262 1048 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919258.1 protein_id gnl|my_center|LOCUS_18520 >Feature sequence287 476 1462 gene locus_tag LOCUS_18530 476 1462 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529574.1 protein_id gnl|my_center|LOCUS_18530 1566 2519 gene locus_tag LOCUS_18540 1566 2519 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224067.1 protein_id gnl|my_center|LOCUS_18540 2691 2536 gene locus_tag LOCUS_18550 2691 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 3464 2823 gene locus_tag LOCUS_18560 3464 2823 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174758.1 protein_id gnl|my_center|LOCUS_18560 >Feature sequence288 1346 225 gene locus_tag LOCUS_18570 1346 225 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114445.1 protein_id gnl|my_center|LOCUS_18570 2676 1336 gene locus_tag LOCUS_18580 2676 1336 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_18580 >Feature sequence289 <1 1855 gene locus_tag LOCUS_18590 <1 1855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393846.1:efflux RND transporter permease subunit 2204 1932 gene locus_tag LOCUS_18600 2204 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 <3649 2294 gene locus_tag LOCUS_18610 <3649 2294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920294.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB >Feature sequence290 1049 177 gene locus_tag LOCUS_18620 1049 177 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918245.1 protein_id gnl|my_center|LOCUS_18620 1993 1127 gene locus_tag LOCUS_18630 1993 1127 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918247.1 protein_id gnl|my_center|LOCUS_18630 3115 2063 gene locus_tag LOCUS_18640 3115 2063 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639944.1 protein_id gnl|my_center|LOCUS_18640 >Feature sequence291 283 2502 gene locus_tag LOCUS_18650 283 2502 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918235.1 protein_id gnl|my_center|LOCUS_18650 >Feature sequence292 2001 688 gene locus_tag LOCUS_18660 2001 688 CDS product DUF3443 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192528.1 protein_id gnl|my_center|LOCUS_18660 2512 2066 gene locus_tag LOCUS_18670 2512 2066 CDS product DUF2844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198643.1 protein_id gnl|my_center|LOCUS_18670 3406 2798 gene locus_tag LOCUS_18680 3406 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 >Feature sequence293 1484 540 gene locus_tag LOCUS_18690 1484 540 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038743.1 protein_id gnl|my_center|LOCUS_18690 2122 1481 gene locus_tag LOCUS_18700 2122 1481 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003717.1 protein_id gnl|my_center|LOCUS_18700 >Feature sequence294 273 584 gene locus_tag LOCUS_18710 273 584 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014490264.1 protein_id gnl|my_center|LOCUS_18710 755 1048 gene locus_tag LOCUS_18720 gene rpmB 755 1048 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918547.1 protein_id gnl|my_center|LOCUS_18720 2036 1101 gene locus_tag LOCUS_18730 2036 1101 CDS product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918089.1 protein_id gnl|my_center|LOCUS_18730 2204 2926 gene locus_tag LOCUS_18740 2204 2926 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918095.1 protein_id gnl|my_center|LOCUS_18740 2926 3573 gene locus_tag LOCUS_18750 2926 3573 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918096.1 protein_id gnl|my_center|LOCUS_18750 >Feature sequence295 665 1198 gene locus_tag LOCUS_18760 665 1198 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886773.1 protein_id gnl|my_center|LOCUS_18760 1358 2344 gene locus_tag LOCUS_18770 gene cysK 1358 2344 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921452.1 protein_id gnl|my_center|LOCUS_18770 2404 2775 gene locus_tag LOCUS_18780 2404 2775 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921451.1 protein_id gnl|my_center|LOCUS_18780 3251 2772 gene locus_tag LOCUS_18790 3251 2772 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188566.1 protein_id gnl|my_center|LOCUS_18790 >Feature sequence296 1440 475 gene locus_tag LOCUS_18800 1440 475 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036684.1 protein_id gnl|my_center|LOCUS_18800 2315 1437 gene locus_tag LOCUS_18810 2315 1437 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036685.1 protein_id gnl|my_center|LOCUS_18810 2700 2317 gene locus_tag LOCUS_18820 2700 2317 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036686.1 protein_id gnl|my_center|LOCUS_18820 3248 2817 gene locus_tag LOCUS_18830 3248 2817 CDS product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918712.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence297 <1 1168 gene locus_tag LOCUS_18840 <1 1168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979972.1:divalent metal cation transporter 3196 1175 gene locus_tag LOCUS_18850 gene rnr 3196 1175 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920311.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence298 1940 1335 gene locus_tag LOCUS_18860 1940 1335 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921304.1 protein_id gnl|my_center|LOCUS_18860 2146 1937 gene locus_tag LOCUS_18870 2146 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 2338 3141 gene locus_tag LOCUS_18880 gene phyR 2338 3141 CDS product anti-anti sigma factor/receiver protein PhyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921306.1 protein_id gnl|my_center|LOCUS_18880 3494 3171 gene locus_tag LOCUS_18890 3494 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 >Feature sequence299 75 1475 gene locus_tag LOCUS_18900 gene uczS 75 1475 CDS product two-component system sensor histidine kinase UczS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920596.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence300 143 1393 gene locus_tag LOCUS_18910 143 1393 CDS product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265522.1 protein_id gnl|my_center|LOCUS_18910 1415 2161 gene locus_tag LOCUS_18920 1415 2161 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918140.1 protein_id gnl|my_center|LOCUS_18920 <3539 2180 gene locus_tag LOCUS_18930 <3539 2180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918141.1:penicillin-binding protein 1A >Feature sequence301 2223 1072 gene locus_tag LOCUS_18940 gene vceA 2223 1072 CDS product multidrug efflux MFS transporter adaptor subunit VceA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625982.1 protein_id gnl|my_center|LOCUS_18940 <3516 2266 gene locus_tag LOCUS_18950 <3516 2266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000798631.1:multidrug efflux MFS transporter outer membrane subunit VceC >Feature sequence302 1178 786 gene locus_tag LOCUS_18960 1178 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 2183 1215 gene locus_tag LOCUS_18970 gene hisG 2183 1215 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921340.1 protein_id gnl|my_center|LOCUS_18970 3313 2180 gene locus_tag LOCUS_18980 3313 2180 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921341.1 protein_id gnl|my_center|LOCUS_18980 >Feature sequence303 291 2765 gene locus_tag LOCUS_18990 291 2765 CDS product ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640358.1 protein_id gnl|my_center|LOCUS_18990 3374 2760 gene locus_tag LOCUS_19000 3374 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 >Feature sequence304 608 129 gene locus_tag LOCUS_19010 gene greA 608 129 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920063.1 protein_id gnl|my_center|LOCUS_19010 713 1219 gene locus_tag LOCUS_19020 713 1219 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810396.1 protein_id gnl|my_center|LOCUS_19020 2165 1239 gene locus_tag LOCUS_19030 2165 1239 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968027.1 protein_id gnl|my_center|LOCUS_19030 2241 3194 gene locus_tag LOCUS_19040 2241 3194 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479611.1 protein_id gnl|my_center|LOCUS_19040 >Feature sequence305 262 1452 gene locus_tag LOCUS_19050 262 1452 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265617.1 protein_id gnl|my_center|LOCUS_19050 1571 2323 gene locus_tag LOCUS_19060 1571 2323 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920511.1 protein_id gnl|my_center|LOCUS_19060 3405 2356 gene locus_tag LOCUS_19070 3405 2356 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529026.1 protein_id gnl|my_center|LOCUS_19070 >Feature sequence306 1088 192 gene locus_tag LOCUS_19080 gene trxA 1088 192 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917999.1 protein_id gnl|my_center|LOCUS_19080 1739 1227 gene locus_tag LOCUS_19090 1739 1227 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918000.1 protein_id gnl|my_center|LOCUS_19090 1814 2566 gene locus_tag LOCUS_19100 1814 2566 CDS product DUF6065 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918001.1 protein_id gnl|my_center|LOCUS_19100 3294 3368 gene locus_tag LOCUS_t00270 3294 3368 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence307 437 1153 gene locus_tag LOCUS_19110 437 1153 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265989.1 protein_id gnl|my_center|LOCUS_19110 1459 1800 gene locus_tag LOCUS_19120 1459 1800 CDS product DUF2794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921491.1 protein_id gnl|my_center|LOCUS_19120 2620 1868 gene locus_tag LOCUS_19130 2620 1868 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923334.1 protein_id gnl|my_center|LOCUS_19130 2787 3332 gene locus_tag LOCUS_19140 gene thpR 2787 3332 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921488.1 protein_id gnl|my_center|LOCUS_19140 >Feature sequence308 1352 801 gene locus_tag LOCUS_19150 1352 801 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529609.1 protein_id gnl|my_center|LOCUS_19150 1780 1349 gene locus_tag LOCUS_19160 1780 1349 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921473.1 protein_id gnl|my_center|LOCUS_19160 2238 1777 gene locus_tag LOCUS_19170 2238 1777 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265987.1 protein_id gnl|my_center|LOCUS_19170 2286 3293 gene locus_tag LOCUS_19180 2286 3293 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921471.1 protein_id gnl|my_center|LOCUS_19180 >Feature sequence309 <1 599 gene locus_tag LOCUS_19190 <1 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265661.1:DUF1134 domain-containing protein 3280 614 gene locus_tag LOCUS_19200 3280 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 >Feature sequence310 142 873 gene locus_tag LOCUS_19210 142 873 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640345.1 protein_id gnl|my_center|LOCUS_19210 1528 878 gene locus_tag LOCUS_19220 1528 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 2591 1776 gene locus_tag LOCUS_19230 2591 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 2751 3035 gene locus_tag LOCUS_19240 2751 3035 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014332579.1 protein_id gnl|my_center|LOCUS_19240 >Feature sequence311 <1 2884 gene locus_tag LOCUS_19250 <1 2884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919710.1:transcription-repair coupling factor >Feature sequence312 420 346 gene locus_tag LOCUS_t00280 420 346 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 542 1132 gene locus_tag LOCUS_19260 542 1132 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918215.1 protein_id gnl|my_center|LOCUS_19260 1960 1145 gene locus_tag LOCUS_19270 1960 1145 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084250.1 protein_id gnl|my_center|LOCUS_19270 3286 2063 gene locus_tag LOCUS_19280 gene rocD 3286 2063 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085639.1 protein_id gnl|my_center|LOCUS_19280 >Feature sequence313 162 410 gene locus_tag LOCUS_19290 162 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 1188 427 gene locus_tag LOCUS_19300 1188 427 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921271.1 protein_id gnl|my_center|LOCUS_19300 1753 1259 gene locus_tag LOCUS_19310 1753 1259 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921269.1 protein_id gnl|my_center|LOCUS_19310 3322 1898 gene locus_tag LOCUS_19320 3322 1898 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921264.1 protein_id gnl|my_center|LOCUS_19320 >Feature sequence314 551 1588 gene locus_tag LOCUS_19330 551 1588 CDS product DUF3667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919988.1 protein_id gnl|my_center|LOCUS_19330 1985 1596 gene locus_tag LOCUS_19340 1985 1596 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204656.1 protein_id gnl|my_center|LOCUS_19340 1964 2051 gene locus_tag LOCUS_t00290 1964 2051 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 <3341 2633 gene locus_tag LOCUS_19350 <3341 2633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037399975.1:4-hydroxythreonine-4-phosphate dehydrogenase PdxA >Feature sequence315 1199 444 gene locus_tag LOCUS_19360 1199 444 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119307.1 protein_id gnl|my_center|LOCUS_19360 1993 1196 gene locus_tag LOCUS_19370 1993 1196 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919071.1 protein_id gnl|my_center|LOCUS_19370 2967 1990 gene locus_tag LOCUS_19380 2967 1990 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640170.1 protein_id gnl|my_center|LOCUS_19380 >Feature sequence316 121 723 gene locus_tag LOCUS_19390 121 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 1142 1068 gene locus_tag LOCUS_t00300 1142 1068 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1242 1844 gene locus_tag LOCUS_19400 1242 1844 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958140.1 protein_id gnl|my_center|LOCUS_19400 >Feature sequence317 <3316 799 gene locus_tag LOCUS_19410 <3316 799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919743.1:ribonuclease E/G >Feature sequence318 1032 544 gene locus_tag LOCUS_19420 1032 544 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920784.1 protein_id gnl|my_center|LOCUS_19420 1344 1159 gene locus_tag LOCUS_19430 1344 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 >Feature sequence319 1298 897 gene locus_tag LOCUS_19440 1298 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 >Feature sequence320 385 1353 gene locus_tag LOCUS_19450 gene chlG 385 1353 CDS product chlorophyll synthase ChlG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388385.1 protein_id gnl|my_center|LOCUS_19450 1383 2687 gene locus_tag LOCUS_19460 1383 2687 CDS product BCD family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388386.1 protein_id gnl|my_center|LOCUS_19460 >Feature sequence321 1352 219 gene locus_tag LOCUS_19470 gene ccmI 1352 219 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532636.1 protein_id gnl|my_center|LOCUS_19470 1834 1349 gene locus_tag LOCUS_19480 1834 1349 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337622.1 protein_id gnl|my_center|LOCUS_19480 2364 1831 gene locus_tag LOCUS_19490 2364 1831 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387795.1 protein_id gnl|my_center|LOCUS_19490 <3262 2361 gene locus_tag LOCUS_19500 <3262 2361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387796.1:heme lyase CcmF/NrfE family subunit >Feature sequence322 456 1868 gene locus_tag LOCUS_19510 gene lpdA 456 1868 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919599.1 protein_id gnl|my_center|LOCUS_19510 <3262 1865 gene locus_tag LOCUS_19520 <3262 1865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919601.1:AMP-binding protein >Feature sequence323 1510 134 gene locus_tag LOCUS_19530 gene rfbH 1510 134 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208596.1 protein_id gnl|my_center|LOCUS_19530 2626 1520 gene locus_tag LOCUS_19540 gene rfbG 2626 1520 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565909.1 protein_id gnl|my_center|LOCUS_19540 <3252 2593 gene locus_tag LOCUS_19550 <3252 2593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261038.1:glucose-1-phosphate cytidylyltransferase >Feature sequence324 <1 601 gene locus_tag LOCUS_19560 <1 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793715.1:S41 family peptidase 777 1847 gene locus_tag LOCUS_19570 gene recA 777 1847 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918971.1 protein_id gnl|my_center|LOCUS_19570 >Feature sequence325 <1 778 gene locus_tag LOCUS_19580 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920494.1:choline dehydrogenase 797 1486 gene locus_tag LOCUS_19590 797 1486 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920480.1 protein_id gnl|my_center|LOCUS_19590 1541 1966 gene locus_tag LOCUS_19600 1541 1966 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640541.1 protein_id gnl|my_center|LOCUS_19600 >Feature sequence326 392 1819 gene locus_tag LOCUS_19610 392 1819 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018647881.1 protein_id gnl|my_center|LOCUS_19610 1816 2553 gene locus_tag LOCUS_19620 1816 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 >Feature sequence327 899 2686 gene locus_tag LOCUS_19630 899 2686 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444518.1 protein_id gnl|my_center|LOCUS_19630 >Feature sequence328 >Feature sequence329 1869 3119 gene locus_tag LOCUS_19640 1869 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 >Feature sequence330 321 1661 gene locus_tag LOCUS_19650 321 1661 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356408.1 protein_id gnl|my_center|LOCUS_19650 1845 2123 gene locus_tag LOCUS_19660 1845 2123 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970279.1 protein_id gnl|my_center|LOCUS_19660 >Feature sequence331 856 1734 gene locus_tag LOCUS_19670 856 1734 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919400.1 protein_id gnl|my_center|LOCUS_19670 1804 3216 gene locus_tag LOCUS_19680 gene uxaC 1804 3216 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338259.1 protein_id gnl|my_center|LOCUS_19680 >Feature sequence332 2082 1162 gene locus_tag LOCUS_19690 2082 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 <3218 2079 gene locus_tag LOCUS_19700 <3218 2079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731115.1:PLP-dependent cysteine synthase family protein >Feature sequence333 434 81 gene locus_tag LOCUS_19710 gene rplR 434 81 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919143.1 protein_id gnl|my_center|LOCUS_19710 971 438 gene locus_tag LOCUS_19720 gene rplF 971 438 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919142.1 protein_id gnl|my_center|LOCUS_19720 1368 973 gene locus_tag LOCUS_19730 gene rpsH 1368 973 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919141.1 protein_id gnl|my_center|LOCUS_19730 1758 1381 gene locus_tag LOCUS_19740 gene rpsN 1758 1381 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919140.1 protein_id gnl|my_center|LOCUS_19740 2281 1718 gene locus_tag LOCUS_19750 gene rplE 2281 1718 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919139.1 protein_id gnl|my_center|LOCUS_19750 2588 2274 gene locus_tag LOCUS_19760 gene rplX 2588 2274 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919138.1 protein_id gnl|my_center|LOCUS_19760 2956 2588 gene locus_tag LOCUS_19770 gene rplN 2956 2588 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919137.1 protein_id gnl|my_center|LOCUS_19770 >Feature sequence334 2 625 gene locus_tag LOCUS_19780 2 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 610 981 gene locus_tag LOCUS_19790 610 981 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969576.1 protein_id gnl|my_center|LOCUS_19790 2298 997 gene locus_tag LOCUS_19800 2298 997 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037785.1 protein_id gnl|my_center|LOCUS_19800 2498 3193 gene locus_tag LOCUS_19810 2498 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524252.1 protein_id gnl|my_center|LOCUS_19810 >Feature sequence335 431 27 gene locus_tag LOCUS_19820 431 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 853 467 gene locus_tag LOCUS_19830 853 467 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113591.1 protein_id gnl|my_center|LOCUS_19830 1804 944 gene locus_tag LOCUS_19840 1804 944 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089316.1 protein_id gnl|my_center|LOCUS_19840 2061 2954 gene locus_tag LOCUS_19850 2061 2954 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529395.1 protein_id gnl|my_center|LOCUS_19850 >Feature sequence336 <1 1202 gene locus_tag LOCUS_19860 <1 1202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921389.1:HWE histidine kinase domain-containing protein 1369 2058 gene locus_tag LOCUS_19870 1369 2058 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921396.1 protein_id gnl|my_center|LOCUS_19870 >Feature sequence337 1806 943 gene locus_tag LOCUS_19880 1806 943 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640424.1 protein_id gnl|my_center|LOCUS_19880 <3180 1875 gene locus_tag LOCUS_19890 <3180 1875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920031.1:propionyl-CoA carboxylase subunit beta >Feature sequence338 1420 278 gene locus_tag LOCUS_19900 1420 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 >Feature sequence339 <1 776 gene locus_tag LOCUS_19910 <1 776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919417.1:rod shape-determining protein 929 1951 gene locus_tag LOCUS_19920 gene mreC 929 1951 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919418.1 protein_id gnl|my_center|LOCUS_19920 1948 2466 gene locus_tag LOCUS_19930 1948 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919419.1 protein_id gnl|my_center|LOCUS_19930 >Feature sequence340 2078 1089 gene locus_tag LOCUS_19940 gene mmsB 2078 1089 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919231.1 protein_id gnl|my_center|LOCUS_19940 2269 2949 gene locus_tag LOCUS_19950 2269 2949 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265678.1 protein_id gnl|my_center|LOCUS_19950 >Feature sequence341 1686 1051 gene locus_tag LOCUS_19960 1686 1051 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921221.1 protein_id gnl|my_center|LOCUS_19960 2574 1870 gene locus_tag LOCUS_19970 2574 1870 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918769.1 protein_id gnl|my_center|LOCUS_19970 >Feature sequence342 <1 1062 gene locus_tag LOCUS_19980 <1 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004195859.1:ethanolamine ammonia-lyase subunit EutB 1059 1871 gene locus_tag LOCUS_19990 gene eutC 1059 1871 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195860.1 protein_id gnl|my_center|LOCUS_19990 >Feature sequence343 65 943 gene locus_tag LOCUS_20000 65 943 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390731.1 protein_id gnl|my_center|LOCUS_20000 963 2075 gene locus_tag LOCUS_20010 963 2075 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390730.1 protein_id gnl|my_center|LOCUS_20010 2095 3063 gene locus_tag LOCUS_20020 gene bchC 2095 3063 CDS product chlorophyll synthesis pathway protein BchC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390729.1 protein_id gnl|my_center|LOCUS_20020 >Feature sequence344 <3079 665 gene locus_tag LOCUS_20030 <3079 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002209892.1:glycoside hydrolase family 31 protein >Feature sequence345 463 1233 gene locus_tag LOCUS_20040 463 1233 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921628.1 protein_id gnl|my_center|LOCUS_20040 1748 1239 gene locus_tag LOCUS_20050 1748 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 2255 1779 gene locus_tag LOCUS_20060 2255 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 2658 2410 gene locus_tag LOCUS_20070 2658 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 >Feature sequence346 <1 542 gene locus_tag LOCUS_20080 <1 542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921083.1:fructose-bisphosphate aldolase class II 2074 560 gene locus_tag LOCUS_20090 2074 560 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531553.1 protein_id gnl|my_center|LOCUS_20090 >Feature sequence347 2485 224 gene locus_tag LOCUS_20100 2485 224 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921166.1 protein_id gnl|my_center|LOCUS_20100 <3062 2482 gene locus_tag LOCUS_20110 <3062 2482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920871.1:cell cycle two-component system response regulator CtrA >Feature sequence348 1954 590 gene locus_tag LOCUS_20120 gene radA 1954 590 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919533.1 protein_id gnl|my_center|LOCUS_20120 <3051 2045 gene locus_tag LOCUS_20130 <3051 2045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919538.1:replicative DNA helicase >Feature sequence349 945 238 gene locus_tag LOCUS_20140 gene uppS 945 238 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919785.1 protein_id gnl|my_center|LOCUS_20140 1597 1031 gene locus_tag LOCUS_20150 gene frr 1597 1031 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919786.1 protein_id gnl|my_center|LOCUS_20150 2365 1640 gene locus_tag LOCUS_20160 gene pyrH 2365 1640 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919787.1 protein_id gnl|my_center|LOCUS_20160 <3039 2464 gene locus_tag LOCUS_20170 <3039 2464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919788.1:translation elongation factor Ts >Feature sequence350 1411 269 gene locus_tag LOCUS_20180 gene recF 1411 269 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918048.1 protein_id gnl|my_center|LOCUS_20180 2587 1451 gene locus_tag LOCUS_20190 gene dnaN 2587 1451 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918045.1 protein_id gnl|my_center|LOCUS_20190 >Feature sequence351 925 347 gene locus_tag LOCUS_20200 925 347 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918293.1 protein_id gnl|my_center|LOCUS_20200 997 2247 gene locus_tag LOCUS_20210 997 2247 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265542.1 protein_id gnl|my_center|LOCUS_20210 >Feature sequence352 1695 1051 gene locus_tag LOCUS_20220 1695 1051 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403961.1 protein_id gnl|my_center|LOCUS_20220 >Feature sequence353 1195 557 gene locus_tag LOCUS_20230 1195 557 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350124.1 protein_id gnl|my_center|LOCUS_20230 1890 1195 gene locus_tag LOCUS_20240 1890 1195 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919687.1 protein_id gnl|my_center|LOCUS_20240 2792 2013 gene locus_tag LOCUS_20250 2792 2013 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919688.1 protein_id gnl|my_center|LOCUS_20250 >Feature sequence354 1004 714 gene locus_tag LOCUS_20260 1004 714 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640346.1 protein_id gnl|my_center|LOCUS_20260 1310 1068 gene locus_tag LOCUS_20270 1310 1068 CDS product DUF3297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089470.1 protein_id gnl|my_center|LOCUS_20270 1789 1439 gene locus_tag LOCUS_20280 1789 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 >Feature sequence355 1303 2070 gene locus_tag LOCUS_20290 1303 2070 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919591.1 protein_id gnl|my_center|LOCUS_20290 2344 2162 gene locus_tag LOCUS_20300 gene rpmF 2344 2162 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919589.1 protein_id gnl|my_center|LOCUS_20300 >Feature sequence356 216 1010 gene locus_tag LOCUS_20310 216 1010 CDS product CDP-diacylglycerol diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036871.1 protein_id gnl|my_center|LOCUS_20310 1202 1834 gene locus_tag LOCUS_20320 1202 1834 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918263.1 protein_id gnl|my_center|LOCUS_20320 1850 2725 gene locus_tag LOCUS_20330 1850 2725 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_20330 >Feature sequence357 623 420 gene locus_tag LOCUS_20340 623 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 754 1893 gene locus_tag LOCUS_20350 754 1893 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088385.1 protein_id gnl|my_center|LOCUS_20350 >Feature sequence358 393 800 gene locus_tag LOCUS_20360 gene crcB 393 800 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387989.1 protein_id gnl|my_center|LOCUS_20360 1432 986 gene locus_tag LOCUS_20370 1432 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 2498 1629 gene locus_tag LOCUS_20380 2498 1629 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008670430.1 protein_id gnl|my_center|LOCUS_20380 2765 2690 gene locus_tag LOCUS_t00310 2765 2690 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence359 762 1223 gene locus_tag LOCUS_20390 762 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 <2953 1336 gene locus_tag LOCUS_20400 <2953 1336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918627.1:translational GTPase TypA >Feature sequence360 2422 1040 gene locus_tag LOCUS_20410 gene gor 2422 1040 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920161.1 protein_id gnl|my_center|LOCUS_20410 >Feature sequence361 <1 858 gene locus_tag LOCUS_20420 <1 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640188.1:DUF2807 domain-containing protein 861 1583 gene locus_tag LOCUS_20430 861 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 1617 2747 gene locus_tag LOCUS_20440 1617 2747 CDS product ISAs1-like element ISEc26 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027427.1 protein_id gnl|my_center|LOCUS_20440 >Feature sequence362 1226 315 gene locus_tag LOCUS_20450 1226 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 2893 1223 gene locus_tag LOCUS_20460 2893 1223 CDS product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265648.1 protein_id gnl|my_center|LOCUS_20460 >Feature sequence363 264 842 gene locus_tag LOCUS_20470 264 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 839 1657 gene locus_tag LOCUS_20480 839 1657 CDS product YmdB family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921077.1 protein_id gnl|my_center|LOCUS_20480 1671 2606 gene locus_tag LOCUS_20490 1671 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 >Feature sequence364 14 2062 gene locus_tag LOCUS_20500 14 2062 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404763.1 protein_id gnl|my_center|LOCUS_20500 >Feature sequence365 <1 881 gene locus_tag LOCUS_20510 <1 881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002261967.1:aminotransferase 1163 2782 gene locus_tag LOCUS_20520 1163 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 >Feature sequence366 1247 303 gene locus_tag LOCUS_20530 gene ftsQ 1247 303 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640522.1 protein_id gnl|my_center|LOCUS_20530 2160 1228 gene locus_tag LOCUS_20540 2160 1228 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920400.1 protein_id gnl|my_center|LOCUS_20540 <2846 2268 gene locus_tag LOCUS_20550 <2846 2268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920402.1:UDP-N-acetylmuramate dehydrogenase >Feature sequence367 >Feature sequence368 800 240 gene locus_tag LOCUS_20560 800 240 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918264.1 protein_id gnl|my_center|LOCUS_20560 822 1865 gene locus_tag LOCUS_20570 gene mutY 822 1865 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918265.1 protein_id gnl|my_center|LOCUS_20570 <2784 1982 gene locus_tag LOCUS_20580 <2784 1982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918266.1:adenine-specific DNA-methyltransferase CcrM >Feature sequence369 1845 604 gene locus_tag LOCUS_20590 1845 604 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104360.1 protein_id gnl|my_center|LOCUS_20590 >Feature sequence370 2028 1009 gene locus_tag LOCUS_20600 2028 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 <2772 2033 gene locus_tag LOCUS_20610 <2772 2033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383974.1:acetolactate synthase 3 large subunit >Feature sequence371 <1 1292 gene locus_tag LOCUS_20620 <1 1292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919415.1:2-isopropylmalate synthase 1357 2241 gene locus_tag LOCUS_20630 1357 2241 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640265.1 protein_id gnl|my_center|LOCUS_20630 2305 2487 gene locus_tag LOCUS_20640 2305 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 >Feature sequence372 522 893 gene locus_tag LOCUS_20650 522 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 886 1257 gene locus_tag LOCUS_20660 886 1257 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051076796.1 protein_id gnl|my_center|LOCUS_20660 1505 1344 gene locus_tag LOCUS_20670 1505 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 1635 1868 gene locus_tag LOCUS_20680 1635 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 1865 2626 gene locus_tag LOCUS_20690 1865 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 >Feature sequence373 65 1408 gene locus_tag LOCUS_20700 gene secY 65 1408 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640191.1 protein_id gnl|my_center|LOCUS_20700 1485 2054 gene locus_tag LOCUS_20710 1485 2054 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919148.1 protein_id gnl|my_center|LOCUS_20710 2240 2608 gene locus_tag LOCUS_20720 gene rpsM 2240 2608 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919149.1 protein_id gnl|my_center|LOCUS_20720 >Feature sequence374 1590 589 gene locus_tag LOCUS_20730 1590 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928827.1 protein_id gnl|my_center|LOCUS_20730 >Feature sequence375 2446 1028 gene locus_tag LOCUS_20740 2446 1028 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921135.1 protein_id gnl|my_center|LOCUS_20740 >Feature sequence376 <1 503 gene locus_tag LOCUS_20750 <1 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919796.1:lipoprotein-releasing ABC transporter permease subunit 496 1176 gene locus_tag LOCUS_20760 496 1176 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919795.1 protein_id gnl|my_center|LOCUS_20760 1948 1472 gene locus_tag LOCUS_20770 gene msrB 1948 1472 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920044.1 protein_id gnl|my_center|LOCUS_20770 >Feature sequence377 <1 940 gene locus_tag LOCUS_20780 <1 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_203891615.1:fumarylacetoacetate hydrolase family protein 1049 2308 gene locus_tag LOCUS_20790 gene hpnE 1049 2308 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857589.1 protein_id gnl|my_center|LOCUS_20790 >Feature sequence378 1053 361 gene locus_tag LOCUS_20800 1053 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 1151 2485 gene locus_tag LOCUS_20810 1151 2485 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085744.1 protein_id gnl|my_center|LOCUS_20810 >Feature sequence379 2182 485 gene locus_tag LOCUS_20820 2182 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 >Feature sequence380 176 787 gene locus_tag LOCUS_20830 176 787 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640472.1 protein_id gnl|my_center|LOCUS_20830 792 1838 gene locus_tag LOCUS_20840 792 1838 CDS product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920200.1 protein_id gnl|my_center|LOCUS_20840 1835 2026 gene locus_tag LOCUS_20850 1835 2026 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920199.1 protein_id gnl|my_center|LOCUS_20850 2116 2191 gene locus_tag LOCUS_t00320 2116 2191 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence381 >Feature sequence382 35 2410 gene locus_tag LOCUS_20860 gene pheT 35 2410 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918927.1 protein_id gnl|my_center|LOCUS_20860 >Feature sequence383 1300 431 gene locus_tag LOCUS_20870 1300 431 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640212.1 protein_id gnl|my_center|LOCUS_20870 <2620 1311 gene locus_tag LOCUS_20880 <2620 1311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919212.1:tetratricopeptide repeat protein >Feature sequence384 1348 194 gene locus_tag LOCUS_20890 gene rodA 1348 194 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919421.1 protein_id gnl|my_center|LOCUS_20890 <2620 1345 gene locus_tag LOCUS_20900 <2620 1345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919420.1:penicillin-binding protein 2 >Feature sequence385 778 317 gene locus_tag LOCUS_20910 778 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 <2617 1322 gene locus_tag LOCUS_20920 <2617 1322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015923272.1:ABC transporter ATP-binding protein >Feature sequence386 <1 1354 gene locus_tag LOCUS_20930 <1 1354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919494.1:glutamine-hydrolyzing GMP synthase >Feature sequence387 417 1247 gene locus_tag LOCUS_20940 417 1247 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920872.1 protein_id gnl|my_center|LOCUS_20940 2246 1269 gene locus_tag LOCUS_20950 2246 1269 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918233.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence388 362 961 gene locus_tag LOCUS_20960 362 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 >Feature sequence389 <1 1044 gene locus_tag LOCUS_20970 <1 1044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971276.1:saccharopine dehydrogenase family protein >Feature sequence390 >Feature sequence391 <1 2296 gene locus_tag LOCUS_20980 <1 2296 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003089920.1:multidrug efflux RND transporter permease subunit MuxB >Feature sequence392 2025 4 gene locus_tag LOCUS_20990 gene glyS 2025 4 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919219.1 protein_id gnl|my_center|LOCUS_20990 <2568 2025 gene locus_tag LOCUS_21000 <2568 2025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919218.1:glycine--tRNA ligase subunit alpha >Feature sequence393 1179 1910 gene locus_tag LOCUS_21010 gene rph 1179 1910 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918041.1 protein_id gnl|my_center|LOCUS_21010 2269 2033 gene locus_tag LOCUS_21020 2269 2033 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639890.1 protein_id gnl|my_center|LOCUS_21020 2548 2273 gene locus_tag LOCUS_21030 2548 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 >Feature sequence394 1618 491 gene locus_tag LOCUS_21040 1618 491 CDS product DUF2827 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205616.1 protein_id gnl|my_center|LOCUS_21040 >Feature sequence395 1309 542 gene locus_tag LOCUS_21050 1309 542 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920487.1 protein_id gnl|my_center|LOCUS_21050 2088 1306 gene locus_tag LOCUS_21060 2088 1306 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920486.1 protein_id gnl|my_center|LOCUS_21060 >Feature sequence396 1002 475 gene locus_tag LOCUS_21070 1002 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 904 1161 gene locus_tag LOCUS_21080 904 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 1792 1184 gene locus_tag LOCUS_21090 gene coaE 1792 1184 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639852.1 protein_id gnl|my_center|LOCUS_21090 <2517 1789 gene locus_tag LOCUS_21100 <2517 1789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010917894.1:shikimate dehydrogenase >Feature sequence397 725 345 gene locus_tag LOCUS_21110 725 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 1560 904 gene locus_tag LOCUS_21120 1560 904 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088064.1 protein_id gnl|my_center|LOCUS_21120 2328 1675 gene locus_tag LOCUS_21130 2328 1675 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931025.1 protein_id gnl|my_center|LOCUS_21130 >Feature sequence398 378 1349 gene locus_tag LOCUS_21140 378 1349 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920777.1 protein_id gnl|my_center|LOCUS_21140 >Feature sequence399 >Feature sequence400 114 290 gene locus_tag LOCUS_21150 114 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 545 1285 gene locus_tag LOCUS_21160 545 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 1282 1458 gene locus_tag LOCUS_21170 1282 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 1449 1727 gene locus_tag LOCUS_21180 1449 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 1858 2172 gene locus_tag LOCUS_21190 1858 2172 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933584.1 protein_id gnl|my_center|LOCUS_21190 >Feature sequence401 445 1206 gene locus_tag LOCUS_21200 445 1206 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920912.1 protein_id gnl|my_center|LOCUS_21200 2051 1347 gene locus_tag LOCUS_21210 2051 1347 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877819.1 protein_id gnl|my_center|LOCUS_21210 2431 2174 gene locus_tag LOCUS_21220 2431 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 >Feature sequence402 1634 477 gene locus_tag LOCUS_21230 1634 477 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533428.1 protein_id gnl|my_center|LOCUS_21230 >Feature sequence403 150 1436 gene locus_tag LOCUS_21240 gene fabF 150 1436 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919549.1 protein_id gnl|my_center|LOCUS_21240 >Feature sequence404 779 2176 gene locus_tag LOCUS_21250 gene glmU 779 2176 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920163.1 protein_id gnl|my_center|LOCUS_21250 >Feature sequence405 471 2408 gene locus_tag LOCUS_21260 471 2408 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357009.1 protein_id gnl|my_center|LOCUS_21260 >Feature sequence406 43 870 gene locus_tag LOCUS_21270 43 870 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085546.1 protein_id gnl|my_center|LOCUS_21270 2161 1208 gene locus_tag LOCUS_21280 2161 1208 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072167.1 protein_id gnl|my_center|LOCUS_21280 >Feature sequence407 >Feature sequence408 <1 763 gene locus_tag LOCUS_21290 <1 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249303.1:slipin family protein 799 2202 gene locus_tag LOCUS_21300 799 2202 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403781.1 protein_id gnl|my_center|LOCUS_21300 >Feature sequence409 1621 284 gene locus_tag LOCUS_21310 gene tilS 1621 284 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921060.1 protein_id gnl|my_center|LOCUS_21310 <2390 1652 gene locus_tag LOCUS_21320 <2390 1652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921061.1:tol-pal system protein YbgF >Feature sequence410 <1 1755 gene locus_tag LOCUS_21330 <1 1755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640172.1:lytic transglycosylase domain-containing protein >Feature sequence411 >Feature sequence412 1316 2182 gene locus_tag LOCUS_21340 gene yghU 1316 2182 CDS product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085723.1 protein_id gnl|my_center|LOCUS_21340 >Feature sequence413 >Feature sequence414 1206 256 gene locus_tag LOCUS_21350 1206 256 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098345.1 protein_id gnl|my_center|LOCUS_21350 1721 1230 gene locus_tag LOCUS_21360 1721 1230 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090633.1 protein_id gnl|my_center|LOCUS_21360 1815 2318 gene locus_tag LOCUS_21370 1815 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 >Feature sequence415 1 1398 gene locus_tag LOCUS_21380 1 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 1398 1997 gene locus_tag LOCUS_21390 gene fixJ 1398 1997 CDS product response regulator FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085544.1 protein_id gnl|my_center|LOCUS_21390 >Feature sequence416 <1 935 gene locus_tag LOCUS_21400 <1 935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010917940.1:methionine adenosyltransferase 1566 988 gene locus_tag LOCUS_21410 1566 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 >Feature sequence417 110 862 gene locus_tag LOCUS_21420 110 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 >Feature sequence418 1 195 gene locus_tag LOCUS_21430 1 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 192 341 gene locus_tag LOCUS_21440 192 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 385 948 gene locus_tag LOCUS_21450 385 948 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923266.1 protein_id gnl|my_center|LOCUS_21450 1035 1910 gene locus_tag LOCUS_21460 1035 1910 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921231.1 protein_id gnl|my_center|LOCUS_21460 >Feature sequence419 504 19 gene locus_tag LOCUS_21470 504 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 1694 588 gene locus_tag LOCUS_21480 1694 588 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640051.1 protein_id gnl|my_center|LOCUS_21480 >Feature sequence420 <1 885 gene locus_tag LOCUS_21490 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257648.1:DUF2309 domain-containing protein 882 1790 gene locus_tag LOCUS_21500 gene cysD 882 1790 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140408.1 protein_id gnl|my_center|LOCUS_21500 1832 2083 gene locus_tag LOCUS_21510 1832 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 >Feature sequence421 <1 1151 gene locus_tag LOCUS_21520 <1 1151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640370.1:NADH-quinone oxidoreductase subunit D 1148 1813 gene locus_tag LOCUS_21530 gene nuoE 1148 1813 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919816.1 protein_id gnl|my_center|LOCUS_21530 1810 2082 gene locus_tag LOCUS_21540 1810 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 >Feature sequence422 1149 142 gene locus_tag LOCUS_21550 1149 142 CDS product DUF2891 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919081.1 protein_id gnl|my_center|LOCUS_21550 2122 1169 gene locus_tag LOCUS_21560 2122 1169 CDS product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919082.1 protein_id gnl|my_center|LOCUS_21560 >Feature sequence423 <1 647 gene locus_tag LOCUS_21570 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383616.1:type I pantothenate kinase 724 1392 gene locus_tag LOCUS_21580 724 1392 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921386.1 protein_id gnl|my_center|LOCUS_21580 1649 1912 gene locus_tag LOCUS_21590 1649 1912 CDS product SWIB/MDM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814592.1 protein_id gnl|my_center|LOCUS_21590 >Feature sequence424 462 1112 gene locus_tag LOCUS_21600 462 1112 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083641.1 protein_id gnl|my_center|LOCUS_21600 >Feature sequence425 154 1143 gene locus_tag LOCUS_21610 154 1143 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639871.1 protein_id gnl|my_center|LOCUS_21610 1140 1535 gene locus_tag LOCUS_21620 1140 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 1579 1956 gene locus_tag LOCUS_21630 1579 1956 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917957.1 protein_id gnl|my_center|LOCUS_21630 >Feature sequence426 1594 890 gene locus_tag LOCUS_21640 1594 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 >Feature sequence427 <1 1443 gene locus_tag LOCUS_21650 <1 1443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921333.1:M13 family metallopeptidase <2219 1453 gene locus_tag LOCUS_21660 <2219 1453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014626566.1:pantoate--beta-alanine ligase >Feature sequence428 <1 1256 gene locus_tag LOCUS_21670 <1 1256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919065.1:ATP-binding protein 1432 1644 gene locus_tag LOCUS_21680 1432 1644 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919062.1 protein_id gnl|my_center|LOCUS_21680 >Feature sequence429 113 628 gene locus_tag LOCUS_21690 113 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 625 1125 gene locus_tag LOCUS_21700 625 1125 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919244.1 protein_id gnl|my_center|LOCUS_21700 >Feature sequence430 989 354 gene locus_tag LOCUS_21710 989 354 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400924.1 protein_id gnl|my_center|LOCUS_21710 1549 989 gene locus_tag LOCUS_21720 1549 989 CDS product demethoxyubiquinone hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640434.1 protein_id gnl|my_center|LOCUS_21720 2046 1546 gene locus_tag LOCUS_21730 2046 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 >Feature sequence431 1506 346 gene locus_tag LOCUS_21740 1506 346 CDS product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534674.1 protein_id gnl|my_center|LOCUS_21740 >Feature sequence432 711 316 gene locus_tag LOCUS_21750 711 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919342.1 protein_id gnl|my_center|LOCUS_21750 1526 774 gene locus_tag LOCUS_21760 1526 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919341.1 protein_id gnl|my_center|LOCUS_21760 1772 1554 gene locus_tag LOCUS_21770 gene infA 1772 1554 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004617696.1 protein_id gnl|my_center|LOCUS_21770 >Feature sequence433 1589 1119 gene locus_tag LOCUS_21780 1589 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 2151 1669 gene locus_tag LOCUS_21790 2151 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 >Feature sequence434 1585 146 gene locus_tag LOCUS_21800 1585 146 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918307.1 protein_id gnl|my_center|LOCUS_21800 >Feature sequence435 211 978 gene locus_tag LOCUS_21810 211 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 >Feature sequence436 4 864 gene locus_tag LOCUS_21820 4 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 976 1530 gene locus_tag LOCUS_21830 976 1530 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920592.1 protein_id gnl|my_center|LOCUS_21830 1547 2002 gene locus_tag LOCUS_21840 1547 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920591.1 protein_id gnl|my_center|LOCUS_21840 >Feature sequence437 >Feature sequence438 1585 275 gene locus_tag LOCUS_21850 1585 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 <2106 1582 gene locus_tag LOCUS_21860 <2106 1582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084304.1:3-hydroxybutyrate dehydrogenase >Feature sequence439 359 1300 gene locus_tag LOCUS_21870 gene rarD 359 1300 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918143.1 protein_id gnl|my_center|LOCUS_21870 1799 1305 gene locus_tag LOCUS_21880 1799 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 >Feature sequence440 <2079 1173 gene locus_tag LOCUS_21890 <2079 1173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265854.1:putative 2OG-Fe(II) oxygenase >Feature sequence441 >Feature sequence442 781 461 gene locus_tag LOCUS_21900 781 461 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918134.1 protein_id gnl|my_center|LOCUS_21900 1500 778 gene locus_tag LOCUS_21910 1500 778 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918133.1 protein_id gnl|my_center|LOCUS_21910 <2058 1528 gene locus_tag LOCUS_21920 <2058 1528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813155.1:DHA2 family efflux MFS transporter permease subunit >Feature sequence443 <1 770 gene locus_tag LOCUS_21930 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920204.1:histidinol dehydrogenase 817 1299 gene locus_tag LOCUS_21940 817 1299 CDS product UPF0262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920203.1 protein_id gnl|my_center|LOCUS_21940 1369 1764 gene locus_tag LOCUS_21950 1369 1764 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920202.1 protein_id gnl|my_center|LOCUS_21950 >Feature sequence444 274 1344 gene locus_tag LOCUS_21960 274 1344 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918188.1 protein_id gnl|my_center|LOCUS_21960 1628 1368 gene locus_tag LOCUS_21970 1628 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21970 1859 1680 gene locus_tag LOCUS_21980 1859 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21980 >Feature sequence445 5 1309 gene locus_tag LOCUS_21990 gene rfaE1 5 1309 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921467.1 protein_id gnl|my_center|LOCUS_21990 >Feature sequence446 1433 144 gene locus_tag LOCUS_22000 1433 144 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920240.1 protein_id gnl|my_center|LOCUS_22000 <2036 1519 gene locus_tag LOCUS_22010 <2036 1519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265717.1:universal stress protein >Feature sequence447 301 948 gene locus_tag LOCUS_22020 301 948 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918295.1 protein_id gnl|my_center|LOCUS_22020 >Feature sequence448 799 1062 gene locus_tag LOCUS_22030 799 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 <2029 1162 gene locus_tag LOCUS_22040 <2029 1162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920009.1:energy-dependent translational throttle protein EttA >Feature sequence449 138 1316 gene locus_tag LOCUS_22050 138 1316 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918772.1 protein_id gnl|my_center|LOCUS_22050 1319 1798 gene locus_tag LOCUS_22060 gene ribH 1319 1798 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918773.1 protein_id gnl|my_center|LOCUS_22060 >Feature sequence450 <2009 678 gene locus_tag LOCUS_22070 <2009 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921186.1:zinc-dependent metalloprotease >Feature sequence451 790 299 gene locus_tag LOCUS_22080 790 299 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919605.1 protein_id gnl|my_center|LOCUS_22080 2008 884 gene locus_tag LOCUS_22090 2008 884 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919606.1 protein_id gnl|my_center|LOCUS_22090 >Feature sequence452 <1 1464 gene locus_tag LOCUS_22100 <1 1464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015923339.1:prolyl oligopeptidase family protein >Feature sequence453 <1 1207 gene locus_tag LOCUS_22110 <1 1207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087644.1:proline--tRNA ligase >Feature sequence454 1162 296 gene locus_tag LOCUS_22120 1162 296 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919210.1 protein_id gnl|my_center|LOCUS_22120 >Feature sequence455 399 992 gene locus_tag LOCUS_22130 gene yihX 399 992 CDS product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209011.1 protein_id gnl|my_center|LOCUS_22130 1120 1545 gene locus_tag LOCUS_22140 1120 1545 CDS product DUF6249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265731.1 protein_id gnl|my_center|LOCUS_22140 >Feature sequence456 71 460 gene locus_tag LOCUS_22150 71 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640296.1 protein_id gnl|my_center|LOCUS_22150 550 1347 gene locus_tag LOCUS_22160 gene panB 550 1347 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640297.1 protein_id gnl|my_center|LOCUS_22160 >Feature sequence457 1380 373 gene locus_tag LOCUS_22170 gene ubiA 1380 373 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923273.1 protein_id gnl|my_center|LOCUS_22170 >Feature sequence458 >Feature sequence459 337 1062 gene locus_tag LOCUS_22180 337 1062 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214431907.1 protein_id gnl|my_center|LOCUS_22180 <1951 1238 gene locus_tag LOCUS_22190 <1951 1238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943652.1:glycosyltransferase family 9 protein >Feature sequence460 652 50 gene locus_tag LOCUS_22200 652 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 1606 854 gene locus_tag LOCUS_22210 1606 854 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640625.1 protein_id gnl|my_center|LOCUS_22210 >Feature sequence461 <1904 1193 gene locus_tag LOCUS_22220 <1904 1193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920753.1:carboxylating nicotinate-nucleotide diphosphorylase >Feature sequence462 >Feature sequence463 <1 952 gene locus_tag LOCUS_22230 <1 952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640335.1:acyl-CoA synthetase >Feature sequence464 >Feature sequence465 <1 770 gene locus_tag LOCUS_22240 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112848.1:tetratricopeptide repeat protein 767 1450 gene locus_tag LOCUS_22250 767 1450 CDS product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112849.1 protein_id gnl|my_center|LOCUS_22250 >Feature sequence466 390 623 gene locus_tag LOCUS_22260 390 623 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388465.1 protein_id gnl|my_center|LOCUS_22260 744 1085 gene locus_tag LOCUS_22270 gene grxD 744 1085 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920362.1 protein_id gnl|my_center|LOCUS_22270 >Feature sequence467 591 151 gene locus_tag LOCUS_22280 591 151 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392679.1 protein_id gnl|my_center|LOCUS_22280 673 1290 gene locus_tag LOCUS_22290 673 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 >Feature sequence468 1430 1251 gene locus_tag LOCUS_22300 1430 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 >Feature sequence469 <1 819 gene locus_tag LOCUS_22310 <1 819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005816831.1:tetracycline resistance MFS efflux pump >Feature sequence470 >Feature sequence471 <1 1141 gene locus_tag LOCUS_22320 <1 1141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044977.1:EAL domain-containing protein >Feature sequence472 >Feature sequence473 554 1450 gene locus_tag LOCUS_22330 gene hemB 554 1450 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919224.1 protein_id gnl|my_center|LOCUS_22330 >Feature sequence474 646 963 gene locus_tag LOCUS_22340 646 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 1574 915 gene locus_tag LOCUS_22350 gene aat 1574 915 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919751.1 protein_id gnl|my_center|LOCUS_22350 >Feature sequence475 <1 1455 gene locus_tag LOCUS_22360 <1 1455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388380.1:ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit B >Feature sequence476 15 1313 gene locus_tag LOCUS_22370 15 1313 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640508.1 protein_id gnl|my_center|LOCUS_22370 >Feature sequence477 949 506 gene locus_tag LOCUS_22380 gene ybeY 949 506 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265493.1 protein_id gnl|my_center|LOCUS_22380 <1610 946 gene locus_tag LOCUS_22390 <1610 946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012639866.1:PhoH family protein >Feature sequence478 1294 212 gene locus_tag LOCUS_22400 1294 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 >Feature sequence479 1442 603 gene locus_tag LOCUS_22410 1442 603 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728655.1 protein_id gnl|my_center|LOCUS_22410 >Feature sequence480 220 873 gene locus_tag LOCUS_22420 gene msrA 220 873 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918878.1 protein_id gnl|my_center|LOCUS_22420 881 1219 gene locus_tag LOCUS_22430 881 1219 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918877.1 protein_id gnl|my_center|LOCUS_22430 >Feature sequence481 1436 819 gene locus_tag LOCUS_22440 gene hslV 1436 819 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923353.1 protein_id gnl|my_center|LOCUS_22440 >Feature sequence482 >Feature sequence483 <1472 629 gene locus_tag LOCUS_22450 <1472 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839972.1:alpha/beta hydrolase >Feature sequence484 1177 341 gene locus_tag LOCUS_22460 1177 341 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034360134.1 protein_id gnl|my_center|LOCUS_22460 >Feature sequence485 287 1009 gene locus_tag LOCUS_22470 gene queC 287 1009 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920996.1 protein_id gnl|my_center|LOCUS_22470 >Feature sequence486 >Feature sequence487 799 317 gene locus_tag LOCUS_22480 799 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 >Feature sequence488 >Feature sequence489 <1 900 gene locus_tag LOCUS_22490 <1 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920832.1:acetyl-CoA carboxylase carboxyltransferase subunit alpha >Feature sequence490 <1300 400 gene locus_tag LOCUS_22500 <1300 400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919211.1:electron transfer flavoprotein-ubiquinone oxidoreductase >Feature sequence491 <1 829 gene locus_tag LOCUS_22510 <1 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918022.1:SDR family oxidoreductase >Feature sequence492 >Feature sequence493 >Feature sequence494 >Feature sequence495 >Feature sequence496 262 1005 gene locus_tag LOCUS_22520 262 1005 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917995.1 protein_id gnl|my_center|LOCUS_22520 >Feature sequence497