>Feature sequence01 63 281 gene locus_tag LOCUS_00010 63 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 826 278 gene locus_tag LOCUS_00020 826 278 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010793894.1 protein_id gnl|my_center|LOCUS_00020 861 1148 gene locus_tag LOCUS_00030 861 1148 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112565.1 protein_id gnl|my_center|LOCUS_00030 1319 1558 gene locus_tag LOCUS_00040 1319 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3510 2044 gene locus_tag LOCUS_00050 3510 2044 CDS product colicin-like pore-forming protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115311.1 protein_id gnl|my_center|LOCUS_00050 3916 4179 gene locus_tag LOCUS_00060 3916 4179 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111834.1 protein_id gnl|my_center|LOCUS_00060 4212 5054 gene locus_tag LOCUS_00070 4212 5054 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112560.1 protein_id gnl|my_center|LOCUS_00070 5492 5896 gene locus_tag LOCUS_00080 5492 5896 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112559.1 protein_id gnl|my_center|LOCUS_00080 6577 6017 gene locus_tag LOCUS_00090 6577 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112558.1 protein_id gnl|my_center|LOCUS_00090 7600 6962 gene locus_tag LOCUS_00100 7600 6962 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003145564.1 protein_id gnl|my_center|LOCUS_00100 8184 8456 gene locus_tag LOCUS_00110 8184 8456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9004 9615 gene locus_tag LOCUS_00120 9004 9615 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895531.1 protein_id gnl|my_center|LOCUS_00120 9673 10386 gene locus_tag LOCUS_00130 9673 10386 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112554.1 protein_id gnl|my_center|LOCUS_00130 10487 13006 gene locus_tag LOCUS_00140 10487 13006 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895532.1 protein_id gnl|my_center|LOCUS_00140 13607 13086 gene locus_tag LOCUS_00150 13607 13086 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086236.1 protein_id gnl|my_center|LOCUS_00150 14165 15718 gene locus_tag LOCUS_00160 gene pqsA 14165 15718 CDS product anthranilate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112552.1 protein_id gnl|my_center|LOCUS_00160 15712 16563 gene locus_tag LOCUS_00170 gene pqsB 15712 16563 CDS product 2-heptyl-4(1H)-quinolone synthase subunit PqsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108611.1 protein_id gnl|my_center|LOCUS_00170 16556 17602 gene locus_tag LOCUS_00180 gene pqsC 16556 17602 CDS product 2-heptyl-4(1H)-quinolone synthase subunit PqsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108612.1 protein_id gnl|my_center|LOCUS_00180 17645 18658 gene locus_tag LOCUS_00190 gene pqsD 17645 18658 CDS product anthraniloyl-CoA anthraniloyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112550.1 protein_id gnl|my_center|LOCUS_00190 18652 19557 gene locus_tag LOCUS_00200 gene pqsE 18652 19557 CDS product 2-aminobenzoylacetyl-CoA thioesterase PqsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086247.1 protein_id gnl|my_center|LOCUS_00200 19696 21267 gene locus_tag LOCUS_00210 19696 21267 CDS product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895533.1 protein_id gnl|my_center|LOCUS_00210 21245 21847 gene locus_tag LOCUS_00220 gene phnB 21245 21847 CDS product anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112548.1 protein_id gnl|my_center|LOCUS_00220 22798 21800 gene locus_tag LOCUS_00230 gene mvfR 22798 21800 CDS product multiple virulence factor transcriptional regulator MvfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108614.1 protein_id gnl|my_center|LOCUS_00230 23546 24604 gene locus_tag LOCUS_00240 gene nadA 23546 24604 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112547.1 protein_id gnl|my_center|LOCUS_00240 26146 24713 gene locus_tag LOCUS_00250 26146 24713 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112546.1 protein_id gnl|my_center|LOCUS_00250 26309 26560 gene locus_tag LOCUS_00260 26309 26560 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086258.1 protein_id gnl|my_center|LOCUS_00260 26594 27667 gene locus_tag LOCUS_00270 26594 27667 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_00270 28201 27728 gene locus_tag LOCUS_00280 28201 27728 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086262.1 protein_id gnl|my_center|LOCUS_00280 28770 28213 gene locus_tag LOCUS_00290 28770 28213 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086267.1 protein_id gnl|my_center|LOCUS_00290 28954 29832 gene locus_tag LOCUS_00300 gene dapA 28954 29832 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086270.1 protein_id gnl|my_center|LOCUS_00300 29850 31040 gene locus_tag LOCUS_00310 gene bamC 29850 31040 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086271.1 protein_id gnl|my_center|LOCUS_00310 30979 31737 gene locus_tag LOCUS_00320 30979 31737 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112544.1 protein_id gnl|my_center|LOCUS_00320 31766 32476 gene locus_tag LOCUS_00330 31766 32476 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108622.1 protein_id gnl|my_center|LOCUS_00330 32570 32659 gene locus_tag LOCUS_t00010 32570 32659 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 32882 32646 gene locus_tag LOCUS_00340 32882 32646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 33093 33992 gene locus_tag LOCUS_00350 gene wapB 33093 33992 CDS product 1,2-glucosyltransferase WapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003140646.1 protein_id gnl|my_center|LOCUS_00350 34832 34032 gene locus_tag LOCUS_00360 34832 34032 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112543.1 protein_id gnl|my_center|LOCUS_00360 34990 35376 gene locus_tag LOCUS_00370 34990 35376 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812491.1 protein_id gnl|my_center|LOCUS_00370 35373 36524 gene locus_tag LOCUS_00380 35373 36524 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112542.1 protein_id gnl|my_center|LOCUS_00380 36634 38781 gene locus_tag LOCUS_00390 36634 38781 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112541.1 protein_id gnl|my_center|LOCUS_00390 38765 39631 gene locus_tag LOCUS_00400 38765 39631 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112540.1 protein_id gnl|my_center|LOCUS_00400 39713 41068 gene locus_tag LOCUS_00410 39713 41068 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112539.1 protein_id gnl|my_center|LOCUS_00410 41092 41499 gene locus_tag LOCUS_00420 41092 41499 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112538.1 protein_id gnl|my_center|LOCUS_00420 41640 42704 gene locus_tag LOCUS_00430 41640 42704 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895534.1 protein_id gnl|my_center|LOCUS_00430 42704 43465 gene locus_tag LOCUS_00440 42704 43465 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086299.1 protein_id gnl|my_center|LOCUS_00440 43467 44612 gene locus_tag LOCUS_00450 43467 44612 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112534.1 protein_id gnl|my_center|LOCUS_00450 44653 45570 gene locus_tag LOCUS_00460 44653 45570 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086302.1 protein_id gnl|my_center|LOCUS_00460 45586 46572 gene locus_tag LOCUS_00470 45586 46572 CDS product NADH:ubiquinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086306.1 protein_id gnl|my_center|LOCUS_00470 46651 47901 gene locus_tag LOCUS_00480 46651 47901 CDS product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112533.1 protein_id gnl|my_center|LOCUS_00480 48754 48278 gene locus_tag LOCUS_00490 48754 48278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112531.1 protein_id gnl|my_center|LOCUS_00490 48929 50422 gene locus_tag LOCUS_00500 48929 50422 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895535.1 protein_id gnl|my_center|LOCUS_00500 50478 51764 gene locus_tag LOCUS_00510 50478 51764 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112529.1 protein_id gnl|my_center|LOCUS_00510 51837 52205 gene locus_tag LOCUS_00520 51837 52205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 52340 53095 gene locus_tag LOCUS_00530 52340 53095 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112528.1 protein_id gnl|my_center|LOCUS_00530 53749 55224 gene locus_tag LOCUS_00540 53749 55224 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895536.1 protein_id gnl|my_center|LOCUS_00540 57922 55379 gene locus_tag LOCUS_00550 gene quiP 57922 55379 CDS product acyl-homoserine-lactone acylase QuiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112526.1 protein_id gnl|my_center|LOCUS_00550 58686 58045 gene locus_tag LOCUS_00560 58686 58045 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112525.1 protein_id gnl|my_center|LOCUS_00560 58751 59074 gene locus_tag LOCUS_00570 58751 59074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 59471 59061 gene locus_tag LOCUS_00580 59471 59061 CDS product LEA type 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081986.1 protein_id gnl|my_center|LOCUS_00580 59870 60430 gene locus_tag LOCUS_00590 59870 60430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081987.1 protein_id gnl|my_center|LOCUS_00590 61170 60550 gene locus_tag LOCUS_00600 61170 60550 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081997.1 protein_id gnl|my_center|LOCUS_00600 61570 61253 gene locus_tag LOCUS_00610 61570 61253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082000.1 protein_id gnl|my_center|LOCUS_00610 62043 61570 gene locus_tag LOCUS_00620 62043 61570 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082003.1 protein_id gnl|my_center|LOCUS_00620 62543 62046 gene locus_tag LOCUS_00630 62543 62046 CDS product DUF6231 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112524.1 protein_id gnl|my_center|LOCUS_00630 62674 63306 gene locus_tag LOCUS_00640 62674 63306 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082015.1 protein_id gnl|my_center|LOCUS_00640 63422 63721 gene locus_tag LOCUS_00650 63422 63721 CDS product DUF1145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082018.1 protein_id gnl|my_center|LOCUS_00650 63714 64523 gene locus_tag LOCUS_00660 63714 64523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112523.1 protein_id gnl|my_center|LOCUS_00660 65026 64562 gene locus_tag LOCUS_00670 65026 64562 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082024.1 protein_id gnl|my_center|LOCUS_00670 65156 67300 gene locus_tag LOCUS_00680 gene dinG 65156 67300 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112522.1 protein_id gnl|my_center|LOCUS_00680 67403 69652 gene locus_tag LOCUS_00690 67403 69652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895537.1 protein_id gnl|my_center|LOCUS_00690 69762 70907 gene locus_tag LOCUS_00700 69762 70907 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120625.1 protein_id gnl|my_center|LOCUS_00700 71113 71994 gene locus_tag LOCUS_00710 71113 71994 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082037.1 protein_id gnl|my_center|LOCUS_00710 72093 72740 gene locus_tag LOCUS_00720 gene pdxH 72093 72740 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112518.1 protein_id gnl|my_center|LOCUS_00720 72748 73860 gene locus_tag LOCUS_00730 72748 73860 CDS product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112517.1 protein_id gnl|my_center|LOCUS_00730 74019 75377 gene locus_tag LOCUS_00740 74019 75377 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086363.1 protein_id gnl|my_center|LOCUS_00740 75419 76564 gene locus_tag LOCUS_00750 75419 76564 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082051.1 protein_id gnl|my_center|LOCUS_00750 76785 76543 gene locus_tag LOCUS_00760 76785 76543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082053.1 protein_id gnl|my_center|LOCUS_00760 76973 77437 gene locus_tag LOCUS_00770 76973 77437 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082056.1 protein_id gnl|my_center|LOCUS_00770 77766 80567 gene locus_tag LOCUS_00780 77766 80567 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082059.1 protein_id gnl|my_center|LOCUS_00780 80567 80905 gene locus_tag LOCUS_00790 80567 80905 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082068.1 protein_id gnl|my_center|LOCUS_00790 80902 82401 gene locus_tag LOCUS_00800 80902 82401 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112516.1 protein_id gnl|my_center|LOCUS_00800 82398 82922 gene locus_tag LOCUS_00810 82398 82922 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112515.1 protein_id gnl|my_center|LOCUS_00810 82907 83176 gene locus_tag LOCUS_00820 82907 83176 CDS product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082079.1 protein_id gnl|my_center|LOCUS_00820 83173 83520 gene locus_tag LOCUS_00830 83173 83520 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082083.1 protein_id gnl|my_center|LOCUS_00830 83633 84538 gene locus_tag LOCUS_00840 83633 84538 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082086.1 protein_id gnl|my_center|LOCUS_00840 84549 85646 gene locus_tag LOCUS_00850 84549 85646 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112514.1 protein_id gnl|my_center|LOCUS_00850 85657 86178 gene locus_tag LOCUS_00860 85657 86178 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082093.1 protein_id gnl|my_center|LOCUS_00860 86175 86426 gene locus_tag LOCUS_00870 86175 86426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112513.1 protein_id gnl|my_center|LOCUS_00870 87120 86455 gene locus_tag LOCUS_00880 87120 86455 CDS product COG3650 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082099.1 protein_id gnl|my_center|LOCUS_00880 87215 87613 gene locus_tag LOCUS_00890 87215 87613 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895538.1 protein_id gnl|my_center|LOCUS_00890 88223 87624 gene locus_tag LOCUS_00900 88223 87624 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082103.1 protein_id gnl|my_center|LOCUS_00900 88329 89243 gene locus_tag LOCUS_00910 88329 89243 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082110.1 protein_id gnl|my_center|LOCUS_00910 89411 91252 gene locus_tag LOCUS_00920 89411 91252 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895539.1 protein_id gnl|my_center|LOCUS_00920 91289 93583 gene locus_tag LOCUS_00930 91289 93583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112509.1 protein_id gnl|my_center|LOCUS_00930 94361 93660 gene locus_tag LOCUS_00940 94361 93660 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086389.1 protein_id gnl|my_center|LOCUS_00940 95131 94364 gene locus_tag LOCUS_00950 gene livG 95131 94364 CDS product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082125.1 protein_id gnl|my_center|LOCUS_00950 96381 95128 gene locus_tag LOCUS_00960 96381 95128 CDS product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082131.1 protein_id gnl|my_center|LOCUS_00960 97301 96378 gene locus_tag LOCUS_00970 gene livH 97301 96378 CDS product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086391.1 protein_id gnl|my_center|LOCUS_00970 98683 97562 gene locus_tag LOCUS_00980 98683 97562 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082136.1 protein_id gnl|my_center|LOCUS_00980 98982 99299 gene locus_tag LOCUS_00990 98982 99299 CDS product DUF2288 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086400.1 protein_id gnl|my_center|LOCUS_00990 99366 99728 gene locus_tag LOCUS_01000 99366 99728 CDS product DUF5064 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082140.1 protein_id gnl|my_center|LOCUS_01000 99981 100388 gene locus_tag LOCUS_01010 gene flgB 99981 100388 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082144.1 protein_id gnl|my_center|LOCUS_01010 100394 100834 gene locus_tag LOCUS_01020 gene flgC 100394 100834 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082150.1 protein_id gnl|my_center|LOCUS_01020 100847 101560 gene locus_tag LOCUS_01030 gene flgD 100847 101560 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082153.1 protein_id gnl|my_center|LOCUS_01030 101588 102976 gene locus_tag LOCUS_01040 gene flgE 101588 102976 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082154.1 protein_id gnl|my_center|LOCUS_01040 103194 103943 gene locus_tag LOCUS_01050 gene flgF 103194 103943 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082159.1 protein_id gnl|my_center|LOCUS_01050 103990 104775 gene locus_tag LOCUS_01060 gene flgG 103990 104775 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082164.1 protein_id gnl|my_center|LOCUS_01060 104821 105516 gene locus_tag LOCUS_01070 gene flgH 104821 105516 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082166.1 protein_id gnl|my_center|LOCUS_01070 105528 106637 gene locus_tag LOCUS_01080 105528 106637 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082169.1 protein_id gnl|my_center|LOCUS_01080 106648 107850 gene locus_tag LOCUS_01090 gene flgJ 106648 107850 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112508.1 protein_id gnl|my_center|LOCUS_01090 107869 109917 gene locus_tag LOCUS_01100 gene flgK 107869 109917 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112507.1 protein_id gnl|my_center|LOCUS_01100 109956 111257 gene locus_tag LOCUS_01110 gene flgL 109956 111257 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112506.1 protein_id gnl|my_center|LOCUS_01110 111546 111701 gene locus_tag LOCUS_01120 111546 111701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01120 111656 112708 gene locus_tag LOCUS_01130 111656 112708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01130 112737 112961 gene locus_tag LOCUS_01140 112737 112961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 112964 114004 gene locus_tag LOCUS_01150 112964 114004 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202154.1 protein_id gnl|my_center|LOCUS_01150 114030 114797 gene locus_tag LOCUS_01160 114030 114797 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198214.1 protein_id gnl|my_center|LOCUS_01160 114808 115440 gene locus_tag LOCUS_01170 114808 115440 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700389.1 protein_id gnl|my_center|LOCUS_01170 115458 116588 gene locus_tag LOCUS_01180 115458 116588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 116585 117205 gene locus_tag LOCUS_01190 116585 117205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 117216 118355 gene locus_tag LOCUS_01200 117216 118355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 118483 119757 gene locus_tag LOCUS_01210 118483 119757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 119802 120569 gene locus_tag LOCUS_01220 gene kdsB 119802 120569 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030761.1 protein_id gnl|my_center|LOCUS_01220 120559 121059 gene locus_tag LOCUS_01230 120559 121059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 121056 122159 gene locus_tag LOCUS_01240 121056 122159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 122163 123779 gene locus_tag LOCUS_01250 122163 123779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 123894 127400 gene locus_tag LOCUS_01260 123894 127400 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157768866.1 protein_id gnl|my_center|LOCUS_01260 127625 128809 gene locus_tag LOCUS_01270 127625 128809 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154827.1 protein_id gnl|my_center|LOCUS_01270 128889 129275 gene locus_tag LOCUS_01280 128889 129275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 129353 130789 gene locus_tag LOCUS_01290 gene fliD 129353 130789 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082190.1 protein_id gnl|my_center|LOCUS_01290 130789 131187 gene locus_tag LOCUS_01300 gene fliS 130789 131187 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037104.1 protein_id gnl|my_center|LOCUS_01300 131246 131626 gene locus_tag LOCUS_01310 gene fliS 131246 131626 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082192.1 protein_id gnl|my_center|LOCUS_01310 131652 131945 gene locus_tag LOCUS_01320 gene fleP 131652 131945 CDS product pili length/flagellar attachment protein FleP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082194.1 protein_id gnl|my_center|LOCUS_01320 132227 133699 gene locus_tag LOCUS_01330 gene fleQ 132227 133699 CDS product transcriptional regulator FleQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086448.1 protein_id gnl|my_center|LOCUS_01330 133812 135020 gene locus_tag LOCUS_01340 gene fleS 133812 135020 CDS product sensor histidine kinase FleS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086450.1 protein_id gnl|my_center|LOCUS_01340 135025 136446 gene locus_tag LOCUS_01350 gene fleR 135025 136446 CDS product sigma-54-dependent response regulator transcription factor FleR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082202.1 protein_id gnl|my_center|LOCUS_01350 136693 137022 gene locus_tag LOCUS_01360 gene fliE 136693 137022 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086454.1 protein_id gnl|my_center|LOCUS_01360 137045 138841 gene locus_tag LOCUS_01370 gene fliF 137045 138841 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109118.1 protein_id gnl|my_center|LOCUS_01370 138847 139863 gene locus_tag LOCUS_01380 gene fliG 138847 139863 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082212.1 protein_id gnl|my_center|LOCUS_01380 139865 140671 gene locus_tag LOCUS_01390 gene fliH 139865 140671 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082217.1 protein_id gnl|my_center|LOCUS_01390 140661 142016 gene locus_tag LOCUS_01400 gene fliI 140661 142016 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086458.1 protein_id gnl|my_center|LOCUS_01400 142030 142473 gene locus_tag LOCUS_01410 gene fliJ 142030 142473 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082220.1 protein_id gnl|my_center|LOCUS_01410 143191 142478 gene locus_tag LOCUS_01420 143191 142478 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086461.1 protein_id gnl|my_center|LOCUS_01420 144586 143390 gene locus_tag LOCUS_01430 gene roeA 144586 143390 CDS product diguanylate cyclase RoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082226.1 protein_id gnl|my_center|LOCUS_01430 145860 144703 gene locus_tag LOCUS_01440 145860 144703 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082230.1 protein_id gnl|my_center|LOCUS_01440 145950 146729 gene locus_tag LOCUS_01450 145950 146729 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082235.1 protein_id gnl|my_center|LOCUS_01450 147444 146734 gene locus_tag LOCUS_01460 147444 146734 CDS product rRNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112501.1 protein_id gnl|my_center|LOCUS_01460 147557 148180 gene locus_tag LOCUS_01470 gene hcuA 147557 148180 CDS product hydrophobic compound transporter HcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082239.1 protein_id gnl|my_center|LOCUS_01470 148273 149421 gene locus_tag LOCUS_01480 gene hcuB 148273 149421 CDS product hydrophobic compound transporter HcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112500.1 protein_id gnl|my_center|LOCUS_01480 149646 149425 gene locus_tag LOCUS_01490 149646 149425 CDS product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082243.1 protein_id gnl|my_center|LOCUS_01490 149938 149747 gene locus_tag LOCUS_01500 149938 149747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109112.1 protein_id gnl|my_center|LOCUS_01500 150411 152177 gene locus_tag LOCUS_01510 gene hcuC 150411 152177 CDS product hydrophobic compound transporter HcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112499.1 protein_id gnl|my_center|LOCUS_01510 152515 152180 gene locus_tag LOCUS_01520 152515 152180 CDS product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112498.1 protein_id gnl|my_center|LOCUS_01520 154943 152619 gene locus_tag LOCUS_01530 154943 152619 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112497.1 protein_id gnl|my_center|LOCUS_01530 155198 156037 gene locus_tag LOCUS_01540 155198 156037 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082250.1 protein_id gnl|my_center|LOCUS_01540 156421 156047 gene locus_tag LOCUS_01550 156421 156047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082252.1 protein_id gnl|my_center|LOCUS_01550 157082 156528 gene locus_tag LOCUS_01560 157082 156528 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082253.1 protein_id gnl|my_center|LOCUS_01560 157863 157357 gene locus_tag LOCUS_01570 157863 157357 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082254.1 protein_id gnl|my_center|LOCUS_01570 159142 157835 gene locus_tag LOCUS_01580 gene tpbB 159142 157835 CDS product diguanylate cyclase TpbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082256.1 protein_id gnl|my_center|LOCUS_01580 159714 159142 gene locus_tag LOCUS_01590 gene yfiR 159714 159142 CDS product diguanylate cyclase inhibitor YfiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115307.1 protein_id gnl|my_center|LOCUS_01590 159924 160463 gene locus_tag LOCUS_01600 gene def 159924 160463 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245711.1 protein_id gnl|my_center|LOCUS_01600 161081 160761 gene locus_tag LOCUS_01610 161081 160761 CDS product DUF2025 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082265.1 protein_id gnl|my_center|LOCUS_01610 161312 162808 gene locus_tag LOCUS_01620 gene dgt 161312 162808 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112492.1 protein_id gnl|my_center|LOCUS_01620 162822 163574 gene locus_tag LOCUS_01630 162822 163574 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112491.1 protein_id gnl|my_center|LOCUS_01630 164168 163581 gene locus_tag LOCUS_01640 164168 163581 CDS product DUF4234 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112490.1 protein_id gnl|my_center|LOCUS_01640 165252 164263 gene locus_tag LOCUS_01650 165252 164263 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082273.1 protein_id gnl|my_center|LOCUS_01650 165387 166298 gene locus_tag LOCUS_01660 165387 166298 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086503.1 protein_id gnl|my_center|LOCUS_01660 166334 166741 gene locus_tag LOCUS_01670 gene fos 166334 166741 CDS product FosA family fosfomycin resistance glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082280.1 protein_id gnl|my_center|LOCUS_01670 167715 166738 gene locus_tag LOCUS_01680 167715 166738 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112489.1 protein_id gnl|my_center|LOCUS_01680 168971 167703 gene locus_tag LOCUS_01690 168971 167703 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082286.1 protein_id gnl|my_center|LOCUS_01690 169224 169973 gene locus_tag LOCUS_01700 169224 169973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003133880.1 protein_id gnl|my_center|LOCUS_01700 170333 169983 gene locus_tag LOCUS_01710 170333 169983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112487.1 protein_id gnl|my_center|LOCUS_01710 170813 170400 gene locus_tag LOCUS_01720 170813 170400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01720 171944 171069 gene locus_tag LOCUS_01730 gene hchA 171944 171069 CDS product protein deglycase HchA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112486.1 protein_id gnl|my_center|LOCUS_01730 172116 172847 gene locus_tag LOCUS_01740 172116 172847 CDS product autoinducer binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112485.1 protein_id gnl|my_center|LOCUS_01740 173870 172854 gene locus_tag LOCUS_01750 173870 172854 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112484.1 protein_id gnl|my_center|LOCUS_01750 173986 174861 gene locus_tag LOCUS_01760 173986 174861 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082301.1 protein_id gnl|my_center|LOCUS_01760 174952 175800 gene locus_tag LOCUS_01770 174952 175800 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112483.1 protein_id gnl|my_center|LOCUS_01770 176734 175898 gene locus_tag LOCUS_01780 176734 175898 CDS product bifunctional allantoicase/(S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086528.1 protein_id gnl|my_center|LOCUS_01780 177773 176871 gene locus_tag LOCUS_01790 177773 176871 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112482.1 protein_id gnl|my_center|LOCUS_01790 178655 177939 gene locus_tag LOCUS_01800 178655 177939 CDS product UTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086532.1 protein_id gnl|my_center|LOCUS_01800 179390 178737 gene locus_tag LOCUS_01810 179390 178737 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112481.1 protein_id gnl|my_center|LOCUS_01810 180849 179458 gene locus_tag LOCUS_01820 180849 179458 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112480.1 protein_id gnl|my_center|LOCUS_01820 181286 182188 gene locus_tag LOCUS_01830 181286 182188 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086538.1 protein_id gnl|my_center|LOCUS_01830 183374 182193 gene locus_tag LOCUS_01840 183374 182193 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112479.1 protein_id gnl|my_center|LOCUS_01840 184966 183476 gene locus_tag LOCUS_01850 184966 183476 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082330.1 protein_id gnl|my_center|LOCUS_01850 187142 185226 gene locus_tag LOCUS_01860 gene toxA 187142 185226 CDS product exotoxin A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112478.1 protein_id gnl|my_center|LOCUS_01860 187760 187392 gene locus_tag LOCUS_01870 187760 187392 CDS product DUF2195 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112477.1 protein_id gnl|my_center|LOCUS_01870 188386 189474 gene locus_tag LOCUS_01880 188386 189474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01880 189438 190076 gene locus_tag LOCUS_01890 189438 190076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01890 190083 190310 gene locus_tag LOCUS_01900 190083 190310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01900 190312 190575 gene locus_tag LOCUS_01910 190312 190575 CDS product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112475.1 protein_id gnl|my_center|LOCUS_01910 191091 191435 gene locus_tag LOCUS_01920 191091 191435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01920 191452 191724 gene locus_tag LOCUS_01930 191452 191724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 192140 192373 gene locus_tag LOCUS_01940 192140 192373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 193133 192579 gene locus_tag LOCUS_01950 193133 192579 CDS product Bro-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112473.1 protein_id gnl|my_center|LOCUS_01950 194199 193666 gene locus_tag LOCUS_01960 194199 193666 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 protein_id gnl|my_center|LOCUS_01960 195801 194554 gene locus_tag LOCUS_01970 195801 194554 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086547.1 protein_id gnl|my_center|LOCUS_01970 198956 196065 gene locus_tag LOCUS_01980 198956 196065 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082358.1 protein_id gnl|my_center|LOCUS_01980 199689 200399 gene locus_tag LOCUS_01990 199689 200399 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082360.1 protein_id gnl|my_center|LOCUS_01990 200483 201379 gene locus_tag LOCUS_02000 200483 201379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02000 201322 202077 gene locus_tag LOCUS_02010 201322 202077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02010 202397 202606 gene locus_tag LOCUS_02020 202397 202606 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082372.1 protein_id gnl|my_center|LOCUS_02020 203131 202712 gene locus_tag LOCUS_02030 203131 202712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082373.1 protein_id gnl|my_center|LOCUS_02030 203916 203113 gene locus_tag LOCUS_02040 203916 203113 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112471.1 protein_id gnl|my_center|LOCUS_02040 205067 203916 gene locus_tag LOCUS_02050 gene dapE 205067 203916 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082377.1 protein_id gnl|my_center|LOCUS_02050 207791 205182 gene locus_tag LOCUS_02060 gene ndvB 207791 205182 CDS product glycosyltransferase NdvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115817.1 protein_id gnl|my_center|LOCUS_02060 208157 207912 gene locus_tag LOCUS_02070 208157 207912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 208938 208288 gene locus_tag LOCUS_02080 208938 208288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 209603 208938 gene locus_tag LOCUS_02090 209603 208938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 209950 209633 gene locus_tag LOCUS_02100 209950 209633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 210748 210305 gene locus_tag LOCUS_02110 210748 210305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 211595 210942 gene locus_tag LOCUS_02120 211595 210942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 211999 211769 gene locus_tag LOCUS_02130 211999 211769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 212649 211996 gene locus_tag LOCUS_02140 212649 211996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 215103 215447 gene locus_tag LOCUS_02150 215103 215447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 215750 216562 gene locus_tag LOCUS_02160 gene tcdA 215750 216562 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112469.1 protein_id gnl|my_center|LOCUS_02160 217291 216563 gene locus_tag LOCUS_02170 217291 216563 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112468.1 protein_id gnl|my_center|LOCUS_02170 218307 217519 gene locus_tag LOCUS_02180 218307 217519 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112467.1 protein_id gnl|my_center|LOCUS_02180 218483 219154 gene locus_tag LOCUS_02190 218483 219154 CDS product polysaccharide lyase family 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106699.1 protein_id gnl|my_center|LOCUS_02190 219654 219974 gene locus_tag LOCUS_02200 219654 219974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082401.1 protein_id gnl|my_center|LOCUS_02200 220052 222109 gene locus_tag LOCUS_02210 220052 222109 CDS product arachidonate 15-lipoxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895542.1 protein_id gnl|my_center|LOCUS_02210 222887 222153 gene locus_tag LOCUS_02220 222887 222153 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106697.1 protein_id gnl|my_center|LOCUS_02220 223344 224540 gene locus_tag LOCUS_02230 223344 224540 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082409.1 protein_id gnl|my_center|LOCUS_02230 225168 224572 gene locus_tag LOCUS_02240 225168 224572 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082412.1 protein_id gnl|my_center|LOCUS_02240 225670 225179 gene locus_tag LOCUS_02250 225670 225179 CDS product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082414.1 protein_id gnl|my_center|LOCUS_02250 228185 225681 gene locus_tag LOCUS_02260 gene napA 228185 225681 CDS product nitrate reductase catalytic subunit NapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895543.1 protein_id gnl|my_center|LOCUS_02260 228495 228166 gene locus_tag LOCUS_02270 228495 228166 CDS product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082422.1 protein_id gnl|my_center|LOCUS_02270 228979 228488 gene locus_tag LOCUS_02280 gene napF 228979 228488 CDS product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112466.1 protein_id gnl|my_center|LOCUS_02280 229155 228988 gene locus_tag LOCUS_02290 gene napE 229155 228988 CDS product periplasmic nitrate reductase, NapE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082429.1 protein_id gnl|my_center|LOCUS_02290 229377 229979 gene locus_tag LOCUS_02300 229377 229979 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082431.1 protein_id gnl|my_center|LOCUS_02300 230059 230736 gene locus_tag LOCUS_02310 gene phoP 230059 230736 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082436.1 protein_id gnl|my_center|LOCUS_02310 230733 232079 gene locus_tag LOCUS_02320 gene phoQ 230733 232079 CDS product two-component system sensor histidine kinase PhoQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082438.1 protein_id gnl|my_center|LOCUS_02320 232181 235543 gene locus_tag LOCUS_02330 232181 235543 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112465.1 protein_id gnl|my_center|LOCUS_02330 236548 235547 gene locus_tag LOCUS_02340 236548 235547 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106595.1 protein_id gnl|my_center|LOCUS_02340 236884 238194 gene locus_tag LOCUS_02350 gene dctA 236884 238194 CDS product C4-dicarboxylate transporter DctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082442.1 protein_id gnl|my_center|LOCUS_02350 239159 238269 gene locus_tag LOCUS_02360 239159 238269 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109209.1 protein_id gnl|my_center|LOCUS_02360 239361 239990 gene locus_tag LOCUS_02370 239361 239990 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112463.1 protein_id gnl|my_center|LOCUS_02370 239987 241006 gene locus_tag LOCUS_02380 239987 241006 CDS product LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112461.1 protein_id gnl|my_center|LOCUS_02380 241108 242247 gene locus_tag LOCUS_02390 241108 242247 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082447.1 protein_id gnl|my_center|LOCUS_02390 242336 243517 gene locus_tag LOCUS_02400 242336 243517 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082450.1 protein_id gnl|my_center|LOCUS_02400 244016 243519 gene locus_tag LOCUS_02410 244016 243519 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082453.1 protein_id gnl|my_center|LOCUS_02410 244783 244184 gene locus_tag LOCUS_02420 244783 244184 CDS product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082455.1 protein_id gnl|my_center|LOCUS_02420 245535 244942 gene locus_tag LOCUS_02430 245535 244942 CDS product DNA-J related domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112460.1 protein_id gnl|my_center|LOCUS_02430 245638 246462 gene locus_tag LOCUS_02440 gene ttcA 245638 246462 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082462.1 protein_id gnl|my_center|LOCUS_02440 246509 247180 gene locus_tag LOCUS_02450 246509 247180 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082464.1 protein_id gnl|my_center|LOCUS_02450 248600 247182 gene locus_tag LOCUS_02460 248600 247182 CDS product basic amino acid/polyamine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112459.1 protein_id gnl|my_center|LOCUS_02460 249469 248705 gene locus_tag LOCUS_02470 249469 248705 CDS product dimethylarginine dimethylaminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086612.1 protein_id gnl|my_center|LOCUS_02470 249680 251080 gene locus_tag LOCUS_02480 gene ddaR 249680 251080 CDS product transcriptional regulator DdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112458.1 protein_id gnl|my_center|LOCUS_02480 251093 251863 gene locus_tag LOCUS_02490 251093 251863 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112457.1 protein_id gnl|my_center|LOCUS_02490 251929 252546 gene locus_tag LOCUS_02500 251929 252546 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082470.1 protein_id gnl|my_center|LOCUS_02500 252629 253162 gene locus_tag LOCUS_02510 252629 253162 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082473.1 protein_id gnl|my_center|LOCUS_02510 253182 253844 gene locus_tag LOCUS_02520 253182 253844 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086626.1 protein_id gnl|my_center|LOCUS_02520 254766 253852 gene locus_tag LOCUS_02530 254766 253852 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082475.1 protein_id gnl|my_center|LOCUS_02530 255067 255684 gene locus_tag LOCUS_02540 gene ycaC 255067 255684 CDS product isochorismate family cysteine hydrolase YcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082476.1 protein_id gnl|my_center|LOCUS_02540 255827 256234 gene locus_tag LOCUS_02550 255827 256234 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112456.1 protein_id gnl|my_center|LOCUS_02550 256262 256819 gene locus_tag LOCUS_02560 256262 256819 CDS product NAD(P)H-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082483.1 protein_id gnl|my_center|LOCUS_02560 256846 257793 gene locus_tag LOCUS_02570 256846 257793 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112455.1 protein_id gnl|my_center|LOCUS_02570 257953 258426 gene locus_tag LOCUS_02580 257953 258426 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082488.1 protein_id gnl|my_center|LOCUS_02580 258429 260270 gene locus_tag LOCUS_02590 gene kefB 258429 260270 CDS product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112454.1 protein_id gnl|my_center|LOCUS_02590 260437 261936 gene locus_tag LOCUS_02600 260437 261936 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115383.1 protein_id gnl|my_center|LOCUS_02600 262888 261953 gene locus_tag LOCUS_02610 262888 261953 CDS product DedA family protein/thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112452.1 protein_id gnl|my_center|LOCUS_02610 263756 263058 gene locus_tag LOCUS_02620 263756 263058 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086661.1 protein_id gnl|my_center|LOCUS_02620 264509 263874 gene locus_tag LOCUS_02630 264509 263874 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112451.1 protein_id gnl|my_center|LOCUS_02630 265735 264506 gene locus_tag LOCUS_02640 265735 264506 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112450.1 protein_id gnl|my_center|LOCUS_02640 266691 265732 gene locus_tag LOCUS_02650 266691 265732 CDS product clavaminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082503.1 protein_id gnl|my_center|LOCUS_02650 268286 266688 gene locus_tag LOCUS_02660 268286 266688 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112449.1 protein_id gnl|my_center|LOCUS_02660 269764 268286 gene locus_tag LOCUS_02670 269764 268286 CDS product fatty acid--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895544.1 protein_id gnl|my_center|LOCUS_02670 270520 269774 gene locus_tag LOCUS_02680 270520 269774 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112447.1 protein_id gnl|my_center|LOCUS_02680 271884 270517 gene locus_tag LOCUS_02690 271884 270517 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086676.1 protein_id gnl|my_center|LOCUS_02690 272759 271881 gene locus_tag LOCUS_02700 272759 271881 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082507.1 protein_id gnl|my_center|LOCUS_02700 273370 272756 gene locus_tag LOCUS_02710 273370 272756 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109228.1 protein_id gnl|my_center|LOCUS_02710 274626 273364 gene locus_tag LOCUS_02720 274626 273364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112446.1 protein_id gnl|my_center|LOCUS_02720 276443 274623 gene locus_tag LOCUS_02730 276443 274623 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895545.1 protein_id gnl|my_center|LOCUS_02730 278320 277163 gene locus_tag LOCUS_02740 278320 277163 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082509.1 protein_id gnl|my_center|LOCUS_02740 279309 278416 gene locus_tag LOCUS_02750 279309 278416 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082510.1 protein_id gnl|my_center|LOCUS_02750 279394 280173 gene locus_tag LOCUS_02760 279394 280173 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112444.1 protein_id gnl|my_center|LOCUS_02760 280807 280181 gene locus_tag LOCUS_02770 280807 280181 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082512.1 protein_id gnl|my_center|LOCUS_02770 280913 281521 gene locus_tag LOCUS_02780 280913 281521 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003133652.1 protein_id gnl|my_center|LOCUS_02780 281518 282408 gene locus_tag LOCUS_02790 281518 282408 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895546.1 protein_id gnl|my_center|LOCUS_02790 282835 282485 gene locus_tag LOCUS_02800 282835 282485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082515.1 protein_id gnl|my_center|LOCUS_02800 283751 282945 gene locus_tag LOCUS_02810 283751 282945 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082516.1 protein_id gnl|my_center|LOCUS_02810 283894 284082 gene locus_tag LOCUS_02820 283894 284082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 284095 285003 gene locus_tag LOCUS_02830 284095 285003 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112442.1 protein_id gnl|my_center|LOCUS_02830 285003 287042 gene locus_tag LOCUS_02840 285003 287042 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112441.1 protein_id gnl|my_center|LOCUS_02840 287039 287296 gene locus_tag LOCUS_02850 287039 287296 CDS product DUF2790 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107483.1 protein_id gnl|my_center|LOCUS_02850 287821 287318 gene locus_tag LOCUS_02860 287821 287318 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107482.1 protein_id gnl|my_center|LOCUS_02860 288013 288795 gene locus_tag LOCUS_02870 288013 288795 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082522.1 protein_id gnl|my_center|LOCUS_02870 290309 288798 gene locus_tag LOCUS_02880 290309 288798 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082523.1 protein_id gnl|my_center|LOCUS_02880 291450 290299 gene locus_tag LOCUS_02890 291450 290299 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112440.1 protein_id gnl|my_center|LOCUS_02890 292895 291447 gene locus_tag LOCUS_02900 292895 291447 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147345.1 protein_id gnl|my_center|LOCUS_02900 294162 293278 gene locus_tag LOCUS_02910 294162 293278 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086717.1 protein_id gnl|my_center|LOCUS_02910 295016 294219 gene locus_tag LOCUS_02920 295016 294219 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086719.1 protein_id gnl|my_center|LOCUS_02920 295181 295741 gene locus_tag LOCUS_02930 295181 295741 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086720.1 protein_id gnl|my_center|LOCUS_02930 295821 297593 gene locus_tag LOCUS_02940 295821 297593 CDS product S8/S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086721.1 protein_id gnl|my_center|LOCUS_02940 300192 297616 gene locus_tag LOCUS_02950 300192 297616 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114970.1 protein_id gnl|my_center|LOCUS_02950 300742 300428 gene locus_tag LOCUS_02960 300742 300428 CDS product LasR-specific antiactivator QslA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119603.1 protein_id gnl|my_center|LOCUS_02960 301784 303028 gene locus_tag LOCUS_02970 gene aprX 301784 303028 CDS product type I secretion system-dependent protein AprX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082538.1 protein_id gnl|my_center|LOCUS_02970 303115 304896 gene locus_tag LOCUS_02980 gene aprD 303115 304896 CDS product alkaline protease secretion ATP-binding protein AprD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082539.1 protein_id gnl|my_center|LOCUS_02980 304893 306191 gene locus_tag LOCUS_02990 gene aprE 304893 306191 CDS product alkaline protease secretion protein AprE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082540.1 protein_id gnl|my_center|LOCUS_02990 306195 307640 gene locus_tag LOCUS_03000 gene aprF 306195 307640 CDS product alkaline protease secretion protein AprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110827.1 protein_id gnl|my_center|LOCUS_03000 307999 309438 gene locus_tag LOCUS_03010 gene aprA 307999 309438 CDS product serralysin family metalloprotease AprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082542.1 protein_id gnl|my_center|LOCUS_03010 309721 310080 gene locus_tag LOCUS_03020 gene aprI 309721 310080 CDS product alkaline proteinase inhibitor AprI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082543.1 protein_id gnl|my_center|LOCUS_03020 311718 310093 gene locus_tag LOCUS_03030 311718 310093 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114967.1 protein_id gnl|my_center|LOCUS_03030 311958 312962 gene locus_tag LOCUS_03040 gene lhpD 311958 312962 CDS product bifunctional delta(1)-pyrroline-2-carboxylate/delta(1)-piperideine-2-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082545.1 protein_id gnl|my_center|LOCUS_03040 314646 313066 gene locus_tag LOCUS_03050 314646 313066 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114966.1 protein_id gnl|my_center|LOCUS_03050 315656 314739 gene locus_tag LOCUS_03060 315656 314739 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105052.1 protein_id gnl|my_center|LOCUS_03060 316841 315807 gene locus_tag LOCUS_03070 316841 315807 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114965.1 protein_id gnl|my_center|LOCUS_03070 317589 316867 gene locus_tag LOCUS_03080 317589 316867 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114964.1 protein_id gnl|my_center|LOCUS_03080 318230 317586 gene locus_tag LOCUS_03090 318230 317586 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114963.1 protein_id gnl|my_center|LOCUS_03090 318906 318241 gene locus_tag LOCUS_03100 318906 318241 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082559.1 protein_id gnl|my_center|LOCUS_03100 320639 318906 gene locus_tag LOCUS_03110 320639 318906 CDS product aconitase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114962.1 protein_id gnl|my_center|LOCUS_03110 321519 320698 gene locus_tag LOCUS_03120 321519 320698 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082561.1 protein_id gnl|my_center|LOCUS_03120 322574 321777 gene locus_tag LOCUS_03130 322574 321777 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082563.1 protein_id gnl|my_center|LOCUS_03130 324058 322616 gene locus_tag LOCUS_03140 324058 322616 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114961.1 protein_id gnl|my_center|LOCUS_03140 324178 325041 gene locus_tag LOCUS_03150 324178 325041 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082569.1 protein_id gnl|my_center|LOCUS_03150 326204 325338 gene locus_tag LOCUS_03160 326204 325338 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114959.1 protein_id gnl|my_center|LOCUS_03160 326304 327206 gene locus_tag LOCUS_03170 326304 327206 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114958.1 protein_id gnl|my_center|LOCUS_03170 328456 327203 gene locus_tag LOCUS_03180 328456 327203 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114957.1 protein_id gnl|my_center|LOCUS_03180 328689 328453 gene locus_tag LOCUS_03190 328689 328453 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523445.1 protein_id gnl|my_center|LOCUS_03190 329801 328686 gene locus_tag LOCUS_03200 gene lhpB 329801 328686 CDS product D-hydroxyproline dehydrogenase subunit beta LhpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114955.1 protein_id gnl|my_center|LOCUS_03200 330742 329798 gene locus_tag LOCUS_03210 330742 329798 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114954.1 protein_id gnl|my_center|LOCUS_03210 331527 330859 gene locus_tag LOCUS_03220 331527 330859 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114953.1 protein_id gnl|my_center|LOCUS_03220 331772 333811 gene locus_tag LOCUS_03230 331772 333811 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004348771.1 protein_id gnl|my_center|LOCUS_03230 334163 336013 gene locus_tag LOCUS_03240 gene btuB 334163 336013 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_03240 336077 336688 gene locus_tag LOCUS_03250 gene cobO 336077 336688 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086769.1 protein_id gnl|my_center|LOCUS_03250 336720 338027 gene locus_tag LOCUS_03260 336720 338027 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082590.1 protein_id gnl|my_center|LOCUS_03260 338029 338685 gene locus_tag LOCUS_03270 gene bluB 338029 338685 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082592.1 protein_id gnl|my_center|LOCUS_03270 338667 339620 gene locus_tag LOCUS_03280 gene cbiB 338667 339620 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112351.1 protein_id gnl|my_center|LOCUS_03280 339634 340608 gene locus_tag LOCUS_03290 gene cobD 339634 340608 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112352.1 protein_id gnl|my_center|LOCUS_03290 340601 342073 gene locus_tag LOCUS_03300 340601 342073 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112353.1 protein_id gnl|my_center|LOCUS_03300 342066 342587 gene locus_tag LOCUS_03310 gene cobU 342066 342587 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082599.1 protein_id gnl|my_center|LOCUS_03310 342584 343639 gene locus_tag LOCUS_03320 gene cobT 342584 343639 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112354.1 protein_id gnl|my_center|LOCUS_03320 343636 344220 gene locus_tag LOCUS_03330 343636 344220 CDS product alpha-ribazole phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112355.1 protein_id gnl|my_center|LOCUS_03330 344223 344960 gene locus_tag LOCUS_03340 344223 344960 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086787.1 protein_id gnl|my_center|LOCUS_03340 346428 344923 gene locus_tag LOCUS_03350 346428 344923 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112356.1 protein_id gnl|my_center|LOCUS_03350 346547 347107 gene locus_tag LOCUS_03360 346547 347107 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109279.1 protein_id gnl|my_center|LOCUS_03360 348958 347138 gene locus_tag LOCUS_03370 348958 347138 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086792.1 protein_id gnl|my_center|LOCUS_03370 349125 349538 gene locus_tag LOCUS_03380 349125 349538 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895547.1 protein_id gnl|my_center|LOCUS_03380 349612 350811 gene locus_tag LOCUS_03390 349612 350811 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086798.1 protein_id gnl|my_center|LOCUS_03390 350976 351530 gene locus_tag LOCUS_03400 350976 351530 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082631.1 protein_id gnl|my_center|LOCUS_03400 352863 351589 gene locus_tag LOCUS_03410 352863 351589 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082638.1 protein_id gnl|my_center|LOCUS_03410 352696 352791 gene locus_tag LOCUS_t00020 352696 352791 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 353548 353069 gene locus_tag LOCUS_03420 353548 353069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082640.1 protein_id gnl|my_center|LOCUS_03420 354363 353770 gene locus_tag LOCUS_03430 354363 353770 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082643.1 protein_id gnl|my_center|LOCUS_03430 354475 355314 gene locus_tag LOCUS_03440 354475 355314 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112358.1 protein_id gnl|my_center|LOCUS_03440 356193 355339 gene locus_tag LOCUS_03450 356193 355339 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109274.1 protein_id gnl|my_center|LOCUS_03450 357555 356494 gene locus_tag LOCUS_03460 357555 356494 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112360.1 protein_id gnl|my_center|LOCUS_03460 357696 358820 gene locus_tag LOCUS_03470 gene rnd 357696 358820 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895548.1 protein_id gnl|my_center|LOCUS_03470 358817 359110 gene locus_tag LOCUS_03480 358817 359110 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100122.1 protein_id gnl|my_center|LOCUS_03480 359365 360297 gene locus_tag LOCUS_03490 359365 360297 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082652.1 protein_id gnl|my_center|LOCUS_03490 361286 360309 gene locus_tag LOCUS_03500 gene aitP 361286 360309 CDS product CDF family iron/cobalt efflux transporter AitP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112362.1 protein_id gnl|my_center|LOCUS_03500 361354 361629 gene locus_tag LOCUS_03510 361354 361629 CDS product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082658.1 protein_id gnl|my_center|LOCUS_03510 361706 362155 gene locus_tag LOCUS_03520 361706 362155 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082662.1 protein_id gnl|my_center|LOCUS_03520 362304 362831 gene locus_tag LOCUS_03530 362304 362831 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082669.1 protein_id gnl|my_center|LOCUS_03530 362828 363811 gene locus_tag LOCUS_03540 362828 363811 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082671.1 protein_id gnl|my_center|LOCUS_03540 363940 366495 gene locus_tag LOCUS_03550 gene hxuC 363940 366495 CDS product heme receptor HxuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112363.1 protein_id gnl|my_center|LOCUS_03550 367065 366502 gene locus_tag LOCUS_03560 gene lepB 367065 366502 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112364.1 protein_id gnl|my_center|LOCUS_03560 369169 367118 gene locus_tag LOCUS_03570 369169 367118 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112365.1 protein_id gnl|my_center|LOCUS_03570 369318 369791 gene locus_tag LOCUS_03580 369318 369791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086834.1 protein_id gnl|my_center|LOCUS_03580 369855 370316 gene locus_tag LOCUS_03590 369855 370316 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895549.1 protein_id gnl|my_center|LOCUS_03590 370320 371093 gene locus_tag LOCUS_03600 370320 371093 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082680.1 protein_id gnl|my_center|LOCUS_03600 371120 371644 gene locus_tag LOCUS_03610 371120 371644 CDS product DUF2937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082681.1 protein_id gnl|my_center|LOCUS_03610 372513 371653 gene locus_tag LOCUS_03620 372513 371653 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082684.1 protein_id gnl|my_center|LOCUS_03620 372681 373796 gene locus_tag LOCUS_03630 gene phnW 372681 373796 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112368.1 protein_id gnl|my_center|LOCUS_03630 373832 374659 gene locus_tag LOCUS_03640 373832 374659 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112369.1 protein_id gnl|my_center|LOCUS_03640 375621 374710 gene locus_tag LOCUS_03650 375621 374710 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082689.1 protein_id gnl|my_center|LOCUS_03650 375729 377087 gene locus_tag LOCUS_03660 375729 377087 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082692.1 protein_id gnl|my_center|LOCUS_03660 377101 377487 gene locus_tag LOCUS_03670 377101 377487 CDS product DUF4440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082694.1 protein_id gnl|my_center|LOCUS_03670 378109 377495 gene locus_tag LOCUS_03680 378109 377495 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082696.1 protein_id gnl|my_center|LOCUS_03680 378267 379808 gene locus_tag LOCUS_03690 378267 379808 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112370.1 protein_id gnl|my_center|LOCUS_03690 380435 381430 gene locus_tag LOCUS_03700 gene cyoA 380435 381430 CDS product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082702.1 protein_id gnl|my_center|LOCUS_03700 381437 383413 gene locus_tag LOCUS_03710 gene cyoB 381437 383413 CDS product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112371.1 protein_id gnl|my_center|LOCUS_03710 383417 384046 gene locus_tag LOCUS_03720 gene cyoC 383417 384046 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086858.1 protein_id gnl|my_center|LOCUS_03720 384046 384381 gene locus_tag LOCUS_03730 gene cyoD 384046 384381 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109258.1 protein_id gnl|my_center|LOCUS_03730 384392 385282 gene locus_tag LOCUS_03740 gene cyoE 384392 385282 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082726.1 protein_id gnl|my_center|LOCUS_03740 385521 387719 gene locus_tag LOCUS_03750 385521 387719 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082728.1 protein_id gnl|my_center|LOCUS_03750 387848 388180 gene locus_tag LOCUS_03760 387848 388180 CDS product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082731.1 protein_id gnl|my_center|LOCUS_03760 388240 388752 gene locus_tag LOCUS_03770 388240 388752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112372.1 protein_id gnl|my_center|LOCUS_03770 389018 389425 gene locus_tag LOCUS_03780 389018 389425 CDS product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082737.1 protein_id gnl|my_center|LOCUS_03780 389422 390969 gene locus_tag LOCUS_03790 gene ilvA 389422 390969 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082739.1 protein_id gnl|my_center|LOCUS_03790 391061 392989 gene locus_tag LOCUS_03800 391061 392989 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895550.1 protein_id gnl|my_center|LOCUS_03800 393901 392993 gene locus_tag LOCUS_03810 393901 392993 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112374.1 protein_id gnl|my_center|LOCUS_03810 394001 394417 gene locus_tag LOCUS_03820 394001 394417 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004348825.1 protein_id gnl|my_center|LOCUS_03820 394423 395202 gene locus_tag LOCUS_03830 394423 395202 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112376.1 protein_id gnl|my_center|LOCUS_03830 396805 395258 gene locus_tag LOCUS_03840 396805 395258 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082751.1 protein_id gnl|my_center|LOCUS_03840 397131 397754 gene locus_tag LOCUS_03850 397131 397754 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105355.1 protein_id gnl|my_center|LOCUS_03850 397966 397760 gene locus_tag LOCUS_03860 397966 397760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082754.1 protein_id gnl|my_center|LOCUS_03860 399273 398161 gene locus_tag LOCUS_03870 399273 398161 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112378.1 protein_id gnl|my_center|LOCUS_03870 400882 399557 gene locus_tag LOCUS_03880 400882 399557 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082756.1 protein_id gnl|my_center|LOCUS_03880 402780 400879 gene locus_tag LOCUS_03890 402780 400879 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115580.1 protein_id gnl|my_center|LOCUS_03890 403964 402876 gene locus_tag LOCUS_03900 403964 402876 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104093.1 protein_id gnl|my_center|LOCUS_03900 405723 404050 gene locus_tag LOCUS_03910 gene ggt 405723 404050 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086881.1 protein_id gnl|my_center|LOCUS_03910 406535 405801 gene locus_tag LOCUS_03920 406535 405801 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082761.1 protein_id gnl|my_center|LOCUS_03920 407197 406532 gene locus_tag LOCUS_03930 407197 406532 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082765.1 protein_id gnl|my_center|LOCUS_03930 407943 407197 gene locus_tag LOCUS_03940 407943 407197 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082767.1 protein_id gnl|my_center|LOCUS_03940 409054 408146 gene locus_tag LOCUS_03950 409054 408146 CDS product glutamate/aspartate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082770.1 protein_id gnl|my_center|LOCUS_03950 409506 409964 gene locus_tag LOCUS_03960 gene pagP 409506 409964 CDS product palmitoyltransferase PagP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082771.1 protein_id gnl|my_center|LOCUS_03960 410060 410854 gene locus_tag LOCUS_03970 410060 410854 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082773.1 protein_id gnl|my_center|LOCUS_03970 411038 412627 gene locus_tag LOCUS_03980 411038 412627 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895552.1 protein_id gnl|my_center|LOCUS_03980 413954 412638 gene locus_tag LOCUS_03990 413954 412638 CDS product Orn/Lys/Arg decarboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895553.1 protein_id gnl|my_center|LOCUS_03990 413889 414158 gene locus_tag LOCUS_04000 413889 414158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 414961 414269 gene locus_tag LOCUS_04010 414961 414269 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082787.1 protein_id gnl|my_center|LOCUS_04010 415396 415734 gene locus_tag LOCUS_04020 415396 415734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 415917 416267 gene locus_tag LOCUS_04030 415917 416267 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082795.1 protein_id gnl|my_center|LOCUS_04030 416442 417191 gene locus_tag LOCUS_04040 416442 417191 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112385.1 protein_id gnl|my_center|LOCUS_04040 417188 418432 gene locus_tag LOCUS_04050 417188 418432 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082803.1 protein_id gnl|my_center|LOCUS_04050 419651 418440 gene locus_tag LOCUS_04060 419651 418440 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112386.1 protein_id gnl|my_center|LOCUS_04060 420234 419821 gene locus_tag LOCUS_04070 420234 419821 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082839.1 protein_id gnl|my_center|LOCUS_04070 420696 420271 gene locus_tag LOCUS_04080 420696 420271 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086910.1 protein_id gnl|my_center|LOCUS_04080 420954 421223 gene locus_tag LOCUS_04090 420954 421223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 421246 422352 gene locus_tag LOCUS_04100 421246 422352 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109596.1 protein_id gnl|my_center|LOCUS_04100 422421 422897 gene locus_tag LOCUS_04110 422421 422897 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086914.1 protein_id gnl|my_center|LOCUS_04110 423311 422913 gene locus_tag LOCUS_04120 423311 422913 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106807.1 protein_id gnl|my_center|LOCUS_04120 423936 423349 gene locus_tag LOCUS_04130 423936 423349 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895555.1 protein_id gnl|my_center|LOCUS_04130 423998 424891 gene locus_tag LOCUS_04140 gene rhtA 423998 424891 CDS product threonine/homoserine exporter RhtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086919.1 protein_id gnl|my_center|LOCUS_04140 426307 424874 gene locus_tag LOCUS_04150 gene pmpM 426307 424874 CDS product proton-coupled multidrug efflux MATE transporter PmpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112388.1 protein_id gnl|my_center|LOCUS_04150 426938 427261 gene locus_tag LOCUS_04160 426938 427261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082848.1 protein_id gnl|my_center|LOCUS_04160 427274 428014 gene locus_tag LOCUS_04170 427274 428014 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082855.1 protein_id gnl|my_center|LOCUS_04170 428011 428853 gene locus_tag LOCUS_04180 428011 428853 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112389.1 protein_id gnl|my_center|LOCUS_04180 428931 431372 gene locus_tag LOCUS_04190 428931 431372 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086926.1 protein_id gnl|my_center|LOCUS_04190 432338 431568 gene locus_tag LOCUS_04200 432338 431568 CDS product Fic/DOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102000.1 protein_id gnl|my_center|LOCUS_04200 432595 432335 gene locus_tag LOCUS_04210 432595 432335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 433598 432762 gene locus_tag LOCUS_04220 433598 432762 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109588.1 protein_id gnl|my_center|LOCUS_04220 435306 433882 gene locus_tag LOCUS_04230 435306 433882 CDS product IS1182-like element ISPa22 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112390.1 protein_id gnl|my_center|LOCUS_04230 435671 436423 gene locus_tag LOCUS_04240 435671 436423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112391.1 protein_id gnl|my_center|LOCUS_04240 436446 438311 gene locus_tag LOCUS_04250 436446 438311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010793970.1 protein_id gnl|my_center|LOCUS_04250 439515 438814 gene locus_tag LOCUS_04260 439515 438814 CDS product DUF2290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112393.1 protein_id gnl|my_center|LOCUS_04260 441643 439508 gene locus_tag LOCUS_04270 441643 439508 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003159898.1 protein_id gnl|my_center|LOCUS_04270 443631 442363 gene locus_tag LOCUS_04280 gene fabF 443631 442363 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895556.1 protein_id gnl|my_center|LOCUS_04280 443740 444246 gene locus_tag LOCUS_04290 443740 444246 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086962.1 protein_id gnl|my_center|LOCUS_04290 444461 445603 gene locus_tag LOCUS_04300 gene pdxB 444461 445603 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112396.1 protein_id gnl|my_center|LOCUS_04300 447371 445638 gene locus_tag LOCUS_04310 gene aceK 447371 445638 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112397.1 protein_id gnl|my_center|LOCUS_04310 447498 448040 gene locus_tag LOCUS_04320 447498 448040 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082887.1 protein_id gnl|my_center|LOCUS_04320 448144 447959 gene locus_tag LOCUS_04330 448144 447959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 448195 448557 gene locus_tag LOCUS_04340 448195 448557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082890.1 protein_id gnl|my_center|LOCUS_04340 449480 448647 gene locus_tag LOCUS_04350 449480 448647 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112398.1 protein_id gnl|my_center|LOCUS_04350 449627 450538 gene locus_tag LOCUS_04360 449627 450538 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895557.1 protein_id gnl|my_center|LOCUS_04360 450852 451136 gene locus_tag LOCUS_04370 450852 451136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115603.1 protein_id gnl|my_center|LOCUS_04370 451152 451568 gene locus_tag LOCUS_04380 451152 451568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082897.1 protein_id gnl|my_center|LOCUS_04380 453217 451595 gene locus_tag LOCUS_04390 453217 451595 CDS product two-component system sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082898.1 protein_id gnl|my_center|LOCUS_04390 453363 453995 gene locus_tag LOCUS_04400 453363 453995 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112415.1 protein_id gnl|my_center|LOCUS_04400 454076 454417 gene locus_tag LOCUS_04410 454076 454417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082903.1 protein_id gnl|my_center|LOCUS_04410 455353 454433 gene locus_tag LOCUS_04420 455353 454433 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112416.1 protein_id gnl|my_center|LOCUS_04420 455558 458845 gene locus_tag LOCUS_04430 455558 458845 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112417.1 protein_id gnl|my_center|LOCUS_04430 459280 458873 gene locus_tag LOCUS_04440 459280 458873 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112418.1 protein_id gnl|my_center|LOCUS_04440 460023 459358 gene locus_tag LOCUS_04450 460023 459358 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082920.1 protein_id gnl|my_center|LOCUS_04450 460116 460748 gene locus_tag LOCUS_04460 460116 460748 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112419.1 protein_id gnl|my_center|LOCUS_04460 461106 460879 gene locus_tag LOCUS_04470 461106 460879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082927.1 protein_id gnl|my_center|LOCUS_04470 461253 463232 gene locus_tag LOCUS_04480 461253 463232 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895565.1 protein_id gnl|my_center|LOCUS_04480 464010 463252 gene locus_tag LOCUS_04490 464010 463252 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112421.1 protein_id gnl|my_center|LOCUS_04490 464987 464046 gene locus_tag LOCUS_04500 464987 464046 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112422.1 protein_id gnl|my_center|LOCUS_04500 467477 465054 gene locus_tag LOCUS_04510 467477 465054 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112423.1 protein_id gnl|my_center|LOCUS_04510 467687 468727 gene locus_tag LOCUS_04520 gene aphA 467687 468727 CDS product acetylpolyamine amidohydrolase AphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112424.1 protein_id gnl|my_center|LOCUS_04520 468738 469829 gene locus_tag LOCUS_04530 468738 469829 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082943.1 protein_id gnl|my_center|LOCUS_04530 470137 469721 gene locus_tag LOCUS_04540 470137 469721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 470025 470936 gene locus_tag LOCUS_04550 470025 470936 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082945.1 protein_id gnl|my_center|LOCUS_04550 472089 470896 gene locus_tag LOCUS_04560 472089 470896 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115602.1 protein_id gnl|my_center|LOCUS_04560 472194 473066 gene locus_tag LOCUS_04570 472194 473066 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082949.1 protein_id gnl|my_center|LOCUS_04570 473122 473355 gene locus_tag LOCUS_04580 473122 473355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082952.1 protein_id gnl|my_center|LOCUS_04580 474143 473415 gene locus_tag LOCUS_04590 474143 473415 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112427.1 protein_id gnl|my_center|LOCUS_04590 475570 474188 gene locus_tag LOCUS_04600 475570 474188 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087009.1 protein_id gnl|my_center|LOCUS_04600 477185 475584 gene locus_tag LOCUS_04610 477185 475584 CDS product 5-guanidino-2-oxopentanoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112428.1 protein_id gnl|my_center|LOCUS_04610 478652 477261 gene locus_tag LOCUS_04620 478652 477261 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100479.1 protein_id gnl|my_center|LOCUS_04620 480257 478746 gene locus_tag LOCUS_04630 480257 478746 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112429.1 protein_id gnl|my_center|LOCUS_04630 480695 480276 gene locus_tag LOCUS_04640 480695 480276 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112430.1 protein_id gnl|my_center|LOCUS_04640 481669 480710 gene locus_tag LOCUS_04650 gene speB 481669 480710 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082966.1 protein_id gnl|my_center|LOCUS_04650 481876 482769 gene locus_tag LOCUS_04660 481876 482769 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082969.1 protein_id gnl|my_center|LOCUS_04660 484095 482773 gene locus_tag LOCUS_04670 gene bdlA 484095 482773 CDS product biofilm dispersion protein BdlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082971.1 protein_id gnl|my_center|LOCUS_04670 484320 484931 gene locus_tag LOCUS_04680 484320 484931 CDS product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082973.1 protein_id gnl|my_center|LOCUS_04680 485224 484889 gene locus_tag LOCUS_04690 485224 484889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112431.1 protein_id gnl|my_center|LOCUS_04690 485397 487037 gene locus_tag LOCUS_04700 485397 487037 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895566.1 protein_id gnl|my_center|LOCUS_04700 488592 487003 gene locus_tag LOCUS_04710 488592 487003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112434.1 protein_id gnl|my_center|LOCUS_04710 488852 489283 gene locus_tag LOCUS_04720 488852 489283 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082981.1 protein_id gnl|my_center|LOCUS_04720 489449 492157 gene locus_tag LOCUS_04730 489449 492157 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112435.1 protein_id gnl|my_center|LOCUS_04730 492608 493327 gene locus_tag LOCUS_04740 gene lasR 492608 493327 CDS product transcriptional regulator LasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082999.1 protein_id gnl|my_center|LOCUS_04740 493559 493317 gene locus_tag LOCUS_04750 gene rsaL 493559 493317 CDS product quorum-sensing transcriptional regulator RsaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083010.1 protein_id gnl|my_center|LOCUS_04750 493691 494296 gene locus_tag LOCUS_04760 gene lasI 493691 494296 CDS product acyl-homoserine-lactone synthase LasI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083017.1 protein_id gnl|my_center|LOCUS_04760 496355 494403 gene locus_tag LOCUS_04770 496355 494403 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112436.1 protein_id gnl|my_center|LOCUS_04770 497069 496356 gene locus_tag LOCUS_04780 497069 496356 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083022.1 protein_id gnl|my_center|LOCUS_04780 497250 498407 gene locus_tag LOCUS_04790 gene mexM 497250 498407 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MexM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112437.1 protein_id gnl|my_center|LOCUS_04790 498404 501514 gene locus_tag LOCUS_04800 gene mexN 498404 501514 CDS product multidrug efflux RND transporter permease subunit MexN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147398.1 protein_id gnl|my_center|LOCUS_04800 501618 502307 gene locus_tag LOCUS_04810 501618 502307 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083028.1 protein_id gnl|my_center|LOCUS_04810 502321 503730 gene locus_tag LOCUS_04820 502321 503730 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083034.1 protein_id gnl|my_center|LOCUS_04820 504146 503739 gene locus_tag LOCUS_04830 504146 503739 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087079.1 protein_id gnl|my_center|LOCUS_04830 504745 504158 gene locus_tag LOCUS_04840 504745 504158 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083037.1 protein_id gnl|my_center|LOCUS_04840 504933 506216 gene locus_tag LOCUS_04850 504933 506216 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895568.1 protein_id gnl|my_center|LOCUS_04850 506460 506981 gene locus_tag LOCUS_04860 gene fliL 506460 506981 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083042.1 protein_id gnl|my_center|LOCUS_04860 506989 507960 gene locus_tag LOCUS_04870 gene fliM 506989 507960 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083045.1 protein_id gnl|my_center|LOCUS_04870 507988 508461 gene locus_tag LOCUS_04880 gene fliN 507988 508461 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083049.1 protein_id gnl|my_center|LOCUS_04880 508463 508915 gene locus_tag LOCUS_04890 gene fliO 508463 508915 CDS product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083051.1 protein_id gnl|my_center|LOCUS_04890 508912 509679 gene locus_tag LOCUS_04900 gene fliP 508912 509679 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083052.1 protein_id gnl|my_center|LOCUS_04900 509724 509993 gene locus_tag LOCUS_04910 gene fliQ 509724 509993 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083053.1 protein_id gnl|my_center|LOCUS_04910 509993 510769 gene locus_tag LOCUS_04920 gene fliR 509993 510769 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114278.1 protein_id gnl|my_center|LOCUS_04920 510772 511908 gene locus_tag LOCUS_04930 gene flhB 510772 511908 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083056.1 protein_id gnl|my_center|LOCUS_04930 511993 513240 gene locus_tag LOCUS_04940 511993 513240 CDS product YgcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114279.1 protein_id gnl|my_center|LOCUS_04940 513273 514616 gene locus_tag LOCUS_04950 513273 514616 CDS product YgcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114280.1 protein_id gnl|my_center|LOCUS_04950 514755 516878 gene locus_tag LOCUS_04960 gene flhA 514755 516878 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083059.1 protein_id gnl|my_center|LOCUS_04960 516962 518251 gene locus_tag LOCUS_04970 gene flhF 516962 518251 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114281.1 protein_id gnl|my_center|LOCUS_04970 518390 519232 gene locus_tag LOCUS_04980 gene fleN 518390 519232 CDS product flagellar synthesis regulator FleN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083064.1 protein_id gnl|my_center|LOCUS_04980 519253 519972 gene locus_tag LOCUS_04990 gene fliA 519253 519972 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083070.1 protein_id gnl|my_center|LOCUS_04990 520062 520448 gene locus_tag LOCUS_05000 520062 520448 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083073.1 protein_id gnl|my_center|LOCUS_05000 520468 521256 gene locus_tag LOCUS_05010 520468 521256 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083075.1 protein_id gnl|my_center|LOCUS_05010 521457 523718 gene locus_tag LOCUS_05020 521457 523718 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114282.1 protein_id gnl|my_center|LOCUS_05020 523772 524878 gene locus_tag LOCUS_05030 523772 524878 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895569.1 protein_id gnl|my_center|LOCUS_05030 524967 525707 gene locus_tag LOCUS_05040 524967 525707 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083089.1 protein_id gnl|my_center|LOCUS_05040 525720 526610 gene locus_tag LOCUS_05050 gene motD 525720 526610 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083090.1 protein_id gnl|my_center|LOCUS_05050 526705 527493 gene locus_tag LOCUS_05060 526705 527493 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083092.1 protein_id gnl|my_center|LOCUS_05060 527585 528475 gene locus_tag LOCUS_05070 527585 528475 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083094.1 protein_id gnl|my_center|LOCUS_05070 528521 529000 gene locus_tag LOCUS_05080 528521 529000 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083098.1 protein_id gnl|my_center|LOCUS_05080 529031 529438 gene locus_tag LOCUS_05090 529031 529438 CDS product DUF2802 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083101.1 protein_id gnl|my_center|LOCUS_05090 530152 529466 gene locus_tag LOCUS_05100 530152 529466 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114283.1 protein_id gnl|my_center|LOCUS_05100 530261 531232 gene locus_tag LOCUS_05110 530261 531232 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083105.1 protein_id gnl|my_center|LOCUS_05110 531323 531739 gene locus_tag LOCUS_05120 531323 531739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083108.1 protein_id gnl|my_center|LOCUS_05120 531799 532521 gene locus_tag LOCUS_05130 531799 532521 CDS product laccase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087130.1 protein_id gnl|my_center|LOCUS_05130 532655 533392 gene locus_tag LOCUS_05140 532655 533392 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114285.1 protein_id gnl|my_center|LOCUS_05140 533799 533458 gene locus_tag LOCUS_05150 533799 533458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114286.1 protein_id gnl|my_center|LOCUS_05150 534461 533907 gene locus_tag LOCUS_05160 534461 533907 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083119.1 protein_id gnl|my_center|LOCUS_05160 534897 534562 gene locus_tag LOCUS_05170 534897 534562 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083121.1 protein_id gnl|my_center|LOCUS_05170 536474 534894 gene locus_tag LOCUS_05180 536474 534894 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895570.1 protein_id gnl|my_center|LOCUS_05180 536694 537359 gene locus_tag LOCUS_05190 gene ccmA 536694 537359 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895571.1 protein_id gnl|my_center|LOCUS_05190 537356 538027 gene locus_tag LOCUS_05200 gene ccmB 537356 538027 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114289.1 protein_id gnl|my_center|LOCUS_05200 538150 538908 gene locus_tag LOCUS_05210 538150 538908 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083135.1 protein_id gnl|my_center|LOCUS_05210 538905 539081 gene locus_tag LOCUS_05220 538905 539081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 539078 539566 gene locus_tag LOCUS_05230 gene ccmE 539078 539566 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107323.1 protein_id gnl|my_center|LOCUS_05230 539567 541540 gene locus_tag LOCUS_05240 539567 541540 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114291.1 protein_id gnl|my_center|LOCUS_05240 541544 542086 gene locus_tag LOCUS_05250 gene dsbE 541544 542086 CDS product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083138.1 protein_id gnl|my_center|LOCUS_05250 542083 542550 gene locus_tag LOCUS_05260 gene ccmH 542083 542550 CDS product cytochrome c maturation protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114292.1 protein_id gnl|my_center|LOCUS_05260 542547 543770 gene locus_tag LOCUS_05270 gene ccmI 542547 543770 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083145.1 protein_id gnl|my_center|LOCUS_05270 543797 544213 gene locus_tag LOCUS_05280 543797 544213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087156.1 protein_id gnl|my_center|LOCUS_05280 545023 544217 gene locus_tag LOCUS_05290 545023 544217 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083150.1 protein_id gnl|my_center|LOCUS_05290 545224 546591 gene locus_tag LOCUS_05300 545224 546591 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110692.1 protein_id gnl|my_center|LOCUS_05300 546605 547705 gene locus_tag LOCUS_05310 546605 547705 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083160.1 protein_id gnl|my_center|LOCUS_05310 549128 547713 gene locus_tag LOCUS_05320 549128 547713 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114294.1 protein_id gnl|my_center|LOCUS_05320 550387 549149 gene locus_tag LOCUS_05330 550387 549149 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114295.1 protein_id gnl|my_center|LOCUS_05330 551783 550374 gene locus_tag LOCUS_05340 551783 550374 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895572.1 protein_id gnl|my_center|LOCUS_05340 552744 551968 gene locus_tag LOCUS_05350 552744 551968 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083169.1 protein_id gnl|my_center|LOCUS_05350 553091 554326 gene locus_tag LOCUS_05360 gene eutH 553091 554326 CDS product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083171.1 protein_id gnl|my_center|LOCUS_05360 554386 554742 gene locus_tag LOCUS_05370 554386 554742 CDS product DUF1937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083172.1 protein_id gnl|my_center|LOCUS_05370 555822 554824 gene locus_tag LOCUS_05380 555822 554824 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087175.1 protein_id gnl|my_center|LOCUS_05380 557606 555951 gene locus_tag LOCUS_05390 gene muiA 557606 555951 CDS product mucoidy inhibitor MuiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114297.1 protein_id gnl|my_center|LOCUS_05390 558356 557730 gene locus_tag LOCUS_05400 558356 557730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083175.1 protein_id gnl|my_center|LOCUS_05400 559194 558343 gene locus_tag LOCUS_05410 559194 558343 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083179.1 protein_id gnl|my_center|LOCUS_05410 560174 559260 gene locus_tag LOCUS_05420 560174 559260 CDS product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114298.1 protein_id gnl|my_center|LOCUS_05420 561974 560541 gene locus_tag LOCUS_05430 gene pyk 561974 560541 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114299.1 protein_id gnl|my_center|LOCUS_05430 563241 561976 gene locus_tag LOCUS_05440 563241 561976 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114300.1 protein_id gnl|my_center|LOCUS_05440 564428 563538 gene locus_tag LOCUS_05450 564428 563538 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105826.1 protein_id gnl|my_center|LOCUS_05450 565285 564503 gene locus_tag LOCUS_05460 gene hyi 565285 564503 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087181.1 protein_id gnl|my_center|LOCUS_05460 567147 565381 gene locus_tag LOCUS_05470 gene gcl 567147 565381 CDS product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114301.1 protein_id gnl|my_center|LOCUS_05470 567485 567916 gene locus_tag LOCUS_05480 567485 567916 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083199.1 protein_id gnl|my_center|LOCUS_05480 568969 568319 gene locus_tag LOCUS_05490 568969 568319 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087183.1 protein_id gnl|my_center|LOCUS_05490 569204 570199 gene locus_tag LOCUS_05500 gene moaA 569204 570199 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083204.1 protein_id gnl|my_center|LOCUS_05500 570384 570713 gene locus_tag LOCUS_05510 570384 570713 CDS product low molecular weight protein tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087185.1 protein_id gnl|my_center|LOCUS_05510 572172 570805 gene locus_tag LOCUS_05520 572172 570805 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083208.1 protein_id gnl|my_center|LOCUS_05520 573114 572854 gene locus_tag LOCUS_05530 573114 572854 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083211.1 protein_id gnl|my_center|LOCUS_05530 574173 573127 gene locus_tag LOCUS_05540 574173 573127 CDS product T6SS immunity protein Tli4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895573.1 protein_id gnl|my_center|LOCUS_05540 575975 574266 gene locus_tag LOCUS_05550 575975 574266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114302.1 protein_id gnl|my_center|LOCUS_05550 >Feature sequence02 625 227 gene locus_tag LOCUS_05560 625 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 1063 809 gene locus_tag LOCUS_05570 1063 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 2075 1302 gene locus_tag LOCUS_05580 2075 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920547.1 protein_id gnl|my_center|LOCUS_05580 3616 2072 gene locus_tag LOCUS_05590 3616 2072 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265837.1 protein_id gnl|my_center|LOCUS_05590 4635 3697 gene locus_tag LOCUS_05600 4635 3697 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920548.1 protein_id gnl|my_center|LOCUS_05600 5468 5061 gene locus_tag LOCUS_05610 5468 5061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093113.1 protein_id gnl|my_center|LOCUS_05610 6226 5492 gene locus_tag LOCUS_05620 6226 5492 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093112.1 protein_id gnl|my_center|LOCUS_05620 7455 6316 gene locus_tag LOCUS_05630 7455 6316 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106827.1 protein_id gnl|my_center|LOCUS_05630 7517 8353 gene locus_tag LOCUS_05640 7517 8353 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106828.1 protein_id gnl|my_center|LOCUS_05640 8794 8360 gene locus_tag LOCUS_05650 8794 8360 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106829.1 protein_id gnl|my_center|LOCUS_05650 9517 8861 gene locus_tag LOCUS_05660 9517 8861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114321.1 protein_id gnl|my_center|LOCUS_05660 10695 9601 gene locus_tag LOCUS_05670 gene sfnG 10695 9601 CDS product dimethyl sulfone monooxygenase SfnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093107.1 protein_id gnl|my_center|LOCUS_05670 11434 10853 gene locus_tag LOCUS_05680 11434 10853 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106834.1 protein_id gnl|my_center|LOCUS_05680 11534 12250 gene locus_tag LOCUS_05690 11534 12250 CDS product DUF2076 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114320.1 protein_id gnl|my_center|LOCUS_05690 12316 12819 gene locus_tag LOCUS_05700 12316 12819 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093104.1 protein_id gnl|my_center|LOCUS_05700 12897 14246 gene locus_tag LOCUS_05710 12897 14246 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114319.1 protein_id gnl|my_center|LOCUS_05710 15444 14269 gene locus_tag LOCUS_05720 15444 14269 CDS product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119225.1 protein_id gnl|my_center|LOCUS_05720 16433 15804 gene locus_tag LOCUS_05730 16433 15804 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106011.1 protein_id gnl|my_center|LOCUS_05730 16703 17893 gene locus_tag LOCUS_05740 gene rocR 16703 17893 CDS product two-component system response regulator cyclic di-GMP-specific phosphodiesterase RocR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106013.1 protein_id gnl|my_center|LOCUS_05740 17995 21633 gene locus_tag LOCUS_05750 17995 21633 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114318.1 protein_id gnl|my_center|LOCUS_05750 21848 22438 gene locus_tag LOCUS_05760 21848 22438 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106016.1 protein_id gnl|my_center|LOCUS_05760 22465 23043 gene locus_tag LOCUS_05770 22465 23043 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106018.1 protein_id gnl|my_center|LOCUS_05770 23046 24641 gene locus_tag LOCUS_05780 23046 24641 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114317.1 protein_id gnl|my_center|LOCUS_05780 24675 25544 gene locus_tag LOCUS_05790 gene tesB 24675 25544 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093084.1 protein_id gnl|my_center|LOCUS_05790 25541 26137 gene locus_tag LOCUS_05800 25541 26137 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114316.1 protein_id gnl|my_center|LOCUS_05800 26542 26261 gene locus_tag LOCUS_05810 26542 26261 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093079.1 protein_id gnl|my_center|LOCUS_05810 26960 27832 gene locus_tag LOCUS_05820 26960 27832 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003143037.1 protein_id gnl|my_center|LOCUS_05820 28037 29050 gene locus_tag LOCUS_05830 gene tauA 28037 29050 CDS product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114314.1 protein_id gnl|my_center|LOCUS_05830 29115 29906 gene locus_tag LOCUS_05840 29115 29906 CDS product taurine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114313.1 protein_id gnl|my_center|LOCUS_05840 29896 30714 gene locus_tag LOCUS_05850 29896 30714 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114312.1 protein_id gnl|my_center|LOCUS_05850 30821 31654 gene locus_tag LOCUS_05860 gene tauD 30821 31654 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114311.1 protein_id gnl|my_center|LOCUS_05860 31817 33853 gene locus_tag LOCUS_05870 31817 33853 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114310.1 protein_id gnl|my_center|LOCUS_05870 35976 33961 gene locus_tag LOCUS_05880 gene betT 35976 33961 CDS product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119234.1 protein_id gnl|my_center|LOCUS_05880 37086 36112 gene locus_tag LOCUS_05890 37086 36112 CDS product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114309.1 protein_id gnl|my_center|LOCUS_05890 38040 37261 gene locus_tag LOCUS_05900 38040 37261 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093057.1 protein_id gnl|my_center|LOCUS_05900 38478 39944 gene locus_tag LOCUS_05910 gene cioA 38478 39944 CDS product cyanide-insensitive cytochrome bd quinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103027.1 protein_id gnl|my_center|LOCUS_05910 39948 40955 gene locus_tag LOCUS_05920 gene cioB 39948 40955 CDS product cyanide-insensitive cytochrome bd quinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093053.1 protein_id gnl|my_center|LOCUS_05920 40969 41139 gene locus_tag LOCUS_05930 40969 41139 CDS product DUF2474 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093052.1 protein_id gnl|my_center|LOCUS_05930 42208 41420 gene locus_tag LOCUS_05940 42208 41420 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004351567.1 protein_id gnl|my_center|LOCUS_05940 42310 43491 gene locus_tag LOCUS_05950 42310 43491 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093049.1 protein_id gnl|my_center|LOCUS_05950 44723 43548 gene locus_tag LOCUS_05960 44723 43548 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103022.1 protein_id gnl|my_center|LOCUS_05960 44905 46587 gene locus_tag LOCUS_05970 44905 46587 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103012.1 protein_id gnl|my_center|LOCUS_05970 46799 48724 gene locus_tag LOCUS_05980 46799 48724 CDS product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093045.1 protein_id gnl|my_center|LOCUS_05980 48785 50152 gene locus_tag LOCUS_05990 48785 50152 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103009.1 protein_id gnl|my_center|LOCUS_05990 50485 53205 gene locus_tag LOCUS_06000 50485 53205 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103006.1 protein_id gnl|my_center|LOCUS_06000 55615 53237 gene locus_tag LOCUS_06010 gene copA1 55615 53237 CDS product copper-translocating P-type ATPase CopA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093042.1 protein_id gnl|my_center|LOCUS_06010 56112 57503 gene locus_tag LOCUS_06020 56112 57503 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093038.1 protein_id gnl|my_center|LOCUS_06020 57752 58234 gene locus_tag LOCUS_06030 gene moaC 57752 58234 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093030.1 protein_id gnl|my_center|LOCUS_06030 58231 58482 gene locus_tag LOCUS_06040 gene moaD 58231 58482 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093027.1 protein_id gnl|my_center|LOCUS_06040 58487 58939 gene locus_tag LOCUS_06050 gene moaE 58487 58939 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093025.1 protein_id gnl|my_center|LOCUS_06050 59041 59598 gene locus_tag LOCUS_06060 gene moaB 59041 59598 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093023.1 protein_id gnl|my_center|LOCUS_06060 59595 60818 gene locus_tag LOCUS_06070 59595 60818 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114306.1 protein_id gnl|my_center|LOCUS_06070 60933 61928 gene locus_tag LOCUS_06080 60933 61928 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093020.1 protein_id gnl|my_center|LOCUS_06080 61940 62830 gene locus_tag LOCUS_06090 61940 62830 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110916.1 protein_id gnl|my_center|LOCUS_06090 62824 63339 gene locus_tag LOCUS_06100 62824 63339 CDS product phosphatidic acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104247.1 protein_id gnl|my_center|LOCUS_06100 63591 65153 gene locus_tag LOCUS_06110 63591 65153 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110915.1 protein_id gnl|my_center|LOCUS_06110 65190 67532 gene locus_tag LOCUS_06120 65190 67532 CDS product ExeM/NucH family extracellular endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114304.1 protein_id gnl|my_center|LOCUS_06120 68449 67724 gene locus_tag LOCUS_06130 gene tsiT 68449 67724 CDS product type VI secretion system immunity protein TsiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113762.1 protein_id gnl|my_center|LOCUS_06130 69225 68440 gene locus_tag LOCUS_06140 gene tseT 69225 68440 CDS product type VI secretion system effector protein TseT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104240.1 protein_id gnl|my_center|LOCUS_06140 69605 69222 gene locus_tag LOCUS_06150 69605 69222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104238.1 protein_id gnl|my_center|LOCUS_06150 70125 69598 gene locus_tag LOCUS_06160 70125 69598 CDS product DUF4123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104236.1 protein_id gnl|my_center|LOCUS_06160 70517 70122 gene locus_tag LOCUS_06170 70517 70122 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104235.1 protein_id gnl|my_center|LOCUS_06170 72485 70902 gene locus_tag LOCUS_06180 72485 70902 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093004.1 protein_id gnl|my_center|LOCUS_06180 72706 73167 gene locus_tag LOCUS_06190 gene ivy 72706 73167 CDS product lysozyme inhibitor Ivy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093002.1 protein_id gnl|my_center|LOCUS_06190 75617 73263 gene locus_tag LOCUS_06200 gene fecA 75617 73263 CDS product Fe(3+) dicitrate transport protein FecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113763.1 protein_id gnl|my_center|LOCUS_06200 76665 75712 gene locus_tag LOCUS_06210 76665 75712 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113764.1 protein_id gnl|my_center|LOCUS_06210 77171 76662 gene locus_tag LOCUS_06220 77171 76662 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092999.1 protein_id gnl|my_center|LOCUS_06220 78162 77272 gene locus_tag LOCUS_06230 gene mdrR1 78162 77272 CDS product transcriptional regulator MdrR1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895665.1 protein_id gnl|my_center|LOCUS_06230 78049 78252 gene locus_tag LOCUS_06240 78049 78252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 78279 79181 gene locus_tag LOCUS_06250 78279 79181 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104227.1 protein_id gnl|my_center|LOCUS_06250 80176 79199 gene locus_tag LOCUS_06260 80176 79199 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104226.1 protein_id gnl|my_center|LOCUS_06260 81224 80271 gene locus_tag LOCUS_06270 81224 80271 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092994.1 protein_id gnl|my_center|LOCUS_06270 81470 82960 gene locus_tag LOCUS_06280 81470 82960 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105655.1 protein_id gnl|my_center|LOCUS_06280 82957 85152 gene locus_tag LOCUS_06290 82957 85152 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092992.1 protein_id gnl|my_center|LOCUS_06290 85142 85342 gene locus_tag LOCUS_06300 85142 85342 CDS product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365425.1 protein_id gnl|my_center|LOCUS_06300 85379 86287 gene locus_tag LOCUS_06310 85379 86287 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113767.1 protein_id gnl|my_center|LOCUS_06310 87578 86415 gene locus_tag LOCUS_06320 87578 86415 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113768.1 protein_id gnl|my_center|LOCUS_06320 88253 87591 gene locus_tag LOCUS_06330 88253 87591 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092985.1 protein_id gnl|my_center|LOCUS_06330 89188 88253 gene locus_tag LOCUS_06340 89188 88253 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113769.1 protein_id gnl|my_center|LOCUS_06340 89910 89188 gene locus_tag LOCUS_06350 89910 89188 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092982.1 protein_id gnl|my_center|LOCUS_06350 89831 90082 gene locus_tag LOCUS_06360 89831 90082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 90352 91626 gene locus_tag LOCUS_06370 90352 91626 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105667.1 protein_id gnl|my_center|LOCUS_06370 91930 91685 gene locus_tag LOCUS_06380 91930 91685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092978.1 protein_id gnl|my_center|LOCUS_06380 92859 91960 gene locus_tag LOCUS_06390 92859 91960 CDS product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113770.1 protein_id gnl|my_center|LOCUS_06390 93620 92964 gene locus_tag LOCUS_06400 gene tpbA 93620 92964 CDS product tyrosine phosphatase TpbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105672.1 protein_id gnl|my_center|LOCUS_06400 94101 93715 gene locus_tag LOCUS_06410 94101 93715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113771.1 protein_id gnl|my_center|LOCUS_06410 94952 94122 gene locus_tag LOCUS_06420 94952 94122 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113772.1 protein_id gnl|my_center|LOCUS_06420 95789 95040 gene locus_tag LOCUS_06430 95789 95040 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105293.1 protein_id gnl|my_center|LOCUS_06430 96269 95805 gene locus_tag LOCUS_06440 96269 95805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092973.1 protein_id gnl|my_center|LOCUS_06440 96825 96430 gene locus_tag LOCUS_06450 gene anvM 96825 96430 CDS product anaerobic/virulence modulator AnvM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092971.1 protein_id gnl|my_center|LOCUS_06450 97569 96910 gene locus_tag LOCUS_06460 gene narL 97569 96910 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092968.1 protein_id gnl|my_center|LOCUS_06460 99434 97566 gene locus_tag LOCUS_06470 gene narX 99434 97566 CDS product two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105296.1 protein_id gnl|my_center|LOCUS_06470 99609 100904 gene locus_tag LOCUS_06480 99609 100904 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113773.1 protein_id gnl|my_center|LOCUS_06480 100674 100763 gene locus_tag LOCUS_t00030 100674 100763 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 100916 102322 gene locus_tag LOCUS_06490 gene narK2 100916 102322 CDS product nitrate/nitrite transporter NarK2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105301.1 protein_id gnl|my_center|LOCUS_06490 102398 106183 gene locus_tag LOCUS_06500 102398 106183 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105302.1 protein_id gnl|my_center|LOCUS_06500 106195 107736 gene locus_tag LOCUS_06510 gene narH 106195 107736 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092958.1 protein_id gnl|my_center|LOCUS_06510 107742 108482 gene locus_tag LOCUS_06520 gene narJ 107742 108482 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092956.1 protein_id gnl|my_center|LOCUS_06520 108485 109168 gene locus_tag LOCUS_06530 gene narI 108485 109168 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105305.1 protein_id gnl|my_center|LOCUS_06530 109223 110041 gene locus_tag LOCUS_06540 109223 110041 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105307.1 protein_id gnl|my_center|LOCUS_06540 110098 111087 gene locus_tag LOCUS_06550 gene moaA 110098 111087 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092949.1 protein_id gnl|my_center|LOCUS_06550 111725 112516 gene locus_tag LOCUS_06560 111725 112516 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113778.1 protein_id gnl|my_center|LOCUS_06560 113172 112540 gene locus_tag LOCUS_06570 gene dauR 113172 112540 CDS product transcriptional regulator DauR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113779.1 protein_id gnl|my_center|LOCUS_06570 114362 113235 gene locus_tag LOCUS_06580 gene dauA 114362 113235 CDS product FAD-dependent catabolic D-arginine dehydrogenase DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113780.1 protein_id gnl|my_center|LOCUS_06580 115332 114385 gene locus_tag LOCUS_06590 gene dauB 115332 114385 CDS product NAD(P)H-dependent anabolic L-arginine dehydrogenase DauB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113781.1 protein_id gnl|my_center|LOCUS_06590 117064 115493 gene locus_tag LOCUS_06600 gene rhlB 117064 115493 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119269.1 protein_id gnl|my_center|LOCUS_06600 117300 119198 gene locus_tag LOCUS_06610 117300 119198 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113783.1 protein_id gnl|my_center|LOCUS_06610 119861 119214 gene locus_tag LOCUS_06620 119861 119214 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105021.1 protein_id gnl|my_center|LOCUS_06620 120167 121183 gene locus_tag LOCUS_06630 120167 121183 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119272.1 protein_id gnl|my_center|LOCUS_06630 121301 122011 gene locus_tag LOCUS_06640 121301 122011 CDS product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105024.1 protein_id gnl|my_center|LOCUS_06640 122082 122564 gene locus_tag LOCUS_06650 122082 122564 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113784.1 protein_id gnl|my_center|LOCUS_06650 122631 123332 gene locus_tag LOCUS_06660 122631 123332 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092922.1 protein_id gnl|my_center|LOCUS_06660 123325 123639 gene locus_tag LOCUS_06670 123325 123639 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119275.1 protein_id gnl|my_center|LOCUS_06670 123668 124357 gene locus_tag LOCUS_06680 123668 124357 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105028.1 protein_id gnl|my_center|LOCUS_06680 124478 125413 gene locus_tag LOCUS_06690 124478 125413 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092916.1 protein_id gnl|my_center|LOCUS_06690 125417 126169 gene locus_tag LOCUS_06700 125417 126169 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113785.1 protein_id gnl|my_center|LOCUS_06700 126712 127158 gene locus_tag LOCUS_06710 126712 127158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06710 128184 127180 gene locus_tag LOCUS_06720 gene yejK 128184 127180 CDS product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113787.1 protein_id gnl|my_center|LOCUS_06720 129632 128277 gene locus_tag LOCUS_06730 129632 128277 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111143.1 protein_id gnl|my_center|LOCUS_06730 130176 129706 gene locus_tag LOCUS_06740 130176 129706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100569.1 protein_id gnl|my_center|LOCUS_06740 130280 130822 gene locus_tag LOCUS_06750 130280 130822 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100571.1 protein_id gnl|my_center|LOCUS_06750 131708 130812 gene locus_tag LOCUS_06760 131708 130812 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113788.1 protein_id gnl|my_center|LOCUS_06760 131832 132443 gene locus_tag LOCUS_06770 131832 132443 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113789.1 protein_id gnl|my_center|LOCUS_06770 132624 132758 gene locus_tag LOCUS_06780 132624 132758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 133400 133050 gene locus_tag LOCUS_06790 133400 133050 CDS product CesT family type III secretion system chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113790.1 protein_id gnl|my_center|LOCUS_06790 133588 134949 gene locus_tag LOCUS_06800 gene exoS 133588 134949 CDS product T3SS effector bifunctional cytotoxin exoenzyme S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113791.1 protein_id gnl|my_center|LOCUS_06800 136049 135039 gene locus_tag LOCUS_06810 gene rlmF 136049 135039 CDS product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092887.1 protein_id gnl|my_center|LOCUS_06810 137973 136141 gene locus_tag LOCUS_06820 137973 136141 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113792.1 protein_id gnl|my_center|LOCUS_06820 138886 138092 gene locus_tag LOCUS_06830 138886 138092 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092883.1 protein_id gnl|my_center|LOCUS_06830 139779 138889 gene locus_tag LOCUS_06840 139779 138889 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092881.1 protein_id gnl|my_center|LOCUS_06840 140840 139863 gene locus_tag LOCUS_06850 140840 139863 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092876.1 protein_id gnl|my_center|LOCUS_06850 141262 147864 gene locus_tag LOCUS_06860 141262 147864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 147872 148171 gene locus_tag LOCUS_06870 147872 148171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 148206 148556 gene locus_tag LOCUS_06880 148206 148556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003143111.1 protein_id gnl|my_center|LOCUS_06880 151455 148603 gene locus_tag LOCUS_06890 151455 148603 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113794.1 protein_id gnl|my_center|LOCUS_06890 151944 151576 gene locus_tag LOCUS_06900 151944 151576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100590.1 protein_id gnl|my_center|LOCUS_06900 152384 151956 gene locus_tag LOCUS_06910 gene holC 152384 151956 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100593.1 protein_id gnl|my_center|LOCUS_06910 153868 152381 gene locus_tag LOCUS_06920 153868 152381 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092867.1 protein_id gnl|my_center|LOCUS_06920 154384 154157 gene locus_tag LOCUS_06930 154384 154157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 154289 155017 gene locus_tag LOCUS_06940 154289 155017 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100594.1 protein_id gnl|my_center|LOCUS_06940 155101 156024 gene locus_tag LOCUS_06950 155101 156024 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115256.1 protein_id gnl|my_center|LOCUS_06950 156216 157334 gene locus_tag LOCUS_06960 gene lptF 156216 157334 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092864.1 protein_id gnl|my_center|LOCUS_06960 157327 158394 gene locus_tag LOCUS_06970 gene lptG 157327 158394 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092863.1 protein_id gnl|my_center|LOCUS_06970 159023 158526 gene locus_tag LOCUS_06980 159023 158526 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100603.1 protein_id gnl|my_center|LOCUS_06980 159153 160733 gene locus_tag LOCUS_06990 159153 160733 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119288.1 protein_id gnl|my_center|LOCUS_06990 161146 161060 gene locus_tag LOCUS_t00040 161146 161060 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 161249 162292 gene locus_tag LOCUS_07000 gene queA 161249 162292 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113798.1 protein_id gnl|my_center|LOCUS_07000 162296 163423 gene locus_tag LOCUS_07010 gene tgt 162296 163423 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100607.1 protein_id gnl|my_center|LOCUS_07010 163467 163805 gene locus_tag LOCUS_07020 gene yajC 163467 163805 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092856.1 protein_id gnl|my_center|LOCUS_07020 163865 165727 gene locus_tag LOCUS_07030 gene secD 163865 165727 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100609.1 protein_id gnl|my_center|LOCUS_07030 165738 166658 gene locus_tag LOCUS_07040 gene secF 165738 166658 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100612.1 protein_id gnl|my_center|LOCUS_07040 166842 167390 gene locus_tag LOCUS_07050 166842 167390 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092848.1 protein_id gnl|my_center|LOCUS_07050 168310 167495 gene locus_tag LOCUS_07060 gene suhB 168310 167495 CDS product inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092845.1 protein_id gnl|my_center|LOCUS_07060 168462 169235 gene locus_tag LOCUS_07070 gene trmJ 168462 169235 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113799.1 protein_id gnl|my_center|LOCUS_07070 169235 170011 gene locus_tag LOCUS_07080 gene cysE 169235 170011 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_07080 170156 170647 gene locus_tag LOCUS_07090 gene iscR 170156 170647 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092836.1 protein_id gnl|my_center|LOCUS_07090 170677 171891 gene locus_tag LOCUS_07100 170677 171891 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092832.1 protein_id gnl|my_center|LOCUS_07100 171927 172313 gene locus_tag LOCUS_07110 gene iscU 171927 172313 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092829.1 protein_id gnl|my_center|LOCUS_07110 172341 172664 gene locus_tag LOCUS_07120 gene iscA 172341 172664 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100617.1 protein_id gnl|my_center|LOCUS_07120 172672 173193 gene locus_tag LOCUS_07130 gene hscB 172672 173193 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092824.1 protein_id gnl|my_center|LOCUS_07130 173236 175095 gene locus_tag LOCUS_07140 gene hscA 173236 175095 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100622.1 protein_id gnl|my_center|LOCUS_07140 175102 175440 gene locus_tag LOCUS_07150 gene fdx 175102 175440 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092818.1 protein_id gnl|my_center|LOCUS_07150 175467 175667 gene locus_tag LOCUS_07160 gene iscX 175467 175667 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092814.1 protein_id gnl|my_center|LOCUS_07160 175911 176342 gene locus_tag LOCUS_07170 gene ndk 175911 176342 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092811.1 protein_id gnl|my_center|LOCUS_07170 176367 177506 gene locus_tag LOCUS_07180 gene rlmN 176367 177506 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092809.1 protein_id gnl|my_center|LOCUS_07180 177524 178282 gene locus_tag LOCUS_07190 gene pilF 177524 178282 CDS product type 4a pilus biogenesis protein PilF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113801.1 protein_id gnl|my_center|LOCUS_07190 178279 179322 gene locus_tag LOCUS_07200 178279 179322 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115257.1 protein_id gnl|my_center|LOCUS_07200 179319 180434 gene locus_tag LOCUS_07210 gene ispG 179319 180434 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092800.1 protein_id gnl|my_center|LOCUS_07210 180453 181742 gene locus_tag LOCUS_07220 gene hisS 180453 181742 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092797.1 protein_id gnl|my_center|LOCUS_07220 181769 182413 gene locus_tag LOCUS_07230 181769 182413 CDS product YfgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106650.1 protein_id gnl|my_center|LOCUS_07230 182415 183557 gene locus_tag LOCUS_07240 gene bamB 182415 183557 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092789.1 protein_id gnl|my_center|LOCUS_07240 183635 185116 gene locus_tag LOCUS_07250 gene der 183635 185116 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092786.1 protein_id gnl|my_center|LOCUS_07250 185424 186572 gene locus_tag LOCUS_07260 185424 186572 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106648.1 protein_id gnl|my_center|LOCUS_07260 186560 187354 gene locus_tag LOCUS_07270 186560 187354 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106646.1 protein_id gnl|my_center|LOCUS_07270 187488 188075 gene locus_tag LOCUS_07280 187488 188075 CDS product YidB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113804.1 protein_id gnl|my_center|LOCUS_07280 189113 188163 gene locus_tag LOCUS_07290 189113 188163 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107361.1 protein_id gnl|my_center|LOCUS_07290 189294 189749 gene locus_tag LOCUS_07300 189294 189749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107363.1 protein_id gnl|my_center|LOCUS_07300 189803 190135 gene locus_tag LOCUS_07310 189803 190135 CDS product DUF5629 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092770.1 protein_id gnl|my_center|LOCUS_07310 191875 190205 gene locus_tag LOCUS_07320 gene leuA 191875 190205 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113805.1 protein_id gnl|my_center|LOCUS_07320 192355 192816 gene locus_tag LOCUS_07330 192355 192816 CDS product DUF2946 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092760.1 protein_id gnl|my_center|LOCUS_07330 192949 195108 gene locus_tag LOCUS_07340 192949 195108 CDS product TonB-dependent copper receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119294.1 protein_id gnl|my_center|LOCUS_07340 195173 196588 gene locus_tag LOCUS_07350 195173 196588 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113806.1 protein_id gnl|my_center|LOCUS_07350 197001 196606 gene locus_tag LOCUS_07360 197001 196606 CDS product DUF4345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113807.1 protein_id gnl|my_center|LOCUS_07360 197935 197087 gene locus_tag LOCUS_07370 197935 197087 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092745.1 protein_id gnl|my_center|LOCUS_07370 197856 198080 gene locus_tag LOCUS_07380 197856 198080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 198107 198496 gene locus_tag LOCUS_07390 198107 198496 CDS product DUF2946 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105383.1 protein_id gnl|my_center|LOCUS_07390 198626 199102 gene locus_tag LOCUS_07400 198626 199102 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105385.1 protein_id gnl|my_center|LOCUS_07400 199159 199731 gene locus_tag LOCUS_07410 199159 199731 CDS product putative natural product biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092738.1 protein_id gnl|my_center|LOCUS_07410 200395 199766 gene locus_tag LOCUS_07420 200395 199766 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113808.1 protein_id gnl|my_center|LOCUS_07420 200516 201469 gene locus_tag LOCUS_07430 200516 201469 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113809.1 protein_id gnl|my_center|LOCUS_07430 202227 201466 gene locus_tag LOCUS_07440 202227 201466 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058294.1 protein_id gnl|my_center|LOCUS_07440 203512 202232 gene locus_tag LOCUS_07450 203512 202232 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113810.1 protein_id gnl|my_center|LOCUS_07450 204003 203509 gene locus_tag LOCUS_07460 204003 203509 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113811.1 protein_id gnl|my_center|LOCUS_07460 205117 204077 gene locus_tag LOCUS_07470 gene dctP 205117 204077 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113812.1 protein_id gnl|my_center|LOCUS_07470 206204 205269 gene locus_tag LOCUS_07480 206204 205269 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092728.1 protein_id gnl|my_center|LOCUS_07480 207590 206211 gene locus_tag LOCUS_07490 gene xseA 207590 206211 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113813.1 protein_id gnl|my_center|LOCUS_07490 208535 207627 gene locus_tag LOCUS_07500 208535 207627 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113814.1 protein_id gnl|my_center|LOCUS_07500 208643 209425 gene locus_tag LOCUS_07510 208643 209425 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113815.1 protein_id gnl|my_center|LOCUS_07510 210552 209410 gene locus_tag LOCUS_07520 210552 209410 CDS product class II histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113816.1 protein_id gnl|my_center|LOCUS_07520 211739 210582 gene locus_tag LOCUS_07530 211739 210582 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113817.1 protein_id gnl|my_center|LOCUS_07530 212648 211752 gene locus_tag LOCUS_07540 212648 211752 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113818.1 protein_id gnl|my_center|LOCUS_07540 213760 212783 gene locus_tag LOCUS_07550 213760 212783 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119304.1 protein_id gnl|my_center|LOCUS_07550 214024 215493 gene locus_tag LOCUS_07560 gene guaB 214024 215493 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092702.1 protein_id gnl|my_center|LOCUS_07560 215573 217150 gene locus_tag LOCUS_07570 gene guaA 215573 217150 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105901.1 protein_id gnl|my_center|LOCUS_07570 217452 218708 gene locus_tag LOCUS_07580 217452 218708 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530374.1 protein_id gnl|my_center|LOCUS_07580 218769 219044 gene locus_tag LOCUS_07590 218769 219044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 219049 219573 gene locus_tag LOCUS_07600 219049 219573 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812293.1 protein_id gnl|my_center|LOCUS_07600 219971 219588 gene locus_tag LOCUS_07610 219971 219588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 222570 220579 gene locus_tag LOCUS_07620 222570 220579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 223028 222570 gene locus_tag LOCUS_07630 223028 222570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 223935 223021 gene locus_tag LOCUS_07640 223935 223021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 224458 224039 gene locus_tag LOCUS_07650 224458 224039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 225747 224626 gene locus_tag LOCUS_07660 225747 224626 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113218.1 protein_id gnl|my_center|LOCUS_07660 229023 226762 gene locus_tag LOCUS_07670 229023 226762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 233262 229048 gene locus_tag LOCUS_07680 233262 229048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 235915 233255 gene locus_tag LOCUS_07690 235915 233255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 237686 235875 gene locus_tag LOCUS_07700 237686 235875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 238458 238189 gene locus_tag LOCUS_07710 238458 238189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 239743 238952 gene locus_tag LOCUS_07720 239743 238952 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040071.1 protein_id gnl|my_center|LOCUS_07720 239967 239749 gene locus_tag LOCUS_07730 239967 239749 CDS product Plasmid-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039729.1 protein_id gnl|my_center|LOCUS_07730 240094 240852 gene locus_tag LOCUS_07740 240094 240852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 241171 242679 gene locus_tag LOCUS_07750 241171 242679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 242783 243253 gene locus_tag LOCUS_07760 242783 243253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 243250 244005 gene locus_tag LOCUS_07770 243250 244005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 245063 244077 gene locus_tag LOCUS_07780 245063 244077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 245772 247163 gene locus_tag LOCUS_07790 245772 247163 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119305.1 protein_id gnl|my_center|LOCUS_07790 247154 247702 gene locus_tag LOCUS_07800 gene tadA 247154 247702 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092697.1 protein_id gnl|my_center|LOCUS_07800 248091 249347 gene locus_tag LOCUS_07810 248091 249347 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105913.1 protein_id gnl|my_center|LOCUS_07810 249473 250057 gene locus_tag LOCUS_07820 249473 250057 CDS product DUF2239 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113820.1 protein_id gnl|my_center|LOCUS_07820 251543 250071 gene locus_tag LOCUS_07830 gene mltF 251543 250071 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104806.1 protein_id gnl|my_center|LOCUS_07830 251830 255726 gene locus_tag LOCUS_07840 gene purL 251830 255726 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113821.1 protein_id gnl|my_center|LOCUS_07840 255733 256011 gene locus_tag LOCUS_07850 255733 256011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 256191 256508 gene locus_tag LOCUS_07860 256191 256508 CDS product YqfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092679.1 protein_id gnl|my_center|LOCUS_07860 258422 256710 gene locus_tag LOCUS_07870 gene nagE 258422 256710 CDS product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113823.1 protein_id gnl|my_center|LOCUS_07870 260975 258447 gene locus_tag LOCUS_07880 gene ptsP 260975 258447 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895663.1 protein_id gnl|my_center|LOCUS_07880 261972 260992 gene locus_tag LOCUS_07890 261972 260992 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148055.1 protein_id gnl|my_center|LOCUS_07890 263102 262011 gene locus_tag LOCUS_07900 gene nagA 263102 262011 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113826.1 protein_id gnl|my_center|LOCUS_07900 263862 263119 gene locus_tag LOCUS_07910 263862 263119 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113827.1 protein_id gnl|my_center|LOCUS_07910 264605 264105 gene locus_tag LOCUS_07920 264605 264105 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092667.1 protein_id gnl|my_center|LOCUS_07920 265222 264668 gene locus_tag LOCUS_07930 265222 264668 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092665.1 protein_id gnl|my_center|LOCUS_07930 265363 265974 gene locus_tag LOCUS_07940 265363 265974 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092664.1 protein_id gnl|my_center|LOCUS_07940 266012 266536 gene locus_tag LOCUS_07950 266012 266536 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092662.1 protein_id gnl|my_center|LOCUS_07950 266533 266727 gene locus_tag LOCUS_07960 266533 266727 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092660.1 protein_id gnl|my_center|LOCUS_07960 266765 267946 gene locus_tag LOCUS_07970 gene purT 266765 267946 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092658.1 protein_id gnl|my_center|LOCUS_07970 267948 268697 gene locus_tag LOCUS_07980 267948 268697 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113828.1 protein_id gnl|my_center|LOCUS_07980 270018 268705 gene locus_tag LOCUS_07990 270018 268705 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113829.1 protein_id gnl|my_center|LOCUS_07990 270146 270427 gene locus_tag LOCUS_08000 270146 270427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 271614 270322 gene locus_tag LOCUS_08010 271614 270322 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111904.1 protein_id gnl|my_center|LOCUS_08010 272427 271627 gene locus_tag LOCUS_08020 272427 271627 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_08020 272728 274101 gene locus_tag LOCUS_08030 gene ffh 272728 274101 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092645.1 protein_id gnl|my_center|LOCUS_08030 274311 274562 gene locus_tag LOCUS_08040 gene rpsP 274311 274562 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092643.1 protein_id gnl|my_center|LOCUS_08040 274578 275105 gene locus_tag LOCUS_08050 gene rimM 274578 275105 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113830.1 protein_id gnl|my_center|LOCUS_08050 275112 275870 gene locus_tag LOCUS_08060 gene trmD 275112 275870 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119312.1 protein_id gnl|my_center|LOCUS_08060 275912 276262 gene locus_tag LOCUS_08070 gene rplS 275912 276262 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092637.1 protein_id gnl|my_center|LOCUS_08070 276414 276839 gene locus_tag LOCUS_08080 276414 276839 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092635.1 protein_id gnl|my_center|LOCUS_08080 277631 276909 gene locus_tag LOCUS_08090 277631 276909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119314.1 protein_id gnl|my_center|LOCUS_08090 279543 277708 gene locus_tag LOCUS_08100 279543 277708 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100653.1 protein_id gnl|my_center|LOCUS_08100 279758 280654 gene locus_tag LOCUS_08110 gene xerD 279758 280654 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092629.1 protein_id gnl|my_center|LOCUS_08110 280781 281509 gene locus_tag LOCUS_08120 gene dsbC 280781 281509 CDS product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092626.1 protein_id gnl|my_center|LOCUS_08120 281708 283027 gene locus_tag LOCUS_08130 281708 283027 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109642.1 protein_id gnl|my_center|LOCUS_08130 283080 284489 gene locus_tag LOCUS_08140 gene thrC 283080 284489 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113831.1 protein_id gnl|my_center|LOCUS_08140 285553 284543 gene locus_tag LOCUS_08150 285553 284543 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003143191.1 protein_id gnl|my_center|LOCUS_08150 285861 286145 gene locus_tag LOCUS_08160 285861 286145 CDS product DUF3509 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004351430.1 protein_id gnl|my_center|LOCUS_08160 287530 286331 gene locus_tag LOCUS_08170 287530 286331 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129868.1 protein_id gnl|my_center|LOCUS_08170 287865 288485 gene locus_tag LOCUS_08180 287865 288485 CDS product YjfI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092612.1 protein_id gnl|my_center|LOCUS_08180 288500 289195 gene locus_tag LOCUS_08190 288500 289195 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092609.1 protein_id gnl|my_center|LOCUS_08190 289251 289892 gene locus_tag LOCUS_08200 289251 289892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100672.1 protein_id gnl|my_center|LOCUS_08200 289928 291994 gene locus_tag LOCUS_08210 289928 291994 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113833.1 protein_id gnl|my_center|LOCUS_08210 292144 297384 gene locus_tag LOCUS_08220 292144 297384 CDS product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113834.1 protein_id gnl|my_center|LOCUS_08220 297403 298095 gene locus_tag LOCUS_08230 297403 298095 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100680.1 protein_id gnl|my_center|LOCUS_08230 298202 298741 gene locus_tag LOCUS_08240 298202 298741 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092594.1 protein_id gnl|my_center|LOCUS_08240 298785 300500 gene locus_tag LOCUS_08250 gene recJ 298785 300500 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 protein_id gnl|my_center|LOCUS_08250 300787 302283 gene locus_tag LOCUS_08260 gene lasB 300787 302283 CDS product M4 family elastase LasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113835.1 protein_id gnl|my_center|LOCUS_08260 302452 303558 gene locus_tag LOCUS_08270 302452 303558 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113836.1 protein_id gnl|my_center|LOCUS_08270 303747 304097 gene locus_tag LOCUS_08280 303747 304097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100685.1 protein_id gnl|my_center|LOCUS_08280 304751 304110 gene locus_tag LOCUS_08290 gene nalC 304751 304110 CDS product efflux system transcriptional repressor NalC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113837.1 protein_id gnl|my_center|LOCUS_08290 304956 305381 gene locus_tag LOCUS_08300 304956 305381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100688.1 protein_id gnl|my_center|LOCUS_08300 305389 305550 gene locus_tag LOCUS_08310 gene armR 305389 305550 CDS product MexR antirepressor ArmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100689.1 protein_id gnl|my_center|LOCUS_08310 305698 306939 gene locus_tag LOCUS_08320 305698 306939 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895662.1 protein_id gnl|my_center|LOCUS_08320 307379 307038 gene locus_tag LOCUS_08330 307379 307038 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092567.1 protein_id gnl|my_center|LOCUS_08330 307590 309296 gene locus_tag LOCUS_08340 307590 309296 CDS product WG repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113839.1 protein_id gnl|my_center|LOCUS_08340 310178 309375 gene locus_tag LOCUS_08350 310178 309375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113840.1 protein_id gnl|my_center|LOCUS_08350 310940 310299 gene locus_tag LOCUS_08360 310940 310299 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092560.1 protein_id gnl|my_center|LOCUS_08360 313126 311264 gene locus_tag LOCUS_08370 313126 311264 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113842.1 protein_id gnl|my_center|LOCUS_08370 313448 314143 gene locus_tag LOCUS_08380 313448 314143 CDS product DUF533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106298.1 protein_id gnl|my_center|LOCUS_08380 315085 314180 gene locus_tag LOCUS_08390 315085 314180 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092552.1 protein_id gnl|my_center|LOCUS_08390 315257 316930 gene locus_tag LOCUS_08400 315257 316930 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113843.1 protein_id gnl|my_center|LOCUS_08400 317039 318658 gene locus_tag LOCUS_08410 317039 318658 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106293.1 protein_id gnl|my_center|LOCUS_08410 318970 320553 gene locus_tag LOCUS_08420 gene wspA 318970 320553 CDS product Wsp signal transduction system chemoreceptor WspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113844.1 protein_id gnl|my_center|LOCUS_08420 320558 321073 gene locus_tag LOCUS_08430 320558 321073 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106290.1 protein_id gnl|my_center|LOCUS_08430 321070 322338 gene locus_tag LOCUS_08440 321070 322338 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113845.1 protein_id gnl|my_center|LOCUS_08440 322331 323020 gene locus_tag LOCUS_08450 322331 323020 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103738.1 protein_id gnl|my_center|LOCUS_08450 323017 325326 gene locus_tag LOCUS_08460 gene wspE 323017 325326 CDS product Wsp signal transduction system sensor histidine kinase WspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103736.1 protein_id gnl|my_center|LOCUS_08460 325323 326330 gene locus_tag LOCUS_08470 gene wspF 325323 326330 CDS product Wsp signal transduction system protein-glutamate methylesterase WspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092534.1 protein_id gnl|my_center|LOCUS_08470 326438 327481 gene locus_tag LOCUS_08480 gene wspR 326438 327481 CDS product Wsp signal transduction system regulator diguanylate cyclase WspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103734.1 protein_id gnl|my_center|LOCUS_08480 327797 328699 gene locus_tag LOCUS_08490 gene prfB 327797 328699 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895661.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08490 328877 330382 gene locus_tag LOCUS_08500 gene lysS 328877 330382 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113846.1 protein_id gnl|my_center|LOCUS_08500 330594 331307 gene locus_tag LOCUS_08510 330594 331307 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092520.1 protein_id gnl|my_center|LOCUS_08510 331404 331955 gene locus_tag LOCUS_08520 331404 331955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103725.1 protein_id gnl|my_center|LOCUS_08520 331964 333259 gene locus_tag LOCUS_08530 331964 333259 CDS product flavohemoglobin expression-modulating QEGLA motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092515.1 protein_id gnl|my_center|LOCUS_08530 333328 334074 gene locus_tag LOCUS_08540 333328 334074 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113847.1 protein_id gnl|my_center|LOCUS_08540 334071 334976 gene locus_tag LOCUS_08550 334071 334976 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103721.1 protein_id gnl|my_center|LOCUS_08550 334973 335296 gene locus_tag LOCUS_08560 334973 335296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092509.1 protein_id gnl|my_center|LOCUS_08560 335293 335814 gene locus_tag LOCUS_08570 335293 335814 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092502.1 protein_id gnl|my_center|LOCUS_08570 336675 335890 gene locus_tag LOCUS_08580 336675 335890 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092499.1 protein_id gnl|my_center|LOCUS_08580 337128 336724 gene locus_tag LOCUS_08590 337128 336724 CDS product DUF4398 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113848.1 protein_id gnl|my_center|LOCUS_08590 339646 337508 gene locus_tag LOCUS_08600 339646 337508 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895660.1 protein_id gnl|my_center|LOCUS_08600 339838 340308 gene locus_tag LOCUS_08610 gene cadR 339838 340308 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103716.1 protein_id gnl|my_center|LOCUS_08610 340661 340317 gene locus_tag LOCUS_08620 340661 340317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113849.1 protein_id gnl|my_center|LOCUS_08620 340545 340814 gene locus_tag LOCUS_08630 340545 340814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 340867 343503 gene locus_tag LOCUS_08640 gene ppc 340867 343503 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113850.1 protein_id gnl|my_center|LOCUS_08640 343664 344311 gene locus_tag LOCUS_08650 gene adk 343664 344311 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092485.1 protein_id gnl|my_center|LOCUS_08650 344415 345095 gene locus_tag LOCUS_08660 gene tsaB 344415 345095 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113851.1 protein_id gnl|my_center|LOCUS_08660 345169 345516 gene locus_tag LOCUS_08670 345169 345516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098661.1 protein_id gnl|my_center|LOCUS_08670 345535 346401 gene locus_tag LOCUS_08680 345535 346401 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098658.1 protein_id gnl|my_center|LOCUS_08680 346474 347298 gene locus_tag LOCUS_08690 346474 347298 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098657.1 protein_id gnl|my_center|LOCUS_08690 347303 347998 gene locus_tag LOCUS_08700 347303 347998 CDS product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113852.1 protein_id gnl|my_center|LOCUS_08700 348054 348839 gene locus_tag LOCUS_08710 348054 348839 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113853.1 protein_id gnl|my_center|LOCUS_08710 348868 350145 gene locus_tag LOCUS_08720 348868 350145 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113854.1 protein_id gnl|my_center|LOCUS_08720 350790 350152 gene locus_tag LOCUS_08730 gene mexL 350790 350152 CDS product efflux system transcriptional repressor MexL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092468.1 protein_id gnl|my_center|LOCUS_08730 350886 351989 gene locus_tag LOCUS_08740 gene mexJ 350886 351989 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MexJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113855.1 protein_id gnl|my_center|LOCUS_08740 351994 355071 gene locus_tag LOCUS_08750 gene mexK 351994 355071 CDS product multidrug efflux RND transporter permease subunit MexK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092464.1 protein_id gnl|my_center|LOCUS_08750 355792 355112 gene locus_tag LOCUS_08760 355792 355112 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098644.1 protein_id gnl|my_center|LOCUS_08760 356327 355929 gene locus_tag LOCUS_08770 356327 355929 CDS product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098642.1 protein_id gnl|my_center|LOCUS_08770 358975 356471 gene locus_tag LOCUS_08780 gene plsB 358975 356471 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113856.1 protein_id gnl|my_center|LOCUS_08780 359259 360182 gene locus_tag LOCUS_08790 359259 360182 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_08790 360179 360913 gene locus_tag LOCUS_08800 360179 360913 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_08800 360924 362771 gene locus_tag LOCUS_08810 360924 362771 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_08810 362775 363755 gene locus_tag LOCUS_08820 362775 363755 CDS product DUF4340 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113859.1 protein_id gnl|my_center|LOCUS_08820 364184 363762 gene locus_tag LOCUS_08830 364184 363762 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092439.1 protein_id gnl|my_center|LOCUS_08830 365386 364181 gene locus_tag LOCUS_08840 365386 364181 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098634.1 protein_id gnl|my_center|LOCUS_08840 366515 365481 gene locus_tag LOCUS_08850 gene dapD 366515 365481 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113860.1 protein_id gnl|my_center|LOCUS_08850 367168 366545 gene locus_tag LOCUS_08860 367168 366545 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098622.1 protein_id gnl|my_center|LOCUS_08860 367528 367181 gene locus_tag LOCUS_08870 367528 367181 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098619.1 protein_id gnl|my_center|LOCUS_08870 367831 368184 gene locus_tag LOCUS_08880 367831 368184 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098616.1 protein_id gnl|my_center|LOCUS_08880 368477 368199 gene locus_tag LOCUS_08890 368477 368199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098613.1 protein_id gnl|my_center|LOCUS_08890 369173 368814 gene locus_tag LOCUS_08900 369173 368814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092416.1 protein_id gnl|my_center|LOCUS_08900 369495 371156 gene locus_tag LOCUS_08910 369495 371156 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895659.1 protein_id gnl|my_center|LOCUS_08910 372415 371207 gene locus_tag LOCUS_08920 gene dapC 372415 371207 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092403.1 protein_id gnl|my_center|LOCUS_08920 375135 372433 gene locus_tag LOCUS_08930 375135 372433 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113862.1 protein_id gnl|my_center|LOCUS_08930 376087 375302 gene locus_tag LOCUS_08940 gene map 376087 375302 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092395.1 protein_id gnl|my_center|LOCUS_08940 376352 377092 gene locus_tag LOCUS_08950 gene rpsB 376352 377092 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092394.1 protein_id gnl|my_center|LOCUS_08950 377223 378092 gene locus_tag LOCUS_08960 gene tsf 377223 378092 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092393.1 protein_id gnl|my_center|LOCUS_08960 378291 379028 gene locus_tag LOCUS_08970 gene pyrH 378291 379028 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092391.1 protein_id gnl|my_center|LOCUS_08970 379031 379588 gene locus_tag LOCUS_08980 gene frr 379031 379588 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092390.1 protein_id gnl|my_center|LOCUS_08980 379604 380359 gene locus_tag LOCUS_08990 gene uppS 379604 380359 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113863.1 protein_id gnl|my_center|LOCUS_08990 380353 381168 gene locus_tag LOCUS_09000 gene cdsA 380353 381168 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092388.1 protein_id gnl|my_center|LOCUS_09000 381165 382355 gene locus_tag LOCUS_09010 gene ispC 381165 382355 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113864.1 protein_id gnl|my_center|LOCUS_09010 382381 383733 gene locus_tag LOCUS_09020 gene rseP 382381 383733 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098594.1 protein_id gnl|my_center|LOCUS_09020 383804 386188 gene locus_tag LOCUS_09030 gene bamA 383804 386188 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092382.1 protein_id gnl|my_center|LOCUS_09030 386239 386745 gene locus_tag LOCUS_09040 386239 386745 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098586.1 protein_id gnl|my_center|LOCUS_09040 386757 387806 gene locus_tag LOCUS_09050 gene lpxD 386757 387806 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098585.1 protein_id gnl|my_center|LOCUS_09050 387852 388292 gene locus_tag LOCUS_09060 gene fabZ 387852 388292 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092375.1 protein_id gnl|my_center|LOCUS_09060 388289 389065 gene locus_tag LOCUS_09070 gene lpxA 388289 389065 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092373.1 protein_id gnl|my_center|LOCUS_09070 389069 390205 gene locus_tag LOCUS_09080 gene lpxB 389069 390205 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113865.1 protein_id gnl|my_center|LOCUS_09080 390205 390810 gene locus_tag LOCUS_09090 gene rnhB 390205 390810 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113866.1 protein_id gnl|my_center|LOCUS_09090 391027 392442 gene locus_tag LOCUS_09100 391027 392442 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092370.1 protein_id gnl|my_center|LOCUS_09100 392572 396093 gene locus_tag LOCUS_09110 gene dnaE 392572 396093 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098578.1 protein_id gnl|my_center|LOCUS_09110 396243 397193 gene locus_tag LOCUS_09120 gene accA 396243 397193 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109333.1 protein_id gnl|my_center|LOCUS_09120 397263 398591 gene locus_tag LOCUS_09130 gene tilS 397263 398591 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113867.1 protein_id gnl|my_center|LOCUS_09130 398870 400390 gene locus_tag LOCUS_09140 398870 400390 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092366.1 protein_id gnl|my_center|LOCUS_09140 400393 401238 gene locus_tag LOCUS_09150 gene kdsA 400393 401238 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092365.1 protein_id gnl|my_center|LOCUS_09150 401284 402573 gene locus_tag LOCUS_09160 gene eno 401284 402573 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092364.1 protein_id gnl|my_center|LOCUS_09160 402638 402922 gene locus_tag LOCUS_09170 gene ftsB 402638 402922 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098569.1 protein_id gnl|my_center|LOCUS_09170 402942 403646 gene locus_tag LOCUS_09180 gene ispD 402942 403646 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092359.1 protein_id gnl|my_center|LOCUS_09180 403955 403707 gene locus_tag LOCUS_09190 gene yedF 403955 403707 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092358.1 protein_id gnl|my_center|LOCUS_09190 405147 403921 gene locus_tag LOCUS_09200 gene yedE 405147 403921 CDS product selenium metabolism membrane protein YedE/FdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098565.1 protein_id gnl|my_center|LOCUS_09200 406131 405223 gene locus_tag LOCUS_09210 gene gfnR 406131 405223 CDS product glutathione-dependent formaldehyde neutralization regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113868.1 protein_id gnl|my_center|LOCUS_09210 406263 407375 gene locus_tag LOCUS_09220 406263 407375 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092351.1 protein_id gnl|my_center|LOCUS_09220 407429 408280 gene locus_tag LOCUS_09230 gene fghA 407429 408280 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113869.1 protein_id gnl|my_center|LOCUS_09230 408351 408824 gene locus_tag LOCUS_09240 gene ispF 408351 408824 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098560.1 protein_id gnl|my_center|LOCUS_09240 408821 409888 gene locus_tag LOCUS_09250 gene truD 408821 409888 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113870.1 protein_id gnl|my_center|LOCUS_09250 409876 410625 gene locus_tag LOCUS_09260 gene surE 409876 410625 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092341.1 protein_id gnl|my_center|LOCUS_09260 410625 411293 gene locus_tag LOCUS_09270 410625 411293 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098558.1 protein_id gnl|my_center|LOCUS_09270 411339 412232 gene locus_tag LOCUS_09280 411339 412232 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406211.1 protein_id gnl|my_center|LOCUS_09280 412337 413341 gene locus_tag LOCUS_09290 gene rpoS 412337 413341 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113871.1 protein_id gnl|my_center|LOCUS_09290 414091 413768 gene locus_tag LOCUS_09300 414091 413768 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092272.1 protein_id gnl|my_center|LOCUS_09300 416794 414158 gene locus_tag LOCUS_09310 gene mutS 416794 414158 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113873.1 protein_id gnl|my_center|LOCUS_09310 417771 416797 gene locus_tag LOCUS_09320 417771 416797 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104854.1 protein_id gnl|my_center|LOCUS_09320 417990 417781 gene locus_tag LOCUS_09330 417990 417781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 418501 418205 gene locus_tag LOCUS_09340 418501 418205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 418777 418574 gene locus_tag LOCUS_09350 418777 418574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 419076 418774 gene locus_tag LOCUS_09360 419076 418774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 419644 419069 gene locus_tag LOCUS_09370 419644 419069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 419876 419637 gene locus_tag LOCUS_09380 419876 419637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 421150 419876 gene locus_tag LOCUS_09390 421150 419876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 421356 421147 gene locus_tag LOCUS_09400 421356 421147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 421568 421320 gene locus_tag LOCUS_09410 421568 421320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 422340 421651 gene locus_tag LOCUS_09420 422340 421651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 422428 422787 gene locus_tag LOCUS_09430 422428 422787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 423326 422790 gene locus_tag LOCUS_09440 423326 422790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 423700 423323 gene locus_tag LOCUS_09450 423700 423323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 424067 423765 gene locus_tag LOCUS_09460 424067 423765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 424429 424067 gene locus_tag LOCUS_09470 424429 424067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 424819 424616 gene locus_tag LOCUS_09480 424819 424616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 425064 424816 gene locus_tag LOCUS_09490 425064 424816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 425461 425075 gene locus_tag LOCUS_09500 425461 425075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 426723 425800 gene locus_tag LOCUS_09510 426723 425800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 427748 426963 gene locus_tag LOCUS_09520 427748 426963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268003.1 protein_id gnl|my_center|LOCUS_09520 428689 428258 gene locus_tag LOCUS_09530 428689 428258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 429117 428686 gene locus_tag LOCUS_09540 429117 428686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 429547 429104 gene locus_tag LOCUS_09550 429547 429104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 430358 429636 gene locus_tag LOCUS_09560 gene prtR 430358 429636 CDS product transcriptional regulator PrtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113202.1 protein_id gnl|my_center|LOCUS_09560 430448 430645 gene locus_tag LOCUS_09570 430448 430645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 430796 431509 gene locus_tag LOCUS_09580 430796 431509 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115765672.1 protein_id gnl|my_center|LOCUS_09580 431574 432335 gene locus_tag LOCUS_09590 431574 432335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 432332 433015 gene locus_tag LOCUS_09600 432332 433015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 433012 433218 gene locus_tag LOCUS_09610 433012 433218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 433257 433796 gene locus_tag LOCUS_09620 433257 433796 CDS product recombination protein NinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267993.1 protein_id gnl|my_center|LOCUS_09620 433793 434089 gene locus_tag LOCUS_09630 433793 434089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 434091 434465 gene locus_tag LOCUS_09640 434091 434465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 434636 434968 gene locus_tag LOCUS_09650 434636 434968 CDS product phage holin, lambda family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377395.1 protein_id gnl|my_center|LOCUS_09650 434965 435582 gene locus_tag LOCUS_09660 434965 435582 CDS product glycoside hydrolase family 19 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113192.1 protein_id gnl|my_center|LOCUS_09660 435639 436031 gene locus_tag LOCUS_09670 435639 436031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 436123 436542 gene locus_tag LOCUS_09680 436123 436542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 436674 437084 gene locus_tag LOCUS_09690 436674 437084 CDS product phage terminase small subunit P27 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938796.1 protein_id gnl|my_center|LOCUS_09690 437077 438840 gene locus_tag LOCUS_09700 437077 438840 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088178.1 protein_id gnl|my_center|LOCUS_09700 438840 440243 gene locus_tag LOCUS_09710 438840 440243 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072869.1 protein_id gnl|my_center|LOCUS_09710 440260 441132 gene locus_tag LOCUS_09720 440260 441132 CDS product Clp protease ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337208.1 protein_id gnl|my_center|LOCUS_09720 441146 442357 gene locus_tag LOCUS_09730 441146 442357 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072867.1 protein_id gnl|my_center|LOCUS_09730 442404 442592 gene locus_tag LOCUS_09740 442404 442592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 442596 442775 gene locus_tag LOCUS_09750 442596 442775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 442786 443118 gene locus_tag LOCUS_09760 442786 443118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 443119 443670 gene locus_tag LOCUS_09770 443119 443670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 443667 444260 gene locus_tag LOCUS_09780 443667 444260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 444273 444710 gene locus_tag LOCUS_09790 444273 444710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 444734 445519 gene locus_tag LOCUS_09800 444734 445519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 445576 445941 gene locus_tag LOCUS_09810 445576 445941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 445986 446135 gene locus_tag LOCUS_09820 445986 446135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 446125 448266 gene locus_tag LOCUS_09830 446125 448266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 448276 448779 gene locus_tag LOCUS_09840 448276 448779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 >Feature sequence03 322 1866 gene locus_tag LOCUS_09850 322 1866 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229626.1 protein_id gnl|my_center|LOCUS_09850 1979 3418 gene locus_tag LOCUS_09860 1979 3418 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315769.1 protein_id gnl|my_center|LOCUS_09860 3525 3845 gene locus_tag LOCUS_09870 3525 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 4750 5841 gene locus_tag LOCUS_09880 4750 5841 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040313.1 protein_id gnl|my_center|LOCUS_09880 5942 6742 gene locus_tag LOCUS_09890 5942 6742 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522303.1 protein_id gnl|my_center|LOCUS_09890 6808 7467 gene locus_tag LOCUS_09900 6808 7467 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522302.1 protein_id gnl|my_center|LOCUS_09900 7522 8247 gene locus_tag LOCUS_09910 7522 8247 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522301.1 protein_id gnl|my_center|LOCUS_09910 8624 9820 gene locus_tag LOCUS_09920 8624 9820 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104588.1 protein_id gnl|my_center|LOCUS_09920 9892 11109 gene locus_tag LOCUS_09930 9892 11109 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_09930 11528 13405 gene locus_tag LOCUS_09940 gene pctA 11528 13405 CDS product methyl-accepting chemotaxis protein PctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148125.1 protein_id gnl|my_center|LOCUS_09940 15037 13787 gene locus_tag LOCUS_09950 15037 13787 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563408.1 protein_id gnl|my_center|LOCUS_09950 15881 15174 gene locus_tag LOCUS_09960 gene dapA 15881 15174 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707511.1 protein_id gnl|my_center|LOCUS_09960 16511 16750 gene locus_tag LOCUS_09970 16511 16750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 18101 16776 gene locus_tag LOCUS_09980 18101 16776 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331280.1 protein_id gnl|my_center|LOCUS_09980 19012 18119 gene locus_tag LOCUS_09990 19012 18119 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331282.1 protein_id gnl|my_center|LOCUS_09990 20516 19029 gene locus_tag LOCUS_10000 20516 19029 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331281.1 protein_id gnl|my_center|LOCUS_10000 20900 20730 gene locus_tag LOCUS_10010 20900 20730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 22312 21380 gene locus_tag LOCUS_10020 22312 21380 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766100.1 protein_id gnl|my_center|LOCUS_10020 23802 22918 gene locus_tag LOCUS_10030 23802 22918 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268101.1 protein_id gnl|my_center|LOCUS_10030 23927 25039 gene locus_tag LOCUS_10040 23927 25039 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268100.1 protein_id gnl|my_center|LOCUS_10040 25230 25613 gene locus_tag LOCUS_10050 25230 25613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10050 26065 25688 gene locus_tag LOCUS_10060 26065 25688 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168302153.1 protein_id gnl|my_center|LOCUS_10060 27613 26348 gene locus_tag LOCUS_10070 gene dadA 27613 26348 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403947.1 protein_id gnl|my_center|LOCUS_10070 28226 34927 gene locus_tag LOCUS_10080 28226 34927 CDS product DUF3320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183275411.1 protein_id gnl|my_center|LOCUS_10080 36077 35070 gene locus_tag LOCUS_10090 36077 35070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 36593 36949 gene locus_tag LOCUS_10100 36593 36949 CDS product DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105154.1 protein_id gnl|my_center|LOCUS_10100 39871 37052 gene locus_tag LOCUS_10110 39871 37052 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280508.1 protein_id gnl|my_center|LOCUS_10110 41087 40233 gene locus_tag LOCUS_10120 gene cysQ 41087 40233 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388204.1 protein_id gnl|my_center|LOCUS_10120 41415 41209 gene locus_tag LOCUS_10130 41415 41209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 41923 41513 gene locus_tag LOCUS_10140 41923 41513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 42150 42010 gene locus_tag LOCUS_10150 42150 42010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 43844 42486 gene locus_tag LOCUS_10160 43844 42486 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478369.1 protein_id gnl|my_center|LOCUS_10160 44473 43883 gene locus_tag LOCUS_10170 44473 43883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 45020 44850 gene locus_tag LOCUS_10180 45020 44850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 45947 45384 gene locus_tag LOCUS_10190 45947 45384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 46276 46046 gene locus_tag LOCUS_10200 46276 46046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 47723 46287 gene locus_tag LOCUS_10210 gene ccoN 47723 46287 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113609.1 protein_id gnl|my_center|LOCUS_10210 48129 49526 gene locus_tag LOCUS_10220 48129 49526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 49563 50717 gene locus_tag LOCUS_10230 gene cfa 49563 50717 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444610.1 protein_id gnl|my_center|LOCUS_10230 51661 50801 gene locus_tag LOCUS_10240 51661 50801 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082145856.1 protein_id gnl|my_center|LOCUS_10240 52240 53754 gene locus_tag LOCUS_10250 52240 53754 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965761.1 protein_id gnl|my_center|LOCUS_10250 55221 53851 gene locus_tag LOCUS_10260 55221 53851 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_10260 57710 55239 gene locus_tag LOCUS_10270 57710 55239 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103006.1 protein_id gnl|my_center|LOCUS_10270 58898 57735 gene locus_tag LOCUS_10280 58898 57735 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113340.1 protein_id gnl|my_center|LOCUS_10280 60308 58965 gene locus_tag LOCUS_10290 60308 58965 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114488.1 protein_id gnl|my_center|LOCUS_10290 62135 60324 gene locus_tag LOCUS_10300 62135 60324 CDS product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102337.1 protein_id gnl|my_center|LOCUS_10300 62604 62936 gene locus_tag LOCUS_10310 62604 62936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 63073 64041 gene locus_tag LOCUS_10320 63073 64041 CDS product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705015.1 protein_id gnl|my_center|LOCUS_10320 64117 65121 gene locus_tag LOCUS_10330 64117 65121 CDS product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705014.1 protein_id gnl|my_center|LOCUS_10330 65211 66161 gene locus_tag LOCUS_10340 65211 66161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042012908.1 protein_id gnl|my_center|LOCUS_10340 66133 66630 gene locus_tag LOCUS_10350 gene radC 66133 66630 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050665004.1 protein_id gnl|my_center|LOCUS_10350 66641 66823 gene locus_tag LOCUS_10360 66641 66823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 67042 66791 gene locus_tag LOCUS_10370 67042 66791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 68131 67763 gene locus_tag LOCUS_10380 68131 67763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 68944 68744 gene locus_tag LOCUS_10390 68944 68744 CDS product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211742.1 protein_id gnl|my_center|LOCUS_10390 69480 70328 gene locus_tag LOCUS_10400 69480 70328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 71679 70477 gene locus_tag LOCUS_10410 71679 70477 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130487.1 protein_id gnl|my_center|LOCUS_10410 72506 72276 gene locus_tag LOCUS_10420 72506 72276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113176.1 protein_id gnl|my_center|LOCUS_10420 72805 72503 gene locus_tag LOCUS_10430 72805 72503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113177.1 protein_id gnl|my_center|LOCUS_10430 73857 72805 gene locus_tag LOCUS_10440 73857 72805 CDS product pyocin knob domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113178.1 protein_id gnl|my_center|LOCUS_10440 74183 73953 gene locus_tag LOCUS_10450 74183 73953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895513.1 protein_id gnl|my_center|LOCUS_10450 74499 74164 gene locus_tag LOCUS_10460 74499 74164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113180.1 protein_id gnl|my_center|LOCUS_10460 75590 74499 gene locus_tag LOCUS_10470 75590 74499 CDS product pyocin knob domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115342.1 protein_id gnl|my_center|LOCUS_10470 76641 76348 gene locus_tag LOCUS_10480 76641 76348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 80252 76638 gene locus_tag LOCUS_10490 80252 76638 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113182.1 protein_id gnl|my_center|LOCUS_10490 80913 80311 gene locus_tag LOCUS_10500 80913 80311 CDS product tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113183.1 protein_id gnl|my_center|LOCUS_10500 81738 80968 gene locus_tag LOCUS_10510 81738 80968 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113184.1 protein_id gnl|my_center|LOCUS_10510 82436 81741 gene locus_tag LOCUS_10520 82436 81741 CDS product phage minor tail protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113185.1 protein_id gnl|my_center|LOCUS_10520 82785 82444 gene locus_tag LOCUS_10530 82785 82444 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113186.1 protein_id gnl|my_center|LOCUS_10530 84613 82778 gene locus_tag LOCUS_10540 84613 82778 CDS product phage tail tape measure C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113187.1 protein_id gnl|my_center|LOCUS_10540 84914 84660 gene locus_tag LOCUS_10550 84914 84660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113188.1 protein_id gnl|my_center|LOCUS_10550 85291 84944 gene locus_tag LOCUS_10560 85291 84944 CDS product phage tail assembly chaperone family protein, TAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113189.1 protein_id gnl|my_center|LOCUS_10560 85797 85303 gene locus_tag LOCUS_10570 85797 85303 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113190.1 protein_id gnl|my_center|LOCUS_10570 86298 86113 gene locus_tag LOCUS_10580 86298 86113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 86729 86367 gene locus_tag LOCUS_10590 86729 86367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118918.1 protein_id gnl|my_center|LOCUS_10590 87355 86726 gene locus_tag LOCUS_10600 87355 86726 CDS product glycoside hydrolase family 19 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113192.1 protein_id gnl|my_center|LOCUS_10600 88377 87388 gene locus_tag LOCUS_10610 88377 87388 CDS product phage late control D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113193.1 protein_id gnl|my_center|LOCUS_10610 88608 88435 gene locus_tag LOCUS_10620 88608 88435 CDS product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101635.1 protein_id gnl|my_center|LOCUS_10620 89488 88616 gene locus_tag LOCUS_10630 89488 88616 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113194.1 protein_id gnl|my_center|LOCUS_10630 91723 89498 gene locus_tag LOCUS_10640 91723 89498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113195.1 protein_id gnl|my_center|LOCUS_10640 92249 91905 gene locus_tag LOCUS_10650 92249 91905 CDS product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085178.1 protein_id gnl|my_center|LOCUS_10650 92767 92264 gene locus_tag LOCUS_10660 92767 92264 CDS product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085175.1 protein_id gnl|my_center|LOCUS_10660 93940 92780 gene locus_tag LOCUS_10670 93940 92780 CDS product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113197.1 protein_id gnl|my_center|LOCUS_10670 96513 94438 gene locus_tag LOCUS_10680 96513 94438 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113198.1 protein_id gnl|my_center|LOCUS_10680 97048 96515 gene locus_tag LOCUS_10690 97048 96515 CDS product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895511.1 protein_id gnl|my_center|LOCUS_10690 97928 97041 gene locus_tag LOCUS_10700 97928 97041 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085151.1 protein_id gnl|my_center|LOCUS_10700 98251 97925 gene locus_tag LOCUS_10710 98251 97925 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113199.1 protein_id gnl|my_center|LOCUS_10710 98961 98404 gene locus_tag LOCUS_10720 98961 98404 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085141.1 protein_id gnl|my_center|LOCUS_10720 99473 98958 gene locus_tag LOCUS_10730 99473 98958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113200.1 protein_id gnl|my_center|LOCUS_10730 99848 99495 gene locus_tag LOCUS_10740 99848 99495 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118908.1 protein_id gnl|my_center|LOCUS_10740 100667 100308 gene locus_tag LOCUS_10750 100667 100308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113201.1 protein_id gnl|my_center|LOCUS_10750 100966 100715 gene locus_tag LOCUS_10760 100966 100715 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085132.1 protein_id gnl|my_center|LOCUS_10760 101118 101288 gene locus_tag LOCUS_10770 101118 101288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 101373 102143 gene locus_tag LOCUS_10780 gene prtR 101373 102143 CDS product transcriptional regulator PrtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113202.1 protein_id gnl|my_center|LOCUS_10780 102243 102557 gene locus_tag LOCUS_10790 gene prtN 102243 102557 CDS product pyocin genes transcriptional regulator PrtN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113203.1 protein_id gnl|my_center|LOCUS_10790 104222 102744 gene locus_tag LOCUS_10800 gene trpE 104222 102744 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113204.1 protein_id gnl|my_center|LOCUS_10800 105113 104295 gene locus_tag LOCUS_10810 105113 104295 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113205.1 protein_id gnl|my_center|LOCUS_10810 105787 105113 gene locus_tag LOCUS_10820 gene rpe 105787 105113 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085122.1 protein_id gnl|my_center|LOCUS_10820 106741 105911 gene locus_tag LOCUS_10830 106741 105911 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099535.1 protein_id gnl|my_center|LOCUS_10830 108094 106847 gene locus_tag LOCUS_10840 108094 106847 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113206.1 protein_id gnl|my_center|LOCUS_10840 109255 108209 gene locus_tag LOCUS_10850 109255 108209 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099539.1 protein_id gnl|my_center|LOCUS_10850 110420 109311 gene locus_tag LOCUS_10860 gene potA 110420 109311 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085109.1 protein_id gnl|my_center|LOCUS_10860 111688 110654 gene locus_tag LOCUS_10870 111688 110654 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085106.1 protein_id gnl|my_center|LOCUS_10870 112464 111817 gene locus_tag LOCUS_10880 112464 111817 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085103.1 protein_id gnl|my_center|LOCUS_10880 114888 112495 gene locus_tag LOCUS_10890 114888 112495 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113207.1 protein_id gnl|my_center|LOCUS_10890 115040 116101 gene locus_tag LOCUS_10900 115040 116101 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099546.1 protein_id gnl|my_center|LOCUS_10900 116860 116102 gene locus_tag LOCUS_10910 116860 116102 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099547.1 protein_id gnl|my_center|LOCUS_10910 117536 116862 gene locus_tag LOCUS_10920 gene murU 117536 116862 CDS product N-acetylmuramate alpha-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099549.1 protein_id gnl|my_center|LOCUS_10920 118549 117533 gene locus_tag LOCUS_10930 gene amgK 118549 117533 CDS product N-acetylmuramate/N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113208.1 protein_id gnl|my_center|LOCUS_10930 119821 121533 gene locus_tag LOCUS_10940 gene ltrA 119821 121533 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235893157.1 protein_id gnl|my_center|LOCUS_10940 121666 124440 gene locus_tag LOCUS_10950 gene lptD 121666 124440 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113209.1 protein_id gnl|my_center|LOCUS_10950 124627 124433 gene locus_tag LOCUS_10960 124627 124433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 124547 125713 gene locus_tag LOCUS_10970 124547 125713 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115345.1 protein_id gnl|my_center|LOCUS_10970 125710 126696 gene locus_tag LOCUS_10980 gene pdxA 125710 126696 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109023.1 protein_id gnl|my_center|LOCUS_10980 126812 127618 gene locus_tag LOCUS_10990 gene rsmA 126812 127618 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113212.1 protein_id gnl|my_center|LOCUS_10990 127655 128035 gene locus_tag LOCUS_11000 gene apaG 127655 128035 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085085.1 protein_id gnl|my_center|LOCUS_11000 128035 128886 gene locus_tag LOCUS_11010 128035 128886 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113213.1 protein_id gnl|my_center|LOCUS_11010 128930 129262 gene locus_tag LOCUS_11020 gene glpE 128930 129262 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085081.1 protein_id gnl|my_center|LOCUS_11020 129541 131463 gene locus_tag LOCUS_11030 129541 131463 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085078.1 protein_id gnl|my_center|LOCUS_11030 131564 132835 gene locus_tag LOCUS_11040 131564 132835 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099579.1 protein_id gnl|my_center|LOCUS_11040 132832 134385 gene locus_tag LOCUS_11050 132832 134385 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099581.1 protein_id gnl|my_center|LOCUS_11050 134479 134985 gene locus_tag LOCUS_11060 134479 134985 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085071.1 protein_id gnl|my_center|LOCUS_11060 135029 136261 gene locus_tag LOCUS_11070 135029 136261 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113214.1 protein_id gnl|my_center|LOCUS_11070 136776 136234 gene locus_tag LOCUS_11080 gene folK 136776 136234 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085067.1 protein_id gnl|my_center|LOCUS_11080 137120 136767 gene locus_tag LOCUS_11090 gene folB 137120 136767 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099587.1 protein_id gnl|my_center|LOCUS_11090 137204 137773 gene locus_tag LOCUS_11100 gene plsY 137204 137773 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085061.1 protein_id gnl|my_center|LOCUS_11100 138877 137852 gene locus_tag LOCUS_11110 gene tsaD 138877 137852 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109020.1 protein_id gnl|my_center|LOCUS_11110 139078 139293 gene locus_tag LOCUS_11120 gene rpsU 139078 139293 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551877.1 protein_id gnl|my_center|LOCUS_11120 139363 139812 gene locus_tag LOCUS_11130 139363 139812 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085042.1 protein_id gnl|my_center|LOCUS_11130 139895 141889 gene locus_tag LOCUS_11140 gene dnaG 139895 141889 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099594.1 protein_id gnl|my_center|LOCUS_11140 141969 143822 gene locus_tag LOCUS_11150 gene rpoD 141969 143822 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085035.1 protein_id gnl|my_center|LOCUS_11150 143929 147666 gene locus_tag LOCUS_11160 143929 147666 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113216.1 protein_id gnl|my_center|LOCUS_11160 148747 150432 gene locus_tag LOCUS_11170 gene ltrA 148747 150432 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235893157.1 protein_id gnl|my_center|LOCUS_11170 150530 150606 gene locus_tag LOCUS_t00050 150530 150606 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 150760 150897 gene locus_tag LOCUS_11180 150760 150897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 151156 152277 gene locus_tag LOCUS_11190 151156 152277 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113218.1 protein_id gnl|my_center|LOCUS_11190 152370 152705 gene locus_tag LOCUS_11200 152370 152705 CDS product nuclease-related domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115346.1 protein_id gnl|my_center|LOCUS_11200 153320 156046 gene locus_tag LOCUS_11210 gene impA 153320 156046 CDS product metalloprotease ImpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003142775.1 protein_id gnl|my_center|LOCUS_11210 156237 156851 gene locus_tag LOCUS_11220 156237 156851 CDS product DMP19 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118887.1 protein_id gnl|my_center|LOCUS_11220 156853 157188 gene locus_tag LOCUS_11230 156853 157188 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113222.1 protein_id gnl|my_center|LOCUS_11230 157202 157672 gene locus_tag LOCUS_11240 157202 157672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099612.1 protein_id gnl|my_center|LOCUS_11240 157688 158146 gene locus_tag LOCUS_11250 157688 158146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113223.1 protein_id gnl|my_center|LOCUS_11250 158314 158156 gene locus_tag LOCUS_11260 158314 158156 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084988.1 protein_id gnl|my_center|LOCUS_11260 158502 159017 gene locus_tag LOCUS_11270 158502 159017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113224.1 protein_id gnl|my_center|LOCUS_11270 159345 159007 gene locus_tag LOCUS_11280 159345 159007 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084980.1 protein_id gnl|my_center|LOCUS_11280 159463 160374 gene locus_tag LOCUS_11290 159463 160374 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113225.1 protein_id gnl|my_center|LOCUS_11290 160552 160905 gene locus_tag LOCUS_11300 160552 160905 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084974.1 protein_id gnl|my_center|LOCUS_11300 161034 161729 gene locus_tag LOCUS_11310 161034 161729 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101612.1 protein_id gnl|my_center|LOCUS_11310 162225 161737 gene locus_tag LOCUS_11320 162225 161737 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084971.1 protein_id gnl|my_center|LOCUS_11320 162353 163516 gene locus_tag LOCUS_11330 162353 163516 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113227.1 protein_id gnl|my_center|LOCUS_11330 164280 163513 gene locus_tag LOCUS_11340 164280 163513 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084969.1 protein_id gnl|my_center|LOCUS_11340 164510 164935 gene locus_tag LOCUS_11350 164510 164935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 165419 164937 gene locus_tag LOCUS_11360 165419 164937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113228.1 protein_id gnl|my_center|LOCUS_11360 166549 165485 gene locus_tag LOCUS_11370 gene fba 166549 165485 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084964.1 protein_id gnl|my_center|LOCUS_11370 167010 166669 gene locus_tag LOCUS_11380 167010 166669 CDS product MliC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113229.1 protein_id gnl|my_center|LOCUS_11380 167370 167170 gene locus_tag LOCUS_11390 167370 167170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084961.1 protein_id gnl|my_center|LOCUS_11390 168606 167443 gene locus_tag LOCUS_11400 168606 167443 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084960.1 protein_id gnl|my_center|LOCUS_11400 169673 168612 gene locus_tag LOCUS_11410 gene epd 169673 168612 CDS product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084958.1 protein_id gnl|my_center|LOCUS_11410 169888 170685 gene locus_tag LOCUS_11420 169888 170685 CDS product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113230.1 protein_id gnl|my_center|LOCUS_11420 171730 170666 gene locus_tag LOCUS_11430 171730 170666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101600.1 protein_id gnl|my_center|LOCUS_11430 173727 171730 gene locus_tag LOCUS_11440 gene tkt 173727 171730 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110216.1 protein_id gnl|my_center|LOCUS_11440 173974 174975 gene locus_tag LOCUS_11450 173974 174975 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113231.1 protein_id gnl|my_center|LOCUS_11450 174991 176181 gene locus_tag LOCUS_11460 gene metK 174991 176181 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084948.1 protein_id gnl|my_center|LOCUS_11460 177541 176237 gene locus_tag LOCUS_11470 177541 176237 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101595.1 protein_id gnl|my_center|LOCUS_11470 177747 178490 gene locus_tag LOCUS_11480 177747 178490 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101593.1 protein_id gnl|my_center|LOCUS_11480 179462 178494 gene locus_tag LOCUS_11490 179462 178494 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101591.1 protein_id gnl|my_center|LOCUS_11490 179712 180131 gene locus_tag LOCUS_11500 179712 180131 CDS product DUF1090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101589.1 protein_id gnl|my_center|LOCUS_11500 180781 180323 gene locus_tag LOCUS_11510 180781 180323 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110213.1 protein_id gnl|my_center|LOCUS_11510 181280 180894 gene locus_tag LOCUS_11520 181280 180894 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101585.1 protein_id gnl|my_center|LOCUS_11520 182180 181350 gene locus_tag LOCUS_11530 182180 181350 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101583.1 protein_id gnl|my_center|LOCUS_11530 182337 182918 gene locus_tag LOCUS_11540 182337 182918 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113232.1 protein_id gnl|my_center|LOCUS_11540 183006 183614 gene locus_tag LOCUS_11550 183006 183614 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084923.1 protein_id gnl|my_center|LOCUS_11550 183618 184643 gene locus_tag LOCUS_11560 183618 184643 CDS product YgcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084914.1 protein_id gnl|my_center|LOCUS_11560 185308 184754 gene locus_tag LOCUS_11570 185308 184754 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101576.1 protein_id gnl|my_center|LOCUS_11570 186615 185326 gene locus_tag LOCUS_11580 186615 185326 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101571.1 protein_id gnl|my_center|LOCUS_11580 188443 186953 gene locus_tag LOCUS_11590 188443 186953 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084906.1 protein_id gnl|my_center|LOCUS_11590 188717 188992 gene locus_tag LOCUS_11600 188717 188992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 189783 189067 gene locus_tag LOCUS_11610 189783 189067 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084901.1 protein_id gnl|my_center|LOCUS_11610 190964 189783 gene locus_tag LOCUS_11620 190964 189783 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084899.1 protein_id gnl|my_center|LOCUS_11620 191193 190957 gene locus_tag LOCUS_11630 191193 190957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 191891 191190 gene locus_tag LOCUS_11640 191891 191190 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084895.1 protein_id gnl|my_center|LOCUS_11640 191993 192871 gene locus_tag LOCUS_11650 191993 192871 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084893.1 protein_id gnl|my_center|LOCUS_11650 193225 193908 gene locus_tag LOCUS_11660 gene dnr 193225 193908 CDS product transcriptional regulator Dnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113234.1 protein_id gnl|my_center|LOCUS_11660 193992 194186 gene locus_tag LOCUS_11670 193992 194186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113235.1 protein_id gnl|my_center|LOCUS_11670 196031 194193 gene locus_tag LOCUS_11680 196031 194193 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113236.1 protein_id gnl|my_center|LOCUS_11680 197430 196033 gene locus_tag LOCUS_11690 gene norB 197430 196033 CDS product nitric-oxide reductase subunit NorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113237.1 protein_id gnl|my_center|LOCUS_11690 197870 197430 gene locus_tag LOCUS_11700 gene norC 197870 197430 CDS product nitric oxide reductase subunit NorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113238.1 protein_id gnl|my_center|LOCUS_11700 198217 197960 gene locus_tag LOCUS_11710 198217 197960 CDS product cytochrome C oxidase subunit IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113239.1 protein_id gnl|my_center|LOCUS_11710 198797 198225 gene locus_tag LOCUS_11720 198797 198225 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118864.1 protein_id gnl|my_center|LOCUS_11720 199569 198787 gene locus_tag LOCUS_11730 gene nirQ 199569 198787 CDS product transcriptional regulator NirQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113240.1 protein_id gnl|my_center|LOCUS_11730 199785 201491 gene locus_tag LOCUS_11740 gene nirS 199785 201491 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 protein_id gnl|my_center|LOCUS_11740 201542 201856 gene locus_tag LOCUS_11750 gene nirM 201542 201856 CDS product cytochrome C-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084872.1 protein_id gnl|my_center|LOCUS_11750 201895 202212 gene locus_tag LOCUS_11760 gene nirC 201895 202212 CDS product cytochrome c55X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084870.1 protein_id gnl|my_center|LOCUS_11760 202209 203387 gene locus_tag LOCUS_11770 gene nirF 202209 203387 CDS product heme d1 biosynthesis protein NirF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113241.1 protein_id gnl|my_center|LOCUS_11770 203396 203848 gene locus_tag LOCUS_11780 203396 203848 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084864.1 protein_id gnl|my_center|LOCUS_11780 203938 204369 gene locus_tag LOCUS_11790 203938 204369 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111534.1 protein_id gnl|my_center|LOCUS_11790 204362 204805 gene locus_tag LOCUS_11800 204362 204805 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084860.1 protein_id gnl|my_center|LOCUS_11800 204780 205295 gene locus_tag LOCUS_11810 204780 205295 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084858.1 protein_id gnl|my_center|LOCUS_11810 205289 206452 gene locus_tag LOCUS_11820 gene nirJ 205289 206452 CDS product heme d1 biosynthesis radical SAM protein NirJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113242.1 protein_id gnl|my_center|LOCUS_11820 206463 207302 gene locus_tag LOCUS_11830 gene cobA 206463 207302 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113243.1 protein_id gnl|my_center|LOCUS_11830 207293 208774 gene locus_tag LOCUS_11840 gene nirN 207293 208774 CDS product dihydro-heme d1 dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113244.1 protein_id gnl|my_center|LOCUS_11840 210883 209105 gene locus_tag LOCUS_11850 210883 209105 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113245.1 protein_id gnl|my_center|LOCUS_11850 212953 211157 gene locus_tag LOCUS_11860 212953 211157 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103343.1 protein_id gnl|my_center|LOCUS_11860 214971 213166 gene locus_tag LOCUS_11870 214971 213166 CDS product phenylacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084842.1 protein_id gnl|my_center|LOCUS_11870 215541 215311 gene locus_tag LOCUS_11880 215541 215311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113246.1 protein_id gnl|my_center|LOCUS_11880 216336 215650 gene locus_tag LOCUS_11890 gene bioD 216336 215650 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103336.1 protein_id gnl|my_center|LOCUS_11890 217164 216340 gene locus_tag LOCUS_11900 gene bioC 217164 216340 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113247.1 protein_id gnl|my_center|LOCUS_11900 217879 217157 gene locus_tag LOCUS_11910 217879 217157 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103332.1 protein_id gnl|my_center|LOCUS_11910 219077 217872 gene locus_tag LOCUS_11920 gene bioF 219077 217872 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113248.1 protein_id gnl|my_center|LOCUS_11920 220241 219183 gene locus_tag LOCUS_11930 gene bioB 220241 219183 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103330.1 protein_id gnl|my_center|LOCUS_11930 220806 221507 gene locus_tag LOCUS_11940 220806 221507 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113249.1 protein_id gnl|my_center|LOCUS_11940 221636 222523 gene locus_tag LOCUS_11950 221636 222523 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113251.1 protein_id gnl|my_center|LOCUS_11950 223544 222567 gene locus_tag LOCUS_11960 223544 222567 CDS product 5-oxoprolinase/urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113252.1 protein_id gnl|my_center|LOCUS_11960 224412 223534 gene locus_tag LOCUS_11970 224412 223534 CDS product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113253.1 protein_id gnl|my_center|LOCUS_11970 225790 224414 gene locus_tag LOCUS_11980 225790 224414 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113254.1 protein_id gnl|my_center|LOCUS_11980 226049 225801 gene locus_tag LOCUS_11990 226049 225801 CDS product acetyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084813.1 protein_id gnl|my_center|LOCUS_11990 226884 226126 gene locus_tag LOCUS_12000 226884 226126 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103315.1 protein_id gnl|my_center|LOCUS_12000 227011 227928 gene locus_tag LOCUS_12010 227011 227928 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118849.1 protein_id gnl|my_center|LOCUS_12010 227982 228275 gene locus_tag LOCUS_12020 227982 228275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113255.1 protein_id gnl|my_center|LOCUS_12020 228414 229145 gene locus_tag LOCUS_12030 228414 229145 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103309.1 protein_id gnl|my_center|LOCUS_12030 229187 229507 gene locus_tag LOCUS_12040 229187 229507 CDS product YfiM family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103307.1 protein_id gnl|my_center|LOCUS_12040 229575 230333 gene locus_tag LOCUS_12050 229575 230333 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084796.1 protein_id gnl|my_center|LOCUS_12050 230395 231369 gene locus_tag LOCUS_12060 230395 231369 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113256.1 protein_id gnl|my_center|LOCUS_12060 231572 232468 gene locus_tag LOCUS_12070 gene rarD 231572 232468 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103301.1 protein_id gnl|my_center|LOCUS_12070 233673 233158 gene locus_tag LOCUS_12080 233673 233158 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084789.1 protein_id gnl|my_center|LOCUS_12080 234148 233705 gene locus_tag LOCUS_12090 234148 233705 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105215.1 protein_id gnl|my_center|LOCUS_12090 234455 236632 gene locus_tag LOCUS_12100 234455 236632 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113258.1 protein_id gnl|my_center|LOCUS_12100 237123 236680 gene locus_tag LOCUS_12110 237123 236680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105223.1 protein_id gnl|my_center|LOCUS_12110 237963 237166 gene locus_tag LOCUS_12120 gene pcaD 237963 237166 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113259.1 protein_id gnl|my_center|LOCUS_12120 238067 239017 gene locus_tag LOCUS_12130 238067 239017 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113260.1 protein_id gnl|my_center|LOCUS_12130 239572 239096 gene locus_tag LOCUS_12140 239572 239096 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084777.1 protein_id gnl|my_center|LOCUS_12140 239660 240586 gene locus_tag LOCUS_12150 239660 240586 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105226.1 protein_id gnl|my_center|LOCUS_12150 240933 242660 gene locus_tag LOCUS_12160 240933 242660 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084774.1 protein_id gnl|my_center|LOCUS_12160 243263 242694 gene locus_tag LOCUS_12170 243263 242694 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084771.1 protein_id gnl|my_center|LOCUS_12170 243714 243313 gene locus_tag LOCUS_12180 243714 243313 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118845.1 protein_id gnl|my_center|LOCUS_12180 244606 243857 gene locus_tag LOCUS_12190 244606 243857 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113262.1 protein_id gnl|my_center|LOCUS_12190 244775 245293 gene locus_tag LOCUS_12200 244775 245293 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084762.1 protein_id gnl|my_center|LOCUS_12200 245290 246261 gene locus_tag LOCUS_12210 245290 246261 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113263.1 protein_id gnl|my_center|LOCUS_12210 246365 248773 gene locus_tag LOCUS_12220 gene fiuA 246365 248773 CDS product TonB-dependent ferrichrome receptor FiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113264.1 protein_id gnl|my_center|LOCUS_12220 249803 248946 gene locus_tag LOCUS_12230 249803 248946 CDS product PP2C family serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099950.1 protein_id gnl|my_center|LOCUS_12230 249889 250839 gene locus_tag LOCUS_12240 249889 250839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099948.1 protein_id gnl|my_center|LOCUS_12240 250858 251478 gene locus_tag LOCUS_12250 250858 251478 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113265.1 protein_id gnl|my_center|LOCUS_12250 251925 251623 gene locus_tag LOCUS_12260 251925 251623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084737.1 protein_id gnl|my_center|LOCUS_12260 253333 251975 gene locus_tag LOCUS_12270 gene creD 253333 251975 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113266.1 protein_id gnl|my_center|LOCUS_12270 254860 253436 gene locus_tag LOCUS_12280 gene creC 254860 253436 CDS product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113267.1 protein_id gnl|my_center|LOCUS_12280 255549 254860 gene locus_tag LOCUS_12290 gene creB 255549 254860 CDS product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113268.1 protein_id gnl|my_center|LOCUS_12290 256143 255634 gene locus_tag LOCUS_12300 256143 255634 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113269.1 protein_id gnl|my_center|LOCUS_12300 256286 257173 gene locus_tag LOCUS_12310 256286 257173 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113270.1 protein_id gnl|my_center|LOCUS_12310 258025 257447 gene locus_tag LOCUS_12320 258025 257447 CDS product DUF2780 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084725.1 protein_id gnl|my_center|LOCUS_12320 260925 258127 gene locus_tag LOCUS_12330 gene clpG 260925 258127 CDS product AAA family protein disaggregase ClpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895510.1 protein_id gnl|my_center|LOCUS_12330 261299 262732 gene locus_tag LOCUS_12340 gene mdtD 261299 262732 CDS product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084717.1 protein_id gnl|my_center|LOCUS_12340 263359 262835 gene locus_tag LOCUS_12350 263359 262835 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113272.1 protein_id gnl|my_center|LOCUS_12350 263719 263510 gene locus_tag LOCUS_12360 263719 263510 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084710.1 protein_id gnl|my_center|LOCUS_12360 264067 265443 gene locus_tag LOCUS_12370 gene dbpA 264067 265443 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113273.1 protein_id gnl|my_center|LOCUS_12370 265705 267906 gene locus_tag LOCUS_12380 gene yccS 265705 267906 CDS product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113274.1 protein_id gnl|my_center|LOCUS_12380 268634 267903 gene locus_tag LOCUS_12390 268634 267903 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113275.1 protein_id gnl|my_center|LOCUS_12390 269533 268742 gene locus_tag LOCUS_12400 269533 268742 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084693.1 protein_id gnl|my_center|LOCUS_12400 270864 269533 gene locus_tag LOCUS_12410 270864 269533 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113277.1 protein_id gnl|my_center|LOCUS_12410 271244 272866 gene locus_tag LOCUS_12420 271244 272866 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115437.1 protein_id gnl|my_center|LOCUS_12420 273313 272909 gene locus_tag LOCUS_12430 273313 272909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 274374 273466 gene locus_tag LOCUS_12440 274374 273466 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084684.1 protein_id gnl|my_center|LOCUS_12440 274595 275776 gene locus_tag LOCUS_12450 274595 275776 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084682.1 protein_id gnl|my_center|LOCUS_12450 275896 277119 gene locus_tag LOCUS_12460 275896 277119 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084679.1 protein_id gnl|my_center|LOCUS_12460 277375 278391 gene locus_tag LOCUS_12470 277375 278391 CDS product IS110-like element ISPa11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147159.1 protein_id gnl|my_center|LOCUS_12470 280076 278793 gene locus_tag LOCUS_12480 280076 278793 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084676.1 protein_id gnl|my_center|LOCUS_12480 281625 280135 gene locus_tag LOCUS_12490 281625 280135 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084674.1 protein_id gnl|my_center|LOCUS_12490 282241 283680 gene locus_tag LOCUS_12500 gene hydA 282241 283680 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099919.1 protein_id gnl|my_center|LOCUS_12500 283775 285142 gene locus_tag LOCUS_12510 283775 285142 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114904.1 protein_id gnl|my_center|LOCUS_12510 285142 286416 gene locus_tag LOCUS_12520 gene preA 285142 286416 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895509.1 protein_id gnl|my_center|LOCUS_12520 286598 287848 gene locus_tag LOCUS_12530 gene codB 286598 287848 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084659.1 protein_id gnl|my_center|LOCUS_12530 287838 289109 gene locus_tag LOCUS_12540 287838 289109 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084657.1 protein_id gnl|my_center|LOCUS_12540 289766 289146 gene locus_tag LOCUS_12550 289766 289146 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084655.1 protein_id gnl|my_center|LOCUS_12550 291329 289851 gene locus_tag LOCUS_12560 291329 289851 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114902.1 protein_id gnl|my_center|LOCUS_12560 293532 291340 gene locus_tag LOCUS_12570 293532 291340 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114901.1 protein_id gnl|my_center|LOCUS_12570 294074 293658 gene locus_tag LOCUS_12580 294074 293658 CDS product DUF2946 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895508.1 protein_id gnl|my_center|LOCUS_12580 294381 295790 gene locus_tag LOCUS_12590 gene ahcY 294381 295790 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099900.1 protein_id gnl|my_center|LOCUS_12590 295846 296385 gene locus_tag LOCUS_12600 295846 296385 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895507.1 protein_id gnl|my_center|LOCUS_12600 296428 297300 gene locus_tag LOCUS_12610 gene metF 296428 297300 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118821.1 protein_id gnl|my_center|LOCUS_12610 297370 298440 gene locus_tag LOCUS_12620 297370 298440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114898.1 protein_id gnl|my_center|LOCUS_12620 298691 300610 gene locus_tag LOCUS_12630 298691 300610 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099895.1 protein_id gnl|my_center|LOCUS_12630 302163 300706 gene locus_tag LOCUS_12640 gene oprM 302163 300706 CDS product multidrug efflux RND transporter outer membrane channel subunit OprM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084633.1 protein_id gnl|my_center|LOCUS_12640 305248 302165 gene locus_tag LOCUS_12650 gene mexB 305248 302165 CDS product multidrug efflux RND transporter permease subunit MexB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107312.1 protein_id gnl|my_center|LOCUS_12650 306454 305321 gene locus_tag LOCUS_12660 gene mexA 306454 305321 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118819.1 protein_id gnl|my_center|LOCUS_12660 306747 307190 gene locus_tag LOCUS_12670 gene mexR 306747 307190 CDS product MarR family transcriptional repressor MexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114897.1 protein_id gnl|my_center|LOCUS_12670 307834 307259 gene locus_tag LOCUS_12680 307834 307259 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084626.1 protein_id gnl|my_center|LOCUS_12680 308415 307846 gene locus_tag LOCUS_12690 308415 307846 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106133.1 protein_id gnl|my_center|LOCUS_12690 310086 308596 gene locus_tag LOCUS_12700 310086 308596 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118815.1 protein_id gnl|my_center|LOCUS_12700 310260 311663 gene locus_tag LOCUS_12710 310260 311663 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106128.1 protein_id gnl|my_center|LOCUS_12710 311756 312478 gene locus_tag LOCUS_12720 311756 312478 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106127.1 protein_id gnl|my_center|LOCUS_12720 312555 313928 gene locus_tag LOCUS_12730 312555 313928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895506.1 protein_id gnl|my_center|LOCUS_12730 314547 313936 gene locus_tag LOCUS_12740 314547 313936 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084610.1 protein_id gnl|my_center|LOCUS_12740 315417 314623 gene locus_tag LOCUS_12750 315417 314623 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111539.1 protein_id gnl|my_center|LOCUS_12750 315931 315425 gene locus_tag LOCUS_12760 315931 315425 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114895.1 protein_id gnl|my_center|LOCUS_12760 316959 315928 gene locus_tag LOCUS_12770 316959 315928 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118811.1 protein_id gnl|my_center|LOCUS_12770 324370 316952 gene locus_tag LOCUS_12780 gene chpA 324370 316952 CDS product chemotaxis signal transduction system protein ChpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114893.1 protein_id gnl|my_center|LOCUS_12780 325257 324382 gene locus_tag LOCUS_12790 gene pilK 325257 324382 CDS product type 4 fimbrial methyltransferase PilK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100938.1 protein_id gnl|my_center|LOCUS_12790 327366 325318 gene locus_tag LOCUS_12800 gene pilJ 327366 325318 CDS product chemotaxis chemoreceptor PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100940.1 protein_id gnl|my_center|LOCUS_12800 327987 327451 gene locus_tag LOCUS_12810 327987 327451 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084590.1 protein_id gnl|my_center|LOCUS_12810 328403 328038 gene locus_tag LOCUS_12820 gene pilH 328403 328038 CDS product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084587.1 protein_id gnl|my_center|LOCUS_12820 328857 328450 gene locus_tag LOCUS_12830 gene pilG 328857 328450 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084583.1 protein_id gnl|my_center|LOCUS_12830 329112 330065 gene locus_tag LOCUS_12840 gene gshB 329112 330065 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100943.1 protein_id gnl|my_center|LOCUS_12840 330212 331105 gene locus_tag LOCUS_12850 330212 331105 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895505.1 protein_id gnl|my_center|LOCUS_12850 331154 331723 gene locus_tag LOCUS_12860 331154 331723 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100947.1 protein_id gnl|my_center|LOCUS_12860 331723 332157 gene locus_tag LOCUS_12870 gene ruvX 331723 332157 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084575.1 protein_id gnl|my_center|LOCUS_12870 332269 332781 gene locus_tag LOCUS_12880 gene pyrR 332269 332781 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084574.1 protein_id gnl|my_center|LOCUS_12880 332805 333809 gene locus_tag LOCUS_12890 332805 333809 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084569.1 protein_id gnl|my_center|LOCUS_12890 333806 335077 gene locus_tag LOCUS_12900 333806 335077 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114891.1 protein_id gnl|my_center|LOCUS_12900 336488 335304 gene locus_tag LOCUS_12910 336488 335304 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100953.1 protein_id gnl|my_center|LOCUS_12910 337858 336485 gene locus_tag LOCUS_12920 337858 336485 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100955.1 protein_id gnl|my_center|LOCUS_12920 338505 338101 gene locus_tag LOCUS_12930 338505 338101 CDS product NINE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084560.1 protein_id gnl|my_center|LOCUS_12930 338661 339560 gene locus_tag LOCUS_12940 gene czcD 338661 339560 CDS product CDF family zinc transporter CzcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100957.1 protein_id gnl|my_center|LOCUS_12940 340716 339568 gene locus_tag LOCUS_12950 gene pilU 340716 339568 CDS product type IV pilus ATPase PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_12950 341928 340894 gene locus_tag LOCUS_12960 gene pilT 341928 340894 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084552.1 protein_id gnl|my_center|LOCUS_12960 342242 342835 gene locus_tag LOCUS_12970 342242 342835 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084549.1 protein_id gnl|my_center|LOCUS_12970 342847 343668 gene locus_tag LOCUS_12980 gene proC 342847 343668 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114890.1 protein_id gnl|my_center|LOCUS_12980 343679 344272 gene locus_tag LOCUS_12990 343679 344272 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084544.1 protein_id gnl|my_center|LOCUS_12990 344395 344565 gene locus_tag LOCUS_13000 344395 344565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 344673 346640 gene locus_tag LOCUS_13010 344673 346640 CDS product dynamin-like GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114887.1 protein_id gnl|my_center|LOCUS_13010 346729 347868 gene locus_tag LOCUS_13020 346729 347868 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084535.1 protein_id gnl|my_center|LOCUS_13020 347876 348496 gene locus_tag LOCUS_13030 gene metW 347876 348496 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084530.1 protein_id gnl|my_center|LOCUS_13030 348628 349047 gene locus_tag LOCUS_13040 348628 349047 CDS product DUF4426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100965.1 protein_id gnl|my_center|LOCUS_13040 349044 349637 gene locus_tag LOCUS_13050 gene rdgB 349044 349637 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084527.1 protein_id gnl|my_center|LOCUS_13050 349758 350912 gene locus_tag LOCUS_13060 gene hemW 349758 350912 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114885.1 protein_id gnl|my_center|LOCUS_13060 350993 351316 gene locus_tag LOCUS_13070 350993 351316 CDS product DUF3392 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084525.1 protein_id gnl|my_center|LOCUS_13070 351378 351635 gene locus_tag LOCUS_13080 351378 351635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084524.1 protein_id gnl|my_center|LOCUS_13080 352994 351648 gene locus_tag LOCUS_13090 352994 351648 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114884.1 protein_id gnl|my_center|LOCUS_13090 353891 353157 gene locus_tag LOCUS_13100 gene trmB 353891 353157 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118800.1 protein_id gnl|my_center|LOCUS_13100 354779 353982 gene locus_tag LOCUS_13110 354779 353982 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084517.1 protein_id gnl|my_center|LOCUS_13110 355038 354838 gene locus_tag LOCUS_13120 gene thiS 355038 354838 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_13120 355518 355141 gene locus_tag LOCUS_13130 355518 355141 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084513.1 protein_id gnl|my_center|LOCUS_13130 355555 356286 gene locus_tag LOCUS_13140 gene mtgA 355555 356286 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023518284.1 protein_id gnl|my_center|LOCUS_13140 356896 356291 gene locus_tag LOCUS_13150 356896 356291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084511.1 protein_id gnl|my_center|LOCUS_13150 357815 356961 gene locus_tag LOCUS_13160 gene rpoH 357815 356961 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084510.1 protein_id gnl|my_center|LOCUS_13160 358936 357929 gene locus_tag LOCUS_13170 gene ftsX 358936 357929 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084508.1 protein_id gnl|my_center|LOCUS_13170 359607 358936 gene locus_tag LOCUS_13180 gene ftsE 359607 358936 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084505.1 protein_id gnl|my_center|LOCUS_13180 360956 359604 gene locus_tag LOCUS_13190 gene ftsY 360956 359604 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003128930.1 protein_id gnl|my_center|LOCUS_13190 361077 362474 gene locus_tag LOCUS_13200 361077 362474 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895504.1 protein_id gnl|my_center|LOCUS_13200 362467 363954 gene locus_tag LOCUS_13210 362467 363954 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112971.1 protein_id gnl|my_center|LOCUS_13210 363954 364550 gene locus_tag LOCUS_13220 gene rsmD 363954 364550 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102864.1 protein_id gnl|my_center|LOCUS_13220 364553 365119 gene locus_tag LOCUS_13230 364553 365119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 365156 366154 gene locus_tag LOCUS_13240 365156 366154 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084490.1 protein_id gnl|my_center|LOCUS_13240 366217 366627 gene locus_tag LOCUS_13250 366217 366627 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102866.1 protein_id gnl|my_center|LOCUS_13250 367259 366612 gene locus_tag LOCUS_13260 367259 366612 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084488.1 protein_id gnl|my_center|LOCUS_13260 367548 368978 gene locus_tag LOCUS_13270 367548 368978 CDS product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102868.1 protein_id gnl|my_center|LOCUS_13270 369033 369581 gene locus_tag LOCUS_13280 369033 369581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084486.1 protein_id gnl|my_center|LOCUS_13280 369637 371232 gene locus_tag LOCUS_13290 369637 371232 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102870.1 protein_id gnl|my_center|LOCUS_13290 371384 371863 gene locus_tag LOCUS_13300 gene coaD 371384 371863 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084466.1 protein_id gnl|my_center|LOCUS_13300 371984 372235 gene locus_tag LOCUS_13310 371984 372235 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084462.1 protein_id gnl|my_center|LOCUS_13310 372363 374096 gene locus_tag LOCUS_13320 gene ggt 372363 374096 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112970.1 protein_id gnl|my_center|LOCUS_13320 375187 374201 gene locus_tag LOCUS_13330 375187 374201 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112969.1 protein_id gnl|my_center|LOCUS_13330 375801 375457 gene locus_tag LOCUS_13340 375801 375457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084452.1 protein_id gnl|my_center|LOCUS_13340 376462 375884 gene locus_tag LOCUS_13350 376462 375884 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084450.1 protein_id gnl|my_center|LOCUS_13350 377351 376539 gene locus_tag LOCUS_13360 gene mutM 377351 376539 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102876.1 protein_id gnl|my_center|LOCUS_13360 378288 377410 gene locus_tag LOCUS_13370 378288 377410 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118789.1 protein_id gnl|my_center|LOCUS_13370 378450 378989 gene locus_tag LOCUS_13380 gene pfpI 378450 378989 CDS product protease PfpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102879.1 protein_id gnl|my_center|LOCUS_13380 379062 380258 gene locus_tag LOCUS_13390 379062 380258 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084438.1 protein_id gnl|my_center|LOCUS_13390 380587 382425 gene locus_tag LOCUS_13400 gene ilvD 380587 382425 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084436.1 protein_id gnl|my_center|LOCUS_13400 382655 384040 gene locus_tag LOCUS_13410 382655 384040 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102887.1 protein_id gnl|my_center|LOCUS_13410 384179 384652 gene locus_tag LOCUS_13420 384179 384652 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102894.1 protein_id gnl|my_center|LOCUS_13420 385174 384668 gene locus_tag LOCUS_13430 385174 384668 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084430.1 protein_id gnl|my_center|LOCUS_13430 386297 385257 gene locus_tag LOCUS_13440 386297 385257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112968.1 protein_id gnl|my_center|LOCUS_13440 387388 386294 gene locus_tag LOCUS_13450 387388 386294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102900.1 protein_id gnl|my_center|LOCUS_13450 387598 388749 gene locus_tag LOCUS_13460 387598 388749 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102904.1 protein_id gnl|my_center|LOCUS_13460 389148 388786 gene locus_tag LOCUS_13470 389148 388786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102907.1 protein_id gnl|my_center|LOCUS_13470 389340 390725 gene locus_tag LOCUS_13480 389340 390725 CDS product DUF2868 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112967.1 protein_id gnl|my_center|LOCUS_13480 390718 392097 gene locus_tag LOCUS_13490 390718 392097 CDS product GTPase/DUF3482 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112966.1 protein_id gnl|my_center|LOCUS_13490 392132 392929 gene locus_tag LOCUS_13500 392132 392929 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112965.1 protein_id gnl|my_center|LOCUS_13500 393750 392956 gene locus_tag LOCUS_13510 393750 392956 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110588.1 protein_id gnl|my_center|LOCUS_13510 394756 393956 gene locus_tag LOCUS_13520 gene lgt 394756 393956 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112963.1 protein_id gnl|my_center|LOCUS_13520 395569 394766 gene locus_tag LOCUS_13530 395569 394766 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110587.1 protein_id gnl|my_center|LOCUS_13530 395691 396446 gene locus_tag LOCUS_13540 395691 396446 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112962.1 protein_id gnl|my_center|LOCUS_13540 397487 396450 gene locus_tag LOCUS_13550 397487 396450 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121736.1 protein_id gnl|my_center|LOCUS_13550 399885 397606 gene locus_tag LOCUS_13560 gene ptsP 399885 397606 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084404.1 protein_id gnl|my_center|LOCUS_13560 400387 399908 gene locus_tag LOCUS_13570 400387 399908 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084400.1 protein_id gnl|my_center|LOCUS_13570 400591 401244 gene locus_tag LOCUS_13580 400591 401244 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110585.1 protein_id gnl|my_center|LOCUS_13580 401294 402535 gene locus_tag LOCUS_13590 401294 402535 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112960.1 protein_id gnl|my_center|LOCUS_13590 402975 402508 gene locus_tag LOCUS_13600 402975 402508 CDS product DUF2269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947031.1 protein_id gnl|my_center|LOCUS_13600 404243 402972 gene locus_tag LOCUS_13610 404243 402972 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112959.1 protein_id gnl|my_center|LOCUS_13610 404761 404294 gene locus_tag LOCUS_13620 404761 404294 CDS product DUF2269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112958.1 protein_id gnl|my_center|LOCUS_13620 406395 404881 gene locus_tag LOCUS_13630 gene ilvA 406395 404881 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110582.1 protein_id gnl|my_center|LOCUS_13630 406654 407325 gene locus_tag LOCUS_13640 gene rpiA 406654 407325 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084386.1 protein_id gnl|my_center|LOCUS_13640 407449 407781 gene locus_tag LOCUS_13650 407449 407781 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112957.1 protein_id gnl|my_center|LOCUS_13650 408082 410025 gene locus_tag LOCUS_13660 408082 410025 CDS product autotransporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895503.1 protein_id gnl|my_center|LOCUS_13660 411030 410065 gene locus_tag LOCUS_13670 411030 410065 CDS product YjiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118774.1 protein_id gnl|my_center|LOCUS_13670 411358 412407 gene locus_tag LOCUS_13680 411358 412407 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112954.1 protein_id gnl|my_center|LOCUS_13680 412404 413333 gene locus_tag LOCUS_13690 412404 413333 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112953.1 protein_id gnl|my_center|LOCUS_13690 413330 414118 gene locus_tag LOCUS_13700 413330 414118 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112952.1 protein_id gnl|my_center|LOCUS_13700 414166 415209 gene locus_tag LOCUS_13710 414166 415209 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084365.1 protein_id gnl|my_center|LOCUS_13710 415206 415547 gene locus_tag LOCUS_13720 415206 415547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 415630 417024 gene locus_tag LOCUS_13730 415630 417024 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112951.1 protein_id gnl|my_center|LOCUS_13730 417040 418074 gene locus_tag LOCUS_13740 gene aphB 417040 418074 CDS product acetylpolyamine amidohydrolase AphB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112950.1 protein_id gnl|my_center|LOCUS_13740 418505 418155 gene locus_tag LOCUS_13750 418505 418155 CDS product YgiW/YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084357.1 protein_id gnl|my_center|LOCUS_13750 419521 418589 gene locus_tag LOCUS_13760 419521 418589 CDS product YjiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121726.1 protein_id gnl|my_center|LOCUS_13760 420342 419677 gene locus_tag LOCUS_13770 420342 419677 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110705.1 protein_id gnl|my_center|LOCUS_13770 421828 420434 gene locus_tag LOCUS_13780 421828 420434 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112948.1 protein_id gnl|my_center|LOCUS_13780 422032 423261 gene locus_tag LOCUS_13790 gene serA 422032 423261 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112947.1 protein_id gnl|my_center|LOCUS_13790 423756 423319 gene locus_tag LOCUS_13800 423756 423319 CDS product DUF4399 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084345.1 protein_id gnl|my_center|LOCUS_13800 424049 424819 gene locus_tag LOCUS_13810 424049 424819 CDS product cystine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112946.1 protein_id gnl|my_center|LOCUS_13810 424891 425583 gene locus_tag LOCUS_13820 424891 425583 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084339.1 protein_id gnl|my_center|LOCUS_13820 426080 425586 gene locus_tag LOCUS_13830 426080 425586 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112945.1 protein_id gnl|my_center|LOCUS_13830 426346 426900 gene locus_tag LOCUS_13840 426346 426900 CDS product DUF6160 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084327.1 protein_id gnl|my_center|LOCUS_13840 427551 426922 gene locus_tag LOCUS_13850 427551 426922 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118764.1 protein_id gnl|my_center|LOCUS_13850 427669 428421 gene locus_tag LOCUS_13860 427669 428421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084320.1 protein_id gnl|my_center|LOCUS_13860 429382 428441 gene locus_tag LOCUS_13870 429382 428441 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118763.1 protein_id gnl|my_center|LOCUS_13870 429495 430070 gene locus_tag LOCUS_13880 429495 430070 CDS product DUF6436 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004352065.1 protein_id gnl|my_center|LOCUS_13880 430175 430678 gene locus_tag LOCUS_13890 430175 430678 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112942.1 protein_id gnl|my_center|LOCUS_13890 431709 430657 gene locus_tag LOCUS_13900 431709 430657 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112941.1 protein_id gnl|my_center|LOCUS_13900 431820 434207 gene locus_tag LOCUS_13910 gene hacB 431820 434207 CDS product N-acylhomoserine lactone acylase HacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112940.1 protein_id gnl|my_center|LOCUS_13910 435254 434385 gene locus_tag LOCUS_13920 435254 434385 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112939.1 protein_id gnl|my_center|LOCUS_13920 436248 435337 gene locus_tag LOCUS_13930 436248 435337 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121722.1 protein_id gnl|my_center|LOCUS_13930 437399 436245 gene locus_tag LOCUS_13940 gene potA 437399 436245 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084303.1 protein_id gnl|my_center|LOCUS_13940 438551 437454 gene locus_tag LOCUS_13950 gene spuE 438551 437454 CDS product spermidine-binding protein SpuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084301.1 protein_id gnl|my_center|LOCUS_13950 440073 438970 gene locus_tag LOCUS_13960 gene spuD 440073 438970 CDS product putrescine-binding protein SpuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084299.1 protein_id gnl|my_center|LOCUS_13960 441559 440189 gene locus_tag LOCUS_13970 gene spuC 441559 440189 CDS product putrescine--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084297.1 protein_id gnl|my_center|LOCUS_13970 442983 441625 gene locus_tag LOCUS_13980 442983 441625 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084290.1 protein_id gnl|my_center|LOCUS_13980 443776 443024 gene locus_tag LOCUS_13990 443776 443024 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112938.1 protein_id gnl|my_center|LOCUS_13990 >Feature sequence04 453 378 gene locus_tag LOCUS_t00060 453 378 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1187 513 gene locus_tag LOCUS_14000 gene queC 1187 513 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111415.1 protein_id gnl|my_center|LOCUS_14000 1850 1203 gene locus_tag LOCUS_14010 gene queE 1850 1203 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120697.1 protein_id gnl|my_center|LOCUS_14010 2894 2070 gene locus_tag LOCUS_14020 gene ybgF 2894 2070 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120698.1 protein_id gnl|my_center|LOCUS_14020 3410 2904 gene locus_tag LOCUS_14030 gene pal 3410 2904 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111417.1 protein_id gnl|my_center|LOCUS_14030 4761 3463 gene locus_tag LOCUS_14040 gene tolB 4761 3463 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112572.1 protein_id gnl|my_center|LOCUS_14040 5801 4758 gene locus_tag LOCUS_14050 gene tolA 5801 4758 CDS product cell envelope integrity protein TolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112574.1 protein_id gnl|my_center|LOCUS_14050 6244 5804 gene locus_tag LOCUS_14060 gene tolR 6244 5804 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086126.1 protein_id gnl|my_center|LOCUS_14060 6962 6267 gene locus_tag LOCUS_14070 gene tolQ 6962 6267 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086125.1 protein_id gnl|my_center|LOCUS_14070 7410 6964 gene locus_tag LOCUS_14080 gene ybgC 7410 6964 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086124.1 protein_id gnl|my_center|LOCUS_14080 8521 7463 gene locus_tag LOCUS_14090 gene ruvB 8521 7463 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086123.1 protein_id gnl|my_center|LOCUS_14090 9137 8532 gene locus_tag LOCUS_14100 gene ruvA 9137 8532 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086122.1 protein_id gnl|my_center|LOCUS_14100 9678 9154 gene locus_tag LOCUS_14110 gene ruvC 9678 9154 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112575.1 protein_id gnl|my_center|LOCUS_14110 10509 9763 gene locus_tag LOCUS_14120 10509 9763 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086107.1 protein_id gnl|my_center|LOCUS_14120 12351 10576 gene locus_tag LOCUS_14130 gene aspS 12351 10576 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123218.1 protein_id gnl|my_center|LOCUS_14130 12767 12348 gene locus_tag LOCUS_14140 12767 12348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 12792 13262 gene locus_tag LOCUS_14150 12792 13262 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086103.1 protein_id gnl|my_center|LOCUS_14150 13477 14091 gene locus_tag LOCUS_14160 13477 14091 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106665.1 protein_id gnl|my_center|LOCUS_14160 14349 14140 gene locus_tag LOCUS_14170 14349 14140 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086099.1 protein_id gnl|my_center|LOCUS_14170 14778 14350 gene locus_tag LOCUS_14180 14778 14350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 15497 16828 gene locus_tag LOCUS_14190 gene oprD 15497 16828 CDS product outer membrane porin OprD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112576.1 protein_id gnl|my_center|LOCUS_14190 17299 16892 gene locus_tag LOCUS_14200 17299 16892 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086091.1 protein_id gnl|my_center|LOCUS_14200 17407 19122 gene locus_tag LOCUS_14210 17407 19122 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102377.1 protein_id gnl|my_center|LOCUS_14210 19131 20087 gene locus_tag LOCUS_14220 19131 20087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102379.1 protein_id gnl|my_center|LOCUS_14220 20379 20104 gene locus_tag LOCUS_14230 20379 20104 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102385.1 protein_id gnl|my_center|LOCUS_14230 20843 20379 gene locus_tag LOCUS_14240 20843 20379 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102387.1 protein_id gnl|my_center|LOCUS_14240 21188 21571 gene locus_tag LOCUS_14250 21188 21571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109947.1 protein_id gnl|my_center|LOCUS_14250 21776 21582 gene locus_tag LOCUS_14260 21776 21582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112577.1 protein_id gnl|my_center|LOCUS_14260 23161 21926 gene locus_tag LOCUS_14270 23161 21926 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112579.1 protein_id gnl|my_center|LOCUS_14270 23286 23639 gene locus_tag LOCUS_14280 gene arsC 23286 23639 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112580.1 protein_id gnl|my_center|LOCUS_14280 23636 24232 gene locus_tag LOCUS_14290 gene wrbA 23636 24232 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115189.1 protein_id gnl|my_center|LOCUS_14290 24234 24653 gene locus_tag LOCUS_14300 24234 24653 CDS product DUF2069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086072.1 protein_id gnl|my_center|LOCUS_14300 25533 24829 gene locus_tag LOCUS_14310 gene hda 25533 24829 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102398.1 protein_id gnl|my_center|LOCUS_14310 26772 25735 gene locus_tag LOCUS_14320 26772 25735 CDS product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112582.1 protein_id gnl|my_center|LOCUS_14320 26986 28047 gene locus_tag LOCUS_14330 gene purM 26986 28047 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112583.1 protein_id gnl|my_center|LOCUS_14330 28047 28715 gene locus_tag LOCUS_14340 gene purN 28047 28715 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112584.1 protein_id gnl|my_center|LOCUS_14340 28708 29424 gene locus_tag LOCUS_14350 28708 29424 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086061.1 protein_id gnl|my_center|LOCUS_14350 30038 29478 gene locus_tag LOCUS_14360 30038 29478 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112585.1 protein_id gnl|my_center|LOCUS_14360 30153 30386 gene locus_tag LOCUS_14370 30153 30386 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086058.1 protein_id gnl|my_center|LOCUS_14370 30398 30652 gene locus_tag LOCUS_14380 30398 30652 CDS product DUF2024 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086057.1 protein_id gnl|my_center|LOCUS_14380 30658 30984 gene locus_tag LOCUS_14390 30658 30984 CDS product Rho-binding antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112586.1 protein_id gnl|my_center|LOCUS_14390 31077 31268 gene locus_tag LOCUS_14400 31077 31268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381582.1 protein_id gnl|my_center|LOCUS_14400 32637 31309 gene locus_tag LOCUS_14410 32637 31309 CDS product LPS O-antigen chain length determinant protein WzzB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112588.1 protein_id gnl|my_center|LOCUS_14410 33364 32825 gene locus_tag LOCUS_14420 33364 32825 CDS product DUF2058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086049.1 protein_id gnl|my_center|LOCUS_14420 33597 34535 gene locus_tag LOCUS_14430 gene lpxO2 33597 34535 CDS product lipid A hydroxylase LpxO2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086047.1 protein_id gnl|my_center|LOCUS_14430 35408 34578 gene locus_tag LOCUS_14440 gene mazG 35408 34578 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112589.1 protein_id gnl|my_center|LOCUS_14440 37756 35513 gene locus_tag LOCUS_14450 gene relA 37756 35513 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086042.1 protein_id gnl|my_center|LOCUS_14450 39193 37841 gene locus_tag LOCUS_14460 gene rlmD 39193 37841 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102417.1 protein_id gnl|my_center|LOCUS_14460 40101 39202 gene locus_tag LOCUS_14470 gene cysM 40101 39202 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102419.1 protein_id gnl|my_center|LOCUS_14470 42579 40351 gene locus_tag LOCUS_14480 gene pirA 42579 40351 CDS product TonB-dependent siderophore receptor PirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112590.1 protein_id gnl|my_center|LOCUS_14480 44155 42815 gene locus_tag LOCUS_14490 gene pirS 44155 42815 CDS product sensor histidine kinase PirS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895528.1 protein_id gnl|my_center|LOCUS_14490 44871 44152 gene locus_tag LOCUS_14500 gene pirR 44871 44152 CDS product response regulator transcription factor PirR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102425.1 protein_id gnl|my_center|LOCUS_14500 45057 47834 gene locus_tag LOCUS_14510 gene gacS 45057 47834 CDS product two-component system sensor histidine kinase GacS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102426.1 protein_id gnl|my_center|LOCUS_14510 47837 48826 gene locus_tag LOCUS_14520 47837 48826 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112591.1 protein_id gnl|my_center|LOCUS_14520 48862 49287 gene locus_tag LOCUS_14530 48862 49287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112592.1 protein_id gnl|my_center|LOCUS_14530 49355 49762 gene locus_tag LOCUS_14540 49355 49762 CDS product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112593.1 protein_id gnl|my_center|LOCUS_14540 49875 51803 gene locus_tag LOCUS_14550 49875 51803 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112594.1 protein_id gnl|my_center|LOCUS_14550 52859 51810 gene locus_tag LOCUS_14560 gene dinB 52859 51810 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086018.1 protein_id gnl|my_center|LOCUS_14560 53006 53082 gene locus_tag LOCUS_t00070 53006 53082 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 53261 53575 gene locus_tag LOCUS_14570 53261 53575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086015.1 protein_id gnl|my_center|LOCUS_14570 53949 53590 gene locus_tag LOCUS_14580 53949 53590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104747.1 protein_id gnl|my_center|LOCUS_14580 54198 56843 gene locus_tag LOCUS_14590 gene mprF 54198 56843 CDS product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112595.1 protein_id gnl|my_center|LOCUS_14590 56845 58128 gene locus_tag LOCUS_14600 56845 58128 CDS product virulence factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112596.1 protein_id gnl|my_center|LOCUS_14600 58289 58837 gene locus_tag LOCUS_14610 58289 58837 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112597.1 protein_id gnl|my_center|LOCUS_14610 60796 58892 gene locus_tag LOCUS_14620 60796 58892 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104754.1 protein_id gnl|my_center|LOCUS_14620 61043 62365 gene locus_tag LOCUS_14630 gene rimO 61043 62365 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086001.1 protein_id gnl|my_center|LOCUS_14630 62427 62888 gene locus_tag LOCUS_14640 62427 62888 CDS product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112599.1 protein_id gnl|my_center|LOCUS_14640 62881 63273 gene locus_tag LOCUS_14650 62881 63273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085997.1 protein_id gnl|my_center|LOCUS_14650 64771 63323 gene locus_tag LOCUS_14660 gene mgtE 64771 63323 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085996.1 protein_id gnl|my_center|LOCUS_14660 65098 65613 gene locus_tag LOCUS_14670 65098 65613 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112600.1 protein_id gnl|my_center|LOCUS_14670 66111 65659 gene locus_tag LOCUS_14680 66111 65659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003159666.1 protein_id gnl|my_center|LOCUS_14680 66667 66164 gene locus_tag LOCUS_14690 66667 66164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112601.1 protein_id gnl|my_center|LOCUS_14690 67034 66759 gene locus_tag LOCUS_14700 67034 66759 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085989.1 protein_id gnl|my_center|LOCUS_14700 67401 67027 gene locus_tag LOCUS_14710 67401 67027 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104765.1 protein_id gnl|my_center|LOCUS_14710 68096 67566 gene locus_tag LOCUS_14720 68096 67566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085984.1 protein_id gnl|my_center|LOCUS_14720 68267 68980 gene locus_tag LOCUS_14730 gene alpR 68267 68980 CDS product transcriptional regulator AlpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085982.1 protein_id gnl|my_center|LOCUS_14730 69154 69078 gene locus_tag LOCUS_t00080 69154 69078 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 69342 69266 gene locus_tag LOCUS_t00090 69342 69266 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 69550 69460 gene locus_tag LOCUS_t00100 69550 69460 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 69797 69612 gene locus_tag LOCUS_14740 gene csrA 69797 69612 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085981.1 protein_id gnl|my_center|LOCUS_14740 71220 69982 gene locus_tag LOCUS_14750 71220 69982 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085971.1 protein_id gnl|my_center|LOCUS_14750 73992 71368 gene locus_tag LOCUS_14760 gene alaS 73992 71368 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112602.1 protein_id gnl|my_center|LOCUS_14760 75118 74114 gene locus_tag LOCUS_14770 gene ltaE 75118 74114 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112603.1 protein_id gnl|my_center|LOCUS_14770 76261 75263 gene locus_tag LOCUS_14780 gene astE 76261 75263 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112605.1 protein_id gnl|my_center|LOCUS_14780 76565 76275 gene locus_tag LOCUS_14790 76565 76275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085959.1 protein_id gnl|my_center|LOCUS_14790 77925 76579 gene locus_tag LOCUS_14800 gene astB 77925 76579 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085956.1 protein_id gnl|my_center|LOCUS_14800 79385 77922 gene locus_tag LOCUS_14810 gene astD 79385 77922 CDS product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895527.1 protein_id gnl|my_center|LOCUS_14810 80453 79431 gene locus_tag LOCUS_14820 gene astA 80453 79431 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112607.1 protein_id gnl|my_center|LOCUS_14820 81481 80465 gene locus_tag LOCUS_14830 gene aruF 81481 80465 CDS product arginine/ornithine succinyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085950.1 protein_id gnl|my_center|LOCUS_14830 82900 81680 gene locus_tag LOCUS_14840 gene aruC 82900 81680 CDS product bifunctional succinylornithine transaminase/acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112608.1 protein_id gnl|my_center|LOCUS_14840 83130 83390 gene locus_tag LOCUS_14850 83130 83390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123239.1 protein_id gnl|my_center|LOCUS_14850 84400 83411 gene locus_tag LOCUS_14860 gene argR 84400 83411 CDS product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085944.1 protein_id gnl|my_center|LOCUS_14860 85197 84433 gene locus_tag LOCUS_14870 gene aotP 85197 84433 CDS product arginine/ornithine transport ATP-binding protein AotP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085940.1 protein_id gnl|my_center|LOCUS_14870 86328 85216 gene locus_tag LOCUS_14880 86328 85216 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112610.1 protein_id gnl|my_center|LOCUS_14880 87040 86342 gene locus_tag LOCUS_14890 87040 86342 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085936.1 protein_id gnl|my_center|LOCUS_14890 87746 87057 gene locus_tag LOCUS_14900 87746 87057 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085934.1 protein_id gnl|my_center|LOCUS_14900 88644 87865 gene locus_tag LOCUS_14910 88644 87865 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085932.1 protein_id gnl|my_center|LOCUS_14910 91140 89185 gene locus_tag LOCUS_14920 gene acs 91140 89185 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110260.1 protein_id gnl|my_center|LOCUS_14920 92606 91323 gene locus_tag LOCUS_14930 gene dctM 92606 91323 CDS product C4-dicarboxylate TRAP transporter large permease protein DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085927.1 protein_id gnl|my_center|LOCUS_14930 93241 92603 gene locus_tag LOCUS_14940 93241 92603 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114245.1 protein_id gnl|my_center|LOCUS_14940 94285 93290 gene locus_tag LOCUS_14950 94285 93290 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114244.1 protein_id gnl|my_center|LOCUS_14950 95226 94399 gene locus_tag LOCUS_14960 95226 94399 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085920.1 protein_id gnl|my_center|LOCUS_14960 96439 95237 gene locus_tag LOCUS_14970 96439 95237 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085918.1 protein_id gnl|my_center|LOCUS_14970 97847 96495 gene locus_tag LOCUS_14980 97847 96495 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085916.1 protein_id gnl|my_center|LOCUS_14980 98266 97886 gene locus_tag LOCUS_14990 98266 97886 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085915.1 protein_id gnl|my_center|LOCUS_14990 99441 98281 gene locus_tag LOCUS_15000 99441 98281 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085913.1 protein_id gnl|my_center|LOCUS_15000 100314 99487 gene locus_tag LOCUS_15010 100314 99487 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085910.1 protein_id gnl|my_center|LOCUS_15010 100431 101327 gene locus_tag LOCUS_15020 100431 101327 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085908.1 protein_id gnl|my_center|LOCUS_15020 102404 101460 gene locus_tag LOCUS_15030 102404 101460 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105984.1 protein_id gnl|my_center|LOCUS_15030 102624 104819 gene locus_tag LOCUS_15040 102624 104819 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114243.1 protein_id gnl|my_center|LOCUS_15040 105088 105354 gene locus_tag LOCUS_15050 105088 105354 CDS product DUF2790 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085904.1 protein_id gnl|my_center|LOCUS_15050 107131 105572 gene locus_tag LOCUS_15060 107131 105572 CDS product sigma-54-dependent phenylalanine hydroxylase transcriptional regulator PhhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114242.1 protein_id gnl|my_center|LOCUS_15060 107415 108203 gene locus_tag LOCUS_15070 gene phhA 107415 108203 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114241.1 protein_id gnl|my_center|LOCUS_15070 108308 108664 gene locus_tag LOCUS_15080 108308 108664 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085898.1 protein_id gnl|my_center|LOCUS_15080 108661 109860 gene locus_tag LOCUS_15090 108661 109860 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114240.1 protein_id gnl|my_center|LOCUS_15090 110174 111106 gene locus_tag LOCUS_15100 gene pbpG 110174 111106 CDS product D-alanyl-D-alanine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114239.1 protein_id gnl|my_center|LOCUS_15100 111542 111129 gene locus_tag LOCUS_15110 gene arfB 111542 111129 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_15110 112046 111663 gene locus_tag LOCUS_15120 112046 111663 CDS product lysozyme inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085889.1 protein_id gnl|my_center|LOCUS_15120 113617 112199 gene locus_tag LOCUS_15130 113617 112199 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114238.1 protein_id gnl|my_center|LOCUS_15130 114988 113915 gene locus_tag LOCUS_15140 gene hppD 114988 113915 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106569.1 protein_id gnl|my_center|LOCUS_15140 115310 116098 gene locus_tag LOCUS_15150 115310 116098 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114237.1 protein_id gnl|my_center|LOCUS_15150 116182 116355 gene locus_tag LOCUS_15160 116182 116355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 116381 117340 gene locus_tag LOCUS_15170 116381 117340 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106575.1 protein_id gnl|my_center|LOCUS_15170 118173 117391 gene locus_tag LOCUS_15180 118173 117391 CDS product TenA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106577.1 protein_id gnl|my_center|LOCUS_15180 120704 118248 gene locus_tag LOCUS_15190 120704 118248 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114236.1 protein_id gnl|my_center|LOCUS_15190 122789 120999 gene locus_tag LOCUS_15200 122789 120999 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085865.1 protein_id gnl|my_center|LOCUS_15200 123420 122782 gene locus_tag LOCUS_15210 123420 122782 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895526.1 protein_id gnl|my_center|LOCUS_15210 124362 123424 gene locus_tag LOCUS_15220 124362 123424 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085861.1 protein_id gnl|my_center|LOCUS_15220 124832 124527 gene locus_tag LOCUS_15230 124832 124527 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114234.1 protein_id gnl|my_center|LOCUS_15230 125349 124846 gene locus_tag LOCUS_15240 125349 124846 CDS product DUF2059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120754.1 protein_id gnl|my_center|LOCUS_15240 125562 126581 gene locus_tag LOCUS_15250 125562 126581 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114233.1 protein_id gnl|my_center|LOCUS_15250 126710 128104 gene locus_tag LOCUS_15260 126710 128104 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085854.1 protein_id gnl|my_center|LOCUS_15260 128097 128720 gene locus_tag LOCUS_15270 128097 128720 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114232.1 protein_id gnl|my_center|LOCUS_15270 129000 130169 gene locus_tag LOCUS_15280 gene cbpD 129000 130169 CDS product chitin-binding protein CbpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114231.1 protein_id gnl|my_center|LOCUS_15280 130346 131308 gene locus_tag LOCUS_15290 130346 131308 CDS product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114230.1 protein_id gnl|my_center|LOCUS_15290 131738 131319 gene locus_tag LOCUS_15300 131738 131319 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085846.1 protein_id gnl|my_center|LOCUS_15300 132942 131992 gene locus_tag LOCUS_15310 gene trxB 132942 131992 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114229.1 protein_id gnl|my_center|LOCUS_15310 133675 133076 gene locus_tag LOCUS_15320 133675 133076 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085842.1 protein_id gnl|my_center|LOCUS_15320 133860 135815 gene locus_tag LOCUS_15330 133860 135815 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895525.1 protein_id gnl|my_center|LOCUS_15330 135900 136640 gene locus_tag LOCUS_15340 gene cysZ 135900 136640 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115194.1 protein_id gnl|my_center|LOCUS_15340 137018 139030 gene locus_tag LOCUS_15350 gene cerN 137018 139030 CDS product ceramidase CerN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114226.1 protein_id gnl|my_center|LOCUS_15350 139372 141564 gene locus_tag LOCUS_15360 139372 141564 CDS product phospholipase C, phosphocholine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114225.1 protein_id gnl|my_center|LOCUS_15360 141582 142205 gene locus_tag LOCUS_15370 gene plcR 141582 142205 CDS product phospholipase C accessory protein PlcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134321.1 protein_id gnl|my_center|LOCUS_15370 142293 143513 gene locus_tag LOCUS_15380 142293 143513 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085828.1 protein_id gnl|my_center|LOCUS_15380 144476 143517 gene locus_tag LOCUS_15390 144476 143517 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114223.1 protein_id gnl|my_center|LOCUS_15390 145779 144667 gene locus_tag LOCUS_15400 145779 144667 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085824.1 protein_id gnl|my_center|LOCUS_15400 146410 145820 gene locus_tag LOCUS_15410 146410 145820 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085819.1 protein_id gnl|my_center|LOCUS_15410 147043 146561 gene locus_tag LOCUS_15420 147043 146561 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109429.1 protein_id gnl|my_center|LOCUS_15420 147734 147249 gene locus_tag LOCUS_15430 147734 147249 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085816.1 protein_id gnl|my_center|LOCUS_15430 147703 148041 gene locus_tag LOCUS_15440 147703 148041 CDS product DUF3565 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005733216.1 protein_id gnl|my_center|LOCUS_15440 148041 149225 gene locus_tag LOCUS_15450 148041 149225 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085814.1 protein_id gnl|my_center|LOCUS_15450 149288 151402 gene locus_tag LOCUS_15460 gene pta 149288 151402 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114221.1 protein_id gnl|my_center|LOCUS_15460 151529 152443 gene locus_tag LOCUS_15470 151529 152443 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085811.1 protein_id gnl|my_center|LOCUS_15470 153226 152513 gene locus_tag LOCUS_15480 153226 152513 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085808.1 protein_id gnl|my_center|LOCUS_15480 153973 153332 gene locus_tag LOCUS_15490 153973 153332 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085806.1 protein_id gnl|my_center|LOCUS_15490 155094 154075 gene locus_tag LOCUS_15500 gene oruR 155094 154075 CDS product ornithine utilization transcriptional regulator OruR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114220.1 protein_id gnl|my_center|LOCUS_15500 155219 156052 gene locus_tag LOCUS_15510 155219 156052 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_15510 157128 156187 gene locus_tag LOCUS_15520 157128 156187 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_15520 157920 157237 gene locus_tag LOCUS_15530 157920 157237 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114215.1 protein_id gnl|my_center|LOCUS_15530 158008 158886 gene locus_tag LOCUS_15540 158008 158886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109435.1 protein_id gnl|my_center|LOCUS_15540 158948 159300 gene locus_tag LOCUS_tm00010 158948 159300 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 159400 161853 gene locus_tag LOCUS_15550 159400 161853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 162022 163290 gene locus_tag LOCUS_15560 162022 163290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 164957 165286 gene locus_tag LOCUS_15570 164957 165286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 168593 165552 gene locus_tag LOCUS_15580 168593 165552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 170606 168594 gene locus_tag LOCUS_15590 170606 168594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 171367 170603 gene locus_tag LOCUS_15600 171367 170603 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252511.1 protein_id gnl|my_center|LOCUS_15600 173493 171367 gene locus_tag LOCUS_15610 gene zorA 173493 171367 CDS product anti-phage ZorAB system protein ZorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132365.1 protein_id gnl|my_center|LOCUS_15610 174622 173546 gene locus_tag LOCUS_15620 174622 173546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 176283 174640 gene locus_tag LOCUS_15630 176283 174640 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110082.1 protein_id gnl|my_center|LOCUS_15630 177749 176280 gene locus_tag LOCUS_15640 177749 176280 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939433.1 protein_id gnl|my_center|LOCUS_15640 179071 177752 gene locus_tag LOCUS_15650 179071 177752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 181476 179110 gene locus_tag LOCUS_15660 181476 179110 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105653.1 protein_id gnl|my_center|LOCUS_15660 182516 181869 gene locus_tag LOCUS_15670 182516 181869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 182803 182582 gene locus_tag LOCUS_15680 182803 182582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 183000 183875 gene locus_tag LOCUS_15690 183000 183875 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 protein_id gnl|my_center|LOCUS_15690 183890 184423 gene locus_tag LOCUS_15700 183890 184423 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045599821.1 protein_id gnl|my_center|LOCUS_15700 184681 184911 gene locus_tag LOCUS_15710 184681 184911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 186107 185229 gene locus_tag LOCUS_15720 186107 185229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 186714 187733 gene locus_tag LOCUS_15730 186714 187733 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229118.1 protein_id gnl|my_center|LOCUS_15730 188232 188852 gene locus_tag LOCUS_15740 188232 188852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 189447 188938 gene locus_tag LOCUS_15750 189447 188938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 189845 190294 gene locus_tag LOCUS_15760 189845 190294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 190373 190927 gene locus_tag LOCUS_15770 190373 190927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 191359 191192 gene locus_tag LOCUS_15780 191359 191192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 194520 191356 gene locus_tag LOCUS_15790 194520 191356 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804239.1 protein_id gnl|my_center|LOCUS_15790 197162 194535 gene locus_tag LOCUS_15800 197162 194535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 197760 197194 gene locus_tag LOCUS_15810 197760 197194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 198668 197796 gene locus_tag LOCUS_15820 198668 197796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 198752 199744 gene locus_tag LOCUS_15830 198752 199744 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255981.1 protein_id gnl|my_center|LOCUS_15830 199811 199975 gene locus_tag LOCUS_15840 199811 199975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 199978 200787 gene locus_tag LOCUS_15850 199978 200787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 201036 201467 gene locus_tag LOCUS_15860 201036 201467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 201554 202201 gene locus_tag LOCUS_15870 201554 202201 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065267398.1 protein_id gnl|my_center|LOCUS_15870 202312 204516 gene locus_tag LOCUS_15880 202312 204516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 204850 206076 gene locus_tag LOCUS_15890 204850 206076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 206078 206641 gene locus_tag LOCUS_15900 206078 206641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 207714 206911 gene locus_tag LOCUS_15910 207714 206911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 208029 207763 gene locus_tag LOCUS_15920 208029 207763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 209355 208030 gene locus_tag LOCUS_15930 209355 208030 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073057.1 protein_id gnl|my_center|LOCUS_15930 209835 212294 gene locus_tag LOCUS_15940 209835 212294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 212601 213908 gene locus_tag LOCUS_15950 212601 213908 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479498.1 protein_id gnl|my_center|LOCUS_15950 214727 214035 gene locus_tag LOCUS_15960 214727 214035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 215110 214787 gene locus_tag LOCUS_15970 215110 214787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 216657 216352 gene locus_tag LOCUS_15980 216657 216352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 217097 217582 gene locus_tag LOCUS_15990 217097 217582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 217625 218230 gene locus_tag LOCUS_16000 217625 218230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 218486 219547 gene locus_tag LOCUS_16010 218486 219547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 221395 219587 gene locus_tag LOCUS_16020 221395 219587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 223851 221395 gene locus_tag LOCUS_16030 223851 221395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 225341 223851 gene locus_tag LOCUS_16040 225341 223851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 228717 225325 gene locus_tag LOCUS_16050 228717 225325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 230127 228724 gene locus_tag LOCUS_16060 230127 228724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 230825 230133 gene locus_tag LOCUS_16070 230825 230133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 231496 230825 gene locus_tag LOCUS_16080 231496 230825 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001388628.1 protein_id gnl|my_center|LOCUS_16080 232929 231664 gene locus_tag LOCUS_16090 232929 231664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 233973 233077 gene locus_tag LOCUS_16100 233973 233077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 235751 233973 gene locus_tag LOCUS_16110 235751 233973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 236948 235761 gene locus_tag LOCUS_16120 236948 235761 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083500625.1 protein_id gnl|my_center|LOCUS_16120 238528 236945 gene locus_tag LOCUS_16130 238528 236945 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 protein_id gnl|my_center|LOCUS_16130 240691 238562 gene locus_tag LOCUS_16140 240691 238562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 244098 240700 gene locus_tag LOCUS_16150 244098 240700 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022389.1 protein_id gnl|my_center|LOCUS_16150 245591 244131 gene locus_tag LOCUS_16160 245591 244131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 245935 247062 gene locus_tag LOCUS_16170 245935 247062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 247622 247329 gene locus_tag LOCUS_16180 247622 247329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 247515 248855 gene locus_tag LOCUS_16190 247515 248855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 249577 248810 gene locus_tag LOCUS_16200 249577 248810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 250737 249607 gene locus_tag LOCUS_16210 250737 249607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 251600 250734 gene locus_tag LOCUS_16220 251600 250734 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_16220 252625 251597 gene locus_tag LOCUS_16230 252625 251597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 253388 256738 gene locus_tag LOCUS_16240 253388 256738 CDS product STY4851/ECs_5259 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222857981.1 protein_id gnl|my_center|LOCUS_16240 256744 262944 gene locus_tag LOCUS_16250 256744 262944 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213431.1 protein_id gnl|my_center|LOCUS_16250 263361 263969 gene locus_tag LOCUS_16260 263361 263969 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526832.1 protein_id gnl|my_center|LOCUS_16260 265120 264164 gene locus_tag LOCUS_16270 265120 264164 CDS product DUF2220 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209174.1 protein_id gnl|my_center|LOCUS_16270 268598 265293 gene locus_tag LOCUS_16280 268598 265293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 269344 268595 gene locus_tag LOCUS_16290 269344 268595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 270699 269347 gene locus_tag LOCUS_16300 270699 269347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 271706 272344 gene locus_tag LOCUS_16310 271706 272344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114214.1 protein_id gnl|my_center|LOCUS_16310 272585 272920 gene locus_tag LOCUS_16320 272585 272920 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003140884.1 protein_id gnl|my_center|LOCUS_16320 273248 273613 gene locus_tag LOCUS_16330 273248 273613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 273610 274311 gene locus_tag LOCUS_16340 273610 274311 CDS product VRR-NUC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205520.1 protein_id gnl|my_center|LOCUS_16340 274328 275416 gene locus_tag LOCUS_16350 274328 275416 CDS product DUF3396 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114210.1 protein_id gnl|my_center|LOCUS_16350 276115 275792 gene locus_tag LOCUS_16360 276115 275792 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388650.1 protein_id gnl|my_center|LOCUS_16360 276473 276108 gene locus_tag LOCUS_16370 276473 276108 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899954.1 protein_id gnl|my_center|LOCUS_16370 277183 277455 gene locus_tag LOCUS_16380 277183 277455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085667.1 protein_id gnl|my_center|LOCUS_16380 277911 277486 gene locus_tag LOCUS_16390 277911 277486 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114206.1 protein_id gnl|my_center|LOCUS_16390 278012 278896 gene locus_tag LOCUS_16400 278012 278896 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114205.1 protein_id gnl|my_center|LOCUS_16400 279822 278869 gene locus_tag LOCUS_16410 279822 278869 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085661.1 protein_id gnl|my_center|LOCUS_16410 280043 280477 gene locus_tag LOCUS_16420 280043 280477 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114204.1 protein_id gnl|my_center|LOCUS_16420 280474 281721 gene locus_tag LOCUS_16430 280474 281721 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114203.1 protein_id gnl|my_center|LOCUS_16430 282010 283305 gene locus_tag LOCUS_16440 282010 283305 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114202.1 protein_id gnl|my_center|LOCUS_16440 283302 284549 gene locus_tag LOCUS_16450 283302 284549 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114201.1 protein_id gnl|my_center|LOCUS_16450 284580 285281 gene locus_tag LOCUS_16460 284580 285281 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106623.1 protein_id gnl|my_center|LOCUS_16460 285387 286703 gene locus_tag LOCUS_16470 285387 286703 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114200.1 protein_id gnl|my_center|LOCUS_16470 287228 286755 gene locus_tag LOCUS_16480 287228 286755 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114199.1 protein_id gnl|my_center|LOCUS_16480 288064 287297 gene locus_tag LOCUS_16490 gene ampDh3 288064 287297 CDS product N-acetylmuramoyl-L-alanine amidase AmpDh3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114198.1 protein_id gnl|my_center|LOCUS_16490 289086 288691 gene locus_tag LOCUS_16500 289086 288691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114197.1 protein_id gnl|my_center|LOCUS_16500 289647 289874 gene locus_tag LOCUS_16510 289647 289874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085644.1 protein_id gnl|my_center|LOCUS_16510 290905 290084 gene locus_tag LOCUS_16520 290905 290084 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114196.1 protein_id gnl|my_center|LOCUS_16520 291377 290937 gene locus_tag LOCUS_16530 291377 290937 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085641.1 protein_id gnl|my_center|LOCUS_16530 291786 291463 gene locus_tag LOCUS_16540 291786 291463 CDS product DUF3325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114195.1 protein_id gnl|my_center|LOCUS_16540 293306 291786 gene locus_tag LOCUS_16550 293306 291786 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114194.1 protein_id gnl|my_center|LOCUS_16550 293599 293303 gene locus_tag LOCUS_16560 293599 293303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 293925 296246 gene locus_tag LOCUS_16570 293925 296246 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118645.1 protein_id gnl|my_center|LOCUS_16570 296871 296260 gene locus_tag LOCUS_16580 296871 296260 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118644.1 protein_id gnl|my_center|LOCUS_16580 297028 297750 gene locus_tag LOCUS_16590 297028 297750 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085635.1 protein_id gnl|my_center|LOCUS_16590 297761 298657 gene locus_tag LOCUS_16600 gene prpB 297761 298657 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103044.1 protein_id gnl|my_center|LOCUS_16600 298750 299877 gene locus_tag LOCUS_16610 gene prpC 298750 299877 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103050.1 protein_id gnl|my_center|LOCUS_16610 300008 302614 gene locus_tag LOCUS_16620 gene acnD 300008 302614 CDS product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115200.1 protein_id gnl|my_center|LOCUS_16620 302733 303920 gene locus_tag LOCUS_16630 gene prpF 302733 303920 CDS product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114192.1 protein_id gnl|my_center|LOCUS_16630 304055 305539 gene locus_tag LOCUS_16640 gene prpD 304055 305539 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103059.1 protein_id gnl|my_center|LOCUS_16640 306305 305517 gene locus_tag LOCUS_16650 306305 305517 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103062.1 protein_id gnl|my_center|LOCUS_16650 306412 307227 gene locus_tag LOCUS_16660 306412 307227 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085615.1 protein_id gnl|my_center|LOCUS_16660 308768 307353 gene locus_tag LOCUS_16670 308768 307353 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103066.1 protein_id gnl|my_center|LOCUS_16670 309402 309199 gene locus_tag LOCUS_16680 309402 309199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147247.1 protein_id gnl|my_center|LOCUS_16680 309695 312688 gene locus_tag LOCUS_16690 309695 312688 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123023.1 protein_id gnl|my_center|LOCUS_16690 313856 312693 gene locus_tag LOCUS_16700 313856 312693 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109755.1 protein_id gnl|my_center|LOCUS_16700 314217 313912 gene locus_tag LOCUS_16710 314217 313912 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103070.1 protein_id gnl|my_center|LOCUS_16710 314865 314227 gene locus_tag LOCUS_16720 gene azoR1 314865 314227 CDS product FMN-dependent NADH-azoreductase AzoR1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114189.1 protein_id gnl|my_center|LOCUS_16720 315004 315921 gene locus_tag LOCUS_16730 315004 315921 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895522.1 protein_id gnl|my_center|LOCUS_16730 317586 316066 gene locus_tag LOCUS_16740 gene putP 317586 316066 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103073.1 protein_id gnl|my_center|LOCUS_16740 321080 317898 gene locus_tag LOCUS_16750 gene putA 321080 317898 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114187.1 protein_id gnl|my_center|LOCUS_16750 321544 323607 gene locus_tag LOCUS_16760 321544 323607 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101985.1 protein_id gnl|my_center|LOCUS_16760 324480 323728 gene locus_tag LOCUS_16770 324480 323728 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085585.1 protein_id gnl|my_center|LOCUS_16770 324671 327070 gene locus_tag LOCUS_16780 gene lon 324671 327070 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101982.1 protein_id gnl|my_center|LOCUS_16780 327181 327585 gene locus_tag LOCUS_16790 327181 327585 CDS product protease inhibitor I42 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085581.1 protein_id gnl|my_center|LOCUS_16790 327684 328436 gene locus_tag LOCUS_16800 327684 328436 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114186.1 protein_id gnl|my_center|LOCUS_16800 328568 329140 gene locus_tag LOCUS_16810 328568 329140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085577.1 protein_id gnl|my_center|LOCUS_16810 329227 329985 gene locus_tag LOCUS_16820 gene cmoA 329227 329985 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123029.1 protein_id gnl|my_center|LOCUS_16820 329982 330950 gene locus_tag LOCUS_16830 gene cmoB 329982 330950 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114185.1 protein_id gnl|my_center|LOCUS_16830 331787 331041 gene locus_tag LOCUS_16840 gene pdxJ 331787 331041 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101974.1 protein_id gnl|my_center|LOCUS_16840 332481 331780 gene locus_tag LOCUS_16850 gene recO 332481 331780 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101972.1 protein_id gnl|my_center|LOCUS_16850 333459 332542 gene locus_tag LOCUS_16860 gene era 333459 332542 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085566.1 protein_id gnl|my_center|LOCUS_16860 334141 333452 gene locus_tag LOCUS_16870 gene rnc 334141 333452 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085565.1 protein_id gnl|my_center|LOCUS_16870 334515 334138 gene locus_tag LOCUS_16880 334515 334138 CDS product DUF4845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085562.1 protein_id gnl|my_center|LOCUS_16880 335538 334684 gene locus_tag LOCUS_16890 gene lepB 335538 334684 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101969.1 protein_id gnl|my_center|LOCUS_16890 337343 335544 gene locus_tag LOCUS_16900 gene lepA 337343 335544 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085555.1 protein_id gnl|my_center|LOCUS_16900 338917 337493 gene locus_tag LOCUS_16910 gene mucD 338917 337493 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_16910 339412 338957 gene locus_tag LOCUS_16920 gene mucC 339412 338957 CDS product alginate biosynthesis regulator MucC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110245.1 protein_id gnl|my_center|LOCUS_16920 340359 339409 gene locus_tag LOCUS_16930 gene mucB 340359 339409 CDS product sigma factor AlgU regulator MucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101960.1 protein_id gnl|my_center|LOCUS_16930 340952 340368 gene locus_tag LOCUS_16940 gene mucA 340952 340368 CDS product anti-sigma factor MucA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101958.1 protein_id gnl|my_center|LOCUS_16940 341565 340984 gene locus_tag LOCUS_16950 gene rpoE 341565 340984 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_16950 341974 343590 gene locus_tag LOCUS_16960 gene nadB 341974 343590 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114182.1 protein_id gnl|my_center|LOCUS_16960 344011 343559 gene locus_tag LOCUS_16970 344011 343559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268756.1 protein_id gnl|my_center|LOCUS_16970 344249 343995 gene locus_tag LOCUS_16980 344249 343995 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085532.1 protein_id gnl|my_center|LOCUS_16980 344522 345466 gene locus_tag LOCUS_16990 344522 345466 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114180.1 protein_id gnl|my_center|LOCUS_16990 345567 346403 gene locus_tag LOCUS_17000 345567 346403 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114179.1 protein_id gnl|my_center|LOCUS_17000 347794 346412 gene locus_tag LOCUS_17010 347794 346412 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114178.1 protein_id gnl|my_center|LOCUS_17010 348458 347787 gene locus_tag LOCUS_17020 348458 347787 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085524.1 protein_id gnl|my_center|LOCUS_17020 348669 349952 gene locus_tag LOCUS_17030 348669 349952 CDS product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114177.1 protein_id gnl|my_center|LOCUS_17030 349982 350965 gene locus_tag LOCUS_17040 349982 350965 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085519.1 protein_id gnl|my_center|LOCUS_17040 351014 351484 gene locus_tag LOCUS_17050 351014 351484 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114175.1 protein_id gnl|my_center|LOCUS_17050 351495 353012 gene locus_tag LOCUS_17060 351495 353012 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114173.1 protein_id gnl|my_center|LOCUS_17060 353005 354042 gene locus_tag LOCUS_17070 353005 354042 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114172.1 protein_id gnl|my_center|LOCUS_17070 354864 354169 gene locus_tag LOCUS_17080 gene ung 354864 354169 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106436.1 protein_id gnl|my_center|LOCUS_17080 355785 354964 gene locus_tag LOCUS_17090 355785 354964 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114171.1 protein_id gnl|my_center|LOCUS_17090 356723 355842 gene locus_tag LOCUS_17100 gene mmsR 356723 355842 CDS product MmsAB operon transcriptional regulator MmsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122160.1 protein_id gnl|my_center|LOCUS_17100 356856 358364 gene locus_tag LOCUS_17110 356856 358364 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114170.1 protein_id gnl|my_center|LOCUS_17110 358376 359539 gene locus_tag LOCUS_17120 358376 359539 CDS product isobutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085499.1 protein_id gnl|my_center|LOCUS_17120 359605 360423 gene locus_tag LOCUS_17130 359605 360423 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085498.1 protein_id gnl|my_center|LOCUS_17130 360482 361585 gene locus_tag LOCUS_17140 360482 361585 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114169.1 protein_id gnl|my_center|LOCUS_17140 361697 362593 gene locus_tag LOCUS_17150 gene mmsB 361697 362593 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114168.1 protein_id gnl|my_center|LOCUS_17150 362650 363294 gene locus_tag LOCUS_17160 362650 363294 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085490.1 protein_id gnl|my_center|LOCUS_17160 363410 364051 gene locus_tag LOCUS_17170 363410 364051 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110820.1 protein_id gnl|my_center|LOCUS_17170 366062 364086 gene locus_tag LOCUS_17180 366062 364086 CDS product alkyl/aryl-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114166.1 protein_id gnl|my_center|LOCUS_17180 366165 367079 gene locus_tag LOCUS_17190 366165 367079 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114165.1 protein_id gnl|my_center|LOCUS_17190 367271 367083 gene locus_tag LOCUS_17200 367271 367083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 367639 367394 gene locus_tag LOCUS_17210 367639 367394 CDS product DUF1145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085479.1 protein_id gnl|my_center|LOCUS_17210 368211 367756 gene locus_tag LOCUS_17220 368211 367756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114164.1 protein_id gnl|my_center|LOCUS_17220 368480 368307 gene locus_tag LOCUS_17230 368480 368307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098355.1 protein_id gnl|my_center|LOCUS_17230 368719 369795 gene locus_tag LOCUS_17240 368719 369795 CDS product DUF2157 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114162.1 protein_id gnl|my_center|LOCUS_17240 369792 370607 gene locus_tag LOCUS_17250 369792 370607 CDS product DUF4824 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114161.1 protein_id gnl|my_center|LOCUS_17250 370688 370900 gene locus_tag LOCUS_17260 370688 370900 CDS product cysteine-rich CWC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895521.1 protein_id gnl|my_center|LOCUS_17260 370900 371592 gene locus_tag LOCUS_17270 370900 371592 CDS product 16S rRNA pseudouridine(516) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114159.1 protein_id gnl|my_center|LOCUS_17270 371728 372771 gene locus_tag LOCUS_17280 371728 372771 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098363.1 protein_id gnl|my_center|LOCUS_17280 372851 373588 gene locus_tag LOCUS_17290 372851 373588 CDS product murein L,D-transpeptidase catalytic domain family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114158.1 protein_id gnl|my_center|LOCUS_17290 374041 374943 gene locus_tag LOCUS_17300 gene phaG 374041 374943 CDS product (R)-3-hydroxydecanoyl-ACP:CoA transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114157.1 protein_id gnl|my_center|LOCUS_17300 375074 375147 gene locus_tag LOCUS_t00110 375074 375147 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 375617 375270 gene locus_tag LOCUS_17310 375617 375270 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114156.1 protein_id gnl|my_center|LOCUS_17310 375878 375627 gene locus_tag LOCUS_17320 375878 375627 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246542.1 protein_id gnl|my_center|LOCUS_17320 377075 376092 gene locus_tag LOCUS_17330 377075 376092 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114154.1 protein_id gnl|my_center|LOCUS_17330 378367 377075 gene locus_tag LOCUS_17340 378367 377075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115206.1 protein_id gnl|my_center|LOCUS_17340 >Feature sequence05 122 1381 gene locus_tag LOCUS_17350 122 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 1496 1978 gene locus_tag LOCUS_17360 1496 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 2139 2738 gene locus_tag LOCUS_17370 2139 2738 CDS product PilL N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024537152.1 protein_id gnl|my_center|LOCUS_17370 2735 3376 gene locus_tag LOCUS_17380 2735 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 3391 4116 gene locus_tag LOCUS_17390 3391 4116 CDS product TIGR03759 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038883.1 protein_id gnl|my_center|LOCUS_17390 4098 4703 gene locus_tag LOCUS_17400 4098 4703 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038882.1 protein_id gnl|my_center|LOCUS_17400 4700 5239 gene locus_tag LOCUS_17410 4700 5239 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038881.1 protein_id gnl|my_center|LOCUS_17410 5244 7433 gene locus_tag LOCUS_17420 gene traD 5244 7433 CDS product type IV conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038880.1 protein_id gnl|my_center|LOCUS_17420 7430 8179 gene locus_tag LOCUS_17430 7430 8179 CDS product TIGR03747 family integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038879.1 protein_id gnl|my_center|LOCUS_17430 8278 8661 gene locus_tag LOCUS_17440 8278 8661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 8658 8891 gene locus_tag LOCUS_17450 8658 8891 CDS product TIGR03758 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267027.1 protein_id gnl|my_center|LOCUS_17450 8908 9267 gene locus_tag LOCUS_17460 8908 9267 CDS product TIGR03745 family integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003294215.1 protein_id gnl|my_center|LOCUS_17460 9280 9678 gene locus_tag LOCUS_17470 9280 9678 CDS product TIGR03750 family conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267025.1 protein_id gnl|my_center|LOCUS_17470 9675 10364 gene locus_tag LOCUS_17480 9675 10364 CDS product TIGR03746 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203388111.1 protein_id gnl|my_center|LOCUS_17480 10361 11287 gene locus_tag LOCUS_17490 10361 11287 CDS product TIGR03749 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011805409.1 protein_id gnl|my_center|LOCUS_17490 11277 12707 gene locus_tag LOCUS_17500 11277 12707 CDS product TIGR03752 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038862.1 protein_id gnl|my_center|LOCUS_17500 12688 13128 gene locus_tag LOCUS_17510 12688 13128 CDS product TIGR03751 family conjugal transfer lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038861.1 protein_id gnl|my_center|LOCUS_17510 13128 15995 gene locus_tag LOCUS_17520 13128 15995 CDS product conjugative transfer ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038860.1 protein_id gnl|my_center|LOCUS_17520 16009 16773 gene locus_tag LOCUS_17530 16009 16773 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038859.1 protein_id gnl|my_center|LOCUS_17530 16949 17443 gene locus_tag LOCUS_17540 gene radC 16949 17443 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263378.1 protein_id gnl|my_center|LOCUS_17540 17604 18050 gene locus_tag LOCUS_17550 17604 18050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 18068 18994 gene locus_tag LOCUS_17560 18068 18994 CDS product TIGR03756 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038857.1 protein_id gnl|my_center|LOCUS_17560 19061 20398 gene locus_tag LOCUS_17570 19061 20398 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066267402.1 protein_id gnl|my_center|LOCUS_17570 20395 20751 gene locus_tag LOCUS_17580 20395 20751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 20767 22287 gene locus_tag LOCUS_17590 20767 22287 CDS product conjugal transfer protein TraG N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066267399.1 protein_id gnl|my_center|LOCUS_17590 22664 22299 gene locus_tag LOCUS_17600 22664 22299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 23382 22750 gene locus_tag LOCUS_17610 23382 22750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 24021 23395 gene locus_tag LOCUS_17620 24021 23395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 24342 26180 gene locus_tag LOCUS_17630 gene mobH 24342 26180 CDS product MobH family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038851.1 protein_id gnl|my_center|LOCUS_17630 28912 26261 gene locus_tag LOCUS_17640 28912 26261 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036288.1 protein_id gnl|my_center|LOCUS_17640 30803 28938 gene locus_tag LOCUS_17650 30803 28938 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484240.1 protein_id gnl|my_center|LOCUS_17650 32177 30864 gene locus_tag LOCUS_17660 32177 30864 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185515.1 protein_id gnl|my_center|LOCUS_17660 33536 32229 gene locus_tag LOCUS_17670 33536 32229 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969686.1 protein_id gnl|my_center|LOCUS_17670 34385 33555 gene locus_tag LOCUS_17680 gene fghA 34385 33555 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038485.1 protein_id gnl|my_center|LOCUS_17680 35778 34444 gene locus_tag LOCUS_17690 35778 34444 CDS product DUF3422 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530349.1 protein_id gnl|my_center|LOCUS_17690 36359 35961 gene locus_tag LOCUS_17700 36359 35961 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811632.1 protein_id gnl|my_center|LOCUS_17700 37512 36403 gene locus_tag LOCUS_17710 37512 36403 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400756.1 protein_id gnl|my_center|LOCUS_17710 37847 37572 gene locus_tag LOCUS_17720 gene frmR 37847 37572 CDS product formaldehyde-responsive transcriptional repressor FrmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141271.1 protein_id gnl|my_center|LOCUS_17720 39020 38130 gene locus_tag LOCUS_17730 39020 38130 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037818.1 protein_id gnl|my_center|LOCUS_17730 39625 39017 gene locus_tag LOCUS_17740 39625 39017 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037819.1 protein_id gnl|my_center|LOCUS_17740 40034 39627 gene locus_tag LOCUS_17750 40034 39627 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035635.1 protein_id gnl|my_center|LOCUS_17750 40189 41094 gene locus_tag LOCUS_17760 40189 41094 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705466.1 protein_id gnl|my_center|LOCUS_17760 43221 41245 gene locus_tag LOCUS_17770 gene uvrB 43221 41245 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694308.1 protein_id gnl|my_center|LOCUS_17770 44027 43596 gene locus_tag LOCUS_17780 44027 43596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 45916 47130 gene locus_tag LOCUS_17790 gene fdhA 45916 47130 CDS product formaldehyde dehydrogenase, glutathione-independent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523135.1 protein_id gnl|my_center|LOCUS_17790 47111 47389 gene locus_tag LOCUS_17800 47111 47389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 47615 48505 gene locus_tag LOCUS_17810 47615 48505 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038250.1 protein_id gnl|my_center|LOCUS_17810 49127 49594 gene locus_tag LOCUS_17820 49127 49594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 49713 50681 gene locus_tag LOCUS_17830 49713 50681 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531010.1 protein_id gnl|my_center|LOCUS_17830 52663 50720 gene locus_tag LOCUS_17840 52663 50720 CDS product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039577560.1 protein_id gnl|my_center|LOCUS_17840 52965 52890 gene locus_tag LOCUS_t00120 52965 52890 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 53043 52968 gene locus_tag LOCUS_t00130 53043 52968 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 53261 54034 gene locus_tag LOCUS_17850 53261 54034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114771.1 protein_id gnl|my_center|LOCUS_17850 54096 54758 gene locus_tag LOCUS_17860 54096 54758 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114770.1 protein_id gnl|my_center|LOCUS_17860 55250 54768 gene locus_tag LOCUS_17870 55250 54768 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114769.1 protein_id gnl|my_center|LOCUS_17870 56137 55247 gene locus_tag LOCUS_17880 56137 55247 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098802.1 protein_id gnl|my_center|LOCUS_17880 56220 58580 gene locus_tag LOCUS_17890 gene sagS 56220 58580 CDS product two-component system sensor histidine kinase/response regulator SagS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114768.1 protein_id gnl|my_center|LOCUS_17890 59090 58599 gene locus_tag LOCUS_17900 gene ospR 59090 58599 CDS product hydroperoxide stress response transcriptional regulator OspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114767.1 protein_id gnl|my_center|LOCUS_17900 59572 59087 gene locus_tag LOCUS_17910 59572 59087 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090910.1 protein_id gnl|my_center|LOCUS_17910 60082 59684 gene locus_tag LOCUS_17920 gene msrB 60082 59684 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090911.1 protein_id gnl|my_center|LOCUS_17920 60267 61478 gene locus_tag LOCUS_17930 60267 61478 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090913.1 protein_id gnl|my_center|LOCUS_17930 61530 61982 gene locus_tag LOCUS_17940 61530 61982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115276.1 protein_id gnl|my_center|LOCUS_17940 62032 62991 gene locus_tag LOCUS_17950 gene htpX 62032 62991 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090915.1 protein_id gnl|my_center|LOCUS_17950 63132 64259 gene locus_tag LOCUS_17960 63132 64259 CDS product M14-type cytosolic carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114765.1 protein_id gnl|my_center|LOCUS_17960 64947 64291 gene locus_tag LOCUS_17970 64947 64291 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114764.1 protein_id gnl|my_center|LOCUS_17970 65449 65003 gene locus_tag LOCUS_17980 65449 65003 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114763.1 protein_id gnl|my_center|LOCUS_17980 65606 66538 gene locus_tag LOCUS_17990 65606 66538 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003143729.1 protein_id gnl|my_center|LOCUS_17990 66676 68268 gene locus_tag LOCUS_18000 66676 68268 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114761.1 protein_id gnl|my_center|LOCUS_18000 68280 69344 gene locus_tag LOCUS_18010 68280 69344 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114760.1 protein_id gnl|my_center|LOCUS_18010 69341 70780 gene locus_tag LOCUS_18020 69341 70780 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114759.1 protein_id gnl|my_center|LOCUS_18020 70817 71788 gene locus_tag LOCUS_18030 70817 71788 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106096.1 protein_id gnl|my_center|LOCUS_18030 71879 72649 gene locus_tag LOCUS_18040 71879 72649 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106098.1 protein_id gnl|my_center|LOCUS_18040 74686 73016 gene locus_tag LOCUS_18050 74686 73016 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119873.1 protein_id gnl|my_center|LOCUS_18050 74967 75821 gene locus_tag LOCUS_18060 74967 75821 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104155.1 protein_id gnl|my_center|LOCUS_18060 76596 75847 gene locus_tag LOCUS_18070 76596 75847 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119872.1 protein_id gnl|my_center|LOCUS_18070 76772 78118 gene locus_tag LOCUS_18080 76772 78118 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104160.1 protein_id gnl|my_center|LOCUS_18080 79367 78159 gene locus_tag LOCUS_18090 79367 78159 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114757.1 protein_id gnl|my_center|LOCUS_18090 79683 79450 gene locus_tag LOCUS_18100 79683 79450 CDS product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110987.1 protein_id gnl|my_center|LOCUS_18100 79780 80634 gene locus_tag LOCUS_18110 79780 80634 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114756.1 protein_id gnl|my_center|LOCUS_18110 81385 80636 gene locus_tag LOCUS_18120 81385 80636 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114755.1 protein_id gnl|my_center|LOCUS_18120 81486 82442 gene locus_tag LOCUS_18130 81486 82442 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119870.1 protein_id gnl|my_center|LOCUS_18130 82528 82983 gene locus_tag LOCUS_18140 gene ohrR 82528 82983 CDS product hydroperoxide stress response transcriptional regulator OhrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090940.1 protein_id gnl|my_center|LOCUS_18140 83128 83556 gene locus_tag LOCUS_18150 gene ohrR 83128 83556 CDS product organic hydroperoxide resistance protein OhrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104171.1 protein_id gnl|my_center|LOCUS_18150 84210 83644 gene locus_tag LOCUS_18160 gene efp 84210 83644 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090942.1 protein_id gnl|my_center|LOCUS_18160 85383 84253 gene locus_tag LOCUS_18170 gene earP 85383 84253 CDS product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114754.1 protein_id gnl|my_center|LOCUS_18170 85539 85628 gene locus_tag LOCUS_t00140 85539 85628 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 86045 86296 gene locus_tag LOCUS_18180 gene oprI 86045 86296 CDS product outer membrane lipoprotei OprI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090944.1 protein_id gnl|my_center|LOCUS_18180 87391 86420 gene locus_tag LOCUS_18190 87391 86420 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090946.1 protein_id gnl|my_center|LOCUS_18190 87747 87469 gene locus_tag LOCUS_18200 87747 87469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090947.1 protein_id gnl|my_center|LOCUS_18200 88408 87803 gene locus_tag LOCUS_18210 gene tesA 88408 87803 CDS product esterase TesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114753.1 protein_id gnl|my_center|LOCUS_18210 88419 89102 gene locus_tag LOCUS_18220 88419 89102 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_18220 89102 91603 gene locus_tag LOCUS_18230 89102 91603 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122524.1 protein_id gnl|my_center|LOCUS_18230 91655 92161 gene locus_tag LOCUS_18240 gene greB 91655 92161 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090951.1 protein_id gnl|my_center|LOCUS_18240 92491 92174 gene locus_tag LOCUS_18250 92491 92174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 92635 93216 gene locus_tag LOCUS_18260 gene thpR 92635 93216 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115273.1 protein_id gnl|my_center|LOCUS_18260 93412 94347 gene locus_tag LOCUS_18270 gene lipA 93412 94347 CDS product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090955.1 protein_id gnl|my_center|LOCUS_18270 94397 95419 gene locus_tag LOCUS_18280 94397 95419 CDS product lipase secretion chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003117631.1 protein_id gnl|my_center|LOCUS_18280 96021 95587 gene locus_tag LOCUS_18290 96021 95587 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090958.1 protein_id gnl|my_center|LOCUS_18290 97550 96120 gene locus_tag LOCUS_18300 97550 96120 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114749.1 protein_id gnl|my_center|LOCUS_18300 97797 98600 gene locus_tag LOCUS_18310 97797 98600 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114747.1 protein_id gnl|my_center|LOCUS_18310 98739 100211 gene locus_tag LOCUS_18320 98739 100211 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110283.1 protein_id gnl|my_center|LOCUS_18320 100337 100696 gene locus_tag LOCUS_18330 100337 100696 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101677.1 protein_id gnl|my_center|LOCUS_18330 100783 101271 gene locus_tag LOCUS_18340 100783 101271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004344566.1 protein_id gnl|my_center|LOCUS_18340 101281 102858 gene locus_tag LOCUS_18350 101281 102858 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114745.1 protein_id gnl|my_center|LOCUS_18350 103664 102867 gene locus_tag LOCUS_18360 103664 102867 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090970.1 protein_id gnl|my_center|LOCUS_18360 104515 103745 gene locus_tag LOCUS_18370 104515 103745 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114744.1 protein_id gnl|my_center|LOCUS_18370 106518 104512 gene locus_tag LOCUS_18380 gene tgpA 106518 104512 CDS product protein-glutamine gamma-glutamyltransferase TgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114743.1 protein_id gnl|my_center|LOCUS_18380 107468 106515 gene locus_tag LOCUS_18390 107468 106515 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114742.1 protein_id gnl|my_center|LOCUS_18390 108385 107468 gene locus_tag LOCUS_18400 108385 107468 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_18400 109313 108615 gene locus_tag LOCUS_18410 gene pyrF 109313 108615 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090975.1 protein_id gnl|my_center|LOCUS_18410 110303 109410 gene locus_tag LOCUS_18420 110303 109410 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101696.1 protein_id gnl|my_center|LOCUS_18420 110349 110990 gene locus_tag LOCUS_18430 110349 110990 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895640.1 protein_id gnl|my_center|LOCUS_18430 111903 111013 gene locus_tag LOCUS_18440 111903 111013 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090978.1 protein_id gnl|my_center|LOCUS_18440 111950 112465 gene locus_tag LOCUS_18450 111950 112465 CDS product multidrug/biocide efflux PACE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119853.1 protein_id gnl|my_center|LOCUS_18450 113385 112474 gene locus_tag LOCUS_18460 113385 112474 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090981.1 protein_id gnl|my_center|LOCUS_18460 114688 113387 gene locus_tag LOCUS_18470 114688 113387 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124441.1 protein_id gnl|my_center|LOCUS_18470 114925 115092 gene locus_tag LOCUS_18480 114925 115092 CDS product DUF2897 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090984.1 protein_id gnl|my_center|LOCUS_18480 115324 116088 gene locus_tag LOCUS_18490 115324 116088 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090986.1 protein_id gnl|my_center|LOCUS_18490 116685 116089 gene locus_tag LOCUS_18500 gene atuR 116685 116089 CDS product atu genes transcriptional repressor AtuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090989.1 protein_id gnl|my_center|LOCUS_18500 116966 118768 gene locus_tag LOCUS_18510 116966 118768 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114739.1 protein_id gnl|my_center|LOCUS_18510 118838 119716 gene locus_tag LOCUS_18520 118838 119716 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090991.1 protein_id gnl|my_center|LOCUS_18520 119718 121334 gene locus_tag LOCUS_18530 gene atuC 119718 121334 CDS product geranyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114738.1 protein_id gnl|my_center|LOCUS_18530 121391 122611 gene locus_tag LOCUS_18540 gene atuD 121391 122611 CDS product citronellyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101733.1 protein_id gnl|my_center|LOCUS_18540 122632 123426 gene locus_tag LOCUS_18550 gene atuE 122632 123426 CDS product isohexenylglutaconyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114737.1 protein_id gnl|my_center|LOCUS_18550 123472 125457 gene locus_tag LOCUS_18560 gene atuF 123472 125457 CDS product geranyl-CoA carboxylase subunit apha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114736.1 protein_id gnl|my_center|LOCUS_18560 125509 126333 gene locus_tag LOCUS_18570 125509 126333 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101741.1 protein_id gnl|my_center|LOCUS_18570 126495 128321 gene locus_tag LOCUS_18580 126495 128321 CDS product long-chain-acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090998.1 protein_id gnl|my_center|LOCUS_18580 128925 128335 gene locus_tag LOCUS_18590 128925 128335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 129864 129100 gene locus_tag LOCUS_18600 gene sbrR 129864 129100 CDS product anti-sigma factor SbrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114735.1 protein_id gnl|my_center|LOCUS_18600 130496 129861 gene locus_tag LOCUS_18610 gene sbrI 130496 129861 CDS product ECF family RNA polymerase sigma factor SbrI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119848.1 protein_id gnl|my_center|LOCUS_18610 132213 130774 gene locus_tag LOCUS_18620 132213 130774 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091003.1 protein_id gnl|my_center|LOCUS_18620 132803 132435 gene locus_tag LOCUS_18630 132803 132435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114734.1 protein_id gnl|my_center|LOCUS_18630 133527 132889 gene locus_tag LOCUS_18640 133527 132889 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091005.1 protein_id gnl|my_center|LOCUS_18640 134530 133721 gene locus_tag LOCUS_18650 134530 133721 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091007.1 protein_id gnl|my_center|LOCUS_18650 134889 134530 gene locus_tag LOCUS_18660 134889 134530 CDS product DUF4398 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091008.1 protein_id gnl|my_center|LOCUS_18660 135734 134886 gene locus_tag LOCUS_18670 135734 134886 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114733.1 protein_id gnl|my_center|LOCUS_18670 137483 135804 gene locus_tag LOCUS_18680 gene cobJ 137483 135804 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147855.1 protein_id gnl|my_center|LOCUS_18680 138228 137476 gene locus_tag LOCUS_18690 138228 137476 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091011.1 protein_id gnl|my_center|LOCUS_18690 138851 138225 gene locus_tag LOCUS_18700 138851 138225 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107929.1 protein_id gnl|my_center|LOCUS_18700 140218 138848 gene locus_tag LOCUS_18710 gene cobG 140218 138848 CDS product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895641.1 protein_id gnl|my_center|LOCUS_18710 140645 141892 gene locus_tag LOCUS_18720 gene cbiE 140645 141892 CDS product precorrin-6y C5,15-methyltransferase (decarboxylating) subunit CbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114023.1 protein_id gnl|my_center|LOCUS_18720 141885 142985 gene locus_tag LOCUS_18730 141885 142985 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114022.1 protein_id gnl|my_center|LOCUS_18730 142982 143710 gene locus_tag LOCUS_18740 142982 143710 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114021.1 protein_id gnl|my_center|LOCUS_18740 144355 143765 gene locus_tag LOCUS_18750 gene mntP 144355 143765 CDS product manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091017.1 protein_id gnl|my_center|LOCUS_18750 144971 147127 gene locus_tag LOCUS_18760 144971 147127 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114020.1 protein_id gnl|my_center|LOCUS_18760 147180 147953 gene locus_tag LOCUS_18770 147180 147953 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101422.1 protein_id gnl|my_center|LOCUS_18770 147950 148921 gene locus_tag LOCUS_18780 147950 148921 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101423.1 protein_id gnl|my_center|LOCUS_18780 148918 149949 gene locus_tag LOCUS_18790 148918 149949 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114019.1 protein_id gnl|my_center|LOCUS_18790 150816 149950 gene locus_tag LOCUS_18800 150816 149950 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_18800 151529 150936 gene locus_tag LOCUS_18810 151529 150936 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114018.1 protein_id gnl|my_center|LOCUS_18810 152416 151580 gene locus_tag LOCUS_18820 152416 151580 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091026.1 protein_id gnl|my_center|LOCUS_18820 152627 153400 gene locus_tag LOCUS_18830 152627 153400 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114017.1 protein_id gnl|my_center|LOCUS_18830 153451 153708 gene locus_tag LOCUS_18840 153451 153708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101434.1 protein_id gnl|my_center|LOCUS_18840 155354 153717 gene locus_tag LOCUS_18850 155354 153717 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114016.1 protein_id gnl|my_center|LOCUS_18850 156392 155439 gene locus_tag LOCUS_18860 156392 155439 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895642.1 protein_id gnl|my_center|LOCUS_18860 156529 157698 gene locus_tag LOCUS_18870 156529 157698 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114014.1 protein_id gnl|my_center|LOCUS_18870 157758 158543 gene locus_tag LOCUS_18880 157758 158543 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114013.1 protein_id gnl|my_center|LOCUS_18880 158599 159288 gene locus_tag LOCUS_18890 158599 159288 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091034.1 protein_id gnl|my_center|LOCUS_18890 159285 159998 gene locus_tag LOCUS_18900 159285 159998 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091035.1 protein_id gnl|my_center|LOCUS_18900 160019 160786 gene locus_tag LOCUS_18910 160019 160786 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114012.1 protein_id gnl|my_center|LOCUS_18910 160978 160796 gene locus_tag LOCUS_18920 160978 160796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 161108 162439 gene locus_tag LOCUS_18930 161108 162439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114010.1 protein_id gnl|my_center|LOCUS_18930 163999 162491 gene locus_tag LOCUS_18940 163999 162491 CDS product PA2928 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114009.1 protein_id gnl|my_center|LOCUS_18940 164736 164122 gene locus_tag LOCUS_18950 164736 164122 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114008.1 protein_id gnl|my_center|LOCUS_18950 164802 165728 gene locus_tag LOCUS_18960 164802 165728 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114007.1 protein_id gnl|my_center|LOCUS_18960 166329 165739 gene locus_tag LOCUS_18970 166329 165739 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119828.1 protein_id gnl|my_center|LOCUS_18970 166455 167192 gene locus_tag LOCUS_18980 166455 167192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18980 167165 167548 gene locus_tag LOCUS_18990 167165 167548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18990 167614 168792 gene locus_tag LOCUS_19000 167614 168792 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114005.1 protein_id gnl|my_center|LOCUS_19000 168814 169773 gene locus_tag LOCUS_19010 gene cif 168814 169773 CDS product CFTR inhibitory factor Cif inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114004.1 protein_id gnl|my_center|LOCUS_19010 169972 169793 gene locus_tag LOCUS_19020 169972 169793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 170382 170963 gene locus_tag LOCUS_19030 170382 170963 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114003.1 protein_id gnl|my_center|LOCUS_19030 171119 171367 gene locus_tag LOCUS_19040 171119 171367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119823.1 protein_id gnl|my_center|LOCUS_19040 172952 171423 gene locus_tag LOCUS_19050 172952 171423 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101463.1 protein_id gnl|my_center|LOCUS_19050 173380 174990 gene locus_tag LOCUS_19060 gene paaP 173380 174990 CDS product aminopeptidase PaaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101464.1 protein_id gnl|my_center|LOCUS_19060 176216 175077 gene locus_tag LOCUS_19070 176216 175077 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114002.1 protein_id gnl|my_center|LOCUS_19070 176982 176338 gene locus_tag LOCUS_19080 176982 176338 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119819.1 protein_id gnl|my_center|LOCUS_19080 178019 177003 gene locus_tag LOCUS_19090 178019 177003 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114001.1 protein_id gnl|my_center|LOCUS_19090 178590 179684 gene locus_tag LOCUS_19100 178590 179684 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114000.1 protein_id gnl|my_center|LOCUS_19100 183459 179713 gene locus_tag LOCUS_19110 gene cobN 183459 179713 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113999.1 protein_id gnl|my_center|LOCUS_19110 184587 183535 gene locus_tag LOCUS_19120 gene cobW 184587 183535 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895644.1 protein_id gnl|my_center|LOCUS_19120 185277 184918 gene locus_tag LOCUS_19130 185277 184918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 185210 185392 gene locus_tag LOCUS_19140 185210 185392 CDS product CbtB-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766274.1 protein_id gnl|my_center|LOCUS_19140 185410 186111 gene locus_tag LOCUS_19150 185410 186111 CDS product CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091061.1 protein_id gnl|my_center|LOCUS_19150 186184 186612 gene locus_tag LOCUS_19160 186184 186612 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113997.1 protein_id gnl|my_center|LOCUS_19160 186609 187361 gene locus_tag LOCUS_19170 gene cobM 186609 187361 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102926.1 protein_id gnl|my_center|LOCUS_19170 187490 188437 gene locus_tag LOCUS_19180 187490 188437 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_19180 189706 188510 gene locus_tag LOCUS_19190 gene fabV 189706 188510 CDS product enoyl-ACP reductase FabV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102929.1 protein_id gnl|my_center|LOCUS_19190 190820 189891 gene locus_tag LOCUS_19200 190820 189891 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091099.1 protein_id gnl|my_center|LOCUS_19200 191569 190820 gene locus_tag LOCUS_19210 191569 190820 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091107.1 protein_id gnl|my_center|LOCUS_19210 191890 193545 gene locus_tag LOCUS_19220 191890 193545 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102932.1 protein_id gnl|my_center|LOCUS_19220 194163 193594 gene locus_tag LOCUS_19230 194163 193594 CDS product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113996.1 protein_id gnl|my_center|LOCUS_19230 194788 194156 gene locus_tag LOCUS_19240 194788 194156 CDS product DUF4823 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091112.1 protein_id gnl|my_center|LOCUS_19240 195749 194853 gene locus_tag LOCUS_19250 195749 194853 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091113.1 protein_id gnl|my_center|LOCUS_19250 196537 195899 gene locus_tag LOCUS_19260 196537 195899 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091114.1 protein_id gnl|my_center|LOCUS_19260 196623 197756 gene locus_tag LOCUS_19270 196623 197756 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113995.1 protein_id gnl|my_center|LOCUS_19270 198757 197981 gene locus_tag LOCUS_19280 198757 197981 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091117.1 protein_id gnl|my_center|LOCUS_19280 199128 198772 gene locus_tag LOCUS_19290 199128 198772 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_19290 200148 199162 gene locus_tag LOCUS_19300 200148 199162 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104126.1 protein_id gnl|my_center|LOCUS_19300 200773 200141 gene locus_tag LOCUS_19310 gene tmk 200773 200141 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091125.1 protein_id gnl|my_center|LOCUS_19310 201851 200802 gene locus_tag LOCUS_19320 gene mltG 201851 200802 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104128.1 protein_id gnl|my_center|LOCUS_19320 202672 201857 gene locus_tag LOCUS_19330 gene pabC 202672 201857 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113994.1 protein_id gnl|my_center|LOCUS_19330 203916 202672 gene locus_tag LOCUS_19340 gene fabF 203916 202672 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104132.1 protein_id gnl|my_center|LOCUS_19340 204281 204045 gene locus_tag LOCUS_19350 gene acpP 204281 204045 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091135.1 protein_id gnl|my_center|LOCUS_19350 205220 204477 gene locus_tag LOCUS_19360 gene fabG 205220 204477 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091137.1 protein_id gnl|my_center|LOCUS_19360 206181 205243 gene locus_tag LOCUS_19370 gene fabD 206181 205243 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147872.1 protein_id gnl|my_center|LOCUS_19370 207267 206287 gene locus_tag LOCUS_19380 gene plsX 207267 206287 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071533934.1 protein_id gnl|my_center|LOCUS_19380 207483 207301 gene locus_tag LOCUS_19390 gene rpmF 207483 207301 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091143.1 protein_id gnl|my_center|LOCUS_19390 208033 207497 gene locus_tag LOCUS_19400 208033 207497 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091144.1 protein_id gnl|my_center|LOCUS_19400 208143 208721 gene locus_tag LOCUS_19410 208143 208721 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113992.1 protein_id gnl|my_center|LOCUS_19410 209768 208788 gene locus_tag LOCUS_19420 gene sppA 209768 208788 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091146.1 protein_id gnl|my_center|LOCUS_19420 210453 209761 gene locus_tag LOCUS_19430 210453 209761 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113991.1 protein_id gnl|my_center|LOCUS_19430 211402 210446 gene locus_tag LOCUS_19440 gene rluC 211402 210446 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104143.1 protein_id gnl|my_center|LOCUS_19440 211988 215152 gene locus_tag LOCUS_19450 211988 215152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 216329 215310 gene locus_tag LOCUS_19460 gene murB 216329 215310 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106928.1 protein_id gnl|my_center|LOCUS_19460 216790 216326 gene locus_tag LOCUS_19470 216790 216326 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106924.1 protein_id gnl|my_center|LOCUS_19470 217554 216790 gene locus_tag LOCUS_19480 gene kdsB 217554 216790 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106922.1 protein_id gnl|my_center|LOCUS_19480 217739 217554 gene locus_tag LOCUS_19490 217739 217554 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091157.1 protein_id gnl|my_center|LOCUS_19490 218775 217777 gene locus_tag LOCUS_19500 gene lpxK 218775 217777 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091159.1 protein_id gnl|my_center|LOCUS_19500 219215 218775 gene locus_tag LOCUS_19510 219215 218775 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091161.1 protein_id gnl|my_center|LOCUS_19510 219814 219212 gene locus_tag LOCUS_19520 219814 219212 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_19520 222145 219920 gene locus_tag LOCUS_19530 222145 219920 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113988.1 protein_id gnl|my_center|LOCUS_19530 222276 222809 gene locus_tag LOCUS_19540 222276 222809 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 protein_id gnl|my_center|LOCUS_19540 224141 222897 gene locus_tag LOCUS_19550 224141 222897 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119805.1 protein_id gnl|my_center|LOCUS_19550 224894 224211 gene locus_tag LOCUS_19560 gene lolD 224894 224211 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091168.1 protein_id gnl|my_center|LOCUS_19560 226137 224887 gene locus_tag LOCUS_19570 226137 224887 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091170.1 protein_id gnl|my_center|LOCUS_19570 226240 226839 gene locus_tag LOCUS_19580 226240 226839 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105196.1 protein_id gnl|my_center|LOCUS_19580 226849 227157 gene locus_tag LOCUS_19590 226849 227157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 227154 227876 gene locus_tag LOCUS_19600 227154 227876 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113986.1 protein_id gnl|my_center|LOCUS_19600 229313 227919 gene locus_tag LOCUS_19610 gene sthA 229313 227919 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091177.1 protein_id gnl|my_center|LOCUS_19610 229719 229492 gene locus_tag LOCUS_19620 gene nqrM 229719 229492 CDS product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091178.1 protein_id gnl|my_center|LOCUS_19620 230744 229716 gene locus_tag LOCUS_19630 230744 229716 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113985.1 protein_id gnl|my_center|LOCUS_19630 231960 230737 gene locus_tag LOCUS_19640 gene nqrF 231960 230737 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113984.1 protein_id gnl|my_center|LOCUS_19640 232579 231971 gene locus_tag LOCUS_19650 gene nqrE 232579 231971 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091182.1 protein_id gnl|my_center|LOCUS_19650 233250 232579 gene locus_tag LOCUS_19660 gene nqrD 233250 232579 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119802.1 protein_id gnl|my_center|LOCUS_19660 234035 233250 gene locus_tag LOCUS_19670 234035 233250 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105182.1 protein_id gnl|my_center|LOCUS_19670 235239 234028 gene locus_tag LOCUS_19680 235239 234028 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109478.1 protein_id gnl|my_center|LOCUS_19680 236580 235243 gene locus_tag LOCUS_19690 236580 235243 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113983.1 protein_id gnl|my_center|LOCUS_19690 238248 236839 gene locus_tag LOCUS_19700 238248 236839 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113982.1 protein_id gnl|my_center|LOCUS_19700 239798 238350 gene locus_tag LOCUS_19710 239798 238350 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119798.1 protein_id gnl|my_center|LOCUS_19710 239950 243402 gene locus_tag LOCUS_19720 gene mfd 239950 243402 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113980.1 protein_id gnl|my_center|LOCUS_19720 243413 244042 gene locus_tag LOCUS_19730 243413 244042 CDS product CsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091190.1 protein_id gnl|my_center|LOCUS_19730 244825 244088 gene locus_tag LOCUS_19740 244825 244088 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091193.1 protein_id gnl|my_center|LOCUS_19740 245835 244837 gene locus_tag LOCUS_19750 gene nagZ 245835 244837 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118092.1 protein_id gnl|my_center|LOCUS_19750 246738 246037 gene locus_tag LOCUS_19760 gene psrA 246738 246037 CDS product transcriptional regulator PsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091195.1 protein_id gnl|my_center|LOCUS_19760 246970 247584 gene locus_tag LOCUS_19770 gene lexA 246970 247584 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091196.1 protein_id gnl|my_center|LOCUS_19770 247596 248081 gene locus_tag LOCUS_19780 gene sulA 247596 248081 CDS product cell division inhibitor SulA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091197.1 protein_id gnl|my_center|LOCUS_19780 248336 248103 gene locus_tag LOCUS_19790 248336 248103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109483.1 protein_id gnl|my_center|LOCUS_19790 249060 248542 gene locus_tag LOCUS_19800 249060 248542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113979.1 protein_id gnl|my_center|LOCUS_19800 251773 249167 gene locus_tag LOCUS_19810 gene topA 251773 249167 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091201.1 protein_id gnl|my_center|LOCUS_19810 252238 251864 gene locus_tag LOCUS_19820 252238 251864 CDS product DUF1653 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091202.1 protein_id gnl|my_center|LOCUS_19820 253496 252321 gene locus_tag LOCUS_19830 gene fadA 253496 252321 CDS product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113978.1 protein_id gnl|my_center|LOCUS_19830 255674 253527 gene locus_tag LOCUS_19840 gene fadB 255674 253527 CDS product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091204.1 protein_id gnl|my_center|LOCUS_19840 256117 256920 gene locus_tag LOCUS_19850 256117 256920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119795.1 protein_id gnl|my_center|LOCUS_19850 257371 256937 gene locus_tag LOCUS_19860 257371 256937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109487.1 protein_id gnl|my_center|LOCUS_19860 257579 258016 gene locus_tag LOCUS_19870 257579 258016 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091210.1 protein_id gnl|my_center|LOCUS_19870 258732 258046 gene locus_tag LOCUS_19880 258732 258046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091213.1 protein_id gnl|my_center|LOCUS_19880 260804 258882 gene locus_tag LOCUS_19890 260804 258882 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113976.1 protein_id gnl|my_center|LOCUS_19890 261030 262958 gene locus_tag LOCUS_19900 gene slt 261030 262958 CDS product lytic transglycosylase Slt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113975.1 protein_id gnl|my_center|LOCUS_19900 263015 263401 gene locus_tag LOCUS_19910 263015 263401 CDS product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113974.1 protein_id gnl|my_center|LOCUS_19910 264251 263445 gene locus_tag LOCUS_19920 264251 263445 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113973.1 protein_id gnl|my_center|LOCUS_19920 265262 264354 gene locus_tag LOCUS_19930 gene yegS 265262 264354 CDS product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091230.1 protein_id gnl|my_center|LOCUS_19930 266896 265337 gene locus_tag LOCUS_19940 266896 265337 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109491.1 protein_id gnl|my_center|LOCUS_19940 268497 266917 gene locus_tag LOCUS_19950 268497 266917 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113972.1 protein_id gnl|my_center|LOCUS_19950 270098 268503 gene locus_tag LOCUS_19960 270098 268503 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113971.1 protein_id gnl|my_center|LOCUS_19960 270275 271306 gene locus_tag LOCUS_19970 270275 271306 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113970.1 protein_id gnl|my_center|LOCUS_19970 272552 271335 gene locus_tag LOCUS_19980 272552 271335 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113969.1 protein_id gnl|my_center|LOCUS_19980 272301 272394 gene locus_tag LOCUS_t00150 272301 272394 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 273088 272549 gene locus_tag LOCUS_19990 gene moaB 273088 272549 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091240.1 protein_id gnl|my_center|LOCUS_19990 273155 273751 gene locus_tag LOCUS_20000 gene mobA 273155 273751 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113968.1 protein_id gnl|my_center|LOCUS_20000 273883 274104 gene locus_tag LOCUS_20010 273883 274104 CDS product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091247.1 protein_id gnl|my_center|LOCUS_20010 274258 274334 gene locus_tag LOCUS_t00160 274258 274334 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 275795 274392 gene locus_tag LOCUS_20020 275795 274392 CDS product cytochrome C Snr1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103259.1 protein_id gnl|my_center|LOCUS_20020 276402 276163 gene locus_tag LOCUS_20030 276402 276163 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119787.1 protein_id gnl|my_center|LOCUS_20030 277005 276448 gene locus_tag LOCUS_20040 277005 276448 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109619.1 protein_id gnl|my_center|LOCUS_20040 277171 277767 gene locus_tag LOCUS_20050 277171 277767 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113966.1 protein_id gnl|my_center|LOCUS_20050 277784 278716 gene locus_tag LOCUS_20060 277784 278716 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113965.1 protein_id gnl|my_center|LOCUS_20060 278716 279582 gene locus_tag LOCUS_20070 278716 279582 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113964.1 protein_id gnl|my_center|LOCUS_20070 279751 281016 gene locus_tag LOCUS_20080 gene opdQ 279751 281016 CDS product porin OpdQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091257.1 protein_id gnl|my_center|LOCUS_20080 282409 281201 gene locus_tag LOCUS_20090 282409 281201 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119782.1 protein_id gnl|my_center|LOCUS_20090 282878 283207 gene locus_tag LOCUS_20100 282878 283207 CDS product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091262.1 protein_id gnl|my_center|LOCUS_20100 283211 283591 gene locus_tag LOCUS_20110 283211 283591 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091263.1 protein_id gnl|my_center|LOCUS_20110 283605 283928 gene locus_tag LOCUS_20120 283605 283928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103249.1 protein_id gnl|my_center|LOCUS_20120 284045 285376 gene locus_tag LOCUS_20130 284045 285376 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091265.1 protein_id gnl|my_center|LOCUS_20130 287504 285387 gene locus_tag LOCUS_20140 287504 285387 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010793208.1 protein_id gnl|my_center|LOCUS_20140 288249 287626 gene locus_tag LOCUS_20150 288249 287626 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091268.1 protein_id gnl|my_center|LOCUS_20150 289019 288675 gene locus_tag LOCUS_20160 289019 288675 CDS product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091271.1 protein_id gnl|my_center|LOCUS_20160 289330 290760 gene locus_tag LOCUS_20170 gene dacB 289330 290760 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091272.1 protein_id gnl|my_center|LOCUS_20170 293004 290827 gene locus_tag LOCUS_20180 gene rlmKL 293004 290827 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113961.1 protein_id gnl|my_center|LOCUS_20180 294793 293765 gene locus_tag LOCUS_20190 294793 293765 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103236.1 protein_id gnl|my_center|LOCUS_20190 295131 294850 gene locus_tag LOCUS_20200 295131 294850 CDS product DUF2835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119779.1 protein_id gnl|my_center|LOCUS_20200 295224 296105 gene locus_tag LOCUS_20210 295224 296105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122457.1 protein_id gnl|my_center|LOCUS_20210 296177 297178 gene locus_tag LOCUS_20220 296177 297178 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113959.1 protein_id gnl|my_center|LOCUS_20220 297346 299250 gene locus_tag LOCUS_20230 297346 299250 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113957.1 protein_id gnl|my_center|LOCUS_20230 299843 299367 gene locus_tag LOCUS_20240 299843 299367 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115353.1 protein_id gnl|my_center|LOCUS_20240 300339 299881 gene locus_tag LOCUS_20250 300339 299881 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003143634.1 protein_id gnl|my_center|LOCUS_20250 300483 300713 gene locus_tag LOCUS_20260 300483 300713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091282.1 protein_id gnl|my_center|LOCUS_20260 302124 300754 gene locus_tag LOCUS_20270 gene pelG 302124 300754 CDS product exopolysaccharide Pel transporter PelG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091283.1 protein_id gnl|my_center|LOCUS_20270 303649 302126 gene locus_tag LOCUS_20280 gene pelF 303649 302126 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113954.1 protein_id gnl|my_center|LOCUS_20280 304635 303646 gene locus_tag LOCUS_20290 304635 303646 CDS product pellicle/biofilm biosynthesis protein PelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113953.1 protein_id gnl|my_center|LOCUS_20290 305980 304613 gene locus_tag LOCUS_20300 305980 304613 CDS product PelD GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113952.1 protein_id gnl|my_center|LOCUS_20300 306504 305986 gene locus_tag LOCUS_20310 306504 305986 CDS product pellicle/biofilm biosynthesis outer membrane protein PelC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091288.1 protein_id gnl|my_center|LOCUS_20310 310125 306544 gene locus_tag LOCUS_20320 310125 306544 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113951.1 protein_id gnl|my_center|LOCUS_20320 312949 310103 gene locus_tag LOCUS_20330 312949 310103 CDS product bifunctional glycoside hydrolase 114/ polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113950.1 protein_id gnl|my_center|LOCUS_20330 314417 313431 gene locus_tag LOCUS_20340 314417 313431 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113949.1 protein_id gnl|my_center|LOCUS_20340 315002 314430 gene locus_tag LOCUS_20350 315002 314430 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103486.1 protein_id gnl|my_center|LOCUS_20350 315488 315045 gene locus_tag LOCUS_20360 315488 315045 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109601.1 protein_id gnl|my_center|LOCUS_20360 320498 315636 gene locus_tag LOCUS_20370 gene gdhB 320498 315636 CDS product NAD-glutamate dehydrogenase GdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103491.1 protein_id gnl|my_center|LOCUS_20370 321541 320771 gene locus_tag LOCUS_20380 321541 320771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091293.1 protein_id gnl|my_center|LOCUS_20380 321882 322862 gene locus_tag LOCUS_20390 321882 322862 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091294.1 protein_id gnl|my_center|LOCUS_20390 322873 323811 gene locus_tag LOCUS_20400 322873 323811 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091295.1 protein_id gnl|my_center|LOCUS_20400 323808 324302 gene locus_tag LOCUS_20410 323808 324302 CDS product DUF4381 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113947.1 protein_id gnl|my_center|LOCUS_20410 324295 325317 gene locus_tag LOCUS_20420 324295 325317 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113946.1 protein_id gnl|my_center|LOCUS_20420 325314 327074 gene locus_tag LOCUS_20430 325314 327074 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107432.1 protein_id gnl|my_center|LOCUS_20430 327071 328702 gene locus_tag LOCUS_20440 327071 328702 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113945.1 protein_id gnl|my_center|LOCUS_20440 328756 329835 gene locus_tag LOCUS_20450 328756 329835 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113944.1 protein_id gnl|my_center|LOCUS_20450 329897 330568 gene locus_tag LOCUS_20460 gene cprR 329897 330568 CDS product cationic peptide response regulator transcription factor CprR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091311.1 protein_id gnl|my_center|LOCUS_20460 330565 331860 gene locus_tag LOCUS_20470 gene cprS 330565 331860 CDS product cationic peptide sensor histidine kinase CprS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105000.1 protein_id gnl|my_center|LOCUS_20470 334312 331931 gene locus_tag LOCUS_20480 334312 331931 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115638.1 protein_id gnl|my_center|LOCUS_20480 335230 334325 gene locus_tag LOCUS_20490 335230 334325 CDS product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004350939.1 protein_id gnl|my_center|LOCUS_20490 336969 335602 gene locus_tag LOCUS_20500 336969 335602 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_20500 338992 337028 gene locus_tag LOCUS_20510 338992 337028 CDS product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104994.1 protein_id gnl|my_center|LOCUS_20510 342096 339439 gene locus_tag LOCUS_20520 gene pepN 342096 339439 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_20520 342948 342115 gene locus_tag LOCUS_20530 342948 342115 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104990.1 protein_id gnl|my_center|LOCUS_20530 343211 342948 gene locus_tag LOCUS_20540 343211 342948 CDS product YeaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104989.1 protein_id gnl|my_center|LOCUS_20540 344155 343295 gene locus_tag LOCUS_20550 344155 343295 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104987.1 protein_id gnl|my_center|LOCUS_20550 345132 344152 gene locus_tag LOCUS_20560 345132 344152 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091336.1 protein_id gnl|my_center|LOCUS_20560 346019 345132 gene locus_tag LOCUS_20570 346019 345132 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091343.1 protein_id gnl|my_center|LOCUS_20570 346144 347109 gene locus_tag LOCUS_20580 346144 347109 CDS product DUF1853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113939.1 protein_id gnl|my_center|LOCUS_20580 348009 347110 gene locus_tag LOCUS_20590 348009 347110 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091346.1 protein_id gnl|my_center|LOCUS_20590 349450 348047 gene locus_tag LOCUS_20600 349450 348047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119759.1 protein_id gnl|my_center|LOCUS_20600 351862 349823 gene locus_tag LOCUS_20610 351862 349823 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113937.1 protein_id gnl|my_center|LOCUS_20610 352077 353195 gene locus_tag LOCUS_20620 352077 353195 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113936.1 protein_id gnl|my_center|LOCUS_20620 353192 354229 gene locus_tag LOCUS_20630 353192 354229 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113935.1 protein_id gnl|my_center|LOCUS_20630 354593 354517 gene locus_tag LOCUS_t00170 354593 354517 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 354784 354708 gene locus_tag LOCUS_t00180 354784 354708 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence06 <1 625 gene locus_tag LOCUS_20640 <1 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895694.1:tetratricopeptide repeat protein 1596 688 gene locus_tag LOCUS_20650 1596 688 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095930.1 protein_id gnl|my_center|LOCUS_20650 1709 2959 gene locus_tag LOCUS_20660 1709 2959 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095928.1 protein_id gnl|my_center|LOCUS_20660 2985 3335 gene locus_tag LOCUS_20670 2985 3335 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095925.1 protein_id gnl|my_center|LOCUS_20670 3378 4277 gene locus_tag LOCUS_20680 3378 4277 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115039.1 protein_id gnl|my_center|LOCUS_20680 4758 4282 gene locus_tag LOCUS_20690 4758 4282 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095920.1 protein_id gnl|my_center|LOCUS_20690 4940 5911 gene locus_tag LOCUS_20700 gene pip 4940 5911 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095918.1 protein_id gnl|my_center|LOCUS_20700 5908 6345 gene locus_tag LOCUS_20710 gene dtd 5908 6345 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103447.1 protein_id gnl|my_center|LOCUS_20710 6802 8379 gene locus_tag LOCUS_20720 6802 8379 CDS product glucan biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095915.1 protein_id gnl|my_center|LOCUS_20720 8372 10957 gene locus_tag LOCUS_20730 gene mdoH 8372 10957 CDS product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103448.1 protein_id gnl|my_center|LOCUS_20730 11195 11995 gene locus_tag LOCUS_20740 11195 11995 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095910.1 protein_id gnl|my_center|LOCUS_20740 12061 13023 gene locus_tag LOCUS_20750 12061 13023 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103450.1 protein_id gnl|my_center|LOCUS_20750 13016 13750 gene locus_tag LOCUS_20760 13016 13750 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095906.1 protein_id gnl|my_center|LOCUS_20760 14219 13758 gene locus_tag LOCUS_20770 14219 13758 CDS product UPF0158 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095904.1 protein_id gnl|my_center|LOCUS_20770 16272 14329 gene locus_tag LOCUS_20780 16272 14329 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115040.1 protein_id gnl|my_center|LOCUS_20780 17191 16484 gene locus_tag LOCUS_20790 17191 16484 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095898.1 protein_id gnl|my_center|LOCUS_20790 17991 17188 gene locus_tag LOCUS_20800 gene tatC 17991 17188 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115041.1 protein_id gnl|my_center|LOCUS_20800 18413 17988 gene locus_tag LOCUS_20810 18413 17988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 18675 18427 gene locus_tag LOCUS_20820 18675 18427 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095893.1 protein_id gnl|my_center|LOCUS_20820 19036 18701 gene locus_tag LOCUS_20830 19036 18701 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103458.1 protein_id gnl|my_center|LOCUS_20830 19433 19029 gene locus_tag LOCUS_20840 gene hisI 19433 19029 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095888.1 protein_id gnl|my_center|LOCUS_20840 21150 19549 gene locus_tag LOCUS_20850 gene ubiB 21150 19549 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095885.1 protein_id gnl|my_center|LOCUS_20850 21773 21147 gene locus_tag LOCUS_20860 21773 21147 CDS product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115043.1 protein_id gnl|my_center|LOCUS_20860 22558 21788 gene locus_tag LOCUS_20870 gene ubiE 22558 21788 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103462.1 protein_id gnl|my_center|LOCUS_20870 22694 22969 gene locus_tag LOCUS_20880 22694 22969 CDS product polyhydroxyalkanoic acid system family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095874.1 protein_id gnl|my_center|LOCUS_20880 23113 23529 gene locus_tag LOCUS_20890 23113 23529 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103463.1 protein_id gnl|my_center|LOCUS_20890 23540 24469 gene locus_tag LOCUS_20900 23540 24469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20900 25130 24513 gene locus_tag LOCUS_20910 25130 24513 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103292.1 protein_id gnl|my_center|LOCUS_20910 26868 25186 gene locus_tag LOCUS_20920 gene phaC 26868 25186 CDS product class II poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115652.1 protein_id gnl|my_center|LOCUS_20920 28029 27172 gene locus_tag LOCUS_20930 gene phaZ 28029 27172 CDS product poly(3-hydroxyalkanoate) depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095866.1 protein_id gnl|my_center|LOCUS_20930 29861 28182 gene locus_tag LOCUS_20940 gene phaC 29861 28182 CDS product class II poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095864.1 protein_id gnl|my_center|LOCUS_20940 30651 30280 gene locus_tag LOCUS_20950 30651 30280 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095857.1 protein_id gnl|my_center|LOCUS_20950 32089 30746 gene locus_tag LOCUS_20960 gene hslU 32089 30746 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095854.1 protein_id gnl|my_center|LOCUS_20960 32651 32118 gene locus_tag LOCUS_20970 gene hslV 32651 32118 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095852.1 protein_id gnl|my_center|LOCUS_20970 33465 32770 gene locus_tag LOCUS_20980 33465 32770 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095850.1 protein_id gnl|my_center|LOCUS_20980 35263 33500 gene locus_tag LOCUS_20990 gene argS 35263 33500 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110892.1 protein_id gnl|my_center|LOCUS_20990 37732 35513 gene locus_tag LOCUS_21000 37732 35513 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095847.1 protein_id gnl|my_center|LOCUS_21000 37908 38123 gene locus_tag LOCUS_21010 gene rpmE 37908 38123 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095846.1 protein_id gnl|my_center|LOCUS_21010 38183 38950 gene locus_tag LOCUS_21020 38183 38950 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103280.1 protein_id gnl|my_center|LOCUS_21020 38947 40386 gene locus_tag LOCUS_21030 38947 40386 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095844.1 protein_id gnl|my_center|LOCUS_21030 40489 41757 gene locus_tag LOCUS_21040 40489 41757 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103278.1 protein_id gnl|my_center|LOCUS_21040 44333 41862 gene locus_tag LOCUS_21050 44333 41862 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114576.1 protein_id gnl|my_center|LOCUS_21050 44551 45582 gene locus_tag LOCUS_21060 gene pilM 44551 45582 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110888.1 protein_id gnl|my_center|LOCUS_21060 45582 46178 gene locus_tag LOCUS_21070 gene pilN 45582 46178 CDS product type 4a pilus biogenesis protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_21070 46175 46798 gene locus_tag LOCUS_21080 gene pilO 46175 46798 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_21080 46795 47319 gene locus_tag LOCUS_21090 gene pilP 46795 47319 CDS product type 4a pilus biogenesis lipoprotein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 protein_id gnl|my_center|LOCUS_21090 47373 49517 gene locus_tag LOCUS_21100 gene pilQ 47373 49517 CDS product type 4a pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114575.1 protein_id gnl|my_center|LOCUS_21100 49529 50047 gene locus_tag LOCUS_21110 gene aroK 49529 50047 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095833.1 protein_id gnl|my_center|LOCUS_21110 50097 51203 gene locus_tag LOCUS_21120 gene aroB 50097 51203 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114574.1 protein_id gnl|my_center|LOCUS_21120 51210 52859 gene locus_tag LOCUS_21130 51210 52859 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148292.1 protein_id gnl|my_center|LOCUS_21130 53084 57529 gene locus_tag LOCUS_21140 gene gltB 53084 57529 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103700.1 protein_id gnl|my_center|LOCUS_21140 57558 58991 gene locus_tag LOCUS_21150 57558 58991 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095829.1 protein_id gnl|my_center|LOCUS_21150 59168 60235 gene locus_tag LOCUS_21160 gene hemE 59168 60235 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114569.1 protein_id gnl|my_center|LOCUS_21160 61336 60356 gene locus_tag LOCUS_21170 61336 60356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114568.1 protein_id gnl|my_center|LOCUS_21170 62483 61410 gene locus_tag LOCUS_21180 62483 61410 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114567.1 protein_id gnl|my_center|LOCUS_21180 62595 63524 gene locus_tag LOCUS_21190 62595 63524 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114566.1 protein_id gnl|my_center|LOCUS_21190 64868 63552 gene locus_tag LOCUS_21200 64868 63552 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095819.1 protein_id gnl|my_center|LOCUS_21200 65044 65949 gene locus_tag LOCUS_21210 65044 65949 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095817.1 protein_id gnl|my_center|LOCUS_21210 66040 66807 gene locus_tag LOCUS_21220 66040 66807 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103688.1 protein_id gnl|my_center|LOCUS_21220 67644 66829 gene locus_tag LOCUS_21230 67644 66829 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095811.1 protein_id gnl|my_center|LOCUS_21230 68209 67757 gene locus_tag LOCUS_21240 68209 67757 CDS product YiiD C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114565.1 protein_id gnl|my_center|LOCUS_21240 69577 68300 gene locus_tag LOCUS_21250 69577 68300 CDS product bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114564.1 protein_id gnl|my_center|LOCUS_21250 70672 69698 gene locus_tag LOCUS_21260 70672 69698 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148287.1 protein_id gnl|my_center|LOCUS_21260 72283 70823 gene locus_tag LOCUS_21270 72283 70823 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114563.1 protein_id gnl|my_center|LOCUS_21270 75706 72350 gene locus_tag LOCUS_21280 gene mscK 75706 72350 CDS product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103675.1 protein_id gnl|my_center|LOCUS_21280 77540 75798 gene locus_tag LOCUS_21290 77540 75798 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114562.1 protein_id gnl|my_center|LOCUS_21290 79635 77833 gene locus_tag LOCUS_21300 79635 77833 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114561.1 protein_id gnl|my_center|LOCUS_21300 79537 79728 gene locus_tag LOCUS_21310 79537 79728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 79937 80773 gene locus_tag LOCUS_21320 79937 80773 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114560.1 protein_id gnl|my_center|LOCUS_21320 81424 80777 gene locus_tag LOCUS_21330 gene msrA 81424 80777 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095789.1 protein_id gnl|my_center|LOCUS_21330 84217 81518 gene locus_tag LOCUS_21340 gene dipA 84217 81518 CDS product phosphodiesterase DipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114559.1 protein_id gnl|my_center|LOCUS_21340 86278 84635 gene locus_tag LOCUS_21350 gene aceF 86278 84635 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115359.1 protein_id gnl|my_center|LOCUS_21350 89071 86423 gene locus_tag LOCUS_21360 gene aceE 89071 86423 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114556.1 protein_id gnl|my_center|LOCUS_21360 89353 92301 gene locus_tag LOCUS_21370 gene glnE 89353 92301 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114555.1 protein_id gnl|my_center|LOCUS_21370 92357 93280 gene locus_tag LOCUS_21380 gene ilvE 92357 93280 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095783.1 protein_id gnl|my_center|LOCUS_21380 93340 94377 gene locus_tag LOCUS_21390 gene waaF 93340 94377 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109905.1 protein_id gnl|my_center|LOCUS_21390 94374 95441 gene locus_tag LOCUS_21400 gene waaC 94374 95441 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095779.1 protein_id gnl|my_center|LOCUS_21400 95438 96559 gene locus_tag LOCUS_21410 95438 96559 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114554.1 protein_id gnl|my_center|LOCUS_21410 96556 97362 gene locus_tag LOCUS_21420 gene rfaP 96556 97362 CDS product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114553.1 protein_id gnl|my_center|LOCUS_21420 97362 98096 gene locus_tag LOCUS_21430 97362 98096 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095773.1 protein_id gnl|my_center|LOCUS_21430 98093 98851 gene locus_tag LOCUS_21440 98093 98851 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095770.1 protein_id gnl|my_center|LOCUS_21440 98848 100326 gene locus_tag LOCUS_21450 98848 100326 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114552.1 protein_id gnl|my_center|LOCUS_21450 100430 102187 gene locus_tag LOCUS_21460 100430 102187 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114551.1 protein_id gnl|my_center|LOCUS_21460 102171 103307 gene locus_tag LOCUS_21470 102171 103307 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109898.1 protein_id gnl|my_center|LOCUS_21470 103301 104197 gene locus_tag LOCUS_21480 103301 104197 CDS product antimicrobial resistance protein Mig-14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114550.1 protein_id gnl|my_center|LOCUS_21480 104201 105619 gene locus_tag LOCUS_21490 104201 105619 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114549.1 protein_id gnl|my_center|LOCUS_21490 105692 106648 gene locus_tag LOCUS_21500 105692 106648 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114548.1 protein_id gnl|my_center|LOCUS_21500 106809 107693 gene locus_tag LOCUS_21510 gene wapR 106809 107693 CDS product alpha-1,3-rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114547.1 protein_id gnl|my_center|LOCUS_21510 108917 107712 gene locus_tag LOCUS_21520 gene waaL 108917 107712 CDS product O-antigen ligase WaaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114546.1 protein_id gnl|my_center|LOCUS_21520 109575 108925 gene locus_tag LOCUS_21530 109575 108925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114545.1 protein_id gnl|my_center|LOCUS_21530 109683 111494 gene locus_tag LOCUS_21540 gene msbA 109683 111494 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114544.1 protein_id gnl|my_center|LOCUS_21540 111547 112959 gene locus_tag LOCUS_21550 gene hldE 111547 112959 CDS product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095747.1 protein_id gnl|my_center|LOCUS_21550 113093 114376 gene locus_tag LOCUS_21560 113093 114376 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123588.1 protein_id gnl|my_center|LOCUS_21560 114425 115633 gene locus_tag LOCUS_21570 114425 115633 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095742.1 protein_id gnl|my_center|LOCUS_21570 116578 115658 gene locus_tag LOCUS_21580 116578 115658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114542.1 protein_id gnl|my_center|LOCUS_21580 117559 116747 gene locus_tag LOCUS_21590 117559 116747 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114541.1 protein_id gnl|my_center|LOCUS_21590 118731 117556 gene locus_tag LOCUS_21600 118731 117556 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114540.1 protein_id gnl|my_center|LOCUS_21600 119124 118792 gene locus_tag LOCUS_21610 119124 118792 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095735.1 protein_id gnl|my_center|LOCUS_21610 119209 120093 gene locus_tag LOCUS_21620 119209 120093 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114539.1 protein_id gnl|my_center|LOCUS_21620 120129 121406 gene locus_tag LOCUS_21630 gene waaA 120129 121406 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 protein_id gnl|my_center|LOCUS_21630 122054 121455 gene locus_tag LOCUS_21640 122054 121455 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095727.1 protein_id gnl|my_center|LOCUS_21640 124078 122132 gene locus_tag LOCUS_21650 124078 122132 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114537.1 protein_id gnl|my_center|LOCUS_21650 124252 125343 gene locus_tag LOCUS_21660 124252 125343 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114536.1 protein_id gnl|my_center|LOCUS_21660 125420 126067 gene locus_tag LOCUS_21670 125420 126067 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114535.1 protein_id gnl|my_center|LOCUS_21670 126185 126919 gene locus_tag LOCUS_21680 gene aruR 126185 126919 CDS product two-component system response regulator AruR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095718.1 protein_id gnl|my_center|LOCUS_21680 126923 127699 gene locus_tag LOCUS_21690 126923 127699 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070470.1 protein_id gnl|my_center|LOCUS_21690 127696 129948 gene locus_tag LOCUS_21700 127696 129948 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019372340.1 protein_id gnl|my_center|LOCUS_21700 130132 131544 gene locus_tag LOCUS_21710 130132 131544 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109880.1 protein_id gnl|my_center|LOCUS_21710 131803 132594 gene locus_tag LOCUS_21720 131803 132594 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114532.1 protein_id gnl|my_center|LOCUS_21720 132615 133775 gene locus_tag LOCUS_21730 132615 133775 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114530.1 protein_id gnl|my_center|LOCUS_21730 133842 135932 gene locus_tag LOCUS_21740 133842 135932 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114528.1 protein_id gnl|my_center|LOCUS_21740 136043 137653 gene locus_tag LOCUS_21750 136043 137653 CDS product 5-guanidino-2-oxopentanoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895690.1 protein_id gnl|my_center|LOCUS_21750 137676 138857 gene locus_tag LOCUS_21760 gene aruH 137676 138857 CDS product arginine--pyruvate transaminase AruH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102073.1 protein_id gnl|my_center|LOCUS_21760 138908 139612 gene locus_tag LOCUS_21770 138908 139612 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102071.1 protein_id gnl|my_center|LOCUS_21770 141126 139678 gene locus_tag LOCUS_21780 gene opmH 141126 139678 CDS product efflux transporter outer membrane subunit OpmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095699.1 protein_id gnl|my_center|LOCUS_21780 141579 141172 gene locus_tag LOCUS_21790 141579 141172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 141582 143465 gene locus_tag LOCUS_21800 gene thiC 141582 143465 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095696.1 protein_id gnl|my_center|LOCUS_21800 144265 143519 gene locus_tag LOCUS_21810 144265 143519 CDS product RsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102069.1 protein_id gnl|my_center|LOCUS_21810 144609 144253 gene locus_tag LOCUS_21820 144609 144253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 144508 145125 gene locus_tag LOCUS_21830 144508 145125 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095694.1 protein_id gnl|my_center|LOCUS_21830 145116 145574 gene locus_tag LOCUS_21840 145116 145574 CDS product DUF1249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102067.1 protein_id gnl|my_center|LOCUS_21840 145728 146546 gene locus_tag LOCUS_21850 gene cpdA 145728 146546 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102066.1 protein_id gnl|my_center|LOCUS_21850 146678 147298 gene locus_tag LOCUS_21860 146678 147298 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113918.1 protein_id gnl|my_center|LOCUS_21860 147310 149199 gene locus_tag LOCUS_21870 gene parE 147310 149199 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102062.1 protein_id gnl|my_center|LOCUS_21870 149199 150212 gene locus_tag LOCUS_21880 149199 150212 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095689.1 protein_id gnl|my_center|LOCUS_21880 150248 150733 gene locus_tag LOCUS_21890 150248 150733 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113919.1 protein_id gnl|my_center|LOCUS_21890 150741 153005 gene locus_tag LOCUS_21900 gene parC 150741 153005 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095687.1 protein_id gnl|my_center|LOCUS_21900 153298 154008 gene locus_tag LOCUS_21910 153298 154008 CDS product membrane integrity-associated transporter subunit PqiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113920.1 protein_id gnl|my_center|LOCUS_21910 154602 154066 gene locus_tag LOCUS_21920 154602 154066 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113921.1 protein_id gnl|my_center|LOCUS_21920 156137 154599 gene locus_tag LOCUS_21930 156137 154599 CDS product AhpA/YtjB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102052.1 protein_id gnl|my_center|LOCUS_21930 156358 157572 gene locus_tag LOCUS_21940 gene serB 156358 157572 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121162.1 protein_id gnl|my_center|LOCUS_21940 159734 157659 gene locus_tag LOCUS_21950 gene fimX 159734 157659 CDS product cyclic di-GMP-binding protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 protein_id gnl|my_center|LOCUS_21950 161622 159799 gene locus_tag LOCUS_21960 gene fimW 161622 159799 CDS product cyclic-di-GMP receptor FimW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113922.1 protein_id gnl|my_center|LOCUS_21960 162808 161939 gene locus_tag LOCUS_21970 gene asd 162808 161939 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113924.1 protein_id gnl|my_center|LOCUS_21970 163627 162812 gene locus_tag LOCUS_21980 gene rhdA 163627 162812 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113925.1 protein_id gnl|my_center|LOCUS_21980 165213 163702 gene locus_tag LOCUS_21990 165213 163702 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113926.1 protein_id gnl|my_center|LOCUS_21990 165354 166205 gene locus_tag LOCUS_22000 gene motA 165354 166205 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102044.1 protein_id gnl|my_center|LOCUS_22000 166225 167268 gene locus_tag LOCUS_22010 gene motB 166225 167268 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095673.1 protein_id gnl|my_center|LOCUS_22010 168291 167272 gene locus_tag LOCUS_22020 gene rsgA 168291 167272 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113927.1 protein_id gnl|my_center|LOCUS_22020 168403 168945 gene locus_tag LOCUS_22030 gene orn 168403 168945 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095671.1 protein_id gnl|my_center|LOCUS_22030 170064 168979 gene locus_tag LOCUS_22040 gene queG 170064 168979 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110324.1 protein_id gnl|my_center|LOCUS_22040 170146 171654 gene locus_tag LOCUS_22050 170146 171654 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148264.1 protein_id gnl|my_center|LOCUS_22050 171642 172109 gene locus_tag LOCUS_22060 gene tsaE 171642 172109 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106408.1 protein_id gnl|my_center|LOCUS_22060 172118 173545 gene locus_tag LOCUS_22070 gene amiB 172118 173545 CDS product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_22070 173545 175446 gene locus_tag LOCUS_22080 gene mutL 173545 175446 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106411.1 protein_id gnl|my_center|LOCUS_22080 175504 176475 gene locus_tag LOCUS_22090 gene miaA 175504 176475 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113929.1 protein_id gnl|my_center|LOCUS_22090 176581 176829 gene locus_tag LOCUS_22100 gene hfq 176581 176829 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095657.1 protein_id gnl|my_center|LOCUS_22100 176884 178143 gene locus_tag LOCUS_22110 gene hflX 176884 178143 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113930.1 protein_id gnl|my_center|LOCUS_22110 178238 179440 gene locus_tag LOCUS_22120 gene hflK 178238 179440 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106427.1 protein_id gnl|my_center|LOCUS_22120 179440 180309 gene locus_tag LOCUS_22130 gene hflC 179440 180309 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106429.1 protein_id gnl|my_center|LOCUS_22130 180357 180590 gene locus_tag LOCUS_22140 180357 180590 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095647.1 protein_id gnl|my_center|LOCUS_22140 180625 181809 gene locus_tag LOCUS_22150 180625 181809 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095644.1 protein_id gnl|my_center|LOCUS_22150 181861 183153 gene locus_tag LOCUS_22160 181861 183153 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095642.1 protein_id gnl|my_center|LOCUS_22160 183395 183309 gene locus_tag LOCUS_t00190 183395 183309 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 183611 183525 gene locus_tag LOCUS_t00200 183611 183525 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 183816 186530 gene locus_tag LOCUS_22170 gene rnr 183816 186530 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112282.1 protein_id gnl|my_center|LOCUS_22170 186527 187273 gene locus_tag LOCUS_22180 gene rlmB 186527 187273 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095638.1 protein_id gnl|my_center|LOCUS_22180 187488 187907 gene locus_tag LOCUS_22190 gene rpsF 187488 187907 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095636.1 protein_id gnl|my_center|LOCUS_22190 187937 188167 gene locus_tag LOCUS_22200 gene rpsR 187937 188167 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095634.1 protein_id gnl|my_center|LOCUS_22200 188204 189073 gene locus_tag LOCUS_22210 188204 189073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095630.1 protein_id gnl|my_center|LOCUS_22210 189095 189541 gene locus_tag LOCUS_22220 gene rplI 189095 189541 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095627.1 protein_id gnl|my_center|LOCUS_22220 189670 191064 gene locus_tag LOCUS_22230 gene dnaB 189670 191064 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112283.1 protein_id gnl|my_center|LOCUS_22230 191133 192209 gene locus_tag LOCUS_22240 gene alr 191133 192209 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112284.1 protein_id gnl|my_center|LOCUS_22240 194112 192211 gene locus_tag LOCUS_22250 194112 192211 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895689.1 protein_id gnl|my_center|LOCUS_22250 194317 196569 gene locus_tag LOCUS_22260 194317 196569 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100007.1 protein_id gnl|my_center|LOCUS_22260 196831 199329 gene locus_tag LOCUS_22270 196831 199329 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112286.1 protein_id gnl|my_center|LOCUS_22270 199329 200264 gene locus_tag LOCUS_22280 199329 200264 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112287.1 protein_id gnl|my_center|LOCUS_22280 200497 201366 gene locus_tag LOCUS_22290 200497 201366 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095599.1 protein_id gnl|my_center|LOCUS_22290 201553 202248 gene locus_tag LOCUS_22300 201553 202248 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112288.1 protein_id gnl|my_center|LOCUS_22300 202848 202261 gene locus_tag LOCUS_22310 202848 202261 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109460.1 protein_id gnl|my_center|LOCUS_22310 203124 203570 gene locus_tag LOCUS_22320 gene azu 203124 203570 CDS product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095591.1 protein_id gnl|my_center|LOCUS_22320 204562 203639 gene locus_tag LOCUS_22330 gene choE 204562 203639 CDS product cholinesterase ChoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100000.1 protein_id gnl|my_center|LOCUS_22330 205523 204696 gene locus_tag LOCUS_22340 gene nadE 205523 204696 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099998.1 protein_id gnl|my_center|LOCUS_22340 206751 205552 gene locus_tag LOCUS_22350 gene pncB 206751 205552 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099996.1 protein_id gnl|my_center|LOCUS_22350 207413 206754 gene locus_tag LOCUS_22360 207413 206754 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112290.1 protein_id gnl|my_center|LOCUS_22360 207523 208125 gene locus_tag LOCUS_22370 207523 208125 CDS product nicotinate-nicotinamide nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895688.1 protein_id gnl|my_center|LOCUS_22370 208140 208835 gene locus_tag LOCUS_22380 208140 208835 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112292.1 protein_id gnl|my_center|LOCUS_22380 210507 208882 gene locus_tag LOCUS_22390 210507 208882 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112293.1 protein_id gnl|my_center|LOCUS_22390 211502 210564 gene locus_tag LOCUS_22400 211502 210564 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095575.1 protein_id gnl|my_center|LOCUS_22400 212122 213246 gene locus_tag LOCUS_22410 212122 213246 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099985.1 protein_id gnl|my_center|LOCUS_22410 213481 214395 gene locus_tag LOCUS_22420 213481 214395 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095571.1 protein_id gnl|my_center|LOCUS_22420 214406 215683 gene locus_tag LOCUS_22430 gene livM 214406 215683 CDS product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099983.1 protein_id gnl|my_center|LOCUS_22430 215680 216552 gene locus_tag LOCUS_22440 215680 216552 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095566.1 protein_id gnl|my_center|LOCUS_22440 216549 217265 gene locus_tag LOCUS_22450 216549 217265 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095563.1 protein_id gnl|my_center|LOCUS_22450 217336 218268 gene locus_tag LOCUS_22460 217336 218268 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112294.1 protein_id gnl|my_center|LOCUS_22460 218553 219386 gene locus_tag LOCUS_22470 218553 219386 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095557.1 protein_id gnl|my_center|LOCUS_22470 219450 220163 gene locus_tag LOCUS_22480 219450 220163 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099978.1 protein_id gnl|my_center|LOCUS_22480 221113 220160 gene locus_tag LOCUS_22490 221113 220160 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112295.1 protein_id gnl|my_center|LOCUS_22490 222183 221128 gene locus_tag LOCUS_22500 222183 221128 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112296.1 protein_id gnl|my_center|LOCUS_22500 222561 223895 gene locus_tag LOCUS_22510 222561 223895 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112297.1 protein_id gnl|my_center|LOCUS_22510 224806 223910 gene locus_tag LOCUS_22520 224806 223910 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095545.1 protein_id gnl|my_center|LOCUS_22520 224907 226493 gene locus_tag LOCUS_22530 gene mdlC 224907 226493 CDS product benzoylformate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099962.1 protein_id gnl|my_center|LOCUS_22530 226580 227920 gene locus_tag LOCUS_22540 226580 227920 CDS product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112299.1 protein_id gnl|my_center|LOCUS_22540 227943 229412 gene locus_tag LOCUS_22550 227943 229412 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107137.1 protein_id gnl|my_center|LOCUS_22550 229520 230773 gene locus_tag LOCUS_22560 229520 230773 CDS product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121137.1 protein_id gnl|my_center|LOCUS_22560 233887 230918 gene locus_tag LOCUS_22570 233887 230918 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112301.1 protein_id gnl|my_center|LOCUS_22570 234052 234588 gene locus_tag LOCUS_22580 234052 234588 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112302.1 protein_id gnl|my_center|LOCUS_22580 234581 235603 gene locus_tag LOCUS_22590 234581 235603 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112303.1 protein_id gnl|my_center|LOCUS_22590 236192 235620 gene locus_tag LOCUS_22600 236192 235620 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112304.1 protein_id gnl|my_center|LOCUS_22600 236836 236222 gene locus_tag LOCUS_22610 gene ureG 236836 236222 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095530.1 protein_id gnl|my_center|LOCUS_22610 237518 236847 gene locus_tag LOCUS_22620 237518 236847 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095528.1 protein_id gnl|my_center|LOCUS_22620 238018 237515 gene locus_tag LOCUS_22630 gene ureE 238018 237515 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095526.1 protein_id gnl|my_center|LOCUS_22630 238877 238248 gene locus_tag LOCUS_22640 gene desT 238877 238248 CDS product TetR family transcriptional regulator DesT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107570.1 protein_id gnl|my_center|LOCUS_22640 239036 240136 gene locus_tag LOCUS_22650 239036 240136 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112305.1 protein_id gnl|my_center|LOCUS_22650 240157 241245 gene locus_tag LOCUS_22660 gene desB 240157 241245 CDS product fatty acid desaturase DesB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121132.1 protein_id gnl|my_center|LOCUS_22660 241465 242781 gene locus_tag LOCUS_22670 241465 242781 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095519.1 protein_id gnl|my_center|LOCUS_22670 244163 242772 gene locus_tag LOCUS_22680 244163 242772 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099516.1 protein_id gnl|my_center|LOCUS_22680 244831 244142 gene locus_tag LOCUS_22690 244831 244142 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095515.1 protein_id gnl|my_center|LOCUS_22690 244969 245592 gene locus_tag LOCUS_22700 244969 245592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095513.1 protein_id gnl|my_center|LOCUS_22700 245646 246260 gene locus_tag LOCUS_22710 245646 246260 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112306.1 protein_id gnl|my_center|LOCUS_22710 246257 247024 gene locus_tag LOCUS_22720 246257 247024 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112308.1 protein_id gnl|my_center|LOCUS_22720 247410 247138 gene locus_tag LOCUS_22730 247410 247138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112309.1 protein_id gnl|my_center|LOCUS_22730 248219 247686 gene locus_tag LOCUS_22740 248219 247686 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095503.1 protein_id gnl|my_center|LOCUS_22740 248515 250584 gene locus_tag LOCUS_22750 248515 250584 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112310.1 protein_id gnl|my_center|LOCUS_22750 251398 250586 gene locus_tag LOCUS_22760 gene brlR 251398 250586 CDS product c-di-GMP-binding multidrug transporter transcriptional regulator BrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095496.1 protein_id gnl|my_center|LOCUS_22760 251545 251952 gene locus_tag LOCUS_22770 251545 251952 CDS product Rho termination factor N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095492.1 protein_id gnl|my_center|LOCUS_22770 252340 251996 gene locus_tag LOCUS_22780 gene osmE 252340 251996 CDS product osmotically-inducible lipoprotein OsmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095488.1 protein_id gnl|my_center|LOCUS_22780 252968 252429 gene locus_tag LOCUS_22790 252968 252429 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064289.1 protein_id gnl|my_center|LOCUS_22790 253123 253419 gene locus_tag LOCUS_22800 253123 253419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 254859 253594 gene locus_tag LOCUS_22810 254859 253594 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099398.1 protein_id gnl|my_center|LOCUS_22810 255100 255930 gene locus_tag LOCUS_22820 255100 255930 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121125.1 protein_id gnl|my_center|LOCUS_22820 256723 256022 gene locus_tag LOCUS_22830 256723 256022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895687.1 protein_id gnl|my_center|LOCUS_22830 256792 257028 gene locus_tag LOCUS_22840 256792 257028 CDS product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112314.1 protein_id gnl|my_center|LOCUS_22840 258405 257038 gene locus_tag LOCUS_22850 258405 257038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895686.1 protein_id gnl|my_center|LOCUS_22850 260224 258524 gene locus_tag LOCUS_22860 gene ureC 260224 258524 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099392.1 protein_id gnl|my_center|LOCUS_22860 260598 260293 gene locus_tag LOCUS_22870 260598 260293 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095450.1 protein_id gnl|my_center|LOCUS_22870 261133 260615 gene locus_tag LOCUS_22880 261133 260615 CDS product L-methionine sulfoximine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099390.1 protein_id gnl|my_center|LOCUS_22880 261444 261142 gene locus_tag LOCUS_22890 261444 261142 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099389.1 protein_id gnl|my_center|LOCUS_22890 262288 261446 gene locus_tag LOCUS_22900 262288 261446 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112316.1 protein_id gnl|my_center|LOCUS_22900 262749 262297 gene locus_tag LOCUS_22910 262749 262297 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095437.1 protein_id gnl|my_center|LOCUS_22910 263531 262833 gene locus_tag LOCUS_22920 gene urtE 263531 262833 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112317.1 protein_id gnl|my_center|LOCUS_22920 264525 263668 gene locus_tag LOCUS_22930 gene urtD 264525 263668 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105136.1 protein_id gnl|my_center|LOCUS_22930 265601 264522 gene locus_tag LOCUS_22940 gene urtC 265601 264522 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112319.1 protein_id gnl|my_center|LOCUS_22940 267187 265598 gene locus_tag LOCUS_22950 gene urtB 267187 265598 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105141.1 protein_id gnl|my_center|LOCUS_22950 268599 267334 gene locus_tag LOCUS_22960 gene urtA 268599 267334 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112321.1 protein_id gnl|my_center|LOCUS_22960 269617 269024 gene locus_tag LOCUS_22970 269617 269024 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095417.1 protein_id gnl|my_center|LOCUS_22970 272782 269954 gene locus_tag LOCUS_22980 gene retS 272782 269954 CDS product hybrid sensor histidine kinase/response regulator RetS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112323.1 protein_id gnl|my_center|LOCUS_22980 274175 272886 gene locus_tag LOCUS_22990 gene purD 274175 272886 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105150.1 protein_id gnl|my_center|LOCUS_22990 275886 274279 gene locus_tag LOCUS_23000 gene purH 275886 274279 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105151.1 protein_id gnl|my_center|LOCUS_23000 276244 275966 gene locus_tag LOCUS_23010 gene fis 276244 275966 CDS product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121116.1 protein_id gnl|my_center|LOCUS_23010 277284 276286 gene locus_tag LOCUS_23020 gene dusB 277284 276286 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095402.1 protein_id gnl|my_center|LOCUS_23020 278765 277488 gene locus_tag LOCUS_23030 278765 277488 CDS product DUF3426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112325.1 protein_id gnl|my_center|LOCUS_23030 279745 278861 gene locus_tag LOCUS_23040 gene prmA 279745 278861 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112237.1 protein_id gnl|my_center|LOCUS_23040 280692 279826 gene locus_tag LOCUS_23050 280692 279826 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112326.1 protein_id gnl|my_center|LOCUS_23050 282152 280803 gene locus_tag LOCUS_23060 gene accC 282152 280803 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095391.1 protein_id gnl|my_center|LOCUS_23060 282640 282170 gene locus_tag LOCUS_23070 gene accB 282640 282170 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110495.1 protein_id gnl|my_center|LOCUS_23070 283107 282664 gene locus_tag LOCUS_23080 gene aroQ 283107 282664 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095385.1 protein_id gnl|my_center|LOCUS_23080 285026 283251 gene locus_tag LOCUS_23090 285026 283251 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112327.1 protein_id gnl|my_center|LOCUS_23090 287159 285186 gene locus_tag LOCUS_23100 gene ctpL 287159 285186 CDS product methyl-accepting chemotaxis protein CtpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112328.1 protein_id gnl|my_center|LOCUS_23100 288865 287237 gene locus_tag LOCUS_23110 gene gcbA 288865 287237 CDS product diguanylate cyclase GcbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106227.1 protein_id gnl|my_center|LOCUS_23110 289218 290288 gene locus_tag LOCUS_23120 289218 290288 CDS product DUF2333 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 protein_id gnl|my_center|LOCUS_23120 290292 290828 gene locus_tag LOCUS_23130 290292 290828 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095369.1 protein_id gnl|my_center|LOCUS_23130 291032 291403 gene locus_tag LOCUS_23140 291032 291403 CDS product translation initiation factor Sui1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112329.1 protein_id gnl|my_center|LOCUS_23140 291654 293564 gene locus_tag LOCUS_23150 gene speA 291654 293564 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095365.1 protein_id gnl|my_center|LOCUS_23150 294961 293807 gene locus_tag LOCUS_23160 294961 293807 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112330.1 protein_id gnl|my_center|LOCUS_23160 295115 297229 gene locus_tag LOCUS_23170 gene cntO 295115 297229 CDS product pseudopaline transport outer membrane protein CntO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895685.1 protein_id gnl|my_center|LOCUS_23170 297259 298050 gene locus_tag LOCUS_23180 gene cntL 297259 298050 CDS product pseudopaline biosynthesis protein CntL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112332.1 protein_id gnl|my_center|LOCUS_23180 298047 299348 gene locus_tag LOCUS_23190 gene cntM 298047 299348 CDS product pseudopaline biosynthesis dehydrogenase CntM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112333.1 protein_id gnl|my_center|LOCUS_23190 299330 300184 gene locus_tag LOCUS_23200 gene cntI 299330 300184 CDS product pseudopaline transport inner membrane protein CntI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104336.1 protein_id gnl|my_center|LOCUS_23200 300846 300229 gene locus_tag LOCUS_23210 300846 300229 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095352.1 protein_id gnl|my_center|LOCUS_23210 301077 301874 gene locus_tag LOCUS_23220 301077 301874 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095350.1 protein_id gnl|my_center|LOCUS_23220 302439 301879 gene locus_tag LOCUS_23230 302439 301879 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112334.1 protein_id gnl|my_center|LOCUS_23230 303046 302507 gene locus_tag LOCUS_23240 303046 302507 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095346.1 protein_id gnl|my_center|LOCUS_23240 303222 304622 gene locus_tag LOCUS_23250 gene lpdA 303222 304622 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095344.1 protein_id gnl|my_center|LOCUS_23250 305082 304627 gene locus_tag LOCUS_23260 305082 304627 CDS product DUF2214 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112336.1 protein_id gnl|my_center|LOCUS_23260 305207 306046 gene locus_tag LOCUS_23270 305207 306046 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112337.1 protein_id gnl|my_center|LOCUS_23270 306376 306594 gene locus_tag LOCUS_23280 306376 306594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095337.1 protein_id gnl|my_center|LOCUS_23280 306821 309532 gene locus_tag LOCUS_23290 gene mgtA 306821 309532 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112338.1 protein_id gnl|my_center|LOCUS_23290 309630 310406 gene locus_tag LOCUS_23300 309630 310406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112339.1 protein_id gnl|my_center|LOCUS_23300 310457 310666 gene locus_tag LOCUS_23310 310457 310666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104324.1 protein_id gnl|my_center|LOCUS_23310 310706 312373 gene locus_tag LOCUS_23320 310706 312373 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112340.1 protein_id gnl|my_center|LOCUS_23320 312361 312729 gene locus_tag LOCUS_23330 312361 312729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 314066 312705 gene locus_tag LOCUS_23340 314066 312705 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112342.1 protein_id gnl|my_center|LOCUS_23340 314303 314665 gene locus_tag LOCUS_23350 314303 314665 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095326.1 protein_id gnl|my_center|LOCUS_23350 314662 315636 gene locus_tag LOCUS_23360 314662 315636 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003116094.1 protein_id gnl|my_center|LOCUS_23360 315642 317069 gene locus_tag LOCUS_23370 315642 317069 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095324.1 protein_id gnl|my_center|LOCUS_23370 317464 317072 gene locus_tag LOCUS_23380 317464 317072 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123521.1 protein_id gnl|my_center|LOCUS_23380 318777 317542 gene locus_tag LOCUS_23390 318777 317542 CDS product DUF1835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112344.1 protein_id gnl|my_center|LOCUS_23390 319383 318934 gene locus_tag LOCUS_23400 319383 318934 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095321.1 protein_id gnl|my_center|LOCUS_23400 321637 319592 gene locus_tag LOCUS_23410 321637 319592 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112345.1 protein_id gnl|my_center|LOCUS_23410 321997 322926 gene locus_tag LOCUS_23420 gene lipC 321997 322926 CDS product lipase LipC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112346.1 protein_id gnl|my_center|LOCUS_23420 323234 326314 gene locus_tag LOCUS_23430 gene fdnG 323234 326314 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895684.1 transl_except (pos:323822..323824,aa:Sec) note codon on position 197 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_23430 326323 327252 gene locus_tag LOCUS_23440 gene fdxH 326323 327252 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106793.1 protein_id gnl|my_center|LOCUS_23440 327324 327950 gene locus_tag LOCUS_23450 327324 327950 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095316.1 protein_id gnl|my_center|LOCUS_23450 328083 329012 gene locus_tag LOCUS_23460 gene fdhE 328083 329012 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112347.1 protein_id gnl|my_center|LOCUS_23460 329091 330497 gene locus_tag LOCUS_23470 gene selA 329091 330497 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148232.1 protein_id gnl|my_center|LOCUS_23470 330494 332419 gene locus_tag LOCUS_23480 gene selB 330494 332419 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102294.1 protein_id gnl|my_center|LOCUS_23480 333241 332423 gene locus_tag LOCUS_23490 333241 332423 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895683.1 protein_id gnl|my_center|LOCUS_23490 333388 334794 gene locus_tag LOCUS_23500 333388 334794 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114627.1 protein_id gnl|my_center|LOCUS_23500 334843 336240 gene locus_tag LOCUS_23510 334843 336240 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102289.1 protein_id gnl|my_center|LOCUS_23510 336335 336952 gene locus_tag LOCUS_23520 336335 336952 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095305.1 protein_id gnl|my_center|LOCUS_23520 337084 337179 gene locus_tag LOCUS_t00210 337084 337179 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 338247 337207 gene locus_tag LOCUS_23530 338247 337207 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114154.1 protein_id gnl|my_center|LOCUS_23530 339539 338247 gene locus_tag LOCUS_23540 339539 338247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115206.1 protein_id gnl|my_center|LOCUS_23540 >Feature sequence07 460 1689 gene locus_tag LOCUS_23550 460 1689 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107018.1 protein_id gnl|my_center|LOCUS_23550 1698 5333 gene locus_tag LOCUS_23560 1698 5333 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114994.1 protein_id gnl|my_center|LOCUS_23560 7520 5355 gene locus_tag LOCUS_23570 gene recD 7520 5355 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114993.1 protein_id gnl|my_center|LOCUS_23570 11254 7517 gene locus_tag LOCUS_23580 gene recB 11254 7517 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115861.1 protein_id gnl|my_center|LOCUS_23580 14766 11251 gene locus_tag LOCUS_23590 gene recC 14766 11251 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010793829.1 protein_id gnl|my_center|LOCUS_23590 15490 14807 gene locus_tag LOCUS_23600 15490 14807 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110110.1 protein_id gnl|my_center|LOCUS_23600 16493 15603 gene locus_tag LOCUS_23610 16493 15603 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093799.1 protein_id gnl|my_center|LOCUS_23610 16594 17397 gene locus_tag LOCUS_23620 16594 17397 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103975.1 protein_id gnl|my_center|LOCUS_23620 17452 18657 gene locus_tag LOCUS_23630 gene chrA 17452 18657 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114990.1 protein_id gnl|my_center|LOCUS_23630 20270 18654 gene locus_tag LOCUS_23640 20270 18654 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114989.1 protein_id gnl|my_center|LOCUS_23640 20704 20955 gene locus_tag LOCUS_23650 20704 20955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 21099 22568 gene locus_tag LOCUS_23660 21099 22568 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093821.1 protein_id gnl|my_center|LOCUS_23660 25409 22638 gene locus_tag LOCUS_23670 gene pprA 25409 22638 CDS product two-component system sensor histidine kinase PprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115766.1 protein_id gnl|my_center|LOCUS_23670 25883 25419 gene locus_tag LOCUS_23680 25883 25419 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895671.1 protein_id gnl|my_center|LOCUS_23680 25989 26471 gene locus_tag LOCUS_23690 gene fppA 25989 26471 CDS product type 4b pilus Flp prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114986.1 protein_id gnl|my_center|LOCUS_23690 26592 27419 gene locus_tag LOCUS_23700 gene pprB 26592 27419 CDS product two-component response regulator PprB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114985.1 protein_id gnl|my_center|LOCUS_23700 29115 27445 gene locus_tag LOCUS_23710 gene tadG 29115 27445 CDS product type 4b pilus Flp biogenesis protein TadG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114984.1 protein_id gnl|my_center|LOCUS_23710 29424 29140 gene locus_tag LOCUS_23720 29424 29140 CDS product DUF3613 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114983.1 protein_id gnl|my_center|LOCUS_23720 30184 29447 gene locus_tag LOCUS_23730 gene tadD 30184 29447 CDS product type 4b pilus Flp biogenesis protein TadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114982.1 protein_id gnl|my_center|LOCUS_23730 31092 30181 gene locus_tag LOCUS_23740 gene tadC 31092 30181 CDS product type 4b pilus Flp biogenesis protein TadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103955.1 protein_id gnl|my_center|LOCUS_23740 31986 31102 gene locus_tag LOCUS_23750 gene tadB 31986 31102 CDS product type 4b pilus Flp biogenesis protein TadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114981.1 protein_id gnl|my_center|LOCUS_23750 33248 31983 gene locus_tag LOCUS_23760 gene tadA 33248 31983 CDS product type 4b pilus Flp biogenesis ATPase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103953.1 protein_id gnl|my_center|LOCUS_23760 34429 33245 gene locus_tag LOCUS_23770 gene tadZ 34429 33245 CDS product type 4b pilus Flp biogenesis protein TadZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093855.1 protein_id gnl|my_center|LOCUS_23770 35689 34439 gene locus_tag LOCUS_23780 gene rcpA 35689 34439 CDS product type 4b pilus Flp secretin RcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107384.1 protein_id gnl|my_center|LOCUS_23780 36614 35703 gene locus_tag LOCUS_23790 gene rcpC 36614 35703 CDS product type 4b pilus Flp biogenesis protein RcpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114980.1 protein_id gnl|my_center|LOCUS_23790 37023 37241 gene locus_tag LOCUS_23800 gene flp 37023 37241 CDS product type 4b pilus Flp major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114978.1 protein_id gnl|my_center|LOCUS_23800 37431 39329 gene locus_tag LOCUS_23810 gene pctC 37431 39329 CDS product methyl-accepting chemotaxis protein PctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148124.1 protein_id gnl|my_center|LOCUS_23810 40923 39433 gene locus_tag LOCUS_23820 40923 39433 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114975.1 protein_id gnl|my_center|LOCUS_23820 41323 43212 gene locus_tag LOCUS_23830 gene pctA 41323 43212 CDS product methyl-accepting chemotaxis protein PctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148125.1 protein_id gnl|my_center|LOCUS_23830 43530 44645 gene locus_tag LOCUS_23840 43530 44645 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101181.1 protein_id gnl|my_center|LOCUS_23840 44638 45399 gene locus_tag LOCUS_23850 44638 45399 CDS product DUF2334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112786.1 protein_id gnl|my_center|LOCUS_23850 45396 46397 gene locus_tag LOCUS_23860 45396 46397 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093885.1 protein_id gnl|my_center|LOCUS_23860 46584 46372 gene locus_tag LOCUS_23870 46584 46372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115238.1 protein_id gnl|my_center|LOCUS_23870 47485 46634 gene locus_tag LOCUS_23880 gene purU 47485 46634 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101174.1 protein_id gnl|my_center|LOCUS_23880 47745 48119 gene locus_tag LOCUS_23890 gene mvaT 47745 48119 CDS product transcriptional regulator MvaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093888.1 protein_id gnl|my_center|LOCUS_23890 49646 48204 gene locus_tag LOCUS_23900 gene sbcB 49646 48204 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123272.1 protein_id gnl|my_center|LOCUS_23900 49871 50608 gene locus_tag LOCUS_23910 49871 50608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101171.1 protein_id gnl|my_center|LOCUS_23910 50694 51443 gene locus_tag LOCUS_23920 50694 51443 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123273.1 protein_id gnl|my_center|LOCUS_23920 51440 52420 gene locus_tag LOCUS_23930 51440 52420 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112783.1 protein_id gnl|my_center|LOCUS_23930 52407 53978 gene locus_tag LOCUS_23940 52407 53978 CDS product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112782.1 protein_id gnl|my_center|LOCUS_23940 53975 55234 gene locus_tag LOCUS_23950 53975 55234 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112781.1 protein_id gnl|my_center|LOCUS_23950 55357 56238 gene locus_tag LOCUS_23960 55357 56238 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112780.1 protein_id gnl|my_center|LOCUS_23960 56235 57566 gene locus_tag LOCUS_23970 56235 57566 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112779.1 protein_id gnl|my_center|LOCUS_23970 57930 57571 gene locus_tag LOCUS_23980 57930 57571 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093898.1 protein_id gnl|my_center|LOCUS_23980 58413 57991 gene locus_tag LOCUS_23990 58413 57991 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093901.1 protein_id gnl|my_center|LOCUS_23990 58893 58516 gene locus_tag LOCUS_24000 58893 58516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120855.1 protein_id gnl|my_center|LOCUS_24000 58993 59799 gene locus_tag LOCUS_24010 58993 59799 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101159.1 protein_id gnl|my_center|LOCUS_24010 59884 60798 gene locus_tag LOCUS_24020 59884 60798 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112778.1 protein_id gnl|my_center|LOCUS_24020 60881 62332 gene locus_tag LOCUS_24030 gene pyk 60881 62332 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093930.1 protein_id gnl|my_center|LOCUS_24030 63184 62411 gene locus_tag LOCUS_24040 63184 62411 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093932.1 protein_id gnl|my_center|LOCUS_24040 64175 63249 gene locus_tag LOCUS_24050 64175 63249 CDS product iron-sulfur-binding ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112777.1 protein_id gnl|my_center|LOCUS_24050 65229 64168 gene locus_tag LOCUS_24060 65229 64168 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101151.1 protein_id gnl|my_center|LOCUS_24060 65573 67096 gene locus_tag LOCUS_24070 65573 67096 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093938.1 protein_id gnl|my_center|LOCUS_24070 68512 67193 gene locus_tag LOCUS_24080 68512 67193 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004348078.1 protein_id gnl|my_center|LOCUS_24080 68893 68585 gene locus_tag LOCUS_24090 68893 68585 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101146.1 protein_id gnl|my_center|LOCUS_24090 69495 68914 gene locus_tag LOCUS_24100 69495 68914 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120861.1 protein_id gnl|my_center|LOCUS_24100 70213 69602 gene locus_tag LOCUS_24110 70213 69602 CDS product DUF2846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101143.1 protein_id gnl|my_center|LOCUS_24110 71587 70307 gene locus_tag LOCUS_24120 71587 70307 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112774.1 protein_id gnl|my_center|LOCUS_24120 72844 71687 gene locus_tag LOCUS_24130 72844 71687 CDS product phosphatidylserine/phosphatidylglycerophosphate/cardiolipin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120863.1 protein_id gnl|my_center|LOCUS_24130 73413 72841 gene locus_tag LOCUS_24140 73413 72841 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112773.1 protein_id gnl|my_center|LOCUS_24140 74248 73478 gene locus_tag LOCUS_24150 74248 73478 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895672.1 protein_id gnl|my_center|LOCUS_24150 75832 74348 gene locus_tag LOCUS_24160 75832 74348 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115242.1 protein_id gnl|my_center|LOCUS_24160 77152 75833 gene locus_tag LOCUS_24170 77152 75833 CDS product citrate-proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112770.1 protein_id gnl|my_center|LOCUS_24170 78410 77190 gene locus_tag LOCUS_24180 78410 77190 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101134.1 protein_id gnl|my_center|LOCUS_24180 79165 78575 gene locus_tag LOCUS_24190 79165 78575 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120867.1 protein_id gnl|my_center|LOCUS_24190 79561 79226 gene locus_tag LOCUS_24200 79561 79226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093963.1 protein_id gnl|my_center|LOCUS_24200 80673 79558 gene locus_tag LOCUS_24210 80673 79558 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120868.1 protein_id gnl|my_center|LOCUS_24210 81526 80741 gene locus_tag LOCUS_24220 81526 80741 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093967.1 protein_id gnl|my_center|LOCUS_24220 82507 81611 gene locus_tag LOCUS_24230 82507 81611 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093969.1 protein_id gnl|my_center|LOCUS_24230 82710 83465 gene locus_tag LOCUS_24240 gene olsB 82710 83465 CDS product L-ornithine N(alpha)-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093970.1 protein_id gnl|my_center|LOCUS_24240 83465 84241 gene locus_tag LOCUS_24250 gene olsA 83465 84241 CDS product lyso-ornithine lipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112769.1 protein_id gnl|my_center|LOCUS_24250 85098 84238 gene locus_tag LOCUS_24260 85098 84238 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093974.1 protein_id gnl|my_center|LOCUS_24260 85634 85248 gene locus_tag LOCUS_24270 85634 85248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24270 85633 85818 gene locus_tag LOCUS_24280 85633 85818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 85962 86264 gene locus_tag LOCUS_24290 gene pyeR 85962 86264 CDS product ArsR family transcriptional repressor PyeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093978.1 protein_id gnl|my_center|LOCUS_24290 86313 87479 gene locus_tag LOCUS_24300 86313 87479 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103801.1 protein_id gnl|my_center|LOCUS_24300 87516 88568 gene locus_tag LOCUS_24310 87516 88568 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103810.1 protein_id gnl|my_center|LOCUS_24310 88870 88628 gene locus_tag LOCUS_24320 88870 88628 CDS product FeoC-like transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103812.1 protein_id gnl|my_center|LOCUS_24320 91170 88870 gene locus_tag LOCUS_24330 gene feoB 91170 88870 CDS product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112768.1 protein_id gnl|my_center|LOCUS_24330 91415 91188 gene locus_tag LOCUS_24340 gene feoA 91415 91188 CDS product ferrous iron transporter A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103819.1 protein_id gnl|my_center|LOCUS_24340 92467 91631 gene locus_tag LOCUS_24350 92467 91631 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268817.1 protein_id gnl|my_center|LOCUS_24350 92758 93021 gene locus_tag LOCUS_24360 92758 93021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103821.1 protein_id gnl|my_center|LOCUS_24360 94083 93022 gene locus_tag LOCUS_24370 94083 93022 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103823.1 protein_id gnl|my_center|LOCUS_24370 94196 95254 gene locus_tag LOCUS_24380 94196 95254 CDS product trans-acting enoyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093996.1 protein_id gnl|my_center|LOCUS_24380 96151 95255 gene locus_tag LOCUS_24390 96151 95255 CDS product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120877.1 protein_id gnl|my_center|LOCUS_24390 96255 96656 gene locus_tag LOCUS_24400 96255 96656 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112767.1 protein_id gnl|my_center|LOCUS_24400 96658 97260 gene locus_tag LOCUS_24410 96658 97260 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094003.1 protein_id gnl|my_center|LOCUS_24410 97607 98188 gene locus_tag LOCUS_24420 gene sodB 97607 98188 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094005.1 protein_id gnl|my_center|LOCUS_24420 98369 100432 gene locus_tag LOCUS_24430 gene bifA 98369 100432 CDS product cyclic-di-GMP phosphodiesterase BifA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094007.1 protein_id gnl|my_center|LOCUS_24430 101335 100433 gene locus_tag LOCUS_24440 101335 100433 CDS product GIDE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112766.1 protein_id gnl|my_center|LOCUS_24440 101909 101337 gene locus_tag LOCUS_24450 101909 101337 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 protein_id gnl|my_center|LOCUS_24450 102103 103443 gene locus_tag LOCUS_24460 102103 103443 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112765.1 protein_id gnl|my_center|LOCUS_24460 103606 105027 gene locus_tag LOCUS_24470 103606 105027 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895673.1 protein_id gnl|my_center|LOCUS_24470 105037 106101 gene locus_tag LOCUS_24480 105037 106101 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102644.1 protein_id gnl|my_center|LOCUS_24480 106112 107206 gene locus_tag LOCUS_24490 106112 107206 CDS product DUF1513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102648.1 protein_id gnl|my_center|LOCUS_24490 107376 108506 gene locus_tag LOCUS_24500 gene mexV 107376 108506 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MexV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115243.1 protein_id gnl|my_center|LOCUS_24500 108557 111613 gene locus_tag LOCUS_24510 gene mexW 108557 111613 CDS product multidrug efflux RND transporter permease subunit MexW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112762.1 protein_id gnl|my_center|LOCUS_24510 111751 112947 gene locus_tag LOCUS_24520 gene pncB 111751 112947 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102657.1 protein_id gnl|my_center|LOCUS_24520 113314 113072 gene locus_tag LOCUS_24530 113314 113072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102660.1 protein_id gnl|my_center|LOCUS_24530 114015 113311 gene locus_tag LOCUS_24540 114015 113311 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094029.1 protein_id gnl|my_center|LOCUS_24540 114701 114018 gene locus_tag LOCUS_24550 114701 114018 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094031.1 protein_id gnl|my_center|LOCUS_24550 116061 114781 gene locus_tag LOCUS_24560 116061 114781 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094037.1 protein_id gnl|my_center|LOCUS_24560 116734 116051 gene locus_tag LOCUS_24570 116734 116051 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094039.1 protein_id gnl|my_center|LOCUS_24570 116951 117745 gene locus_tag LOCUS_24580 116951 117745 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112760.1 protein_id gnl|my_center|LOCUS_24580 118017 117688 gene locus_tag LOCUS_24590 118017 117688 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425054.1 protein_id gnl|my_center|LOCUS_24590 118420 118037 gene locus_tag LOCUS_24600 gene crcB 118420 118037 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094051.1 protein_id gnl|my_center|LOCUS_24600 118649 119335 gene locus_tag LOCUS_24610 118649 119335 CDS product ParB-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102671.1 protein_id gnl|my_center|LOCUS_24610 121034 119391 gene locus_tag LOCUS_24620 gene groL 121034 119391 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094059.1 protein_id gnl|my_center|LOCUS_24620 121378 121085 gene locus_tag LOCUS_24630 121378 121085 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094064.1 protein_id gnl|my_center|LOCUS_24630 122042 121575 gene locus_tag LOCUS_24640 gene fxsA 122042 121575 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094066.1 protein_id gnl|my_center|LOCUS_24640 122812 122111 gene locus_tag LOCUS_24650 122812 122111 CDS product HugZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112758.1 protein_id gnl|my_center|LOCUS_24650 122954 123712 gene locus_tag LOCUS_24660 122954 123712 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094072.1 protein_id gnl|my_center|LOCUS_24660 124700 123771 gene locus_tag LOCUS_24670 124700 123771 CDS product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120892.1 protein_id gnl|my_center|LOCUS_24670 125861 124893 gene locus_tag LOCUS_24680 125861 124893 CDS product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120893.1 protein_id gnl|my_center|LOCUS_24680 125815 126276 gene locus_tag LOCUS_24690 125815 126276 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112757.1 protein_id gnl|my_center|LOCUS_24690 126319 128103 gene locus_tag LOCUS_24700 gene ampG 126319 128103 CDS product MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112756.1 protein_id gnl|my_center|LOCUS_24700 128995 128159 gene locus_tag LOCUS_24710 128995 128159 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895674.1 protein_id gnl|my_center|LOCUS_24710 129707 129228 gene locus_tag LOCUS_24720 129707 129228 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106526.1 protein_id gnl|my_center|LOCUS_24720 129946 130911 gene locus_tag LOCUS_24730 129946 130911 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106524.1 protein_id gnl|my_center|LOCUS_24730 130948 131859 gene locus_tag LOCUS_24740 130948 131859 CDS product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106518.1 protein_id gnl|my_center|LOCUS_24740 131910 134006 gene locus_tag LOCUS_24750 131910 134006 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106517.1 protein_id gnl|my_center|LOCUS_24750 134011 134589 gene locus_tag LOCUS_24760 134011 134589 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112755.1 protein_id gnl|my_center|LOCUS_24760 135607 134660 gene locus_tag LOCUS_24770 135607 134660 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112754.1 protein_id gnl|my_center|LOCUS_24770 136296 135661 gene locus_tag LOCUS_24780 136296 135661 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112753.1 protein_id gnl|my_center|LOCUS_24780 137634 136417 gene locus_tag LOCUS_24790 gene argJ 137634 136417 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110156.1 protein_id gnl|my_center|LOCUS_24790 140471 137781 gene locus_tag LOCUS_24800 gene secA 140471 137781 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112752.1 protein_id gnl|my_center|LOCUS_24800 141588 140665 gene locus_tag LOCUS_24810 141588 140665 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 protein_id gnl|my_center|LOCUS_24810 141669 142130 gene locus_tag LOCUS_24820 141669 142130 CDS product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120896.1 protein_id gnl|my_center|LOCUS_24820 143102 142191 gene locus_tag LOCUS_24830 gene lpxC 143102 142191 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_24830 144399 143215 gene locus_tag LOCUS_24840 gene ftsZ 144399 143215 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094113.1 protein_id gnl|my_center|LOCUS_24840 145703 144450 gene locus_tag LOCUS_24850 gene ftsA 145703 144450 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094115.1 protein_id gnl|my_center|LOCUS_24850 146588 145725 gene locus_tag LOCUS_24860 146588 145725 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094118.1 protein_id gnl|my_center|LOCUS_24860 147551 146592 gene locus_tag LOCUS_24870 147551 146592 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103113.1 protein_id gnl|my_center|LOCUS_24870 148990 147548 gene locus_tag LOCUS_24880 gene murC 148990 147548 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094121.1 protein_id gnl|my_center|LOCUS_24880 150056 148983 gene locus_tag LOCUS_24890 gene murG 150056 148983 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103107.1 protein_id gnl|my_center|LOCUS_24890 151245 150046 gene locus_tag LOCUS_24900 gene ftsW 151245 150046 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094125.1 protein_id gnl|my_center|LOCUS_24900 152591 151245 gene locus_tag LOCUS_24910 gene murD 152591 151245 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103104.1 protein_id gnl|my_center|LOCUS_24910 153687 152605 gene locus_tag LOCUS_24920 gene mraY 153687 152605 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_24920 155063 153687 gene locus_tag LOCUS_24930 155063 153687 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103103.1 protein_id gnl|my_center|LOCUS_24930 156519 155056 gene locus_tag LOCUS_24940 156519 155056 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112751.1 protein_id gnl|my_center|LOCUS_24940 158258 156519 gene locus_tag LOCUS_24950 gene ftsI 158258 156519 CDS product peptidoglycan D,D-transpeptidase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_24950 158548 158255 gene locus_tag LOCUS_24960 gene ftsL 158548 158255 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094142.1 protein_id gnl|my_center|LOCUS_24960 159486 158545 gene locus_tag LOCUS_24970 gene rsmH 159486 158545 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110151.1 protein_id gnl|my_center|LOCUS_24970 159944 159489 gene locus_tag LOCUS_24980 gene mraZ 159944 159489 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103101.1 protein_id gnl|my_center|LOCUS_24980 161473 160649 gene locus_tag LOCUS_24990 gene rsmI 161473 160649 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120901.1 protein_id gnl|my_center|LOCUS_24990 161624 163438 gene locus_tag LOCUS_25000 161624 163438 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103096.1 protein_id gnl|my_center|LOCUS_25000 163435 163812 gene locus_tag LOCUS_25010 163435 163812 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110149.1 protein_id gnl|my_center|LOCUS_25010 163841 164434 gene locus_tag LOCUS_25020 163841 164434 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094149.1 protein_id gnl|my_center|LOCUS_25020 164431 165009 gene locus_tag LOCUS_25030 164431 165009 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094151.1 protein_id gnl|my_center|LOCUS_25030 165473 165066 gene locus_tag LOCUS_25040 165473 165066 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094153.1 protein_id gnl|my_center|LOCUS_25040 166102 165485 gene locus_tag LOCUS_25050 166102 165485 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094155.1 protein_id gnl|my_center|LOCUS_25050 166970 166188 gene locus_tag LOCUS_25060 166970 166188 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094157.1 protein_id gnl|my_center|LOCUS_25060 168181 166970 gene locus_tag LOCUS_25070 168181 166970 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094159.1 protein_id gnl|my_center|LOCUS_25070 168774 168181 gene locus_tag LOCUS_25080 gene petA 168774 168181 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100631.1 protein_id gnl|my_center|LOCUS_25080 169416 169024 gene locus_tag LOCUS_25090 gene rpsI 169416 169024 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098810.1 protein_id gnl|my_center|LOCUS_25090 169859 169431 gene locus_tag LOCUS_25100 gene rplM 169859 169431 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094164.1 protein_id gnl|my_center|LOCUS_25100 170105 171142 gene locus_tag LOCUS_25110 170105 171142 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094166.1 protein_id gnl|my_center|LOCUS_25110 172363 171227 gene locus_tag LOCUS_25120 172363 171227 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_25120 172527 173525 gene locus_tag LOCUS_25130 172527 173525 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120906.1 protein_id gnl|my_center|LOCUS_25130 173684 174646 gene locus_tag LOCUS_25140 173684 174646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112749.1 protein_id gnl|my_center|LOCUS_25140 175805 174711 gene locus_tag LOCUS_25150 gene zapE 175805 174711 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094297.1 protein_id gnl|my_center|LOCUS_25150 177246 175900 gene locus_tag LOCUS_25160 177246 175900 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112748.1 protein_id gnl|my_center|LOCUS_25160 177943 177314 gene locus_tag LOCUS_25170 177943 177314 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112747.1 protein_id gnl|my_center|LOCUS_25170 178088 178534 gene locus_tag LOCUS_25180 178088 178534 CDS product YhcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094304.1 protein_id gnl|my_center|LOCUS_25180 180509 178608 gene locus_tag LOCUS_25190 gene cysN 180509 178608 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110029.1 protein_id gnl|my_center|LOCUS_25190 181438 180521 gene locus_tag LOCUS_25200 gene cysD 181438 180521 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094311.1 protein_id gnl|my_center|LOCUS_25200 181782 182885 gene locus_tag LOCUS_25210 gene mltB 181782 182885 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112746.1 protein_id gnl|my_center|LOCUS_25210 183630 182872 gene locus_tag LOCUS_25220 183630 182872 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094318.1 protein_id gnl|my_center|LOCUS_25220 183747 184916 gene locus_tag LOCUS_25230 gene algW 183747 184916 CDS product Do family serine endopeptidase AlgW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098831.1 protein_id gnl|my_center|LOCUS_25230 186014 184959 gene locus_tag LOCUS_25240 gene hisC 186014 184959 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098833.1 protein_id gnl|my_center|LOCUS_25240 187339 186017 gene locus_tag LOCUS_25250 gene hisD 187339 186017 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094326.1 protein_id gnl|my_center|LOCUS_25250 188100 187465 gene locus_tag LOCUS_25260 gene hisG 188100 187465 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098837.1 protein_id gnl|my_center|LOCUS_25260 189383 188118 gene locus_tag LOCUS_25270 gene murA 189383 188118 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094332.1 protein_id gnl|my_center|LOCUS_25270 189643 189404 gene locus_tag LOCUS_25280 189643 189404 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094334.1 protein_id gnl|my_center|LOCUS_25280 190068 189760 gene locus_tag LOCUS_25290 190068 189760 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112744.1 protein_id gnl|my_center|LOCUS_25290 190712 190065 gene locus_tag LOCUS_25300 190712 190065 CDS product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094337.1 protein_id gnl|my_center|LOCUS_25300 191197 190724 gene locus_tag LOCUS_25310 gene mlaD 191197 190724 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094339.1 protein_id gnl|my_center|LOCUS_25310 191995 191198 gene locus_tag LOCUS_25320 gene mlaE 191995 191198 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094341.1 protein_id gnl|my_center|LOCUS_25320 192804 191995 gene locus_tag LOCUS_25330 192804 191995 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094343.1 protein_id gnl|my_center|LOCUS_25330 193224 194198 gene locus_tag LOCUS_25340 gene kdsD 193224 194198 CDS product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134758.1 protein_id gnl|my_center|LOCUS_25340 194198 194737 gene locus_tag LOCUS_25350 194198 194737 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112742.1 protein_id gnl|my_center|LOCUS_25350 194746 195318 gene locus_tag LOCUS_25360 gene lptC 194746 195318 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094353.1 protein_id gnl|my_center|LOCUS_25360 195305 195832 gene locus_tag LOCUS_25370 gene lptA 195305 195832 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120916.1 protein_id gnl|my_center|LOCUS_25370 195832 196557 gene locus_tag LOCUS_25380 gene lptB 195832 196557 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094355.1 protein_id gnl|my_center|LOCUS_25380 196783 198276 gene locus_tag LOCUS_25390 196783 198276 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094357.1 protein_id gnl|my_center|LOCUS_25390 198354 198662 gene locus_tag LOCUS_25400 gene raiA 198354 198662 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094359.1 protein_id gnl|my_center|LOCUS_25400 198676 199140 gene locus_tag LOCUS_25410 gene ptsN 198676 199140 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098853.1 protein_id gnl|my_center|LOCUS_25410 199142 200002 gene locus_tag LOCUS_25420 gene rapZ 199142 200002 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094361.1 protein_id gnl|my_center|LOCUS_25420 200032 200304 gene locus_tag LOCUS_25430 200032 200304 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094362.1 protein_id gnl|my_center|LOCUS_25430 201303 200401 gene locus_tag LOCUS_25440 201303 200401 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120918.1 protein_id gnl|my_center|LOCUS_25440 201963 201352 gene locus_tag LOCUS_25450 201963 201352 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098862.1 protein_id gnl|my_center|LOCUS_25450 202425 201976 gene locus_tag LOCUS_25460 202425 201976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094369.1 protein_id gnl|my_center|LOCUS_25460 203830 202454 gene locus_tag LOCUS_25470 gene fumC 203830 202454 CDS product class II fumarate hydratase FumC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112741.1 protein_id gnl|my_center|LOCUS_25470 204218 203823 gene locus_tag LOCUS_25480 204218 203823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094374.1 protein_id gnl|my_center|LOCUS_25480 205715 204366 gene locus_tag LOCUS_25490 gene pmbA 205715 204366 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112740.1 protein_id gnl|my_center|LOCUS_25490 205736 206338 gene locus_tag LOCUS_25500 gene yjgA 205736 206338 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094378.1 protein_id gnl|my_center|LOCUS_25500 207811 206369 gene locus_tag LOCUS_25510 gene tldD 207811 206369 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098866.1 protein_id gnl|my_center|LOCUS_25510 208662 207814 gene locus_tag LOCUS_25520 208662 207814 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112739.1 protein_id gnl|my_center|LOCUS_25520 212542 208712 gene locus_tag LOCUS_25530 212542 208712 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112738.1 protein_id gnl|my_center|LOCUS_25530 214014 212557 gene locus_tag LOCUS_25540 gene rng 214014 212557 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_25540 214653 214048 gene locus_tag LOCUS_25550 214653 214048 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112737.1 protein_id gnl|my_center|LOCUS_25550 215237 214743 gene locus_tag LOCUS_25560 gene mreD 215237 214743 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094389.1 protein_id gnl|my_center|LOCUS_25560 216232 215237 gene locus_tag LOCUS_25570 gene mreC 216232 215237 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123307.1 protein_id gnl|my_center|LOCUS_25570 217346 216309 gene locus_tag LOCUS_25580 gene mreB 217346 216309 CDS product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094393.1 protein_id gnl|my_center|LOCUS_25580 217586 217876 gene locus_tag LOCUS_25590 gene gatC 217586 217876 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106543.1 protein_id gnl|my_center|LOCUS_25590 217889 219343 gene locus_tag LOCUS_25600 gene gatA 217889 219343 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112871.1 protein_id gnl|my_center|LOCUS_25600 219450 220895 gene locus_tag LOCUS_25610 gene gatB 219450 220895 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112870.1 protein_id gnl|my_center|LOCUS_25610 220955 221332 gene locus_tag LOCUS_25620 220955 221332 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112869.1 protein_id gnl|my_center|LOCUS_25620 221364 221750 gene locus_tag LOCUS_25630 221364 221750 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094405.1 protein_id gnl|my_center|LOCUS_25630 222666 221875 gene locus_tag LOCUS_25640 222666 221875 CDS product YfaP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112868.1 protein_id gnl|my_center|LOCUS_25640 224320 222671 gene locus_tag LOCUS_25650 224320 222671 CDS product DUF2300 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003455629.1 protein_id gnl|my_center|LOCUS_25650 228867 224317 gene locus_tag LOCUS_25660 gene magD 228867 224317 CDS product alpha-2-macroglobulin MagD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112866.1 protein_id gnl|my_center|LOCUS_25660 229532 228894 gene locus_tag LOCUS_25670 229532 228894 CDS product DUF1175 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112865.1 protein_id gnl|my_center|LOCUS_25670 231298 229529 gene locus_tag LOCUS_25680 231298 229529 CDS product DUF2138 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112864.1 protein_id gnl|my_center|LOCUS_25680 232146 231337 gene locus_tag LOCUS_25690 232146 231337 CDS product YfaP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094417.1 protein_id gnl|my_center|LOCUS_25690 232869 232309 gene locus_tag LOCUS_25700 232869 232309 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106283.1 protein_id gnl|my_center|LOCUS_25700 234163 232895 gene locus_tag LOCUS_25710 234163 232895 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_25710 234440 235150 gene locus_tag LOCUS_25720 234440 235150 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094423.1 protein_id gnl|my_center|LOCUS_25720 235403 237016 gene locus_tag LOCUS_25730 235403 237016 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112863.1 protein_id gnl|my_center|LOCUS_25730 237110 238708 gene locus_tag LOCUS_25740 237110 238708 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112862.1 protein_id gnl|my_center|LOCUS_25740 239993 238776 gene locus_tag LOCUS_25750 gene mdpA 239993 238776 CDS product metallopeptidase MdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107426.1 protein_id gnl|my_center|LOCUS_25750 240162 240725 gene locus_tag LOCUS_25760 gene psdR 240162 240725 CDS product transcriptional regulator PsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094433.1 protein_id gnl|my_center|LOCUS_25760 240991 242592 gene locus_tag LOCUS_25770 240991 242592 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112861.1 protein_id gnl|my_center|LOCUS_25770 242865 244271 gene locus_tag LOCUS_25780 242865 244271 CDS product OprD family outer membrane porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895675.1 protein_id gnl|my_center|LOCUS_25780 244321 245916 gene locus_tag LOCUS_25790 244321 245916 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112859.1 protein_id gnl|my_center|LOCUS_25790 245984 246994 gene locus_tag LOCUS_25800 245984 246994 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110329.1 protein_id gnl|my_center|LOCUS_25800 247006 247917 gene locus_tag LOCUS_25810 247006 247917 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112858.1 protein_id gnl|my_center|LOCUS_25810 247970 248944 gene locus_tag LOCUS_25820 247970 248944 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112857.1 protein_id gnl|my_center|LOCUS_25820 248944 249915 gene locus_tag LOCUS_25830 248944 249915 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094452.1 protein_id gnl|my_center|LOCUS_25830 250580 249948 gene locus_tag LOCUS_25840 250580 249948 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112856.1 protein_id gnl|my_center|LOCUS_25840 250722 251195 gene locus_tag LOCUS_25850 250722 251195 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112855.1 protein_id gnl|my_center|LOCUS_25850 252129 251200 gene locus_tag LOCUS_25860 252129 251200 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112854.1 protein_id gnl|my_center|LOCUS_25860 252803 252126 gene locus_tag LOCUS_25870 gene pxpB 252803 252126 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112853.1 protein_id gnl|my_center|LOCUS_25870 253555 252800 gene locus_tag LOCUS_25880 253555 252800 CDS product LamB/YcsF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112852.1 protein_id gnl|my_center|LOCUS_25880 253685 254584 gene locus_tag LOCUS_25890 gene lpxO 253685 254584 CDS product lipid A hydroxylase LpxO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094463.1 protein_id gnl|my_center|LOCUS_25890 257547 254995 gene locus_tag LOCUS_25900 257547 254995 CDS product sulfite reductase flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112851.1 protein_id gnl|my_center|LOCUS_25900 260024 257763 gene locus_tag LOCUS_25910 gene piuA 260024 257763 CDS product TonB-dependent siderophore receptor PiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112850.1 protein_id gnl|my_center|LOCUS_25910 260194 260922 gene locus_tag LOCUS_25920 260194 260922 CDS product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112849.1 protein_id gnl|my_center|LOCUS_25920 260925 261740 gene locus_tag LOCUS_25930 260925 261740 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112848.1 protein_id gnl|my_center|LOCUS_25930 261863 263665 gene locus_tag LOCUS_25940 261863 263665 CDS product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112847.1 protein_id gnl|my_center|LOCUS_25940 264146 263721 gene locus_tag LOCUS_25950 264146 263721 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094613.1 protein_id gnl|my_center|LOCUS_25950 265412 264249 gene locus_tag LOCUS_25960 265412 264249 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094617.1 protein_id gnl|my_center|LOCUS_25960 267886 265865 gene locus_tag LOCUS_25970 267886 265865 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112846.1 protein_id gnl|my_center|LOCUS_25970 268912 268076 gene locus_tag LOCUS_25980 gene ampE 268912 268076 CDS product regulatory signaling modulator protein AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112845.1 protein_id gnl|my_center|LOCUS_25980 269475 268909 gene locus_tag LOCUS_25990 gene ampD 269475 268909 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112844.1 protein_id gnl|my_center|LOCUS_25990 271881 269626 gene locus_tag LOCUS_26000 271881 269626 CDS product DUF1631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112843.1 protein_id gnl|my_center|LOCUS_26000 272167 273015 gene locus_tag LOCUS_26010 gene nadC 272167 273015 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104915.1 protein_id gnl|my_center|LOCUS_26010 273143 273068 gene locus_tag LOCUS_t00220 273143 273068 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 273641 273168 gene locus_tag LOCUS_26020 273641 273168 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 protein_id gnl|my_center|LOCUS_26020 273872 275572 gene locus_tag LOCUS_26030 gene pilB 273872 275572 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112841.1 protein_id gnl|my_center|LOCUS_26030 275576 276793 gene locus_tag LOCUS_26040 275576 276793 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103349.1 protein_id gnl|my_center|LOCUS_26040 276796 277668 gene locus_tag LOCUS_26050 gene pilD 276796 277668 CDS product type IV prepilin peptidase/methyltransferase PilD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112839.1 protein_id gnl|my_center|LOCUS_26050 277665 278276 gene locus_tag LOCUS_26060 gene coaE 277665 278276 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112838.1 protein_id gnl|my_center|LOCUS_26060 278273 278473 gene locus_tag LOCUS_26070 gene yacG 278273 278473 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094656.1 protein_id gnl|my_center|LOCUS_26070 278719 278510 gene locus_tag LOCUS_26080 278719 278510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094660.1 protein_id gnl|my_center|LOCUS_26080 279514 278825 gene locus_tag LOCUS_26090 279514 278825 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103868.1 protein_id gnl|my_center|LOCUS_26090 279981 279511 gene locus_tag LOCUS_26100 279981 279511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103866.1 protein_id gnl|my_center|LOCUS_26100 280403 279978 gene locus_tag LOCUS_26110 280403 279978 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103865.1 protein_id gnl|my_center|LOCUS_26110 280536 281165 gene locus_tag LOCUS_26120 280536 281165 CDS product DUF1780 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094668.1 protein_id gnl|my_center|LOCUS_26120 281162 281611 gene locus_tag LOCUS_26130 281162 281611 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094670.1 protein_id gnl|my_center|LOCUS_26130 281637 281807 gene locus_tag LOCUS_26140 281637 281807 CDS product DUF3094 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094672.1 protein_id gnl|my_center|LOCUS_26140 281871 283178 gene locus_tag LOCUS_26150 281871 283178 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112837.1 protein_id gnl|my_center|LOCUS_26150 284276 283218 gene locus_tag LOCUS_26160 gene zapE 284276 283218 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895676.1 protein_id gnl|my_center|LOCUS_26160 284870 286495 gene locus_tag LOCUS_26170 284870 286495 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895677.1 protein_id gnl|my_center|LOCUS_26170 286544 290743 gene locus_tag LOCUS_26180 gene tpsA4 286544 290743 CDS product two-partner secretion system exoprotein TpsA4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115288.1 protein_id gnl|my_center|LOCUS_26180 291114 291980 gene locus_tag LOCUS_26190 291114 291980 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895559.1 protein_id gnl|my_center|LOCUS_26190 >Feature sequence08 3 698 gene locus_tag LOCUS_26200 3 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 748 4701 gene locus_tag LOCUS_26210 gene tse5 748 4701 CDS product type VI secretion system effector Tse5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115323.1 protein_id gnl|my_center|LOCUS_26210 4698 4889 gene locus_tag LOCUS_26220 4698 4889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 5606 4899 gene locus_tag LOCUS_26230 5606 4899 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244148.1 protein_id gnl|my_center|LOCUS_26230 6697 5654 gene locus_tag LOCUS_26240 6697 5654 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401358.1 protein_id gnl|my_center|LOCUS_26240 8186 6708 gene locus_tag LOCUS_26250 8186 6708 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401360.1 protein_id gnl|my_center|LOCUS_26250 9463 8183 gene locus_tag LOCUS_26260 9463 8183 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401363.1 protein_id gnl|my_center|LOCUS_26260 10503 9460 gene locus_tag LOCUS_26270 10503 9460 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389818.1 protein_id gnl|my_center|LOCUS_26270 11438 10560 gene locus_tag LOCUS_26280 gene dapA 11438 10560 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401366.1 protein_id gnl|my_center|LOCUS_26280 12131 11466 gene locus_tag LOCUS_26290 12131 11466 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401368.1 protein_id gnl|my_center|LOCUS_26290 12815 12144 gene locus_tag LOCUS_26300 12815 12144 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401371.1 protein_id gnl|my_center|LOCUS_26300 13649 12828 gene locus_tag LOCUS_26310 13649 12828 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401373.1 protein_id gnl|my_center|LOCUS_26310 14561 13719 gene locus_tag LOCUS_26320 14561 13719 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401376.1 protein_id gnl|my_center|LOCUS_26320 14917 15879 gene locus_tag LOCUS_26330 14917 15879 CDS product threo-3-hydroxy-L-aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090528.1 protein_id gnl|my_center|LOCUS_26330 17128 15887 gene locus_tag LOCUS_26340 17128 15887 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113399.1 protein_id gnl|my_center|LOCUS_26340 18240 17311 gene locus_tag LOCUS_26350 18240 17311 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113398.1 protein_id gnl|my_center|LOCUS_26350 19237 18263 gene locus_tag LOCUS_26360 19237 18263 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113397.1 protein_id gnl|my_center|LOCUS_26360 19463 20215 gene locus_tag LOCUS_26370 19463 20215 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113396.1 protein_id gnl|my_center|LOCUS_26370 20805 21608 gene locus_tag LOCUS_26380 20805 21608 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097732.1 protein_id gnl|my_center|LOCUS_26380 21598 23325 gene locus_tag LOCUS_26390 21598 23325 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113395.1 protein_id gnl|my_center|LOCUS_26390 23330 24517 gene locus_tag LOCUS_26400 23330 24517 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110091.1 protein_id gnl|my_center|LOCUS_26400 24571 25005 gene locus_tag LOCUS_26410 gene gspG 24571 25005 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110089.1 protein_id gnl|my_center|LOCUS_26410 24974 25384 gene locus_tag LOCUS_26420 24974 25384 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113394.1 protein_id gnl|my_center|LOCUS_26420 25384 25809 gene locus_tag LOCUS_26430 25384 25809 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113393.1 protein_id gnl|my_center|LOCUS_26430 25806 26396 gene locus_tag LOCUS_26440 25806 26396 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113392.1 protein_id gnl|my_center|LOCUS_26440 26452 27465 gene locus_tag LOCUS_26450 26452 27465 CDS product type II secretion system protein GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119955.1 protein_id gnl|my_center|LOCUS_26450 27509 28495 gene locus_tag LOCUS_26460 27509 28495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113390.1 protein_id gnl|my_center|LOCUS_26460 28495 29079 gene locus_tag LOCUS_26470 28495 29079 CDS product GspMb/PilO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097715.1 protein_id gnl|my_center|LOCUS_26470 29322 29639 gene locus_tag LOCUS_26480 29322 29639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 30068 29715 gene locus_tag LOCUS_26490 gene mvaU 30068 29715 CDS product transcriptional regulator MvaU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090506.1 protein_id gnl|my_center|LOCUS_26490 30783 30376 gene locus_tag LOCUS_26500 gene queD 30783 30376 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090505.1 protein_id gnl|my_center|LOCUS_26500 32386 30833 gene locus_tag LOCUS_26510 gene norR 32386 30833 CDS product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113388.1 protein_id gnl|my_center|LOCUS_26510 32541 33722 gene locus_tag LOCUS_26520 gene hmpA 32541 33722 CDS product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113387.1 protein_id gnl|my_center|LOCUS_26520 33777 34034 gene locus_tag LOCUS_26530 gene ppyR 33777 34034 CDS product psl/pyoverdine operon transcriptional regulator PpyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090502.1 protein_id gnl|my_center|LOCUS_26530 34021 35214 gene locus_tag LOCUS_26540 34021 35214 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122598.1 protein_id gnl|my_center|LOCUS_26540 35481 35215 gene locus_tag LOCUS_26550 35481 35215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 36358 35465 gene locus_tag LOCUS_26560 36358 35465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115327.1 protein_id gnl|my_center|LOCUS_26560 37467 36385 gene locus_tag LOCUS_26570 37467 36385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 protein_id gnl|my_center|LOCUS_26570 37682 37990 gene locus_tag LOCUS_26580 37682 37990 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090497.1 protein_id gnl|my_center|LOCUS_26580 37990 38304 gene locus_tag LOCUS_26590 37990 38304 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097704.1 protein_id gnl|my_center|LOCUS_26590 38304 38975 gene locus_tag LOCUS_26600 gene carR 38304 38975 CDS product two-component system response regulator CarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090494.1 protein_id gnl|my_center|LOCUS_26600 38972 40309 gene locus_tag LOCUS_26610 gene carS 38972 40309 CDS product two-component system sensor histidine kinase CarS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090493.1 protein_id gnl|my_center|LOCUS_26610 40400 40708 gene locus_tag LOCUS_26620 40400 40708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113384.1 protein_id gnl|my_center|LOCUS_26620 42857 40713 gene locus_tag LOCUS_26630 42857 40713 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113383.1 protein_id gnl|my_center|LOCUS_26630 43116 44441 gene locus_tag LOCUS_26640 43116 44441 CDS product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113382.1 protein_id gnl|my_center|LOCUS_26640 44558 46240 gene locus_tag LOCUS_26650 44558 46240 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895628.1 protein_id gnl|my_center|LOCUS_26650 46400 47458 gene locus_tag LOCUS_26660 46400 47458 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113380.1 protein_id gnl|my_center|LOCUS_26660 48474 47665 gene locus_tag LOCUS_26670 48474 47665 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113379.1 protein_id gnl|my_center|LOCUS_26670 50049 48589 gene locus_tag LOCUS_26680 gene nuoN 50049 48589 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090482.1 protein_id gnl|my_center|LOCUS_26680 51586 50057 gene locus_tag LOCUS_26690 gene nuoM 51586 50057 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097684.1 protein_id gnl|my_center|LOCUS_26690 53461 51614 gene locus_tag LOCUS_26700 gene nuoL 53461 51614 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097681.1 protein_id gnl|my_center|LOCUS_26700 53766 53458 gene locus_tag LOCUS_26710 gene nuoK 53766 53458 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090475.1 protein_id gnl|my_center|LOCUS_26710 54312 53812 gene locus_tag LOCUS_26720 gene nuoJ 54312 53812 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090473.1 protein_id gnl|my_center|LOCUS_26720 54872 54324 gene locus_tag LOCUS_26730 gene nuoI 54872 54324 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090467.1 protein_id gnl|my_center|LOCUS_26730 55879 54884 gene locus_tag LOCUS_26740 gene nuoH 55879 54884 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090465.1 protein_id gnl|my_center|LOCUS_26740 58593 55876 gene locus_tag LOCUS_26750 gene nuoG 58593 55876 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113377.1 protein_id gnl|my_center|LOCUS_26750 60071 58725 gene locus_tag LOCUS_26760 gene nuoF 60071 58725 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097674.1 protein_id gnl|my_center|LOCUS_26760 60568 60068 gene locus_tag LOCUS_26770 gene nuoE 60568 60068 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090460.1 protein_id gnl|my_center|LOCUS_26770 62351 60570 gene locus_tag LOCUS_26780 gene nuoC 62351 60570 CDS product NADH-quinone oxidoreductase subunit C/D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090458.1 protein_id gnl|my_center|LOCUS_26780 63109 62432 gene locus_tag LOCUS_26790 63109 62432 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090455.1 protein_id gnl|my_center|LOCUS_26790 63533 63120 gene locus_tag LOCUS_26800 63533 63120 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090452.1 protein_id gnl|my_center|LOCUS_26800 64648 64133 gene locus_tag LOCUS_26810 64648 64133 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122604.1 protein_id gnl|my_center|LOCUS_26810 66784 64766 gene locus_tag LOCUS_26820 66784 64766 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113374.1 protein_id gnl|my_center|LOCUS_26820 68558 66963 gene locus_tag LOCUS_26830 68558 66963 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113373.1 protein_id gnl|my_center|LOCUS_26830 69974 69153 gene locus_tag LOCUS_26840 69974 69153 CDS product secretin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090446.1 protein_id gnl|my_center|LOCUS_26840 70591 69971 gene locus_tag LOCUS_26850 70591 69971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113372.1 protein_id gnl|my_center|LOCUS_26850 71023 70598 gene locus_tag LOCUS_26860 71023 70598 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090444.1 protein_id gnl|my_center|LOCUS_26860 72185 71016 gene locus_tag LOCUS_26870 72185 71016 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097663.1 protein_id gnl|my_center|LOCUS_26870 73615 72245 gene locus_tag LOCUS_26880 gene purB 73615 72245 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113371.1 protein_id gnl|my_center|LOCUS_26880 74581 73691 gene locus_tag LOCUS_26890 74581 73691 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097658.1 protein_id gnl|my_center|LOCUS_26890 75204 74584 gene locus_tag LOCUS_26900 gene hflD 75204 74584 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090440.1 protein_id gnl|my_center|LOCUS_26900 76328 75201 gene locus_tag LOCUS_26910 gene mnmA 76328 75201 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131114.1 protein_id gnl|my_center|LOCUS_26910 76842 76372 gene locus_tag LOCUS_26920 76842 76372 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097654.1 protein_id gnl|my_center|LOCUS_26920 79154 76929 gene locus_tag LOCUS_26930 79154 76929 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113369.1 protein_id gnl|my_center|LOCUS_26930 79513 80769 gene locus_tag LOCUS_26940 gene icd 79513 80769 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090436.1 protein_id gnl|my_center|LOCUS_26940 81114 80842 gene locus_tag LOCUS_26950 81114 80842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 81340 81708 gene locus_tag LOCUS_26960 gene clpS 81340 81708 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097649.1 protein_id gnl|my_center|LOCUS_26960 81736 84012 gene locus_tag LOCUS_26970 gene clpA 81736 84012 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090432.1 protein_id gnl|my_center|LOCUS_26970 84312 84094 gene locus_tag LOCUS_26980 gene infA 84312 84094 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553999.1 protein_id gnl|my_center|LOCUS_26980 85124 84417 gene locus_tag LOCUS_26990 85124 84417 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108766.1 protein_id gnl|my_center|LOCUS_26990 85859 85179 gene locus_tag LOCUS_27000 gene aat 85859 85179 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113368.1 protein_id gnl|my_center|LOCUS_27000 86847 85897 gene locus_tag LOCUS_27010 gene trxB 86847 85897 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097640.1 protein_id gnl|my_center|LOCUS_27010 87096 89510 gene locus_tag LOCUS_27020 gene ftsK 87096 89510 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895627.1 protein_id gnl|my_center|LOCUS_27020 89536 90162 gene locus_tag LOCUS_27030 gene lolA 89536 90162 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090414.1 protein_id gnl|my_center|LOCUS_27030 90172 91497 gene locus_tag LOCUS_27040 90172 91497 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_27040 91619 92899 gene locus_tag LOCUS_27050 gene serS 91619 92899 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097631.1 protein_id gnl|my_center|LOCUS_27050 92901 94298 gene locus_tag LOCUS_27060 gene cysG 92901 94298 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113366.1 protein_id gnl|my_center|LOCUS_27060 95277 94303 gene locus_tag LOCUS_27070 95277 94303 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097628.1 protein_id gnl|my_center|LOCUS_27070 96348 95365 gene locus_tag LOCUS_27080 96348 95365 CDS product glycosyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108776.1 protein_id gnl|my_center|LOCUS_27080 96668 96345 gene locus_tag LOCUS_27090 96668 96345 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119979.1 protein_id gnl|my_center|LOCUS_27090 96982 96677 gene locus_tag LOCUS_27100 gene tusB 96982 96677 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090391.1 protein_id gnl|my_center|LOCUS_27100 97341 96982 gene locus_tag LOCUS_27110 gene tusC 97341 96982 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090389.1 protein_id gnl|my_center|LOCUS_27110 97796 97338 gene locus_tag LOCUS_27120 gene tusD 97796 97338 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090387.1 protein_id gnl|my_center|LOCUS_27120 98512 97844 gene locus_tag LOCUS_27130 98512 97844 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090386.1 protein_id gnl|my_center|LOCUS_27130 98642 98731 gene locus_tag LOCUS_t00230 98642 98731 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 100449 98866 gene locus_tag LOCUS_27140 100449 98866 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113365.1 protein_id gnl|my_center|LOCUS_27140 101051 100446 gene locus_tag LOCUS_27150 101051 100446 CDS product 3-mercaptopropionate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113364.1 protein_id gnl|my_center|LOCUS_27150 101164 102060 gene locus_tag LOCUS_27160 101164 102060 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113363.1 protein_id gnl|my_center|LOCUS_27160 102379 103467 gene locus_tag LOCUS_27170 102379 103467 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113362.1 protein_id gnl|my_center|LOCUS_27170 103477 104421 gene locus_tag LOCUS_27180 103477 104421 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115329.1 protein_id gnl|my_center|LOCUS_27180 104431 105513 gene locus_tag LOCUS_27190 104431 105513 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113360.1 protein_id gnl|my_center|LOCUS_27190 105518 106669 gene locus_tag LOCUS_27200 105518 106669 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113359.1 protein_id gnl|my_center|LOCUS_27200 106777 107763 gene locus_tag LOCUS_27210 106777 107763 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113358.1 protein_id gnl|my_center|LOCUS_27210 107775 108731 gene locus_tag LOCUS_27220 107775 108731 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097601.1 protein_id gnl|my_center|LOCUS_27220 108867 109826 gene locus_tag LOCUS_27230 108867 109826 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113357.1 protein_id gnl|my_center|LOCUS_27230 110465 109893 gene locus_tag LOCUS_27240 gene qteE 110465 109893 CDS product quorum threshold expression protein QteE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090369.1 protein_id gnl|my_center|LOCUS_27240 111775 110672 gene locus_tag LOCUS_27250 111775 110672 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090368.1 protein_id gnl|my_center|LOCUS_27250 111928 112734 gene locus_tag LOCUS_27260 gene vqsR 111928 112734 CDS product transcriptional regulator VqsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097562.1 protein_id gnl|my_center|LOCUS_27260 112854 115508 gene locus_tag LOCUS_27270 112854 115508 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113356.1 protein_id gnl|my_center|LOCUS_27270 115519 116733 gene locus_tag LOCUS_27280 115519 116733 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113355.1 protein_id gnl|my_center|LOCUS_27280 117777 116749 gene locus_tag LOCUS_27290 117777 116749 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097554.1 protein_id gnl|my_center|LOCUS_27290 118395 119543 gene locus_tag LOCUS_27300 gene pqsH 118395 119543 CDS product 2-heptyl-3-hydroxy-4(1H)-quinolone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090354.1 protein_id gnl|my_center|LOCUS_27300 119885 120529 gene locus_tag LOCUS_27310 gene uvrY 119885 120529 CDS product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090351.1 protein_id gnl|my_center|LOCUS_27310 120530 122356 gene locus_tag LOCUS_27320 gene uvrC 120530 122356 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113354.1 protein_id gnl|my_center|LOCUS_27320 122390 122950 gene locus_tag LOCUS_27330 gene pgsA 122390 122950 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090349.1 protein_id gnl|my_center|LOCUS_27330 123019 123094 gene locus_tag LOCUS_t00240 123019 123094 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 123616 123314 gene locus_tag LOCUS_27340 123616 123314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 123953 126727 gene locus_tag LOCUS_27350 123953 126727 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122622.1 protein_id gnl|my_center|LOCUS_27350 126818 127351 gene locus_tag LOCUS_27360 126818 127351 CDS product ProQ/FINO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099002.1 protein_id gnl|my_center|LOCUS_27360 127641 127714 gene locus_tag LOCUS_t00250 127641 127714 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 129146 128106 gene locus_tag LOCUS_27370 129146 128106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113352.1 protein_id gnl|my_center|LOCUS_27370 129570 130160 gene locus_tag LOCUS_27380 129570 130160 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113351.1 protein_id gnl|my_center|LOCUS_27380 130485 131351 gene locus_tag LOCUS_27390 gene kynA 130485 131351 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120044.1 protein_id gnl|my_center|LOCUS_27390 131943 131383 gene locus_tag LOCUS_27400 131943 131383 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115331.1 protein_id gnl|my_center|LOCUS_27400 132395 131958 gene locus_tag LOCUS_27410 132395 131958 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102469.1 protein_id gnl|my_center|LOCUS_27410 132528 133427 gene locus_tag LOCUS_27420 132528 133427 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102472.1 protein_id gnl|my_center|LOCUS_27420 134092 133490 gene locus_tag LOCUS_27430 134092 133490 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113348.1 protein_id gnl|my_center|LOCUS_27430 134439 135587 gene locus_tag LOCUS_27440 gene alkB1 134439 135587 CDS product alkane 1-monooxygenase AlkB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102475.1 protein_id gnl|my_center|LOCUS_27440 135700 137307 gene locus_tag LOCUS_27450 135700 137307 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113347.1 protein_id gnl|my_center|LOCUS_27450 138661 137318 gene locus_tag LOCUS_27460 138661 137318 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102481.1 protein_id gnl|my_center|LOCUS_27460 138775 140151 gene locus_tag LOCUS_27470 138775 140151 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120048.1 protein_id gnl|my_center|LOCUS_27470 140265 140351 gene locus_tag LOCUS_t00260 140265 140351 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 140767 141135 gene locus_tag LOCUS_27480 gene lecA 140767 141135 CDS product PA-I galactophilic lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102492.1 protein_id gnl|my_center|LOCUS_27480 141410 141751 gene locus_tag LOCUS_27490 141410 141751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120049.1 protein_id gnl|my_center|LOCUS_27490 141870 142277 gene locus_tag LOCUS_27500 141870 142277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113345.1 protein_id gnl|my_center|LOCUS_27500 144099 142336 gene locus_tag LOCUS_27510 144099 142336 CDS product sensor domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113344.1 protein_id gnl|my_center|LOCUS_27510 144356 144565 gene locus_tag LOCUS_27520 144356 144565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 146216 144729 gene locus_tag LOCUS_27530 146216 144729 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115333.1 protein_id gnl|my_center|LOCUS_27530 146122 146406 gene locus_tag LOCUS_27540 146122 146406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 146573 147085 gene locus_tag LOCUS_27550 146573 147085 CDS product anti-virulence regulator CigR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090028.1 protein_id gnl|my_center|LOCUS_27550 148828 147212 gene locus_tag LOCUS_27560 gene ctpH 148828 147212 CDS product methyl-accepting chemotaxis protein CtpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895626.1 protein_id gnl|my_center|LOCUS_27560 149087 149374 gene locus_tag LOCUS_27570 149087 149374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102510.1 protein_id gnl|my_center|LOCUS_27570 149679 149449 gene locus_tag LOCUS_27580 gene srfA 149679 149449 CDS product stress response facilitator SrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090022.1 protein_id gnl|my_center|LOCUS_27580 149998 150540 gene locus_tag LOCUS_27590 149998 150540 CDS product DUF4946 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090018.1 protein_id gnl|my_center|LOCUS_27590 151582 150863 gene locus_tag LOCUS_27600 151582 150863 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102512.1 protein_id gnl|my_center|LOCUS_27600 151776 153470 gene locus_tag LOCUS_27610 151776 153470 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113337.1 protein_id gnl|my_center|LOCUS_27610 153539 154624 gene locus_tag LOCUS_27620 153539 154624 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113336.1 protein_id gnl|my_center|LOCUS_27620 154802 156469 gene locus_tag LOCUS_27630 154802 156469 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102517.1 protein_id gnl|my_center|LOCUS_27630 156489 157256 gene locus_tag LOCUS_27640 156489 157256 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102518.1 protein_id gnl|my_center|LOCUS_27640 157274 158464 gene locus_tag LOCUS_27650 157274 158464 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108823.1 protein_id gnl|my_center|LOCUS_27650 158493 159620 gene locus_tag LOCUS_27660 158493 159620 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090001.1 protein_id gnl|my_center|LOCUS_27660 160729 159737 gene locus_tag LOCUS_27670 160729 159737 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090000.1 protein_id gnl|my_center|LOCUS_27670 160843 162072 gene locus_tag LOCUS_27680 160843 162072 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089998.1 protein_id gnl|my_center|LOCUS_27680 162306 162115 gene locus_tag LOCUS_27690 162306 162115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 163306 162263 gene locus_tag LOCUS_27700 163306 162263 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104462.1 protein_id gnl|my_center|LOCUS_27700 164841 163456 gene locus_tag LOCUS_27710 164841 163456 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895625.1 protein_id gnl|my_center|LOCUS_27710 165816 164911 gene locus_tag LOCUS_27720 165816 164911 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003143867.1 protein_id gnl|my_center|LOCUS_27720 165920 166351 gene locus_tag LOCUS_27730 165920 166351 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009876549.1 protein_id gnl|my_center|LOCUS_27730 167274 166462 gene locus_tag LOCUS_27740 gene xthA 167274 166462 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104469.1 protein_id gnl|my_center|LOCUS_27740 167500 168132 gene locus_tag LOCUS_27750 167500 168132 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003139068.1 protein_id gnl|my_center|LOCUS_27750 168284 170005 gene locus_tag LOCUS_27760 168284 170005 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004343881.1 protein_id gnl|my_center|LOCUS_27760 170002 173667 gene locus_tag LOCUS_27770 170002 173667 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113331.1 protein_id gnl|my_center|LOCUS_27770 173802 174437 gene locus_tag LOCUS_27780 173802 174437 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104477.1 protein_id gnl|my_center|LOCUS_27780 174527 176287 gene locus_tag LOCUS_27790 174527 176287 CDS product bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113330.1 protein_id gnl|my_center|LOCUS_27790 176287 177636 gene locus_tag LOCUS_27800 176287 177636 CDS product phosphatase PAP2/dual specificity phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895624.1 protein_id gnl|my_center|LOCUS_27800 177629 178081 gene locus_tag LOCUS_27810 177629 178081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113328.1 protein_id gnl|my_center|LOCUS_27810 178093 178722 gene locus_tag LOCUS_27820 178093 178722 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113327.1 protein_id gnl|my_center|LOCUS_27820 178724 179659 gene locus_tag LOCUS_27830 178724 179659 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089962.1 protein_id gnl|my_center|LOCUS_27830 180885 179890 gene locus_tag LOCUS_27840 180885 179890 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113326.1 protein_id gnl|my_center|LOCUS_27840 181004 181915 gene locus_tag LOCUS_27850 181004 181915 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113325.1 protein_id gnl|my_center|LOCUS_27850 182071 183420 gene locus_tag LOCUS_27860 182071 183420 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_27860 183555 184052 gene locus_tag LOCUS_27870 gene tpx 183555 184052 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089950.1 protein_id gnl|my_center|LOCUS_27870 185326 184202 gene locus_tag LOCUS_27880 185326 184202 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113323.1 protein_id gnl|my_center|LOCUS_27880 186848 185523 gene locus_tag LOCUS_27890 186848 185523 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113322.1 protein_id gnl|my_center|LOCUS_27890 188281 186848 gene locus_tag LOCUS_27900 188281 186848 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113321.1 protein_id gnl|my_center|LOCUS_27900 188538 189818 gene locus_tag LOCUS_27910 gene muxA 188538 189818 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MuxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113320.1 protein_id gnl|my_center|LOCUS_27910 189815 192946 gene locus_tag LOCUS_27920 gene muxB 189815 192946 CDS product multidrug efflux RND transporter permease subunit MuxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089920.1 protein_id gnl|my_center|LOCUS_27920 192943 196053 gene locus_tag LOCUS_27930 gene muxC 192943 196053 CDS product multidrug efflux RND transporter permease subunit MuxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089914.1 protein_id gnl|my_center|LOCUS_27930 196050 197546 gene locus_tag LOCUS_27940 gene opmB 196050 197546 CDS product multidrug efflux RND transporter outer membrane subunit OpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089909.1 protein_id gnl|my_center|LOCUS_27940 197659 197913 gene locus_tag LOCUS_27950 197659 197913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 199340 197922 gene locus_tag LOCUS_27960 199340 197922 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113318.1 protein_id gnl|my_center|LOCUS_27960 200011 199337 gene locus_tag LOCUS_27970 200011 199337 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089900.1 protein_id gnl|my_center|LOCUS_27970 200524 201810 gene locus_tag LOCUS_27980 200524 201810 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113317.1 protein_id gnl|my_center|LOCUS_27980 201863 203317 gene locus_tag LOCUS_27990 201863 203317 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109532.1 protein_id gnl|my_center|LOCUS_27990 203340 206495 gene locus_tag LOCUS_28000 203340 206495 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115707.1 protein_id gnl|my_center|LOCUS_28000 206654 207658 gene locus_tag LOCUS_28010 206654 207658 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109534.1 protein_id gnl|my_center|LOCUS_28010 207775 209142 gene locus_tag LOCUS_28020 gene benA 207775 209142 CDS product benzoate 1,2-dioxygenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113315.1 protein_id gnl|my_center|LOCUS_28020 209139 209627 gene locus_tag LOCUS_28030 gene benB 209139 209627 CDS product benzoate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113314.1 protein_id gnl|my_center|LOCUS_28030 209661 210674 gene locus_tag LOCUS_28040 gene benC 209661 210674 CDS product benzoate 1,2-dioxygenase electron transfer component BenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109537.1 protein_id gnl|my_center|LOCUS_28040 210700 211461 gene locus_tag LOCUS_28050 210700 211461 CDS product 1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113313.1 protein_id gnl|my_center|LOCUS_28050 212489 211467 gene locus_tag LOCUS_28060 gene antC 212489 211467 CDS product anthranilate 1,2-dioxygenase electron transfer component AntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113312.1 protein_id gnl|my_center|LOCUS_28060 212999 212508 gene locus_tag LOCUS_28070 gene antB 212999 212508 CDS product anthranilate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113311.1 protein_id gnl|my_center|LOCUS_28070 214390 212996 gene locus_tag LOCUS_28080 gene antA 214390 212996 CDS product anthranilate 1,2-dioxygenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113310.1 protein_id gnl|my_center|LOCUS_28080 214707 215708 gene locus_tag LOCUS_28090 214707 215708 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113309.1 protein_id gnl|my_center|LOCUS_28090 216589 215717 gene locus_tag LOCUS_28100 216589 215717 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089870.1 protein_id gnl|my_center|LOCUS_28100 216751 217872 gene locus_tag LOCUS_28110 216751 217872 CDS product muconate cycloisomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113308.1 protein_id gnl|my_center|LOCUS_28110 217904 218194 gene locus_tag LOCUS_28120 gene catC 217904 218194 CDS product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089864.1 protein_id gnl|my_center|LOCUS_28120 218239 219171 gene locus_tag LOCUS_28130 gene catA 218239 219171 CDS product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113307.1 protein_id gnl|my_center|LOCUS_28130 219547 219329 gene locus_tag LOCUS_28140 219547 219329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089862.1 protein_id gnl|my_center|LOCUS_28140 219910 221256 gene locus_tag LOCUS_28150 219910 221256 CDS product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109544.1 protein_id gnl|my_center|LOCUS_28150 221508 222125 gene locus_tag LOCUS_28160 221508 222125 CDS product DUF2185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089860.1 protein_id gnl|my_center|LOCUS_28160 223382 222129 gene locus_tag LOCUS_28170 223382 222129 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113306.1 protein_id gnl|my_center|LOCUS_28170 223500 224840 gene locus_tag LOCUS_28180 223500 224840 CDS product leucine-rich repeat-containing protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895623.1 protein_id gnl|my_center|LOCUS_28180 224944 225111 gene locus_tag LOCUS_28190 224944 225111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089849.1 protein_id gnl|my_center|LOCUS_28190 226381 225155 gene locus_tag LOCUS_28200 226381 225155 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113304.1 protein_id gnl|my_center|LOCUS_28200 226833 226378 gene locus_tag LOCUS_28210 226833 226378 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109548.1 protein_id gnl|my_center|LOCUS_28210 227483 226851 gene locus_tag LOCUS_28220 227483 226851 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109549.1 protein_id gnl|my_center|LOCUS_28220 227611 228489 gene locus_tag LOCUS_28230 227611 228489 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089840.1 protein_id gnl|my_center|LOCUS_28230 228527 229063 gene locus_tag LOCUS_28240 228527 229063 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089838.1 protein_id gnl|my_center|LOCUS_28240 230636 229218 gene locus_tag LOCUS_28250 gene oprN 230636 229218 CDS product multidrug efflux RND transporter outer membrane subunit OprN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113303.1 protein_id gnl|my_center|LOCUS_28250 233821 230633 gene locus_tag LOCUS_28260 gene mexF 233821 230633 CDS product multidrug efflux RND transporter permease subunit MexF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089834.1 protein_id gnl|my_center|LOCUS_28260 235087 233843 gene locus_tag LOCUS_28270 gene mexE 235087 233843 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MexE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103549.1 protein_id gnl|my_center|LOCUS_28270 236232 235318 gene locus_tag LOCUS_28280 236232 235318 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895622.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28280 236453 237472 gene locus_tag LOCUS_28290 gene mexS 236453 237472 CDS product oxidoreductase MexS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113302.1 protein_id gnl|my_center|LOCUS_28290 237905 237531 gene locus_tag LOCUS_28300 237905 237531 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113301.1 protein_id gnl|my_center|LOCUS_28300 238801 237986 gene locus_tag LOCUS_28310 238801 237986 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113300.1 protein_id gnl|my_center|LOCUS_28310 239592 238828 gene locus_tag LOCUS_28320 239592 238828 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113299.1 protein_id gnl|my_center|LOCUS_28320 239690 239962 gene locus_tag LOCUS_28330 239690 239962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089816.1 protein_id gnl|my_center|LOCUS_28330 240182 239988 gene locus_tag LOCUS_28340 240182 239988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089814.1 protein_id gnl|my_center|LOCUS_28340 240506 241120 gene locus_tag LOCUS_28350 240506 241120 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113298.1 protein_id gnl|my_center|LOCUS_28350 241271 242272 gene locus_tag LOCUS_28360 241271 242272 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113297.1 protein_id gnl|my_center|LOCUS_28360 242387 243040 gene locus_tag LOCUS_28370 242387 243040 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113296.1 protein_id gnl|my_center|LOCUS_28370 243037 243912 gene locus_tag LOCUS_28380 243037 243912 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103565.1 protein_id gnl|my_center|LOCUS_28380 245410 244088 gene locus_tag LOCUS_28390 245410 244088 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103567.1 protein_id gnl|my_center|LOCUS_28390 246087 245407 gene locus_tag LOCUS_28400 246087 245407 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103570.1 protein_id gnl|my_center|LOCUS_28400 246250 248019 gene locus_tag LOCUS_28410 gene dsbD 246250 248019 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103572.1 protein_id gnl|my_center|LOCUS_28410 248019 248855 gene locus_tag LOCUS_28420 248019 248855 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089792.1 protein_id gnl|my_center|LOCUS_28420 248852 249622 gene locus_tag LOCUS_28430 gene dsbG 248852 249622 CDS product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089790.1 protein_id gnl|my_center|LOCUS_28430 249695 251029 gene locus_tag LOCUS_28440 249695 251029 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113295.1 protein_id gnl|my_center|LOCUS_28440 251922 251011 gene locus_tag LOCUS_28450 251922 251011 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113294.1 protein_id gnl|my_center|LOCUS_28450 252608 251964 gene locus_tag LOCUS_28460 gene maiA 252608 251964 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113293.1 protein_id gnl|my_center|LOCUS_28460 253967 252621 gene locus_tag LOCUS_28470 253967 252621 CDS product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113292.1 protein_id gnl|my_center|LOCUS_28470 254743 254045 gene locus_tag LOCUS_28480 254743 254045 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089781.1 protein_id gnl|my_center|LOCUS_28480 255817 254756 gene locus_tag LOCUS_28490 gene gtdA 255817 254756 CDS product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113291.1 protein_id gnl|my_center|LOCUS_28490 255942 256856 gene locus_tag LOCUS_28500 255942 256856 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089777.1 protein_id gnl|my_center|LOCUS_28500 256945 257463 gene locus_tag LOCUS_28510 256945 257463 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089775.1 protein_id gnl|my_center|LOCUS_28510 257460 258458 gene locus_tag LOCUS_28520 gene foxR 257460 258458 CDS product anti-sigma factor FoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113290.1 protein_id gnl|my_center|LOCUS_28520 258602 261064 gene locus_tag LOCUS_28530 gene foxA 258602 261064 CDS product ferrioxamine receptor FoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113289.1 protein_id gnl|my_center|LOCUS_28530 261182 262330 gene locus_tag LOCUS_28540 261182 262330 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113288.1 protein_id gnl|my_center|LOCUS_28540 262377 262901 gene locus_tag LOCUS_28550 262377 262901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089762.1 protein_id gnl|my_center|LOCUS_28550 >Feature sequence09 270 584 gene locus_tag LOCUS_28560 270 584 CDS product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061950.1 protein_id gnl|my_center|LOCUS_28560 1139 903 gene locus_tag LOCUS_28570 1139 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 1516 1866 gene locus_tag LOCUS_28580 1516 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 2210 2980 gene locus_tag LOCUS_28590 2210 2980 CDS product DUF2285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109455278.1 protein_id gnl|my_center|LOCUS_28590 3095 3379 gene locus_tag LOCUS_28600 3095 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 3430 4251 gene locus_tag LOCUS_28610 3430 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28610 4517 5155 gene locus_tag LOCUS_28620 gene parA 4517 5155 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082882.1 protein_id gnl|my_center|LOCUS_28620 5143 5415 gene locus_tag LOCUS_28630 5143 5415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082881.1 protein_id gnl|my_center|LOCUS_28630 5412 5969 gene locus_tag LOCUS_28640 5412 5969 CDS product DUF2840 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082880.1 protein_id gnl|my_center|LOCUS_28640 5966 6565 gene locus_tag LOCUS_28650 5966 6565 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533277.1 protein_id gnl|my_center|LOCUS_28650 7002 8990 gene locus_tag LOCUS_28660 7002 8990 CDS product DUF3363 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538232.1 protein_id gnl|my_center|LOCUS_28660 9592 9074 gene locus_tag LOCUS_28670 9592 9074 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920136.1 protein_id gnl|my_center|LOCUS_28670 10483 9596 gene locus_tag LOCUS_28680 10483 9596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 11207 10467 gene locus_tag LOCUS_28690 11207 10467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 12511 11348 gene locus_tag LOCUS_28700 12511 11348 CDS product ISL3-like element ISPpu12 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574636.1 protein_id gnl|my_center|LOCUS_28700 13030 12638 gene locus_tag LOCUS_28710 13030 12638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 14341 13736 gene locus_tag LOCUS_28720 14341 13736 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969419.1 protein_id gnl|my_center|LOCUS_28720 14483 15685 gene locus_tag LOCUS_28730 14483 15685 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036629.1 protein_id gnl|my_center|LOCUS_28730 15705 18872 gene locus_tag LOCUS_28740 gene oqxB 15705 18872 CDS product multidrug efflux RND transporter permease subunit OqxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705069.1 protein_id gnl|my_center|LOCUS_28740 18937 20466 gene locus_tag LOCUS_28750 gene oprN 18937 20466 CDS product multidrug efflux RND transporter outer membrane subunit OprN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113303.1 protein_id gnl|my_center|LOCUS_28750 20481 21821 gene locus_tag LOCUS_28760 20481 21821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 21918 23924 gene locus_tag LOCUS_28770 21918 23924 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533272.1 protein_id gnl|my_center|LOCUS_28770 23921 24409 gene locus_tag LOCUS_28780 23921 24409 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388569.1 protein_id gnl|my_center|LOCUS_28780 24478 25476 gene locus_tag LOCUS_28790 gene trbB 24478 25476 CDS product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388566.1 protein_id gnl|my_center|LOCUS_28790 25473 25859 gene locus_tag LOCUS_28800 25473 25859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 25856 26125 gene locus_tag LOCUS_28810 25856 26125 CDS product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026312513.1 protein_id gnl|my_center|LOCUS_28810 26136 28586 gene locus_tag LOCUS_28820 gene trbE 26136 28586 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533267.1 protein_id gnl|my_center|LOCUS_28820 28583 29326 gene locus_tag LOCUS_28830 gene trbJ 28583 29326 CDS product P-type conjugative transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533266.1 protein_id gnl|my_center|LOCUS_28830 29339 29656 gene locus_tag LOCUS_28840 29339 29656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 29653 31035 gene locus_tag LOCUS_28850 gene trbL 29653 31035 CDS product P-type conjugative transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090990.1 protein_id gnl|my_center|LOCUS_28850 31054 31758 gene locus_tag LOCUS_28860 gene trbF 31054 31758 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084433.1 protein_id gnl|my_center|LOCUS_28860 31755 32747 gene locus_tag LOCUS_28870 gene trbG 31755 32747 CDS product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090988.1 protein_id gnl|my_center|LOCUS_28870 32750 34030 gene locus_tag LOCUS_28880 32750 34030 CDS product TrbI/VirB10 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084435.1 protein_id gnl|my_center|LOCUS_28880 34027 34272 gene locus_tag LOCUS_28890 34027 34272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 34688 35977 gene locus_tag LOCUS_28900 gene pscN 34688 35977 CDS product SctN family type III secretion system ATPase PscN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113545.1 protein_id gnl|my_center|LOCUS_28900 35974 36450 gene locus_tag LOCUS_28910 gene pscO 35974 36450 CDS product type III secretion system central stalk protein PscO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087688.1 protein_id gnl|my_center|LOCUS_28910 37134 37547 gene locus_tag LOCUS_28920 37134 37547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 37544 38473 gene locus_tag LOCUS_28930 gene pscQ 37544 38473 CDS product SctQ family type III secretion system cytoplasmic ring protein PscQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114622.1 protein_id gnl|my_center|LOCUS_28930 38470 39123 gene locus_tag LOCUS_28940 gene pscR 38470 39123 CDS product SctR family type III secretion system export apparatus subunit PscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087674.1 protein_id gnl|my_center|LOCUS_28940 39126 39392 gene locus_tag LOCUS_28950 gene pscS 39126 39392 CDS product SctS family type III secretion system export apparatus subunit PscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087672.1 protein_id gnl|my_center|LOCUS_28950 39389 40177 gene locus_tag LOCUS_28960 gene pscT 39389 40177 CDS product SctT family type III secretion system export apparatus subunit PscT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114621.1 protein_id gnl|my_center|LOCUS_28960 40174 41223 gene locus_tag LOCUS_28970 gene pscU 40174 41223 CDS product SctU family type III secretion system export apparatus subunit PscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103203.1 protein_id gnl|my_center|LOCUS_28970 43431 41329 gene locus_tag LOCUS_28980 43431 41329 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114620.1 protein_id gnl|my_center|LOCUS_28980 44303 43434 gene locus_tag LOCUS_28990 44303 43434 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087664.1 protein_id gnl|my_center|LOCUS_28990 45324 44464 gene locus_tag LOCUS_29000 gene speE 45324 44464 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114619.1 protein_id gnl|my_center|LOCUS_29000 45473 46366 gene locus_tag LOCUS_29010 45473 46366 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103194.1 protein_id gnl|my_center|LOCUS_29010 46573 46382 gene locus_tag LOCUS_29020 46573 46382 CDS product PLDc N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552853.1 protein_id gnl|my_center|LOCUS_29020 47299 46622 gene locus_tag LOCUS_29030 gene mtnC 47299 46622 CDS product acireductone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147428.1 protein_id gnl|my_center|LOCUS_29030 47916 47371 gene locus_tag LOCUS_29040 47916 47371 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087656.1 protein_id gnl|my_center|LOCUS_29040 48530 47913 gene locus_tag LOCUS_29050 48530 47913 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103182.1 protein_id gnl|my_center|LOCUS_29050 49678 48527 gene locus_tag LOCUS_29060 49678 48527 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_29060 50813 49722 gene locus_tag LOCUS_29070 gene aroC 50813 49722 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087653.1 protein_id gnl|my_center|LOCUS_29070 50933 51904 gene locus_tag LOCUS_29080 50933 51904 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004349090.1 protein_id gnl|my_center|LOCUS_29080 51982 52761 gene locus_tag LOCUS_29090 51982 52761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087649.1 protein_id gnl|my_center|LOCUS_29090 53700 52786 gene locus_tag LOCUS_29100 gene prmB 53700 52786 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087648.1 protein_id gnl|my_center|LOCUS_29100 53871 54467 gene locus_tag LOCUS_29110 53871 54467 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103179.1 protein_id gnl|my_center|LOCUS_29110 54640 54960 gene locus_tag LOCUS_29120 54640 54960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087644.1 protein_id gnl|my_center|LOCUS_29120 55017 55574 gene locus_tag LOCUS_29130 55017 55574 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087642.1 protein_id gnl|my_center|LOCUS_29130 55652 56197 gene locus_tag LOCUS_29140 gene folE 55652 56197 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087639.1 protein_id gnl|my_center|LOCUS_29140 56723 56262 gene locus_tag LOCUS_29150 56723 56262 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087637.1 protein_id gnl|my_center|LOCUS_29150 56969 57349 gene locus_tag LOCUS_29160 56969 57349 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114616.1 protein_id gnl|my_center|LOCUS_29160 58366 57377 gene locus_tag LOCUS_29170 58366 57377 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114615.1 protein_id gnl|my_center|LOCUS_29170 59091 58363 gene locus_tag LOCUS_29180 59091 58363 CDS product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087627.1 protein_id gnl|my_center|LOCUS_29180 62618 59091 gene locus_tag LOCUS_29190 gene tssM 62618 59091 CDS product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114614.1 protein_id gnl|my_center|LOCUS_29190 63503 62634 gene locus_tag LOCUS_29200 gene icmH 63503 62634 CDS product type IVB secretion system protein IcmH/DotU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087622.1 protein_id gnl|my_center|LOCUS_29200 64837 63506 gene locus_tag LOCUS_29210 gene tssK 64837 63506 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114613.1 protein_id gnl|my_center|LOCUS_29210 65340 64834 gene locus_tag LOCUS_29220 gene tssJ 65340 64834 CDS product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114612.1 protein_id gnl|my_center|LOCUS_29220 66539 65346 gene locus_tag LOCUS_29230 gene tagH 66539 65346 CDS product type VI secretion system-associated FHA domain protein TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114611.1 protein_id gnl|my_center|LOCUS_29230 66697 66557 gene locus_tag LOCUS_29240 66697 66557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087614.1 protein_id gnl|my_center|LOCUS_29240 68297 66786 gene locus_tag LOCUS_29250 68297 66786 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114610.1 protein_id gnl|my_center|LOCUS_29250 70935 68308 gene locus_tag LOCUS_29260 gene tssH 70935 68308 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895579.1 protein_id gnl|my_center|LOCUS_29260 71955 70948 gene locus_tag LOCUS_29270 gene tssG 71955 70948 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114608.1 protein_id gnl|my_center|LOCUS_29270 73706 71919 gene locus_tag LOCUS_29280 gene tssF 73706 71919 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120358.1 protein_id gnl|my_center|LOCUS_29280 74033 73710 gene locus_tag LOCUS_29290 74033 73710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 74451 74044 gene locus_tag LOCUS_29300 gene tssE 74451 74044 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097809.1 protein_id gnl|my_center|LOCUS_29300 75939 74464 gene locus_tag LOCUS_29310 gene tssC 75939 74464 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087596.1 protein_id gnl|my_center|LOCUS_29310 76474 75968 gene locus_tag LOCUS_29320 gene tssB 76474 75968 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114607.1 protein_id gnl|my_center|LOCUS_29320 78066 76510 gene locus_tag LOCUS_29330 gene tssA 78066 76510 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097814.1 protein_id gnl|my_center|LOCUS_29330 79840 79238 gene locus_tag LOCUS_29340 79840 79238 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097816.1 protein_id gnl|my_center|LOCUS_29340 81062 79896 gene locus_tag LOCUS_29350 81062 79896 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114606.1 protein_id gnl|my_center|LOCUS_29350 81144 81620 gene locus_tag LOCUS_29360 81144 81620 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097819.1 protein_id gnl|my_center|LOCUS_29360 82306 81671 gene locus_tag LOCUS_29370 82306 81671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114605.1 protein_id gnl|my_center|LOCUS_29370 82537 83733 gene locus_tag LOCUS_29380 82537 83733 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087572.1 protein_id gnl|my_center|LOCUS_29380 84633 83740 gene locus_tag LOCUS_29390 84633 83740 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114604.1 protein_id gnl|my_center|LOCUS_29390 85553 84792 gene locus_tag LOCUS_29400 85553 84792 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_29400 85804 86808 gene locus_tag LOCUS_29410 85804 86808 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_29410 86951 88672 gene locus_tag LOCUS_29420 86951 88672 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114602.1 protein_id gnl|my_center|LOCUS_29420 90611 88653 gene locus_tag LOCUS_29430 90611 88653 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114601.1 protein_id gnl|my_center|LOCUS_29430 90813 91220 gene locus_tag LOCUS_29440 90813 91220 CDS product DUF5086 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087555.1 protein_id gnl|my_center|LOCUS_29440 91835 91227 gene locus_tag LOCUS_29450 91835 91227 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097831.1 protein_id gnl|my_center|LOCUS_29450 91973 92320 gene locus_tag LOCUS_29460 91973 92320 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114600.1 protein_id gnl|my_center|LOCUS_29460 93408 92299 gene locus_tag LOCUS_29470 gene mnmH 93408 92299 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087548.1 protein_id gnl|my_center|LOCUS_29470 94442 93408 gene locus_tag LOCUS_29480 gene selD 94442 93408 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087546.1 protein_id gnl|my_center|LOCUS_29480 94804 94526 gene locus_tag LOCUS_29490 94804 94526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097836.1 protein_id gnl|my_center|LOCUS_29490 94919 95956 gene locus_tag LOCUS_29500 94919 95956 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087542.1 protein_id gnl|my_center|LOCUS_29500 96565 95960 gene locus_tag LOCUS_29510 96565 95960 CDS product DUF4893 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097837.1 protein_id gnl|my_center|LOCUS_29510 97584 96676 gene locus_tag LOCUS_29520 gene glsB 97584 96676 CDS product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114599.1 protein_id gnl|my_center|LOCUS_29520 98398 97706 gene locus_tag LOCUS_29530 98398 97706 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114598.1 protein_id gnl|my_center|LOCUS_29530 101156 98499 gene locus_tag LOCUS_29540 101156 98499 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114597.1 protein_id gnl|my_center|LOCUS_29540 101815 101264 gene locus_tag LOCUS_29550 gene kdpC 101815 101264 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087529.1 protein_id gnl|my_center|LOCUS_29550 103941 101869 gene locus_tag LOCUS_29560 gene kdpB 103941 101869 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097844.1 protein_id gnl|my_center|LOCUS_29560 105647 103953 gene locus_tag LOCUS_29570 gene kdpA 105647 103953 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097846.1 protein_id gnl|my_center|LOCUS_29570 105843 105658 gene locus_tag LOCUS_29580 105843 105658 CDS product K(+)-transporting ATPase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004349068.1 protein_id gnl|my_center|LOCUS_29580 107089 105935 gene locus_tag LOCUS_29590 107089 105935 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097850.1 protein_id gnl|my_center|LOCUS_29590 108010 107144 gene locus_tag LOCUS_29600 108010 107144 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097851.1 protein_id gnl|my_center|LOCUS_29600 108252 109037 gene locus_tag LOCUS_29610 108252 109037 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114596.1 protein_id gnl|my_center|LOCUS_29610 109041 110570 gene locus_tag LOCUS_29620 109041 110570 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114595.1 protein_id gnl|my_center|LOCUS_29620 110708 111355 gene locus_tag LOCUS_29630 110708 111355 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097856.1 protein_id gnl|my_center|LOCUS_29630 111371 112645 gene locus_tag LOCUS_29640 111371 112645 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114593.1 protein_id gnl|my_center|LOCUS_29640 113764 112697 gene locus_tag LOCUS_29650 113764 112697 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114591.1 protein_id gnl|my_center|LOCUS_29650 114736 113930 gene locus_tag LOCUS_29660 114736 113930 CDS product DUF4892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097863.1 protein_id gnl|my_center|LOCUS_29660 115407 114745 gene locus_tag LOCUS_29670 115407 114745 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114590.1 protein_id gnl|my_center|LOCUS_29670 116347 115487 gene locus_tag LOCUS_29680 116347 115487 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097867.1 protein_id gnl|my_center|LOCUS_29680 117156 116344 gene locus_tag LOCUS_29690 117156 116344 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087496.1 protein_id gnl|my_center|LOCUS_29690 117899 117258 gene locus_tag LOCUS_29700 117899 117258 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120430.1 protein_id gnl|my_center|LOCUS_29700 118764 117940 gene locus_tag LOCUS_29710 118764 117940 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114248.1 protein_id gnl|my_center|LOCUS_29710 119259 118822 gene locus_tag LOCUS_29720 119259 118822 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087490.1 protein_id gnl|my_center|LOCUS_29720 120976 119309 gene locus_tag LOCUS_29730 120976 119309 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114249.1 protein_id gnl|my_center|LOCUS_29730 121567 121103 gene locus_tag LOCUS_29740 gene sixA 121567 121103 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114250.1 protein_id gnl|my_center|LOCUS_29740 121905 121564 gene locus_tag LOCUS_29750 121905 121564 CDS product DUF4389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114251.1 protein_id gnl|my_center|LOCUS_29750 122941 121919 gene locus_tag LOCUS_29760 122941 121919 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109958.1 protein_id gnl|my_center|LOCUS_29760 123092 125200 gene locus_tag LOCUS_29770 123092 125200 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114252.1 protein_id gnl|my_center|LOCUS_29770 125201 126130 gene locus_tag LOCUS_29780 125201 126130 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895578.1 protein_id gnl|my_center|LOCUS_29780 126127 128082 gene locus_tag LOCUS_29790 126127 128082 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114254.1 protein_id gnl|my_center|LOCUS_29790 128271 128786 gene locus_tag LOCUS_29800 gene fabA 128271 128786 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087475.1 protein_id gnl|my_center|LOCUS_29800 128798 130015 gene locus_tag LOCUS_29810 gene fabB 128798 130015 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_29810 130170 131795 gene locus_tag LOCUS_29820 130170 131795 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109962.1 protein_id gnl|my_center|LOCUS_29820 131901 132341 gene locus_tag LOCUS_29830 131901 132341 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087468.1 protein_id gnl|my_center|LOCUS_29830 132958 132482 gene locus_tag LOCUS_29840 132958 132482 CDS product DUF3859 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087466.1 protein_id gnl|my_center|LOCUS_29840 134061 133027 gene locus_tag LOCUS_29850 134061 133027 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097898.1 protein_id gnl|my_center|LOCUS_29850 134060 134965 gene locus_tag LOCUS_29860 134060 134965 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114256.1 protein_id gnl|my_center|LOCUS_29860 135004 135426 gene locus_tag LOCUS_29870 135004 135426 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004356487.1 protein_id gnl|my_center|LOCUS_29870 135633 136124 gene locus_tag LOCUS_29880 135633 136124 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097907.1 protein_id gnl|my_center|LOCUS_29880 136121 138367 gene locus_tag LOCUS_29890 136121 138367 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114258.1 protein_id gnl|my_center|LOCUS_29890 138417 139718 gene locus_tag LOCUS_29900 138417 139718 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114259.1 protein_id gnl|my_center|LOCUS_29900 140511 139729 gene locus_tag LOCUS_29910 140511 139729 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097919.1 protein_id gnl|my_center|LOCUS_29910 140592 141413 gene locus_tag LOCUS_29920 gene panB 140592 141413 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087450.1 protein_id gnl|my_center|LOCUS_29920 142149 141424 gene locus_tag LOCUS_29930 142149 141424 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114260.1 protein_id gnl|my_center|LOCUS_29930 144121 142217 gene locus_tag LOCUS_29940 gene htpG 144121 142217 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087446.1 protein_id gnl|my_center|LOCUS_29940 145471 144239 gene locus_tag LOCUS_29950 145471 144239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114261.1 protein_id gnl|my_center|LOCUS_29950 145954 145508 gene locus_tag LOCUS_29960 145954 145508 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072665.1 protein_id gnl|my_center|LOCUS_29960 146424 145951 gene locus_tag LOCUS_29970 146424 145951 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106488.1 protein_id gnl|my_center|LOCUS_29970 146597 146833 gene locus_tag LOCUS_29980 146597 146833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 147656 146892 gene locus_tag LOCUS_29990 147656 146892 CDS product DUF599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106486.1 protein_id gnl|my_center|LOCUS_29990 149115 147802 gene locus_tag LOCUS_30000 gene brnQ 149115 147802 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114263.1 protein_id gnl|my_center|LOCUS_30000 150313 149426 gene locus_tag LOCUS_30010 gene sucD 150313 149426 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087428.1 protein_id gnl|my_center|LOCUS_30010 151479 150313 gene locus_tag LOCUS_30020 gene sucC 151479 150313 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087425.1 protein_id gnl|my_center|LOCUS_30020 153244 151808 gene locus_tag LOCUS_30030 gene lpdA 153244 151808 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087422.1 protein_id gnl|my_center|LOCUS_30030 154542 153313 gene locus_tag LOCUS_30040 gene odhB 154542 153313 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114264.1 protein_id gnl|my_center|LOCUS_30040 157416 154585 gene locus_tag LOCUS_30050 157416 154585 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087413.1 protein_id gnl|my_center|LOCUS_30050 158380 157673 gene locus_tag LOCUS_30060 158380 157673 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087410.1 protein_id gnl|my_center|LOCUS_30060 160164 158392 gene locus_tag LOCUS_30070 gene sdhA 160164 158392 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087407.1 protein_id gnl|my_center|LOCUS_30070 160536 160168 gene locus_tag LOCUS_30080 gene sdhD 160536 160168 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104386.1 protein_id gnl|my_center|LOCUS_30080 160916 160530 gene locus_tag LOCUS_30090 gene sdhC 160916 160530 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104388.1 protein_id gnl|my_center|LOCUS_30090 161265 162551 gene locus_tag LOCUS_30100 gene gltA 161265 162551 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087400.1 protein_id gnl|my_center|LOCUS_30100 163274 162666 gene locus_tag LOCUS_30110 163274 162666 CDS product START domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104390.1 protein_id gnl|my_center|LOCUS_30110 163596 163408 gene locus_tag LOCUS_30120 163596 163408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 164521 163766 gene locus_tag LOCUS_30130 164521 163766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114266.1 protein_id gnl|my_center|LOCUS_30130 164637 164978 gene locus_tag LOCUS_30140 164637 164978 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104394.1 protein_id gnl|my_center|LOCUS_30140 165851 164985 gene locus_tag LOCUS_30150 165851 164985 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104396.1 protein_id gnl|my_center|LOCUS_30150 165955 166506 gene locus_tag LOCUS_30160 165955 166506 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104398.1 protein_id gnl|my_center|LOCUS_30160 166601 166882 gene locus_tag LOCUS_30170 166601 166882 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087375.1 protein_id gnl|my_center|LOCUS_30170 167596 167000 gene locus_tag LOCUS_30180 167596 167000 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104401.1 protein_id gnl|my_center|LOCUS_30180 168752 167607 gene locus_tag LOCUS_30190 168752 167607 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895577.1 protein_id gnl|my_center|LOCUS_30190 168962 169141 gene locus_tag LOCUS_30200 168962 169141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104406.1 protein_id gnl|my_center|LOCUS_30200 170091 169210 gene locus_tag LOCUS_30210 170091 169210 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114270.1 protein_id gnl|my_center|LOCUS_30210 170030 170230 gene locus_tag LOCUS_30220 170030 170230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 170469 171830 gene locus_tag LOCUS_30230 170469 171830 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124897.1 protein_id gnl|my_center|LOCUS_30230 171886 172239 gene locus_tag LOCUS_30240 171886 172239 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104412.1 protein_id gnl|my_center|LOCUS_30240 172250 173647 gene locus_tag LOCUS_30250 172250 173647 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114272.1 protein_id gnl|my_center|LOCUS_30250 173799 173987 gene locus_tag LOCUS_30260 173799 173987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 174208 175479 gene locus_tag LOCUS_30270 174208 175479 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106001.1 protein_id gnl|my_center|LOCUS_30270 175548 176858 gene locus_tag LOCUS_30280 175548 176858 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114273.1 protein_id gnl|my_center|LOCUS_30280 177168 176890 gene locus_tag LOCUS_30290 gene tusA 177168 176890 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105999.1 protein_id gnl|my_center|LOCUS_30290 178272 177214 gene locus_tag LOCUS_30300 gene rlmM 178272 177214 CDS product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087345.1 protein_id gnl|my_center|LOCUS_30300 178599 181331 gene locus_tag LOCUS_30310 gene acnA 178599 181331 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105996.1 protein_id gnl|my_center|LOCUS_30310 181564 181307 gene locus_tag LOCUS_30320 181564 181307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 181590 183269 gene locus_tag LOCUS_30330 181590 183269 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087330.1 protein_id gnl|my_center|LOCUS_30330 184464 183307 gene locus_tag LOCUS_30340 184464 183307 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703304.1 protein_id gnl|my_center|LOCUS_30340 185185 184553 gene locus_tag LOCUS_30350 185185 184553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105994.1 protein_id gnl|my_center|LOCUS_30350 185373 186800 gene locus_tag LOCUS_30360 gene ccoN 185373 186800 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087322.1 protein_id gnl|my_center|LOCUS_30360 186811 187419 gene locus_tag LOCUS_30370 gene ccoO 186811 187419 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087318.1 protein_id gnl|my_center|LOCUS_30370 187425 187610 gene locus_tag LOCUS_30380 187425 187610 CDS product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087314.1 protein_id gnl|my_center|LOCUS_30380 187607 188533 gene locus_tag LOCUS_30390 gene ccoP 187607 188533 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087308.1 protein_id gnl|my_center|LOCUS_30390 188898 190325 gene locus_tag LOCUS_30400 gene ccoN 188898 190325 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087306.1 protein_id gnl|my_center|LOCUS_30400 190340 190951 gene locus_tag LOCUS_30410 gene ccoO 190340 190951 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087303.1 protein_id gnl|my_center|LOCUS_30410 190948 191142 gene locus_tag LOCUS_30420 190948 191142 CDS product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087298.1 protein_id gnl|my_center|LOCUS_30420 191139 192095 gene locus_tag LOCUS_30430 gene ccoP 191139 192095 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087292.1 protein_id gnl|my_center|LOCUS_30430 192313 193728 gene locus_tag LOCUS_30440 gene ccoG 192313 193728 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087288.1 protein_id gnl|my_center|LOCUS_30440 193740 194279 gene locus_tag LOCUS_30450 193740 194279 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114667.1 protein_id gnl|my_center|LOCUS_30450 194276 196711 gene locus_tag LOCUS_30460 194276 196711 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_30460 196690 196899 gene locus_tag LOCUS_30470 gene ccoS 196690 196899 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087273.1 protein_id gnl|my_center|LOCUS_30470 196892 197575 gene locus_tag LOCUS_30480 196892 197575 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087270.1 protein_id gnl|my_center|LOCUS_30480 197703 199085 gene locus_tag LOCUS_30490 gene hemN 197703 199085 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087267.1 protein_id gnl|my_center|LOCUS_30490 199600 199133 gene locus_tag LOCUS_30500 199600 199133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114670.1 protein_id gnl|my_center|LOCUS_30500 199846 200580 gene locus_tag LOCUS_30510 gene anr 199846 200580 CDS product transcriptional regulator Anr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087262.1 protein_id gnl|my_center|LOCUS_30510 200666 201214 gene locus_tag LOCUS_30520 200666 201214 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087259.1 protein_id gnl|my_center|LOCUS_30520 201454 202290 gene locus_tag LOCUS_30530 201454 202290 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087258.1 protein_id gnl|my_center|LOCUS_30530 202699 203067 gene locus_tag LOCUS_30540 gene mdtJ 202699 203067 CDS product multidrug/spermidine efflux SMR transporter subunit MdtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103935.1 protein_id gnl|my_center|LOCUS_30540 203061 203390 gene locus_tag LOCUS_30550 gene mdtI 203061 203390 CDS product multidrug/spermidine efflux SMR transporter subunit MdtI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103934.1 protein_id gnl|my_center|LOCUS_30550 203679 204155 gene locus_tag LOCUS_30560 203679 204155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 204245 205789 gene locus_tag LOCUS_30570 204245 205789 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895574.1 protein_id gnl|my_center|LOCUS_30570 205786 206673 gene locus_tag LOCUS_30580 205786 206673 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103932.1 protein_id gnl|my_center|LOCUS_30580 206747 207286 gene locus_tag LOCUS_30590 206747 207286 CDS product CbrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103931.1 protein_id gnl|my_center|LOCUS_30590 208447 207299 gene locus_tag LOCUS_30600 208447 207299 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103930.1 protein_id gnl|my_center|LOCUS_30600 209166 208570 gene locus_tag LOCUS_30610 gene recR 209166 208570 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087237.1 protein_id gnl|my_center|LOCUS_30610 209571 209245 gene locus_tag LOCUS_30620 209571 209245 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087236.1 protein_id gnl|my_center|LOCUS_30620 211710 209617 gene locus_tag LOCUS_30630 211710 209617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 211867 212610 gene locus_tag LOCUS_30640 211867 212610 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120462.1 protein_id gnl|my_center|LOCUS_30640 213244 212867 gene locus_tag LOCUS_30650 213244 212867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083354.1 protein_id gnl|my_center|LOCUS_30650 215674 213290 gene locus_tag LOCUS_30660 gene ligA 215674 213290 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114675.1 protein_id gnl|my_center|LOCUS_30660 216634 215765 gene locus_tag LOCUS_30670 gene zipA 216634 215765 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083352.1 protein_id gnl|my_center|LOCUS_30670 220287 216799 gene locus_tag LOCUS_30680 gene smc 220287 216799 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114676.1 protein_id gnl|my_center|LOCUS_30680 220972 220313 gene locus_tag LOCUS_30690 220972 220313 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083350.1 protein_id gnl|my_center|LOCUS_30690 221153 222286 gene locus_tag LOCUS_30700 gene alkB2 221153 222286 CDS product alkane 1-monooxygenase AlkB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083349.1 protein_id gnl|my_center|LOCUS_30700 222507 223961 gene locus_tag LOCUS_30710 gene xdhA 222507 223961 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083347.1 protein_id gnl|my_center|LOCUS_30710 223954 226353 gene locus_tag LOCUS_30720 gene xdhB 223954 226353 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114679.1 protein_id gnl|my_center|LOCUS_30720 226380 227219 gene locus_tag LOCUS_30730 gene xdhC 226380 227219 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083344.1 protein_id gnl|my_center|LOCUS_30730 227289 228593 gene locus_tag LOCUS_30740 gene guaD 227289 228593 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114680.1 protein_id gnl|my_center|LOCUS_30740 229426 228647 gene locus_tag LOCUS_30750 229426 228647 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083340.1 protein_id gnl|my_center|LOCUS_30750 229801 231150 gene locus_tag LOCUS_30760 229801 231150 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087209.1 protein_id gnl|my_center|LOCUS_30760 231771 231391 gene locus_tag LOCUS_30770 gene uraH 231771 231391 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087207.1 protein_id gnl|my_center|LOCUS_30770 232144 233070 gene locus_tag LOCUS_30780 gene puuE 232144 233070 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083336.1 protein_id gnl|my_center|LOCUS_30780 233067 233582 gene locus_tag LOCUS_30790 gene uraD 233067 233582 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083333.1 protein_id gnl|my_center|LOCUS_30790 233600 234598 gene locus_tag LOCUS_30800 gene alc 233600 234598 CDS product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114681.1 protein_id gnl|my_center|LOCUS_30800 234653 235162 gene locus_tag LOCUS_30810 234653 235162 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083329.1 protein_id gnl|my_center|LOCUS_30810 235211 236497 gene locus_tag LOCUS_30820 235211 236497 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083321.1 protein_id gnl|my_center|LOCUS_30820 >Feature sequence10 546 2621 gene locus_tag LOCUS_30830 546 2621 CDS product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114027.1 protein_id gnl|my_center|LOCUS_30830 2618 3382 gene locus_tag LOCUS_30840 2618 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30840 3383 5887 gene locus_tag LOCUS_30850 3383 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114029.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30850 6466 7089 gene locus_tag LOCUS_30860 6466 7089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 8627 7233 gene locus_tag LOCUS_30870 gene argH 8627 7233 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114030.1 protein_id gnl|my_center|LOCUS_30870 8852 9928 gene locus_tag LOCUS_30880 gene algZ 8852 9928 CDS product alginate biosynthesis two-component system sensor histidine kinase AlgZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096404.1 protein_id gnl|my_center|LOCUS_30880 9933 10679 gene locus_tag LOCUS_30890 gene algR 9933 10679 CDS product alginate biosynthesis regulator AlgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096397.1 protein_id gnl|my_center|LOCUS_30890 10788 11729 gene locus_tag LOCUS_30900 gene hemC 10788 11729 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114031.1 protein_id gnl|my_center|LOCUS_30900 11726 12481 gene locus_tag LOCUS_30910 11726 12481 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114032.1 protein_id gnl|my_center|LOCUS_30910 12508 13638 gene locus_tag LOCUS_30920 12508 13638 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096392.1 protein_id gnl|my_center|LOCUS_30920 13635 14873 gene locus_tag LOCUS_30930 13635 14873 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096390.1 protein_id gnl|my_center|LOCUS_30930 15053 15544 gene locus_tag LOCUS_30940 15053 15544 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099230.1 protein_id gnl|my_center|LOCUS_30940 15824 16306 gene locus_tag LOCUS_30950 gene rsd 15824 16306 CDS product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120370.1 protein_id gnl|my_center|LOCUS_30950 16997 16368 gene locus_tag LOCUS_30960 16997 16368 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099229.1 protein_id gnl|my_center|LOCUS_30960 17123 18181 gene locus_tag LOCUS_30970 17123 18181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30970 18657 18178 gene locus_tag LOCUS_30980 18657 18178 CDS product TIGR02444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114036.1 protein_id gnl|my_center|LOCUS_30980 19017 18727 gene locus_tag LOCUS_30990 19017 18727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 18907 20619 gene locus_tag LOCUS_31000 18907 20619 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114037.1 protein_id gnl|my_center|LOCUS_31000 20619 21197 gene locus_tag LOCUS_31010 20619 21197 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114038.1 protein_id gnl|my_center|LOCUS_31010 21204 21962 gene locus_tag LOCUS_31020 21204 21962 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099222.1 protein_id gnl|my_center|LOCUS_31020 22192 22821 gene locus_tag LOCUS_31030 22192 22821 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096365.1 protein_id gnl|my_center|LOCUS_31030 22869 24827 gene locus_tag LOCUS_31040 22869 24827 CDS product cytochrome c/FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115264.1 protein_id gnl|my_center|LOCUS_31040 24894 25376 gene locus_tag LOCUS_31050 24894 25376 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099218.1 protein_id gnl|my_center|LOCUS_31050 25834 25361 gene locus_tag LOCUS_31060 25834 25361 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096359.1 protein_id gnl|my_center|LOCUS_31060 26598 25930 gene locus_tag LOCUS_31070 gene elbB 26598 25930 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099212.1 protein_id gnl|my_center|LOCUS_31070 27353 26763 gene locus_tag LOCUS_31080 27353 26763 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096354.1 protein_id gnl|my_center|LOCUS_31080 27597 28610 gene locus_tag LOCUS_31090 gene hemB 27597 28610 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096352.1 protein_id gnl|my_center|LOCUS_31090 28628 30838 gene locus_tag LOCUS_31100 gene ppk1 28628 30838 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099209.1 protein_id gnl|my_center|LOCUS_31100 32345 30825 gene locus_tag LOCUS_31110 gene ppx 32345 30825 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120380.1 protein_id gnl|my_center|LOCUS_31110 32529 32855 gene locus_tag LOCUS_31120 gene trxA 32529 32855 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 protein_id gnl|my_center|LOCUS_31120 33099 34358 gene locus_tag LOCUS_31130 gene rho 33099 34358 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096334.1 protein_id gnl|my_center|LOCUS_31130 34429 36417 gene locus_tag LOCUS_31140 34429 36417 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895699.1 protein_id gnl|my_center|LOCUS_31140 36496 37962 gene locus_tag LOCUS_31150 gene ubiD 36496 37962 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096332.1 protein_id gnl|my_center|LOCUS_31150 37962 38930 gene locus_tag LOCUS_31160 37962 38930 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096331.1 protein_id gnl|my_center|LOCUS_31160 40313 38967 gene locus_tag LOCUS_31170 gene glpT 40313 38967 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096330.1 protein_id gnl|my_center|LOCUS_31170 41540 40563 gene locus_tag LOCUS_31180 41540 40563 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 protein_id gnl|my_center|LOCUS_31180 41695 42114 gene locus_tag LOCUS_31190 41695 42114 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096328.1 protein_id gnl|my_center|LOCUS_31190 42321 43394 gene locus_tag LOCUS_31200 42321 43394 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099200.1 protein_id gnl|my_center|LOCUS_31200 43391 46141 gene locus_tag LOCUS_31210 gene rbbA 43391 46141 CDS product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114043.1 protein_id gnl|my_center|LOCUS_31210 46145 47269 gene locus_tag LOCUS_31220 46145 47269 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099197.1 protein_id gnl|my_center|LOCUS_31220 47737 47279 gene locus_tag LOCUS_31230 47737 47279 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114044.1 protein_id gnl|my_center|LOCUS_31230 47922 48053 gene locus_tag LOCUS_31240 47922 48053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317333.1 protein_id gnl|my_center|LOCUS_31240 48715 48104 gene locus_tag LOCUS_31250 48715 48104 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096321.1 protein_id gnl|my_center|LOCUS_31250 49251 48937 gene locus_tag LOCUS_31260 49251 48937 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096316.1 protein_id gnl|my_center|LOCUS_31260 49457 49248 gene locus_tag LOCUS_31270 49457 49248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 49619 50200 gene locus_tag LOCUS_31280 49619 50200 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099193.1 protein_id gnl|my_center|LOCUS_31280 50210 51544 gene locus_tag LOCUS_31290 gene pepP 50210 51544 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_31290 51552 52736 gene locus_tag LOCUS_31300 gene ubiH 51552 52736 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099190.1 protein_id gnl|my_center|LOCUS_31300 52741 53223 gene locus_tag LOCUS_31310 52741 53223 CDS product hotdog fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099189.1 protein_id gnl|my_center|LOCUS_31310 53237 54469 gene locus_tag LOCUS_31320 53237 54469 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115267.1 protein_id gnl|my_center|LOCUS_31320 55327 54506 gene locus_tag LOCUS_31330 55327 54506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114047.1 protein_id gnl|my_center|LOCUS_31330 56559 55366 gene locus_tag LOCUS_31340 56559 55366 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114048.1 protein_id gnl|my_center|LOCUS_31340 56656 57570 gene locus_tag LOCUS_31350 56656 57570 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099180.1 protein_id gnl|my_center|LOCUS_31350 57638 58636 gene locus_tag LOCUS_31360 57638 58636 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096289.1 protein_id gnl|my_center|LOCUS_31360 58704 60323 gene locus_tag LOCUS_31370 58704 60323 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099178.1 protein_id gnl|my_center|LOCUS_31370 60474 61556 gene locus_tag LOCUS_31380 gene gcvT 60474 61556 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114049.1 protein_id gnl|my_center|LOCUS_31380 61564 61992 gene locus_tag LOCUS_31390 gene gcvH 61564 61992 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114050.1 protein_id gnl|my_center|LOCUS_31390 62166 65042 gene locus_tag LOCUS_31400 gene gcvP 62166 65042 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114051.1 protein_id gnl|my_center|LOCUS_31400 65406 65077 gene locus_tag LOCUS_31410 65406 65077 CDS product DUF2388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096280.1 protein_id gnl|my_center|LOCUS_31410 65990 65538 gene locus_tag LOCUS_31420 65990 65538 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107402.1 protein_id gnl|my_center|LOCUS_31420 67996 66212 gene locus_tag LOCUS_31430 67996 66212 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096276.1 protein_id gnl|my_center|LOCUS_31430 69398 68034 gene locus_tag LOCUS_31440 69398 68034 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114052.1 protein_id gnl|my_center|LOCUS_31440 69512 70189 gene locus_tag LOCUS_31450 69512 70189 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114053.1 protein_id gnl|my_center|LOCUS_31450 70234 71502 gene locus_tag LOCUS_31460 70234 71502 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100079.1 protein_id gnl|my_center|LOCUS_31460 71602 72756 gene locus_tag LOCUS_31470 gene argE 71602 72756 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114054.1 protein_id gnl|my_center|LOCUS_31470 73430 72729 gene locus_tag LOCUS_31480 73430 72729 CDS product MarC family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114055.1 protein_id gnl|my_center|LOCUS_31480 73768 75066 gene locus_tag LOCUS_31490 gene argA 73768 75066 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096265.1 protein_id gnl|my_center|LOCUS_31490 76692 75109 gene locus_tag LOCUS_31500 gene gshA 76692 75109 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109990.1 protein_id gnl|my_center|LOCUS_31500 77288 76899 gene locus_tag LOCUS_31510 77288 76899 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096263.1 protein_id gnl|my_center|LOCUS_31510 79639 77300 gene locus_tag LOCUS_31520 79639 77300 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100071.1 protein_id gnl|my_center|LOCUS_31520 79828 80571 gene locus_tag LOCUS_31530 gene amgR 79828 80571 CDS product two-component system response regulator AmgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096259.1 protein_id gnl|my_center|LOCUS_31530 80666 81985 gene locus_tag LOCUS_31540 gene amgS 80666 81985 CDS product two-component system sensor histidine kinase AmgS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096258.1 protein_id gnl|my_center|LOCUS_31540 82985 82062 gene locus_tag LOCUS_31550 82985 82062 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100070.1 protein_id gnl|my_center|LOCUS_31550 84081 83176 gene locus_tag LOCUS_31560 gene rimK 84081 83176 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096254.1 protein_id gnl|my_center|LOCUS_31560 84713 84213 gene locus_tag LOCUS_31570 84713 84213 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003146534.1 protein_id gnl|my_center|LOCUS_31570 84851 85252 gene locus_tag LOCUS_31580 84851 85252 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895698.1 protein_id gnl|my_center|LOCUS_31580 86093 85290 gene locus_tag LOCUS_31590 86093 85290 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114057.1 protein_id gnl|my_center|LOCUS_31590 86206 87099 gene locus_tag LOCUS_31600 gene hslO 86206 87099 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096245.1 protein_id gnl|my_center|LOCUS_31600 87215 88756 gene locus_tag LOCUS_31610 87215 88756 CDS product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100068.1 protein_id gnl|my_center|LOCUS_31610 89170 88814 gene locus_tag LOCUS_31620 89170 88814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109981.1 protein_id gnl|my_center|LOCUS_31620 89423 90025 gene locus_tag LOCUS_31630 89423 90025 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100063.1 protein_id gnl|my_center|LOCUS_31630 90948 90040 gene locus_tag LOCUS_31640 90948 90040 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096239.1 protein_id gnl|my_center|LOCUS_31640 91091 92326 gene locus_tag LOCUS_31650 91091 92326 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114059.1 protein_id gnl|my_center|LOCUS_31650 92328 94118 gene locus_tag LOCUS_31660 92328 94118 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114060.1 protein_id gnl|my_center|LOCUS_31660 94244 95308 gene locus_tag LOCUS_31670 94244 95308 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114061.1 protein_id gnl|my_center|LOCUS_31670 95331 95774 gene locus_tag LOCUS_31680 95331 95774 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114062.1 protein_id gnl|my_center|LOCUS_31680 96313 95756 gene locus_tag LOCUS_31690 96313 95756 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114063.1 protein_id gnl|my_center|LOCUS_31690 96538 96753 gene locus_tag LOCUS_31700 96538 96753 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096222.1 protein_id gnl|my_center|LOCUS_31700 97229 96822 gene locus_tag LOCUS_31710 97229 96822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100051.1 protein_id gnl|my_center|LOCUS_31710 97843 97328 gene locus_tag LOCUS_31720 97843 97328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100049.1 protein_id gnl|my_center|LOCUS_31720 100473 98152 gene locus_tag LOCUS_31730 100473 98152 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114064.1 protein_id gnl|my_center|LOCUS_31730 101320 100481 gene locus_tag LOCUS_31740 gene fdhD 101320 100481 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100044.1 protein_id gnl|my_center|LOCUS_31740 102298 101417 gene locus_tag LOCUS_31750 102298 101417 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100042.1 protein_id gnl|my_center|LOCUS_31750 102472 102909 gene locus_tag LOCUS_31760 gene lysM 102472 102909 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096210.1 protein_id gnl|my_center|LOCUS_31760 103626 102961 gene locus_tag LOCUS_31770 gene yrfG 103626 102961 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 protein_id gnl|my_center|LOCUS_31770 103752 104318 gene locus_tag LOCUS_31780 gene nudE 103752 104318 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114066.1 protein_id gnl|my_center|LOCUS_31780 104324 105136 gene locus_tag LOCUS_31790 gene cysQ 104324 105136 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114067.1 protein_id gnl|my_center|LOCUS_31790 107090 105183 gene locus_tag LOCUS_31800 gene fabY 107090 105183 CDS product beta-ketoacyl-ACP synthase FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114068.1 protein_id gnl|my_center|LOCUS_31800 108435 107503 gene locus_tag LOCUS_31810 gene arcC 108435 107503 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100033.1 protein_id gnl|my_center|LOCUS_31810 109506 108496 gene locus_tag LOCUS_31820 109506 108496 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100031.1 protein_id gnl|my_center|LOCUS_31820 110842 109586 gene locus_tag LOCUS_31830 gene arcA 110842 109586 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111744.1 protein_id gnl|my_center|LOCUS_31830 112249 110864 gene locus_tag LOCUS_31840 gene arcD 112249 110864 CDS product arginine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123669.1 protein_id gnl|my_center|LOCUS_31840 114391 113108 gene locus_tag LOCUS_31850 gene dctM 114391 113108 CDS product C4-dicarboxylate TRAP transporter large permease protein DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105529.1 protein_id gnl|my_center|LOCUS_31850 115020 114388 gene locus_tag LOCUS_31860 gene dctQ 115020 114388 CDS product C4-dicarboxylate TRAP transporter small permease protein DctQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105527.1 protein_id gnl|my_center|LOCUS_31860 116034 115039 gene locus_tag LOCUS_31870 gene dctP 116034 115039 CDS product C4-dicarboxylate TRAP substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105525.1 protein_id gnl|my_center|LOCUS_31870 117663 116275 gene locus_tag LOCUS_31880 gene dctD 117663 116275 CDS product two-component system response regulator DctD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096187.1 protein_id gnl|my_center|LOCUS_31880 119459 117660 gene locus_tag LOCUS_31890 gene dctB 119459 117660 CDS product two-component system sensor histidine kinase DctB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123664.1 protein_id gnl|my_center|LOCUS_31890 120103 119558 gene locus_tag LOCUS_31900 gene rfbC 120103 119558 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096184.1 protein_id gnl|my_center|LOCUS_31900 120984 120103 gene locus_tag LOCUS_31910 gene rfbA 120984 120103 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105518.1 protein_id gnl|my_center|LOCUS_31910 121889 120981 gene locus_tag LOCUS_31920 gene rfbD 121889 120981 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112614.1 protein_id gnl|my_center|LOCUS_31920 122944 121886 gene locus_tag LOCUS_31930 gene rfbB 122944 121886 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096179.1 protein_id gnl|my_center|LOCUS_31930 123254 123179 gene locus_tag LOCUS_t00270 123254 123179 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 124857 123328 gene locus_tag LOCUS_31940 124857 123328 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112615.1 protein_id gnl|my_center|LOCUS_31940 126052 124868 gene locus_tag LOCUS_31950 126052 124868 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112616.1 protein_id gnl|my_center|LOCUS_31950 127545 126067 gene locus_tag LOCUS_31960 127545 126067 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112617.1 protein_id gnl|my_center|LOCUS_31960 128019 127549 gene locus_tag LOCUS_31970 128019 127549 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110596.1 protein_id gnl|my_center|LOCUS_31970 129643 128423 gene locus_tag LOCUS_31980 129643 128423 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112618.1 protein_id gnl|my_center|LOCUS_31980 130404 129712 gene locus_tag LOCUS_31990 130404 129712 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096163.1 protein_id gnl|my_center|LOCUS_31990 131096 130401 gene locus_tag LOCUS_32000 131096 130401 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105543.1 protein_id gnl|my_center|LOCUS_32000 131910 131158 gene locus_tag LOCUS_32010 131910 131158 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096156.1 protein_id gnl|my_center|LOCUS_32010 132698 131925 gene locus_tag LOCUS_32020 132698 131925 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096153.1 protein_id gnl|my_center|LOCUS_32020 133636 132947 gene locus_tag LOCUS_32030 133636 132947 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105540.1 protein_id gnl|my_center|LOCUS_32030 133795 134532 gene locus_tag LOCUS_32040 133795 134532 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096148.1 protein_id gnl|my_center|LOCUS_32040 137625 135445 gene locus_tag LOCUS_32050 137625 135445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 137869 137642 gene locus_tag LOCUS_32060 137869 137642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 138354 137866 gene locus_tag LOCUS_32070 138354 137866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 139061 138351 gene locus_tag LOCUS_32080 139061 138351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 140086 139061 gene locus_tag LOCUS_32090 140086 139061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 141246 140776 gene locus_tag LOCUS_32100 141246 140776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 141605 141324 gene locus_tag LOCUS_32110 141605 141324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 141835 141602 gene locus_tag LOCUS_32120 141835 141602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 142277 141828 gene locus_tag LOCUS_32130 142277 141828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 142621 142274 gene locus_tag LOCUS_32140 142621 142274 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235953532.1 protein_id gnl|my_center|LOCUS_32140 142836 142621 gene locus_tag LOCUS_32150 142836 142621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 143420 142920 gene locus_tag LOCUS_32160 143420 142920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 144688 143417 gene locus_tag LOCUS_32170 144688 143417 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105434.1 protein_id gnl|my_center|LOCUS_32170 144909 144834 gene locus_tag LOCUS_t00280 144909 144834 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 146105 145023 gene locus_tag LOCUS_32180 146105 145023 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112619.1 protein_id gnl|my_center|LOCUS_32180 146405 146133 gene locus_tag LOCUS_32190 146405 146133 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096100.1 protein_id gnl|my_center|LOCUS_32190 147516 146449 gene locus_tag LOCUS_32200 gene mutY 147516 146449 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110600.1 protein_id gnl|my_center|LOCUS_32200 149765 147513 gene locus_tag LOCUS_32210 149765 147513 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112620.1 protein_id gnl|my_center|LOCUS_32210 150965 149859 gene locus_tag LOCUS_32220 150965 149859 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112621.1 protein_id gnl|my_center|LOCUS_32220 151198 150962 gene locus_tag LOCUS_32230 151198 150962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170100.1 protein_id gnl|my_center|LOCUS_32230 151633 151235 gene locus_tag LOCUS_32240 151633 151235 CDS product acetyl-CoA sensor PanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112623.1 protein_id gnl|my_center|LOCUS_32240 151794 152387 gene locus_tag LOCUS_32250 gene hisB 151794 152387 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096088.1 protein_id gnl|my_center|LOCUS_32250 152387 153025 gene locus_tag LOCUS_32260 gene hisH 152387 153025 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121251.1 protein_id gnl|my_center|LOCUS_32260 153029 153289 gene locus_tag LOCUS_32270 153029 153289 CDS product DUF2164 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397145.1 protein_id gnl|my_center|LOCUS_32270 153338 154075 gene locus_tag LOCUS_32280 gene hisA 153338 154075 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106336.1 protein_id gnl|my_center|LOCUS_32280 154086 154856 gene locus_tag LOCUS_32290 gene hisF 154086 154856 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106334.1 protein_id gnl|my_center|LOCUS_32290 155028 155774 gene locus_tag LOCUS_32300 155028 155774 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106332.1 protein_id gnl|my_center|LOCUS_32300 155865 156617 gene locus_tag LOCUS_32310 155865 156617 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106330.1 protein_id gnl|my_center|LOCUS_32310 156767 157522 gene locus_tag LOCUS_32320 156767 157522 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096075.1 protein_id gnl|my_center|LOCUS_32320 159040 157559 gene locus_tag LOCUS_32330 159040 157559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895696.1 protein_id gnl|my_center|LOCUS_32330 159882 159109 gene locus_tag LOCUS_32340 159882 159109 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096069.1 protein_id gnl|my_center|LOCUS_32340 161192 159882 gene locus_tag LOCUS_32350 gene cptA 161192 159882 CDS product proteolytic complex protein CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_32350 162507 161221 gene locus_tag LOCUS_32360 162507 161221 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123645.1 protein_id gnl|my_center|LOCUS_32360 163475 162657 gene locus_tag LOCUS_32370 163475 162657 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114479.1 protein_id gnl|my_center|LOCUS_32370 165336 163789 gene locus_tag LOCUS_32380 gene gpmI 165336 163789 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114478.1 protein_id gnl|my_center|LOCUS_32380 165490 166080 gene locus_tag LOCUS_32390 165490 166080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 166082 166336 gene locus_tag LOCUS_32400 gene grxC 166082 166336 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096057.1 protein_id gnl|my_center|LOCUS_32400 166373 166864 gene locus_tag LOCUS_32410 gene secB 166373 166864 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096050.1 protein_id gnl|my_center|LOCUS_32410 167384 166923 gene locus_tag LOCUS_32420 gene trmL 167384 166923 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114477.1 protein_id gnl|my_center|LOCUS_32420 167383 167850 gene locus_tag LOCUS_32430 167383 167850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114476.1 protein_id gnl|my_center|LOCUS_32430 169948 168518 gene locus_tag LOCUS_32440 gene ntrC 169948 168518 CDS product two-component system response regulator NtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_32440 171027 169951 gene locus_tag LOCUS_32450 gene ntrB 171027 169951 CDS product two-component system sensor histidine kinase NtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096033.1 protein_id gnl|my_center|LOCUS_32450 171870 171298 gene locus_tag LOCUS_32460 171870 171298 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114474.1 protein_id gnl|my_center|LOCUS_32460 172388 171867 gene locus_tag LOCUS_32470 172388 171867 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096024.1 protein_id gnl|my_center|LOCUS_32470 172676 174883 gene locus_tag LOCUS_32480 172676 174883 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111156.1 protein_id gnl|my_center|LOCUS_32480 175284 174880 gene locus_tag LOCUS_32490 175284 174880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114473.1 protein_id gnl|my_center|LOCUS_32490 176841 175432 gene locus_tag LOCUS_32500 gene glnA 176841 175432 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096016.1 protein_id gnl|my_center|LOCUS_32500 177178 178632 gene locus_tag LOCUS_32510 gene thiI 177178 178632 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096011.1 protein_id gnl|my_center|LOCUS_32510 178849 180666 gene locus_tag LOCUS_32520 gene typA 178849 180666 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096009.1 protein_id gnl|my_center|LOCUS_32520 181175 180750 gene locus_tag LOCUS_32530 181175 180750 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114472.1 protein_id gnl|my_center|LOCUS_32530 181259 181843 gene locus_tag LOCUS_32540 181259 181843 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114471.1 protein_id gnl|my_center|LOCUS_32540 181982 185587 gene locus_tag LOCUS_32550 181982 185587 CDS product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114470.1 protein_id gnl|my_center|LOCUS_32550 185584 186978 gene locus_tag LOCUS_32560 185584 186978 CDS product DUF3999 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114469.1 protein_id gnl|my_center|LOCUS_32560 187096 189027 gene locus_tag LOCUS_32570 gene estA 187096 189027 CDS product esterase EstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115524.1 protein_id gnl|my_center|LOCUS_32570 189184 189714 gene locus_tag LOCUS_32580 gene gloA 189184 189714 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101793.1 protein_id gnl|my_center|LOCUS_32580 189854 190864 gene locus_tag LOCUS_32590 189854 190864 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095990.1 protein_id gnl|my_center|LOCUS_32590 190869 191471 gene locus_tag LOCUS_32600 190869 191471 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101790.1 protein_id gnl|my_center|LOCUS_32600 191544 191801 gene locus_tag LOCUS_32610 gene bamE 191544 191801 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095983.1 protein_id gnl|my_center|LOCUS_32610 191798 192367 gene locus_tag LOCUS_32620 191798 192367 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114468.1 protein_id gnl|my_center|LOCUS_32620 193871 192510 gene locus_tag LOCUS_32630 193871 192510 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114467.1 protein_id gnl|my_center|LOCUS_32630 193972 194724 gene locus_tag LOCUS_32640 gene hutC 193972 194724 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095970.1 protein_id gnl|my_center|LOCUS_32640 194721 195311 gene locus_tag LOCUS_32650 194721 195311 CDS product HutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114466.1 protein_id gnl|my_center|LOCUS_32650 195423 196475 gene locus_tag LOCUS_32660 195423 196475 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114465.1 protein_id gnl|my_center|LOCUS_32660 196491 197429 gene locus_tag LOCUS_32670 196491 197429 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114464.1 protein_id gnl|my_center|LOCUS_32670 197448 198245 gene locus_tag LOCUS_32680 197448 198245 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114463.1 protein_id gnl|my_center|LOCUS_32680 198571 200250 gene locus_tag LOCUS_32690 gene hutU 198571 200250 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895695.1 protein_id gnl|my_center|LOCUS_32690 200358 201800 gene locus_tag LOCUS_32700 200358 201800 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114462.1 protein_id gnl|my_center|LOCUS_32700 201897 203426 gene locus_tag LOCUS_32710 gene hutH 201897 203426 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114461.1 protein_id gnl|my_center|LOCUS_32710 203489 204892 gene locus_tag LOCUS_32720 203489 204892 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114460.1 protein_id gnl|my_center|LOCUS_32720 205028 205978 gene locus_tag LOCUS_32730 205028 205978 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114459.1 protein_id gnl|my_center|LOCUS_32730 206003 206854 gene locus_tag LOCUS_32740 206003 206854 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114458.1 protein_id gnl|my_center|LOCUS_32740 206851 207681 gene locus_tag LOCUS_32750 206851 207681 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115525.1 protein_id gnl|my_center|LOCUS_32750 207678 209210 gene locus_tag LOCUS_32760 207678 209210 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101754.1 protein_id gnl|my_center|LOCUS_32760 209207 210415 gene locus_tag LOCUS_32770 gene hutI 209207 210415 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114456.1 protein_id gnl|my_center|LOCUS_32770 210408 211208 gene locus_tag LOCUS_32780 gene hutG 210408 211208 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095940.1 protein_id gnl|my_center|LOCUS_32780 211479 213851 gene locus_tag LOCUS_32790 211479 213851 CDS product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114455.1 protein_id gnl|my_center|LOCUS_32790 213848 216085 gene locus_tag LOCUS_32800 gene pldB 213848 216085 CDS product type VI secrection system-dependent phospholipase D effector PldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114454.1 protein_id gnl|my_center|LOCUS_32800 >Feature sequence11 2444 798 gene locus_tag LOCUS_32810 2444 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 4876 2636 gene locus_tag LOCUS_32820 4876 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 7666 4937 gene locus_tag LOCUS_32830 7666 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 8045 7638 gene locus_tag LOCUS_32840 8045 7638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 8541 8050 gene locus_tag LOCUS_32850 8541 8050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 9007 8525 gene locus_tag LOCUS_32860 9007 8525 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705685.1 protein_id gnl|my_center|LOCUS_32860 11532 9004 gene locus_tag LOCUS_32870 11532 9004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 11836 11582 gene locus_tag LOCUS_32880 11836 11582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113188.1 protein_id gnl|my_center|LOCUS_32880 12219 11860 gene locus_tag LOCUS_32890 12219 11860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 12750 12229 gene locus_tag LOCUS_32900 12750 12229 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113190.1 protein_id gnl|my_center|LOCUS_32900 13196 12825 gene locus_tag LOCUS_32910 13196 12825 CDS product DUF3168 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072861.1 protein_id gnl|my_center|LOCUS_32910 13687 13193 gene locus_tag LOCUS_32920 13687 13193 CDS product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072862.1 protein_id gnl|my_center|LOCUS_32920 14297 13680 gene locus_tag LOCUS_32930 14297 13680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 14479 14294 gene locus_tag LOCUS_32940 14479 14294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 15309 14476 gene locus_tag LOCUS_32950 15309 14476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 15674 15318 gene locus_tag LOCUS_32960 15674 15318 CDS product phage head closure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072864.1 protein_id gnl|my_center|LOCUS_32960 15995 15675 gene locus_tag LOCUS_32970 15995 15675 CDS product head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072865.1 protein_id gnl|my_center|LOCUS_32970 16572 15976 gene locus_tag LOCUS_32980 16572 15976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 17001 16729 gene locus_tag LOCUS_32990 17001 16729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 18608 17421 gene locus_tag LOCUS_33000 18608 17421 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072867.1 protein_id gnl|my_center|LOCUS_33000 19495 18605 gene locus_tag LOCUS_33010 19495 18605 CDS product Clp protease ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337208.1 protein_id gnl|my_center|LOCUS_33010 20889 19627 gene locus_tag LOCUS_33020 20889 19627 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072869.1 protein_id gnl|my_center|LOCUS_33020 21046 20882 gene locus_tag LOCUS_33030 21046 20882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 22734 21043 gene locus_tag LOCUS_33040 22734 21043 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938795.1 protein_id gnl|my_center|LOCUS_33040 23116 22736 gene locus_tag LOCUS_33050 23116 22736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 23644 23330 gene locus_tag LOCUS_33060 23644 23330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 23897 23637 gene locus_tag LOCUS_33070 23897 23637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 24145 23894 gene locus_tag LOCUS_33080 24145 23894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 24363 24145 gene locus_tag LOCUS_33090 24363 24145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 24714 24481 gene locus_tag LOCUS_33100 24714 24481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 24998 24714 gene locus_tag LOCUS_33110 24998 24714 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085989.1 protein_id gnl|my_center|LOCUS_33110 25359 24991 gene locus_tag LOCUS_33120 25359 24991 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104765.1 protein_id gnl|my_center|LOCUS_33120 25946 25425 gene locus_tag LOCUS_33130 25946 25425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 26198 26016 gene locus_tag LOCUS_33140 26198 26016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 27149 26463 gene locus_tag LOCUS_33150 27149 26463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267992.1 protein_id gnl|my_center|LOCUS_33150 27730 27146 gene locus_tag LOCUS_33160 27730 27146 CDS product recombination protein NinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267993.1 protein_id gnl|my_center|LOCUS_33160 28115 27957 gene locus_tag LOCUS_33170 28115 27957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 28321 28112 gene locus_tag LOCUS_33180 28321 28112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 28578 28318 gene locus_tag LOCUS_33190 28578 28318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 29162 28575 gene locus_tag LOCUS_33200 29162 28575 CDS product DUF1367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929790.1 protein_id gnl|my_center|LOCUS_33200 29385 29155 gene locus_tag LOCUS_33210 29385 29155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 29653 29378 gene locus_tag LOCUS_33220 29653 29378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 29897 29646 gene locus_tag LOCUS_33230 29897 29646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 30094 29897 gene locus_tag LOCUS_33240 30094 29897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 30294 30094 gene locus_tag LOCUS_33250 30294 30094 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085132.1 protein_id gnl|my_center|LOCUS_33250 30805 30296 gene locus_tag LOCUS_33260 30805 30296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 32750 30921 gene locus_tag LOCUS_33270 32750 30921 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058461124.1 protein_id gnl|my_center|LOCUS_33270 33595 32747 gene locus_tag LOCUS_33280 33595 32747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 34014 33592 gene locus_tag LOCUS_33290 34014 33592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 34199 34014 gene locus_tag LOCUS_33300 34199 34014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 34968 34396 gene locus_tag LOCUS_33310 34968 34396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 35219 35004 gene locus_tag LOCUS_33320 35219 35004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 35265 36092 gene locus_tag LOCUS_33330 35265 36092 CDS product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693472.1 protein_id gnl|my_center|LOCUS_33330 36122 36772 gene locus_tag LOCUS_33340 36122 36772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 36930 37844 gene locus_tag LOCUS_33350 36930 37844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 38245 38898 gene locus_tag LOCUS_33360 38245 38898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 39329 39535 gene locus_tag LOCUS_33370 39329 39535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 39546 39752 gene locus_tag LOCUS_33380 39546 39752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 40038 40250 gene locus_tag LOCUS_33390 40038 40250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 40294 40503 gene locus_tag LOCUS_33400 40294 40503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 40606 41307 gene locus_tag LOCUS_33410 40606 41307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 41540 41809 gene locus_tag LOCUS_33420 41540 41809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 41845 42084 gene locus_tag LOCUS_33430 41845 42084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 42299 42592 gene locus_tag LOCUS_33440 42299 42592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 42589 42954 gene locus_tag LOCUS_33450 42589 42954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 42951 43481 gene locus_tag LOCUS_33460 42951 43481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 43875 44063 gene locus_tag LOCUS_33470 43875 44063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 44106 45170 gene locus_tag LOCUS_33480 44106 45170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 45178 45924 gene locus_tag LOCUS_33490 gene bet 45178 45924 CDS product phage recombination protein Bet inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100829.1 protein_id gnl|my_center|LOCUS_33490 45908 46528 gene locus_tag LOCUS_33500 45908 46528 CDS product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039432.1 protein_id gnl|my_center|LOCUS_33500 46525 46860 gene locus_tag LOCUS_33510 46525 46860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 46871 47029 gene locus_tag LOCUS_33520 46871 47029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 47092 48477 gene locus_tag LOCUS_33530 47092 48477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 48474 48743 gene locus_tag LOCUS_33540 48474 48743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 48715 48885 gene locus_tag LOCUS_33550 48715 48885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 48882 50081 gene locus_tag LOCUS_33560 48882 50081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 50081 50353 gene locus_tag LOCUS_33570 50081 50353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 50357 50902 gene locus_tag LOCUS_33580 50357 50902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 50895 51239 gene locus_tag LOCUS_33590 50895 51239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 51236 51535 gene locus_tag LOCUS_33600 51236 51535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 51532 51903 gene locus_tag LOCUS_33610 51532 51903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929845.1 protein_id gnl|my_center|LOCUS_33610 51900 52142 gene locus_tag LOCUS_33620 51900 52142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 52139 52300 gene locus_tag LOCUS_33630 52139 52300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 52397 52789 gene locus_tag LOCUS_33640 52397 52789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 52675 53784 gene locus_tag LOCUS_33650 52675 53784 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205298.1 protein_id gnl|my_center|LOCUS_33650 53878 53794 gene locus_tag LOCUS_t00290 53878 53794 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 54008 53933 gene locus_tag LOCUS_t00300 54008 53933 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 54136 54060 gene locus_tag LOCUS_t00310 54136 54060 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 54415 55269 gene locus_tag LOCUS_33660 gene folD 54415 55269 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087898.1 protein_id gnl|my_center|LOCUS_33660 56709 55327 gene locus_tag LOCUS_33670 gene cysS 56709 55327 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113587.1 protein_id gnl|my_center|LOCUS_33670 58404 56719 gene locus_tag LOCUS_33680 58404 56719 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113586.1 protein_id gnl|my_center|LOCUS_33680 58512 59009 gene locus_tag LOCUS_33690 58512 59009 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087890.1 protein_id gnl|my_center|LOCUS_33690 59014 59736 gene locus_tag LOCUS_33700 gene lpxH 59014 59736 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113585.1 protein_id gnl|my_center|LOCUS_33700 59870 61201 gene locus_tag LOCUS_33710 59870 61201 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087885.1 protein_id gnl|my_center|LOCUS_33710 61861 61250 gene locus_tag LOCUS_33720 61861 61250 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122839.1 protein_id gnl|my_center|LOCUS_33720 62044 62907 gene locus_tag LOCUS_33730 62044 62907 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087881.1 protein_id gnl|my_center|LOCUS_33730 63430 62963 gene locus_tag LOCUS_33740 63430 62963 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113583.1 protein_id gnl|my_center|LOCUS_33740 63812 66421 gene locus_tag LOCUS_33750 gene acnB 63812 66421 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087875.1 protein_id gnl|my_center|LOCUS_33750 66599 67807 gene locus_tag LOCUS_33760 66599 67807 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113582.1 protein_id gnl|my_center|LOCUS_33760 67824 68402 gene locus_tag LOCUS_33770 67824 68402 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113581.1 protein_id gnl|my_center|LOCUS_33770 68632 69327 gene locus_tag LOCUS_33780 68632 69327 CDS product polysaccharide lyase family 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087865.1 protein_id gnl|my_center|LOCUS_33780 69681 70892 gene locus_tag LOCUS_33790 69681 70892 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087861.1 protein_id gnl|my_center|LOCUS_33790 70895 72562 gene locus_tag LOCUS_33800 70895 72562 CDS product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004342954.1 protein_id gnl|my_center|LOCUS_33800 72830 75280 gene locus_tag LOCUS_33810 gene nirB 72830 75280 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113579.1 protein_id gnl|my_center|LOCUS_33810 75333 75659 gene locus_tag LOCUS_33820 gene nirD 75333 75659 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087853.1 protein_id gnl|my_center|LOCUS_33820 75686 78412 gene locus_tag LOCUS_33830 75686 78412 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113578.1 protein_id gnl|my_center|LOCUS_33830 76546 76448 gene locus_tag LOCUS_t00320 76546 76448 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 78424 79161 gene locus_tag LOCUS_33840 gene cobA 78424 79161 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087845.1 protein_id gnl|my_center|LOCUS_33840 80282 79230 gene locus_tag LOCUS_33850 gene oprF 80282 79230 CDS product outer membrane porin OprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087843.1 protein_id gnl|my_center|LOCUS_33850 80981 80391 gene locus_tag LOCUS_33860 gene sigX 80981 80391 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406744.1 protein_id gnl|my_center|LOCUS_33860 81877 81053 gene locus_tag LOCUS_33870 81877 81053 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087830.1 protein_id gnl|my_center|LOCUS_33870 82128 81880 gene locus_tag LOCUS_33880 82128 81880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120308.1 protein_id gnl|my_center|LOCUS_33880 83181 82183 gene locus_tag LOCUS_33890 83181 82183 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098062.1 protein_id gnl|my_center|LOCUS_33890 83857 83369 gene locus_tag LOCUS_33900 gene rraA 83857 83369 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087823.1 protein_id gnl|my_center|LOCUS_33900 84974 83964 gene locus_tag LOCUS_33910 84974 83964 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113577.1 protein_id gnl|my_center|LOCUS_33910 87335 85044 gene locus_tag LOCUS_33920 gene ppsA 87335 85044 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098065.1 protein_id gnl|my_center|LOCUS_33920 87225 87554 gene locus_tag LOCUS_33930 87225 87554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 87585 88409 gene locus_tag LOCUS_33940 87585 88409 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120310.1 protein_id gnl|my_center|LOCUS_33940 88700 89239 gene locus_tag LOCUS_33950 88700 89239 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087811.1 protein_id gnl|my_center|LOCUS_33950 89245 90771 gene locus_tag LOCUS_33960 89245 90771 CDS product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087809.1 protein_id gnl|my_center|LOCUS_33960 90775 91758 gene locus_tag LOCUS_33970 90775 91758 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087807.1 protein_id gnl|my_center|LOCUS_33970 93005 91815 gene locus_tag LOCUS_33980 93005 91815 CDS product MalM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113576.1 protein_id gnl|my_center|LOCUS_33980 94614 93016 gene locus_tag LOCUS_33990 94614 93016 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113575.1 protein_id gnl|my_center|LOCUS_33990 95623 94634 gene locus_tag LOCUS_34000 95623 94634 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120313.1 protein_id gnl|my_center|LOCUS_34000 96461 95700 gene locus_tag LOCUS_34010 96461 95700 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098072.1 protein_id gnl|my_center|LOCUS_34010 96977 96540 gene locus_tag LOCUS_34020 96977 96540 CDS product DUF6160 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098074.1 protein_id gnl|my_center|LOCUS_34020 99932 97209 gene locus_tag LOCUS_34030 99932 97209 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113574.1 protein_id gnl|my_center|LOCUS_34030 102505 99935 gene locus_tag LOCUS_34040 102505 99935 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120314.1 protein_id gnl|my_center|LOCUS_34040 102889 104166 gene locus_tag LOCUS_34050 gene pabB 102889 104166 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009314634.1 protein_id gnl|my_center|LOCUS_34050 104826 104209 gene locus_tag LOCUS_34060 gene thrH 104826 104209 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098078.1 protein_id gnl|my_center|LOCUS_34060 104961 105764 gene locus_tag LOCUS_34070 104961 105764 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895583.1 protein_id gnl|my_center|LOCUS_34070 105829 106176 gene locus_tag LOCUS_34080 105829 106176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087777.1 protein_id gnl|my_center|LOCUS_34080 107207 106233 gene locus_tag LOCUS_34090 gene cysB 107207 106233 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 protein_id gnl|my_center|LOCUS_34090 107836 107339 gene locus_tag LOCUS_34100 107836 107339 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087770.1 protein_id gnl|my_center|LOCUS_34100 108946 107999 gene locus_tag LOCUS_34110 108946 107999 CDS product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113573.1 protein_id gnl|my_center|LOCUS_34110 109326 108946 gene locus_tag LOCUS_34120 109326 108946 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122849.1 protein_id gnl|my_center|LOCUS_34120 109523 109323 gene locus_tag LOCUS_34130 109523 109323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 109641 110717 gene locus_tag LOCUS_34140 109641 110717 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109525.1 protein_id gnl|my_center|LOCUS_34140 111059 110775 gene locus_tag LOCUS_34150 111059 110775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34150 111446 112135 gene locus_tag LOCUS_34160 111446 112135 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087759.1 protein_id gnl|my_center|LOCUS_34160 112285 112473 gene locus_tag LOCUS_34170 112285 112473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087758.1 protein_id gnl|my_center|LOCUS_34170 113051 112545 gene locus_tag LOCUS_34180 113051 112545 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087757.1 protein_id gnl|my_center|LOCUS_34180 113272 113760 gene locus_tag LOCUS_34190 113272 113760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087756.1 protein_id gnl|my_center|LOCUS_34190 113915 114133 gene locus_tag LOCUS_34200 113915 114133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098091.1 protein_id gnl|my_center|LOCUS_34200 114161 114400 gene locus_tag LOCUS_34210 114161 114400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087754.1 protein_id gnl|my_center|LOCUS_34210 115180 114458 gene locus_tag LOCUS_34220 115180 114458 CDS product amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113570.1 protein_id gnl|my_center|LOCUS_34220 115425 115796 gene locus_tag LOCUS_34230 115425 115796 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087752.1 protein_id gnl|my_center|LOCUS_34230 116802 115843 gene locus_tag LOCUS_34240 116802 115843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087751.1 protein_id gnl|my_center|LOCUS_34240 117796 116825 gene locus_tag LOCUS_34250 117796 116825 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113567.1 protein_id gnl|my_center|LOCUS_34250 117947 118861 gene locus_tag LOCUS_34260 117947 118861 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113566.1 protein_id gnl|my_center|LOCUS_34260 121390 119246 gene locus_tag LOCUS_34270 121390 119246 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100703.1 protein_id gnl|my_center|LOCUS_34270 122609 121404 gene locus_tag LOCUS_34280 122609 121404 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087747.1 protein_id gnl|my_center|LOCUS_34280 124068 123181 gene locus_tag LOCUS_34290 124068 123181 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087746.1 protein_id gnl|my_center|LOCUS_34290 124181 125002 gene locus_tag LOCUS_34300 124181 125002 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100707.1 protein_id gnl|my_center|LOCUS_34300 125741 125010 gene locus_tag LOCUS_34310 125741 125010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113561.1 protein_id gnl|my_center|LOCUS_34310 126623 125823 gene locus_tag LOCUS_34320 126623 125823 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113560.1 protein_id gnl|my_center|LOCUS_34320 127573 126620 gene locus_tag LOCUS_34330 127573 126620 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087742.1 protein_id gnl|my_center|LOCUS_34330 128988 127576 gene locus_tag LOCUS_34340 128988 127576 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087741.1 protein_id gnl|my_center|LOCUS_34340 130036 129338 gene locus_tag LOCUS_34350 130036 129338 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113559.1 protein_id gnl|my_center|LOCUS_34350 130475 130134 gene locus_tag LOCUS_34360 130475 130134 CDS product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087738.1 protein_id gnl|my_center|LOCUS_34360 130828 132885 gene locus_tag LOCUS_34370 130828 132885 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113558.1 protein_id gnl|my_center|LOCUS_34370 133056 135350 gene locus_tag LOCUS_34380 gene bglX 133056 135350 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113557.1 protein_id gnl|my_center|LOCUS_34380 136097 135453 gene locus_tag LOCUS_34390 gene pscL 136097 135453 CDS product SctL family type III secretion system stator protein PscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120328.1 protein_id gnl|my_center|LOCUS_34390 136696 136076 gene locus_tag LOCUS_34400 gene pscK 136696 136076 CDS product SctK family type III secretion system sorting platform protein PscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113555.1 protein_id gnl|my_center|LOCUS_34400 137439 136705 gene locus_tag LOCUS_34410 gene pscJ 137439 136705 CDS product SctJ family type III secretion inner membrane ring lipoprotein Psc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120329.1 protein_id gnl|my_center|LOCUS_34410 137786 137448 gene locus_tag LOCUS_34420 gene pscI 137786 137448 CDS product SctI family type III secretion system inner rod subunit PscI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895582.1 protein_id gnl|my_center|LOCUS_34420 138217 137786 gene locus_tag LOCUS_34430 gene pscH 138217 137786 CDS product YopR family T3SS polymerization control protein PscH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100725.1 protein_id gnl|my_center|LOCUS_34430 138561 138214 gene locus_tag LOCUS_34440 gene pscG 138561 138214 CDS product YscG family type III secretion system chaperone PscG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100735.1 protein_id gnl|my_center|LOCUS_34440 138821 138564 gene locus_tag LOCUS_34450 gene pscF 138821 138564 CDS product type III secretion system needle filament protein PscF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087729.1 protein_id gnl|my_center|LOCUS_34450 139027 138824 gene locus_tag LOCUS_34460 gene pscE 139027 138824 CDS product YscE family type III secretion system co-chaperone PscE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115377.1 protein_id gnl|my_center|LOCUS_34460 140288 138990 gene locus_tag LOCUS_34470 gene pscD 140288 138990 CDS product SctD family type III secretion system inner membrane ring subunit PscD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113552.1 protein_id gnl|my_center|LOCUS_34470 142092 140290 gene locus_tag LOCUS_34480 gene pscC 142092 140290 CDS product SctC family type III secretion system outer membrane ring subunit PscC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100753.1 protein_id gnl|my_center|LOCUS_34480 142514 142092 gene locus_tag LOCUS_34490 gene pscB 142514 142092 CDS product YscB family type III secretion system chaperone PscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113551.1 protein_id gnl|my_center|LOCUS_34490 143378 142548 gene locus_tag LOCUS_34500 gene exsD 143378 142548 CDS product T3SS regulon anti-activator ExsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100755.1 protein_id gnl|my_center|LOCUS_34500 144312 143476 gene locus_tag LOCUS_34510 gene exsA 144312 143476 CDS product T3SS regulon transcriptional activator ExsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120334.1 protein_id gnl|my_center|LOCUS_34510 145023 144610 gene locus_tag LOCUS_34520 gene exsB 145023 144610 CDS product YscW family type III secretion system pilotin ExsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100765.1 protein_id gnl|my_center|LOCUS_34520 145289 145032 gene locus_tag LOCUS_34530 gene exsE 145289 145032 CDS product T3SS regulon translocated regulator ExsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100766.1 protein_id gnl|my_center|LOCUS_34530 145723 145286 gene locus_tag LOCUS_34540 gene exsC 145723 145286 CDS product type III secretion system regulatory chaperone ExsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100769.1 protein_id gnl|my_center|LOCUS_34540 146736 145849 gene locus_tag LOCUS_34550 gene popD 146736 145849 CDS product type III secretion system translocon subunit PopD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113550.1 protein_id gnl|my_center|LOCUS_34550 147920 146748 gene locus_tag LOCUS_34560 gene popB 147920 146748 CDS product type III secretion system translocon subunit PopB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895581.1 protein_id gnl|my_center|LOCUS_34560 148407 147901 gene locus_tag LOCUS_34570 gene pcrH 148407 147901 CDS product SycD/LcrH family type III secretion system chaperone PcrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113548.1 protein_id gnl|my_center|LOCUS_34570 149300 148416 gene locus_tag LOCUS_34580 gene pcrV 149300 148416 CDS product type III secretion system needle tip protein PcrV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100789.1 protein_id gnl|my_center|LOCUS_34580 149606 149310 gene locus_tag LOCUS_34590 gene pcrG 149606 149310 CDS product LcrG family type III secretion system chaperone PcrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100790.1 protein_id gnl|my_center|LOCUS_34590 150068 149634 gene locus_tag LOCUS_34600 gene pcrR 150068 149634 CDS product LcrR family type III secretion system chaperone PcrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100791.1 protein_id gnl|my_center|LOCUS_34600 152185 150065 gene locus_tag LOCUS_34610 gene pcrD 152185 150065 CDS product SctV family type III secretion system export apparatus subunit PcrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100792.1 protein_id gnl|my_center|LOCUS_34610 152511 152182 gene locus_tag LOCUS_34620 gene pscY 152511 152182 CDS product type III secretion system chaperone PscY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113547.1 protein_id gnl|my_center|LOCUS_34620 152881 152516 gene locus_tag LOCUS_34630 gene pscX 152881 152516 CDS product type III secretion system protein PscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100794.1 protein_id gnl|my_center|LOCUS_34630 153249 152878 gene locus_tag LOCUS_34640 gene sycN 153249 152878 CDS product type III secretion chaperone SycN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113546.1 protein_id gnl|my_center|LOCUS_34640 153472 153236 gene locus_tag LOCUS_34650 gene pcr1 153472 153236 CDS product Acr1 family type III secretion system gatekeeper subunit Pcr1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087693.1 protein_id gnl|my_center|LOCUS_34650 153801 153577 gene locus_tag LOCUS_34660 153801 153577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 154101 153880 gene locus_tag LOCUS_34670 154101 153880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 154400 154098 gene locus_tag LOCUS_34680 154400 154098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 155245 154400 gene locus_tag LOCUS_34690 155245 154400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 157452 155242 gene locus_tag LOCUS_34700 157452 155242 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019561992.1 protein_id gnl|my_center|LOCUS_34700 157896 157666 gene locus_tag LOCUS_34710 157896 157666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 158731 157913 gene locus_tag LOCUS_34720 158731 157913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 160424 158718 gene locus_tag LOCUS_34730 160424 158718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 161350 160427 gene locus_tag LOCUS_34740 161350 160427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 162312 161353 gene locus_tag LOCUS_34750 162312 161353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 166079 162312 gene locus_tag LOCUS_34760 166079 162312 CDS product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267967.1 protein_id gnl|my_center|LOCUS_34760 166309 166166 gene locus_tag LOCUS_34770 166309 166166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 166812 166306 gene locus_tag LOCUS_34780 166812 166306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 167566 166814 gene locus_tag LOCUS_34790 167566 166814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 167779 167570 gene locus_tag LOCUS_34800 167779 167570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 168231 167776 gene locus_tag LOCUS_34810 168231 167776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 168748 168233 gene locus_tag LOCUS_34820 168748 168233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 169076 168750 gene locus_tag LOCUS_34830 169076 168750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 169270 169076 gene locus_tag LOCUS_34840 169270 169076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 170246 169317 gene locus_tag LOCUS_34850 170246 169317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 170635 170258 gene locus_tag LOCUS_34860 170635 170258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 171817 170639 gene locus_tag LOCUS_34870 171817 170639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273067.1 protein_id gnl|my_center|LOCUS_34870 172677 172105 gene locus_tag LOCUS_34880 172677 172105 CDS product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938413.1 protein_id gnl|my_center|LOCUS_34880 173924 172674 gene locus_tag LOCUS_34890 173924 172674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34890 175402 173924 gene locus_tag LOCUS_34900 175402 173924 CDS product DUF935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090685.1 protein_id gnl|my_center|LOCUS_34900 177105 175402 gene locus_tag LOCUS_34910 177105 175402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057672.1 protein_id gnl|my_center|LOCUS_34910 177691 177107 gene locus_tag LOCUS_34920 177691 177107 CDS product DUF3486 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124060.1 protein_id gnl|my_center|LOCUS_34920 177996 177688 gene locus_tag LOCUS_34930 177996 177688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227700.1 protein_id gnl|my_center|LOCUS_34930 178375 177986 gene locus_tag LOCUS_34940 178375 177986 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777272.1 protein_id gnl|my_center|LOCUS_34940 178990 178379 gene locus_tag LOCUS_34950 178990 178379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264661.1 protein_id gnl|my_center|LOCUS_34950 179174 178977 gene locus_tag LOCUS_34960 179174 178977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 179800 179171 gene locus_tag LOCUS_34970 179800 179171 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939968.1 protein_id gnl|my_center|LOCUS_34970 179955 179797 gene locus_tag LOCUS_34980 179955 179797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 180290 179958 gene locus_tag LOCUS_34990 180290 179958 CDS product putative holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793143.1 protein_id gnl|my_center|LOCUS_34990 180428 181315 gene locus_tag LOCUS_35000 180428 181315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 181574 181371 gene locus_tag LOCUS_35010 181574 181371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 182031 181594 gene locus_tag LOCUS_35020 182031 181594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 182130 182339 gene locus_tag LOCUS_35030 182130 182339 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200153.1 protein_id gnl|my_center|LOCUS_35030 182705 182385 gene locus_tag LOCUS_35040 182705 182385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 182732 183412 gene locus_tag LOCUS_35050 182732 183412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 183532 184020 gene locus_tag LOCUS_35060 183532 184020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 184013 184273 gene locus_tag LOCUS_35070 184013 184273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 184270 184569 gene locus_tag LOCUS_35080 184270 184569 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049025.1 protein_id gnl|my_center|LOCUS_35080 184627 185583 gene locus_tag LOCUS_35090 184627 185583 CDS product DUF3102 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533821.1 protein_id gnl|my_center|LOCUS_35090 185588 187366 gene locus_tag LOCUS_35100 185588 187366 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990532.1 protein_id gnl|my_center|LOCUS_35100 187366 188535 gene locus_tag LOCUS_35110 187366 188535 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960679.1 protein_id gnl|my_center|LOCUS_35110 188537 188878 gene locus_tag LOCUS_35120 188537 188878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 188875 189180 gene locus_tag LOCUS_35130 188875 189180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 189180 189791 gene locus_tag LOCUS_35140 189180 189791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 189784 189984 gene locus_tag LOCUS_35150 189784 189984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 189977 190600 gene locus_tag LOCUS_35160 189977 190600 CDS product DUF3164 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070973.1 protein_id gnl|my_center|LOCUS_35160 190602 191291 gene locus_tag LOCUS_35170 190602 191291 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706579.1 protein_id gnl|my_center|LOCUS_35170 191476 192012 gene locus_tag LOCUS_35180 191476 192012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 191996 192208 gene locus_tag LOCUS_35190 191996 192208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 192208 192771 gene locus_tag LOCUS_35200 192208 192771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 192774 193133 gene locus_tag LOCUS_35210 192774 193133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 194139 193273 gene locus_tag LOCUS_35220 gene popN 194139 193273 CDS product SctW family type III secretion system gatekeeper subunit PopN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087692.1 protein_id gnl|my_center|LOCUS_35220 194403 195605 gene locus_tag LOCUS_35230 194403 195605 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074377.1 protein_id gnl|my_center|LOCUS_35230 195602 195826 gene locus_tag LOCUS_35240 195602 195826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 195969 197492 gene locus_tag LOCUS_35250 gene istA 195969 197492 CDS product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_35250 197529 198266 gene locus_tag LOCUS_35260 gene istB 197529 198266 CDS product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_35260 198380 199327 gene locus_tag LOCUS_35270 198380 199327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 199668 200177 gene locus_tag LOCUS_35280 gene radC 199668 200177 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148675.1 protein_id gnl|my_center|LOCUS_35280 200941 200219 gene locus_tag LOCUS_35290 gene arsH 200941 200219 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926640.1 protein_id gnl|my_center|LOCUS_35290 201356 200934 gene locus_tag LOCUS_35300 gene arsC 201356 200934 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033459395.1 protein_id gnl|my_center|LOCUS_35300 202483 201371 gene locus_tag LOCUS_35310 gene arsB 202483 201371 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969943.1 protein_id gnl|my_center|LOCUS_35310 204246 202480 gene locus_tag LOCUS_35320 gene arsA 204246 202480 CDS product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705614.1 protein_id gnl|my_center|LOCUS_35320 204619 204260 gene locus_tag LOCUS_35330 gene arsD 204619 204260 CDS product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817072.1 protein_id gnl|my_center|LOCUS_35330 205158 204661 gene locus_tag LOCUS_35340 205158 204661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 205616 205170 gene locus_tag LOCUS_35350 205616 205170 CDS product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184724.1 protein_id gnl|my_center|LOCUS_35350 205958 205629 gene locus_tag LOCUS_35360 205958 205629 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811464.1 protein_id gnl|my_center|LOCUS_35360 206328 206678 gene locus_tag LOCUS_35370 206328 206678 CDS product DUF2958 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533281.1 protein_id gnl|my_center|LOCUS_35370 206852 207022 gene locus_tag LOCUS_35380 206852 207022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 207726 208553 gene locus_tag LOCUS_35390 207726 208553 CDS product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107012.1 protein_id gnl|my_center|LOCUS_35390 208634 210691 gene locus_tag LOCUS_35400 208634 210691 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028176021.1 protein_id gnl|my_center|LOCUS_35400 210754 210963 gene locus_tag LOCUS_35410 210754 210963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 211898 211074 gene locus_tag LOCUS_35420 211898 211074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 >Feature sequence12 605 1975 gene locus_tag LOCUS_35430 605 1975 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106497.1 protein_id gnl|my_center|LOCUS_35430 2463 3692 gene locus_tag LOCUS_35440 gene sstT 2463 3692 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114881.1 protein_id gnl|my_center|LOCUS_35440 3813 4715 gene locus_tag LOCUS_35450 3813 4715 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114880.1 protein_id gnl|my_center|LOCUS_35450 6748 4874 gene locus_tag LOCUS_35460 6748 4874 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114879.1 protein_id gnl|my_center|LOCUS_35460 7183 6923 gene locus_tag LOCUS_35470 gene yidD 7183 6923 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106504.1 protein_id gnl|my_center|LOCUS_35470 8597 7242 gene locus_tag LOCUS_35480 8597 7242 CDS product DUF1232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070686.1 protein_id gnl|my_center|LOCUS_35480 9617 8685 gene locus_tag LOCUS_35490 gene cmrA 9617 8685 CDS product AraC family transcriptional regulator CmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118743.1 protein_id gnl|my_center|LOCUS_35490 9899 10078 gene locus_tag LOCUS_35500 9899 10078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 10205 10501 gene locus_tag LOCUS_35510 10205 10501 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088696.1 protein_id gnl|my_center|LOCUS_35510 12559 10559 gene locus_tag LOCUS_35520 12559 10559 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115754.1 protein_id gnl|my_center|LOCUS_35520 12887 13393 gene locus_tag LOCUS_35530 12887 13393 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114876.1 protein_id gnl|my_center|LOCUS_35530 13390 14343 gene locus_tag LOCUS_35540 13390 14343 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114875.1 protein_id gnl|my_center|LOCUS_35540 14851 14381 gene locus_tag LOCUS_35550 gene cynS 14851 14381 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088707.1 protein_id gnl|my_center|LOCUS_35550 15553 14891 gene locus_tag LOCUS_35560 gene cynT 15553 14891 CDS product carbonic anhydrase CynT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107081.1 protein_id gnl|my_center|LOCUS_35560 15668 16555 gene locus_tag LOCUS_35570 gene cynR 15668 16555 CDS product transcriptional regulator CynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114874.1 protein_id gnl|my_center|LOCUS_35570 17977 16562 gene locus_tag LOCUS_35580 17977 16562 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114873.1 protein_id gnl|my_center|LOCUS_35580 18088 18990 gene locus_tag LOCUS_35590 18088 18990 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114872.1 protein_id gnl|my_center|LOCUS_35590 19378 22335 gene locus_tag LOCUS_35600 19378 22335 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895598.1 protein_id gnl|my_center|LOCUS_35600 22339 24147 gene locus_tag LOCUS_35610 22339 24147 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103635.1 protein_id gnl|my_center|LOCUS_35610 24149 25222 gene locus_tag LOCUS_35620 24149 25222 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114870.1 protein_id gnl|my_center|LOCUS_35620 25224 26240 gene locus_tag LOCUS_35630 25224 26240 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103639.1 protein_id gnl|my_center|LOCUS_35630 26242 27852 gene locus_tag LOCUS_35640 26242 27852 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114869.1 protein_id gnl|my_center|LOCUS_35640 27998 29179 gene locus_tag LOCUS_35650 27998 29179 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120247.1 protein_id gnl|my_center|LOCUS_35650 29382 30605 gene locus_tag LOCUS_35660 29382 30605 CDS product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088736.1 protein_id gnl|my_center|LOCUS_35660 31680 30625 gene locus_tag LOCUS_35670 31680 30625 CDS product copper resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109652.1 protein_id gnl|my_center|LOCUS_35670 33521 31677 gene locus_tag LOCUS_35680 33521 31677 CDS product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114867.1 protein_id gnl|my_center|LOCUS_35680 34308 33670 gene locus_tag LOCUS_35690 34308 33670 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088740.1 protein_id gnl|my_center|LOCUS_35690 34973 34305 gene locus_tag LOCUS_35700 34973 34305 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103648.1 protein_id gnl|my_center|LOCUS_35700 36138 34975 gene locus_tag LOCUS_35710 36138 34975 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114866.1 protein_id gnl|my_center|LOCUS_35710 37906 36182 gene locus_tag LOCUS_35720 37906 36182 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114865.1 protein_id gnl|my_center|LOCUS_35720 40728 38086 gene locus_tag LOCUS_35730 40728 38086 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114864.1 protein_id gnl|my_center|LOCUS_35730 41004 43112 gene locus_tag LOCUS_35740 gene fusA 41004 43112 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114863.1 protein_id gnl|my_center|LOCUS_35740 43284 45878 gene locus_tag LOCUS_35750 43284 45878 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895599.1 protein_id gnl|my_center|LOCUS_35750 46047 46322 gene locus_tag LOCUS_35760 46047 46322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 47931 46270 gene locus_tag LOCUS_35770 47931 46270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003142545.1 protein_id gnl|my_center|LOCUS_35770 48317 48108 gene locus_tag LOCUS_35780 48317 48108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 48886 48650 gene locus_tag LOCUS_35790 48886 48650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 48783 49733 gene locus_tag LOCUS_35800 48783 49733 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003139628.1 protein_id gnl|my_center|LOCUS_35800 51698 49770 gene locus_tag LOCUS_35810 51698 49770 CDS product 10S-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114857.1 protein_id gnl|my_center|LOCUS_35810 53588 51714 gene locus_tag LOCUS_35820 53588 51714 CDS product (7S,10S)-hydroperoxide diol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114856.1 protein_id gnl|my_center|LOCUS_35820 55280 53874 gene locus_tag LOCUS_35830 55280 53874 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114855.1 protein_id gnl|my_center|LOCUS_35830 56686 55436 gene locus_tag LOCUS_35840 gene kynU 56686 55436 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114854.1 protein_id gnl|my_center|LOCUS_35840 57331 56690 gene locus_tag LOCUS_35850 gene kynB 57331 56690 CDS product kynurenine formamidase KynB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114853.1 protein_id gnl|my_center|LOCUS_35850 57464 57940 gene locus_tag LOCUS_35860 gene kynR 57464 57940 CDS product kynurenine pathway transcriptional regulator KynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088777.1 protein_id gnl|my_center|LOCUS_35860 58142 59416 gene locus_tag LOCUS_35870 58142 59416 CDS product aromatic-ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114852.1 protein_id gnl|my_center|LOCUS_35870 59504 61336 gene locus_tag LOCUS_35880 gene asnB 59504 61336 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115546.1 protein_id gnl|my_center|LOCUS_35880 61364 61873 gene locus_tag LOCUS_35890 61364 61873 CDS product aromatic-ring-hydroxylating dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105327.1 protein_id gnl|my_center|LOCUS_35890 61884 62786 gene locus_tag LOCUS_35900 61884 62786 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114850.1 protein_id gnl|my_center|LOCUS_35900 62783 63439 gene locus_tag LOCUS_35910 62783 63439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114849.1 protein_id gnl|my_center|LOCUS_35910 63423 64271 gene locus_tag LOCUS_35920 63423 64271 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105335.1 protein_id gnl|my_center|LOCUS_35920 64363 67014 gene locus_tag LOCUS_35930 64363 67014 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114848.1 protein_id gnl|my_center|LOCUS_35930 67027 68106 gene locus_tag LOCUS_35940 67027 68106 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114847.1 protein_id gnl|my_center|LOCUS_35940 68103 69383 gene locus_tag LOCUS_35950 68103 69383 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114846.1 protein_id gnl|my_center|LOCUS_35950 69370 70563 gene locus_tag LOCUS_35960 69370 70563 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114845.1 protein_id gnl|my_center|LOCUS_35960 70666 71175 gene locus_tag LOCUS_35970 70666 71175 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107976.1 protein_id gnl|my_center|LOCUS_35970 71172 72128 gene locus_tag LOCUS_35980 71172 72128 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114844.1 protein_id gnl|my_center|LOCUS_35980 72975 72130 gene locus_tag LOCUS_35990 72975 72130 CDS product CmcJ/NvfI family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107935.1 protein_id gnl|my_center|LOCUS_35990 74158 73124 gene locus_tag LOCUS_36000 74158 73124 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114843.1 protein_id gnl|my_center|LOCUS_36000 74121 74327 gene locus_tag LOCUS_36010 74121 74327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 74305 75780 gene locus_tag LOCUS_36020 74305 75780 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107859.1 protein_id gnl|my_center|LOCUS_36020 75791 76720 gene locus_tag LOCUS_36030 75791 76720 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003142502.1 protein_id gnl|my_center|LOCUS_36030 76705 77463 gene locus_tag LOCUS_36040 76705 77463 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113283.1 protein_id gnl|my_center|LOCUS_36040 78266 77868 gene locus_tag LOCUS_36050 78266 77868 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113280.1 protein_id gnl|my_center|LOCUS_36050 78437 80209 gene locus_tag LOCUS_36060 78437 80209 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088823.1 protein_id gnl|my_center|LOCUS_36060 80704 80228 gene locus_tag LOCUS_36070 80704 80228 CDS product DUF4142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106158.1 protein_id gnl|my_center|LOCUS_36070 81713 80772 gene locus_tag LOCUS_36080 81713 80772 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147543.1 protein_id gnl|my_center|LOCUS_36080 82423 81710 gene locus_tag LOCUS_36090 82423 81710 CDS product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113622.1 protein_id gnl|my_center|LOCUS_36090 83163 82420 gene locus_tag LOCUS_36100 83163 82420 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113623.1 protein_id gnl|my_center|LOCUS_36100 84425 83196 gene locus_tag LOCUS_36110 84425 83196 CDS product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113624.1 protein_id gnl|my_center|LOCUS_36110 85721 84450 gene locus_tag LOCUS_36120 85721 84450 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102111.1 protein_id gnl|my_center|LOCUS_36120 85976 86929 gene locus_tag LOCUS_36130 85976 86929 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102114.1 protein_id gnl|my_center|LOCUS_36130 87036 87833 gene locus_tag LOCUS_36140 87036 87833 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113625.1 protein_id gnl|my_center|LOCUS_36140 88798 87818 gene locus_tag LOCUS_36150 88798 87818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113626.1 protein_id gnl|my_center|LOCUS_36150 88990 90066 gene locus_tag LOCUS_36160 gene ada 88990 90066 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147548.1 protein_id gnl|my_center|LOCUS_36160 90473 90234 gene locus_tag LOCUS_36170 90473 90234 CDS product DUF2790 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088835.1 protein_id gnl|my_center|LOCUS_36170 91699 90599 gene locus_tag LOCUS_36180 91699 90599 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113628.1 protein_id gnl|my_center|LOCUS_36180 92460 92032 gene locus_tag LOCUS_36190 92460 92032 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102139.1 protein_id gnl|my_center|LOCUS_36190 93513 92608 gene locus_tag LOCUS_36200 93513 92608 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113629.1 protein_id gnl|my_center|LOCUS_36200 93648 94775 gene locus_tag LOCUS_36210 93648 94775 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895600.1 protein_id gnl|my_center|LOCUS_36210 94812 95744 gene locus_tag LOCUS_36220 94812 95744 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102145.1 protein_id gnl|my_center|LOCUS_36220 95849 97486 gene locus_tag LOCUS_36230 95849 97486 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113631.1 protein_id gnl|my_center|LOCUS_36230 97508 98956 gene locus_tag LOCUS_36240 97508 98956 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102149.1 protein_id gnl|my_center|LOCUS_36240 99627 98992 gene locus_tag LOCUS_36250 99627 98992 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088853.1 protein_id gnl|my_center|LOCUS_36250 99985 99545 gene locus_tag LOCUS_36260 99985 99545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 101280 100054 gene locus_tag LOCUS_36270 101280 100054 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113632.1 protein_id gnl|my_center|LOCUS_36270 102203 102685 gene locus_tag LOCUS_36280 102203 102685 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895601.1 protein_id gnl|my_center|LOCUS_36280 102857 103519 gene locus_tag LOCUS_36290 102857 103519 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088863.1 protein_id gnl|my_center|LOCUS_36290 103503 106121 gene locus_tag LOCUS_36300 103503 106121 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102159.1 protein_id gnl|my_center|LOCUS_36300 106118 107479 gene locus_tag LOCUS_36310 106118 107479 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113634.1 protein_id gnl|my_center|LOCUS_36310 107502 108182 gene locus_tag LOCUS_36320 107502 108182 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113635.1 protein_id gnl|my_center|LOCUS_36320 108179 109036 gene locus_tag LOCUS_36330 108179 109036 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113636.1 protein_id gnl|my_center|LOCUS_36330 109175 109699 gene locus_tag LOCUS_36340 109175 109699 CDS product DUF4142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120284.1 protein_id gnl|my_center|LOCUS_36340 109728 111092 gene locus_tag LOCUS_36350 109728 111092 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113638.1 protein_id gnl|my_center|LOCUS_36350 111519 111070 gene locus_tag LOCUS_36360 111519 111070 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317797.1 protein_id gnl|my_center|LOCUS_36360 112069 111545 gene locus_tag LOCUS_36370 112069 111545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088874.1 protein_id gnl|my_center|LOCUS_36370 112318 112707 gene locus_tag LOCUS_36380 112318 112707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 112725 115247 gene locus_tag LOCUS_36390 gene ligD 112725 115247 CDS product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113639.1 protein_id gnl|my_center|LOCUS_36390 115323 115538 gene locus_tag LOCUS_36400 115323 115538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 115558 115797 gene locus_tag LOCUS_36410 115558 115797 CDS product metallothionein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100805.1 protein_id gnl|my_center|LOCUS_36410 115808 116326 gene locus_tag LOCUS_36420 115808 116326 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147560.1 protein_id gnl|my_center|LOCUS_36420 116352 117212 gene locus_tag LOCUS_36430 116352 117212 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113640.1 protein_id gnl|my_center|LOCUS_36430 117420 117232 gene locus_tag LOCUS_36440 117420 117232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088902.1 protein_id gnl|my_center|LOCUS_36440 117663 117950 gene locus_tag LOCUS_36450 117663 117950 CDS product DUF2513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100808.1 protein_id gnl|my_center|LOCUS_36450 118003 120441 gene locus_tag LOCUS_36460 118003 120441 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100816.1 protein_id gnl|my_center|LOCUS_36460 120846 120448 gene locus_tag LOCUS_36470 120846 120448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100818.1 protein_id gnl|my_center|LOCUS_36470 121345 121512 gene locus_tag LOCUS_36480 121345 121512 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088912.1 protein_id gnl|my_center|LOCUS_36480 121593 123722 gene locus_tag LOCUS_36490 gene katE 121593 123722 CDS product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113643.1 protein_id gnl|my_center|LOCUS_36490 123950 124441 gene locus_tag LOCUS_36500 123950 124441 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100824.1 protein_id gnl|my_center|LOCUS_36500 124455 124697 gene locus_tag LOCUS_36510 124455 124697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088922.1 protein_id gnl|my_center|LOCUS_36510 124720 125601 gene locus_tag LOCUS_36520 124720 125601 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113644.1 protein_id gnl|my_center|LOCUS_36520 125745 127739 gene locus_tag LOCUS_36530 125745 127739 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113645.1 protein_id gnl|my_center|LOCUS_36530 127750 131052 gene locus_tag LOCUS_36540 gene treS 127750 131052 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088929.1 protein_id gnl|my_center|LOCUS_36540 131049 133247 gene locus_tag LOCUS_36550 gene glgB 131049 133247 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113646.1 protein_id gnl|my_center|LOCUS_36550 134244 133249 gene locus_tag LOCUS_36560 134244 133249 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113647.1 protein_id gnl|my_center|LOCUS_36560 135446 134241 gene locus_tag LOCUS_36570 gene clsB 135446 134241 CDS product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113648.1 protein_id gnl|my_center|LOCUS_36570 136180 135443 gene locus_tag LOCUS_36580 136180 135443 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113649.1 protein_id gnl|my_center|LOCUS_36580 137115 136177 gene locus_tag LOCUS_36590 137115 136177 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113650.1 protein_id gnl|my_center|LOCUS_36590 138366 137119 gene locus_tag LOCUS_36600 138366 137119 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088939.1 protein_id gnl|my_center|LOCUS_36600 138849 138433 gene locus_tag LOCUS_36610 138849 138433 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088942.1 protein_id gnl|my_center|LOCUS_36610 141099 138949 gene locus_tag LOCUS_36620 gene glgX 141099 138949 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113651.1 protein_id gnl|my_center|LOCUS_36620 141417 141112 gene locus_tag LOCUS_36630 141417 141112 CDS product DUF2934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113653.1 protein_id gnl|my_center|LOCUS_36630 144194 141414 gene locus_tag LOCUS_36640 144194 141414 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113655.1 protein_id gnl|my_center|LOCUS_36640 146241 144187 gene locus_tag LOCUS_36650 gene malQ 146241 144187 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113656.1 protein_id gnl|my_center|LOCUS_36650 147985 146234 gene locus_tag LOCUS_36660 gene treZ 147985 146234 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113657.1 protein_id gnl|my_center|LOCUS_36660 149589 147985 gene locus_tag LOCUS_36670 gene glgA 149589 147985 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115521.1 protein_id gnl|my_center|LOCUS_36670 149894 150259 gene locus_tag LOCUS_36680 149894 150259 CDS product DUF3509 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113659.1 protein_id gnl|my_center|LOCUS_36680 150365 150556 gene locus_tag LOCUS_36690 150365 150556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 150588 151685 gene locus_tag LOCUS_36700 150588 151685 CDS product DUF3182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088961.1 protein_id gnl|my_center|LOCUS_36700 151682 152458 gene locus_tag LOCUS_36710 151682 152458 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113660.1 protein_id gnl|my_center|LOCUS_36710 152584 153036 gene locus_tag LOCUS_36720 152584 153036 CDS product PA2169 family four-helix-bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113661.1 protein_id gnl|my_center|LOCUS_36720 153063 153272 gene locus_tag LOCUS_36730 153063 153272 CDS product PLD nuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113662.1 protein_id gnl|my_center|LOCUS_36730 153347 153817 gene locus_tag LOCUS_36740 153347 153817 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113663.1 protein_id gnl|my_center|LOCUS_36740 153821 154897 gene locus_tag LOCUS_36750 153821 154897 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088971.1 protein_id gnl|my_center|LOCUS_36750 154924 155274 gene locus_tag LOCUS_36760 154924 155274 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088973.1 protein_id gnl|my_center|LOCUS_36760 155330 155551 gene locus_tag LOCUS_36770 155330 155551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113664.1 protein_id gnl|my_center|LOCUS_36770 155847 155584 gene locus_tag LOCUS_36780 155847 155584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003144276.1 protein_id gnl|my_center|LOCUS_36780 156523 156176 gene locus_tag LOCUS_36790 156523 156176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088982.1 protein_id gnl|my_center|LOCUS_36790 157126 156536 gene locus_tag LOCUS_36800 157126 156536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088985.1 protein_id gnl|my_center|LOCUS_36800 157356 159308 gene locus_tag LOCUS_36810 157356 159308 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895602.1 protein_id gnl|my_center|LOCUS_36810 159920 159312 gene locus_tag LOCUS_36820 159920 159312 CDS product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113667.1 protein_id gnl|my_center|LOCUS_36820 160082 160303 gene locus_tag LOCUS_36830 160082 160303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 161237 160287 gene locus_tag LOCUS_36840 161237 160287 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113669.1 protein_id gnl|my_center|LOCUS_36840 162597 161221 gene locus_tag LOCUS_36850 162597 161221 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113670.1 protein_id gnl|my_center|LOCUS_36850 162783 163916 gene locus_tag LOCUS_36860 162783 163916 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113671.1 protein_id gnl|my_center|LOCUS_36860 164287 164018 gene locus_tag LOCUS_36870 164287 164018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113672.1 protein_id gnl|my_center|LOCUS_36870 164865 164581 gene locus_tag LOCUS_36880 164865 164581 CDS product DUF2061 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115518.1 protein_id gnl|my_center|LOCUS_36880 165371 164862 gene locus_tag LOCUS_36890 165371 164862 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113674.1 protein_id gnl|my_center|LOCUS_36890 165625 166509 gene locus_tag LOCUS_36900 165625 166509 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113675.1 protein_id gnl|my_center|LOCUS_36900 166593 166763 gene locus_tag LOCUS_36910 166593 166763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 166868 167293 gene locus_tag LOCUS_36920 166868 167293 CDS product low affinity iron permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113677.1 protein_id gnl|my_center|LOCUS_36920 168479 167313 gene locus_tag LOCUS_36930 168479 167313 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113678.1 protein_id gnl|my_center|LOCUS_36930 168739 169293 gene locus_tag LOCUS_36940 168739 169293 CDS product ClpP family protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113679.1 protein_id gnl|my_center|LOCUS_36940 169469 169813 gene locus_tag LOCUS_36950 169469 169813 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113680.1 protein_id gnl|my_center|LOCUS_36950 171112 169976 gene locus_tag LOCUS_36960 gene exoY 171112 169976 CDS product type III secretion system adenylate cyclase effector ExoY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115517.1 protein_id gnl|my_center|LOCUS_36960 171341 171754 gene locus_tag LOCUS_36970 171341 171754 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113682.1 protein_id gnl|my_center|LOCUS_36970 171980 171714 gene locus_tag LOCUS_36980 171980 171714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 172333 172109 gene locus_tag LOCUS_36990 172333 172109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 172229 172492 gene locus_tag LOCUS_37000 gene hcnA 172229 172492 CDS product cyanide-forming glycine dehydrogenase subunit HcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113684.1 protein_id gnl|my_center|LOCUS_37000 172489 173883 gene locus_tag LOCUS_37010 gene hcnB 172489 173883 CDS product cyanide-forming glycine dehydrogenase subunit HcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113685.1 protein_id gnl|my_center|LOCUS_37010 173886 175139 gene locus_tag LOCUS_37020 gene hcnC 173886 175139 CDS product cyanide-forming glycine dehydrogenase subunit HcnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113686.1 protein_id gnl|my_center|LOCUS_37020 175293 175877 gene locus_tag LOCUS_37030 175293 175877 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074097.1 protein_id gnl|my_center|LOCUS_37030 176008 177045 gene locus_tag LOCUS_37040 176008 177045 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113689.1 protein_id gnl|my_center|LOCUS_37040 177042 177386 gene locus_tag LOCUS_37050 177042 177386 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113690.1 protein_id gnl|my_center|LOCUS_37050 177392 178267 gene locus_tag LOCUS_37060 177392 178267 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113691.1 protein_id gnl|my_center|LOCUS_37060 178355 179950 gene locus_tag LOCUS_37070 178355 179950 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113692.1 protein_id gnl|my_center|LOCUS_37070 180075 180959 gene locus_tag LOCUS_37080 180075 180959 CDS product DUF1911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113693.1 protein_id gnl|my_center|LOCUS_37080 181652 180975 gene locus_tag LOCUS_37090 181652 180975 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113694.1 protein_id gnl|my_center|LOCUS_37090 182370 181654 gene locus_tag LOCUS_37100 182370 181654 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089046.1 protein_id gnl|my_center|LOCUS_37100 183257 182451 gene locus_tag LOCUS_37110 183257 182451 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089047.1 protein_id gnl|my_center|LOCUS_37110 184032 183556 gene locus_tag LOCUS_37120 184032 183556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089049.1 protein_id gnl|my_center|LOCUS_37120 185061 184114 gene locus_tag LOCUS_37130 185061 184114 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089050.1 protein_id gnl|my_center|LOCUS_37130 186649 185129 gene locus_tag LOCUS_37140 186649 185129 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113695.1 protein_id gnl|my_center|LOCUS_37140 187176 186646 gene locus_tag LOCUS_37150 187176 186646 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113696.1 protein_id gnl|my_center|LOCUS_37150 188217 187204 gene locus_tag LOCUS_37160 188217 187204 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004343538.1 protein_id gnl|my_center|LOCUS_37160 188484 189809 gene locus_tag LOCUS_37170 188484 189809 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113698.1 protein_id gnl|my_center|LOCUS_37170 189802 190761 gene locus_tag LOCUS_37180 189802 190761 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113699.1 protein_id gnl|my_center|LOCUS_37180 190758 191771 gene locus_tag LOCUS_37190 190758 191771 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113700.1 protein_id gnl|my_center|LOCUS_37190 191944 193194 gene locus_tag LOCUS_37200 191944 193194 CDS product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115516.1 protein_id gnl|my_center|LOCUS_37200 193380 194702 gene locus_tag LOCUS_37210 193380 194702 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113702.1 protein_id gnl|my_center|LOCUS_37210 194733 195908 gene locus_tag LOCUS_37220 194733 195908 CDS product L-lyxonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113703.1 protein_id gnl|my_center|LOCUS_37220 195936 196931 gene locus_tag LOCUS_37230 gene gguC 195936 196931 CDS product GguC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111007.1 protein_id gnl|my_center|LOCUS_37230 197059 198642 gene locus_tag LOCUS_37240 197059 198642 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113704.1 protein_id gnl|my_center|LOCUS_37240 199291 199911 gene locus_tag LOCUS_37250 199291 199911 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107436.1 protein_id gnl|my_center|LOCUS_37250 >Feature sequence13 1100 207 gene locus_tag LOCUS_37260 1100 207 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114492.1 protein_id gnl|my_center|LOCUS_37260 1196 1585 gene locus_tag LOCUS_37270 1196 1585 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091885.1 protein_id gnl|my_center|LOCUS_37270 1572 2258 gene locus_tag LOCUS_37280 1572 2258 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102323.1 protein_id gnl|my_center|LOCUS_37280 2387 3166 gene locus_tag LOCUS_37290 2387 3166 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114490.1 protein_id gnl|my_center|LOCUS_37290 3163 4059 gene locus_tag LOCUS_37300 3163 4059 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102328.1 protein_id gnl|my_center|LOCUS_37300 4158 4451 gene locus_tag LOCUS_37310 4158 4451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114489.1 protein_id gnl|my_center|LOCUS_37310 4567 5478 gene locus_tag LOCUS_37320 4567 5478 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111019.1 protein_id gnl|my_center|LOCUS_37320 5595 6365 gene locus_tag LOCUS_37330 5595 6365 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091874.1 protein_id gnl|my_center|LOCUS_37330 6729 6385 gene locus_tag LOCUS_37340 6729 6385 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091873.1 protein_id gnl|my_center|LOCUS_37340 8170 6764 gene locus_tag LOCUS_37350 8170 6764 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102335.1 protein_id gnl|my_center|LOCUS_37350 9067 8261 gene locus_tag LOCUS_37360 9067 8261 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119583.1 protein_id gnl|my_center|LOCUS_37360 9289 11046 gene locus_tag LOCUS_37370 9289 11046 CDS product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102337.1 protein_id gnl|my_center|LOCUS_37370 11103 12473 gene locus_tag LOCUS_37380 11103 12473 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114488.1 protein_id gnl|my_center|LOCUS_37380 12623 15106 gene locus_tag LOCUS_37390 12623 15106 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114487.1 protein_id gnl|my_center|LOCUS_37390 15925 15113 gene locus_tag LOCUS_37400 15925 15113 CDS product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106976.1 protein_id gnl|my_center|LOCUS_37400 16171 17196 gene locus_tag LOCUS_37410 16171 17196 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091859.1 protein_id gnl|my_center|LOCUS_37410 17338 18435 gene locus_tag LOCUS_37420 gene pdhA 17338 18435 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114486.1 protein_id gnl|my_center|LOCUS_37420 18428 19429 gene locus_tag LOCUS_37430 18428 19429 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114485.1 protein_id gnl|my_center|LOCUS_37430 19447 20559 gene locus_tag LOCUS_37440 19447 20559 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114484.1 protein_id gnl|my_center|LOCUS_37440 20958 20560 gene locus_tag LOCUS_37450 20958 20560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 21636 21052 gene locus_tag LOCUS_37460 21636 21052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114483.1 protein_id gnl|my_center|LOCUS_37460 21938 21672 gene locus_tag LOCUS_37470 21938 21672 CDS product YebG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091854.1 protein_id gnl|my_center|LOCUS_37470 22148 22417 gene locus_tag LOCUS_37480 22148 22417 CDS product DUF2790 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091850.1 protein_id gnl|my_center|LOCUS_37480 22537 22755 gene locus_tag LOCUS_37490 22537 22755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112066.1 protein_id gnl|my_center|LOCUS_37490 22833 23348 gene locus_tag LOCUS_37500 22833 23348 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114482.1 protein_id gnl|my_center|LOCUS_37500 23413 24399 gene locus_tag LOCUS_37510 23413 24399 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147971.1 protein_id gnl|my_center|LOCUS_37510 24633 27284 gene locus_tag LOCUS_37520 gene hasR 24633 27284 CDS product heme uptake receptor HasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004345215.1 protein_id gnl|my_center|LOCUS_37520 27370 27987 gene locus_tag LOCUS_37530 gene hasA 27370 27987 CDS product heme acquisition protein HasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115011.1 protein_id gnl|my_center|LOCUS_37530 28205 29995 gene locus_tag LOCUS_37540 28205 29995 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147968.1 protein_id gnl|my_center|LOCUS_37540 29992 31323 gene locus_tag LOCUS_37550 29992 31323 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098666.1 protein_id gnl|my_center|LOCUS_37550 31320 32675 gene locus_tag LOCUS_37560 31320 32675 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113107.1 protein_id gnl|my_center|LOCUS_37560 32955 32668 gene locus_tag LOCUS_37570 32955 32668 CDS product DUF3509 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091839.1 protein_id gnl|my_center|LOCUS_37570 33130 33615 gene locus_tag LOCUS_37580 33130 33615 CDS product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091838.1 protein_id gnl|my_center|LOCUS_37580 33728 34699 gene locus_tag LOCUS_37590 33728 34699 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091837.1 protein_id gnl|my_center|LOCUS_37590 34703 35875 gene locus_tag LOCUS_37600 34703 35875 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098671.1 protein_id gnl|my_center|LOCUS_37600 35872 37005 gene locus_tag LOCUS_37610 35872 37005 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113108.1 protein_id gnl|my_center|LOCUS_37610 37059 37400 gene locus_tag LOCUS_37620 37059 37400 CDS product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098676.1 protein_id gnl|my_center|LOCUS_37620 38328 37402 gene locus_tag LOCUS_37630 38328 37402 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091833.1 protein_id gnl|my_center|LOCUS_37630 38602 39378 gene locus_tag LOCUS_37640 gene fpr 38602 39378 CDS product ferredoxin-NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091832.1 protein_id gnl|my_center|LOCUS_37640 39997 39461 gene locus_tag LOCUS_37650 39997 39461 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113109.1 protein_id gnl|my_center|LOCUS_37650 40841 40014 gene locus_tag LOCUS_37660 40841 40014 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113110.1 protein_id gnl|my_center|LOCUS_37660 41746 40832 gene locus_tag LOCUS_37670 41746 40832 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113111.1 protein_id gnl|my_center|LOCUS_37670 43029 41743 gene locus_tag LOCUS_37680 43029 41743 CDS product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113112.1 protein_id gnl|my_center|LOCUS_37680 44936 43026 gene locus_tag LOCUS_37690 gene nosZ 44936 43026 CDS product TAT-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098686.1 protein_id gnl|my_center|LOCUS_37690 47075 44979 gene locus_tag LOCUS_37700 47075 44979 CDS product regulatory protein NosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004345196.1 protein_id gnl|my_center|LOCUS_37700 47768 47355 gene locus_tag LOCUS_37710 47768 47355 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098688.1 protein_id gnl|my_center|LOCUS_37710 47830 48132 gene locus_tag LOCUS_37720 47830 48132 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113114.1 protein_id gnl|my_center|LOCUS_37720 48834 48139 gene locus_tag LOCUS_37730 gene tsaA 48834 48139 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113115.1 protein_id gnl|my_center|LOCUS_37730 49657 48887 gene locus_tag LOCUS_37740 gene rhlG 49657 48887 CDS product 3-oxoacyl-ACP reductase RhlG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113116.1 protein_id gnl|my_center|LOCUS_37740 50120 49755 gene locus_tag LOCUS_37750 50120 49755 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113117.1 protein_id gnl|my_center|LOCUS_37750 50600 50274 gene locus_tag LOCUS_37760 gene amrZ 50600 50274 CDS product transcriptional regulator AmrZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091802.1 protein_id gnl|my_center|LOCUS_37760 50961 51797 gene locus_tag LOCUS_37770 gene phnC 50961 51797 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113118.1 protein_id gnl|my_center|LOCUS_37770 51850 52854 gene locus_tag LOCUS_37780 gene phnD 51850 52854 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113119.1 protein_id gnl|my_center|LOCUS_37780 52923 53717 gene locus_tag LOCUS_37790 gene phnE 52923 53717 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091793.1 protein_id gnl|my_center|LOCUS_37790 53738 54460 gene locus_tag LOCUS_37800 gene phnF 53738 54460 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113121.1 protein_id gnl|my_center|LOCUS_37800 54470 54928 gene locus_tag LOCUS_37810 gene phnG 54470 54928 CDS product phosphonate C-P lyase system protein PhnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098697.1 protein_id gnl|my_center|LOCUS_37810 54928 55557 gene locus_tag LOCUS_37820 gene phnH 54928 55557 CDS product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113122.1 protein_id gnl|my_center|LOCUS_37820 55557 56657 gene locus_tag LOCUS_37830 55557 56657 CDS product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091786.1 protein_id gnl|my_center|LOCUS_37830 56654 57538 gene locus_tag LOCUS_37840 56654 57538 CDS product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113123.1 protein_id gnl|my_center|LOCUS_37840 57535 58350 gene locus_tag LOCUS_37850 gene phnK 57535 58350 CDS product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091781.1 protein_id gnl|my_center|LOCUS_37850 58400 59116 gene locus_tag LOCUS_37860 gene phnL 58400 59116 CDS product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098702.1 protein_id gnl|my_center|LOCUS_37860 59106 60269 gene locus_tag LOCUS_37870 59106 60269 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113124.1 protein_id gnl|my_center|LOCUS_37870 60269 60826 gene locus_tag LOCUS_37880 gene phnN 60269 60826 CDS product phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109293.1 protein_id gnl|my_center|LOCUS_37880 60817 61587 gene locus_tag LOCUS_37890 gene phnP 60817 61587 CDS product phosphonate metabolism protein PhnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113125.1 protein_id gnl|my_center|LOCUS_37890 61811 61626 gene locus_tag LOCUS_37900 61811 61626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098706.1 protein_id gnl|my_center|LOCUS_37900 62009 61863 gene locus_tag LOCUS_37910 62009 61863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091766.1 protein_id gnl|my_center|LOCUS_37910 62377 62099 gene locus_tag LOCUS_37920 62377 62099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113127.1 protein_id gnl|my_center|LOCUS_37920 63088 62570 gene locus_tag LOCUS_37930 63088 62570 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004345177.1 protein_id gnl|my_center|LOCUS_37930 63208 63284 gene locus_tag LOCUS_t00330 63208 63284 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 65400 66026 gene locus_tag LOCUS_37940 65400 66026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 66041 68782 gene locus_tag LOCUS_37950 66041 68782 CDS product RHS repeat-associated core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267592.1 protein_id gnl|my_center|LOCUS_37950 68791 69030 gene locus_tag LOCUS_37960 68791 69030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 69192 69267 gene locus_tag LOCUS_t00340 69192 69267 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 69656 69318 gene locus_tag LOCUS_37970 69656 69318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109297.1 protein_id gnl|my_center|LOCUS_37970 69923 70963 gene locus_tag LOCUS_37980 69923 70963 CDS product aliphatic amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113129.1 protein_id gnl|my_center|LOCUS_37980 71046 72161 gene locus_tag LOCUS_37990 71046 72161 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113130.1 protein_id gnl|my_center|LOCUS_37990 72187 73344 gene locus_tag LOCUS_38000 gene amiC 72187 73344 CDS product aliphatic amidase expression-regulating protein AmiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091751.1 protein_id gnl|my_center|LOCUS_38000 73341 73931 gene locus_tag LOCUS_38010 gene amiR 73341 73931 CDS product transcriptional antitermination factor AmiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113131.1 protein_id gnl|my_center|LOCUS_38010 73974 74492 gene locus_tag LOCUS_38020 73974 74492 CDS product AmiS/UreI family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098725.1 protein_id gnl|my_center|LOCUS_38020 74893 74546 gene locus_tag LOCUS_38030 gene lecB 74893 74546 CDS product fucose-binding lectin LecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098728.1 protein_id gnl|my_center|LOCUS_38030 75415 76419 gene locus_tag LOCUS_38040 75415 76419 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119629.1 protein_id gnl|my_center|LOCUS_38040 76424 77452 gene locus_tag LOCUS_38050 76424 77452 CDS product DUF2955 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122410.1 protein_id gnl|my_center|LOCUS_38050 78335 77457 gene locus_tag LOCUS_38060 78335 77457 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098734.1 protein_id gnl|my_center|LOCUS_38060 79738 78392 gene locus_tag LOCUS_38070 gene dsdA 79738 78392 CDS product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113132.1 protein_id gnl|my_center|LOCUS_38070 79962 81305 gene locus_tag LOCUS_38080 79962 81305 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895657.1 protein_id gnl|my_center|LOCUS_38080 81489 82793 gene locus_tag LOCUS_38090 81489 82793 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098737.1 protein_id gnl|my_center|LOCUS_38090 83218 83311 gene locus_tag LOCUS_t00350 83218 83311 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 84199 83450 gene locus_tag LOCUS_38100 gene flgZ 84199 83450 CDS product flagellar brake protein FlgZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119635.1 protein_id gnl|my_center|LOCUS_38100 84740 84270 gene locus_tag LOCUS_38110 gene flgN 84740 84270 CDS product flagellar export chaperone FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113135.1 protein_id gnl|my_center|LOCUS_38110 85118 84795 gene locus_tag LOCUS_38120 gene flgM 85118 84795 CDS product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098742.1 protein_id gnl|my_center|LOCUS_38120 85961 85263 gene locus_tag LOCUS_38130 gene flgA 85961 85263 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098745.1 protein_id gnl|my_center|LOCUS_38130 86093 87025 gene locus_tag LOCUS_38140 86093 87025 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098747.1 protein_id gnl|my_center|LOCUS_38140 87102 87926 gene locus_tag LOCUS_38150 gene cheR 87102 87926 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091728.1 protein_id gnl|my_center|LOCUS_38150 88241 88546 gene locus_tag LOCUS_38160 gene hsbA 88241 88546 CDS product anti-anti sigma factor HsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 protein_id gnl|my_center|LOCUS_38160 88548 90263 gene locus_tag LOCUS_38170 gene hsbR 88548 90263 CDS product two-component system response regulator HsbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098751.1 protein_id gnl|my_center|LOCUS_38170 90380 90679 gene locus_tag LOCUS_38180 gene htpB 90380 90679 CDS product two-component system sensor histidine kinase HtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109305.1 protein_id gnl|my_center|LOCUS_38180 90763 92901 gene locus_tag LOCUS_38190 gene recQ 90763 92901 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091724.1 protein_id gnl|my_center|LOCUS_38190 92996 94159 gene locus_tag LOCUS_38200 92996 94159 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119637.1 protein_id gnl|my_center|LOCUS_38200 94310 95326 gene locus_tag LOCUS_38210 94310 95326 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098754.1 protein_id gnl|my_center|LOCUS_38210 95444 95878 gene locus_tag LOCUS_38220 95444 95878 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113137.1 protein_id gnl|my_center|LOCUS_38220 96155 98203 gene locus_tag LOCUS_38230 96155 98203 CDS product FimV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147952.1 protein_id gnl|my_center|LOCUS_38230 100397 98211 gene locus_tag LOCUS_38240 gene plpD 100397 98211 CDS product patatin-like phospholipase PlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113139.1 protein_id gnl|my_center|LOCUS_38240 100466 100756 gene locus_tag LOCUS_38250 100466 100756 CDS product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091717.1 protein_id gnl|my_center|LOCUS_38250 100852 101844 gene locus_tag LOCUS_38260 gene rfaD 100852 101844 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113140.1 protein_id gnl|my_center|LOCUS_38260 103021 101855 gene locus_tag LOCUS_38270 103021 101855 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106206.1 protein_id gnl|my_center|LOCUS_38270 103925 103113 gene locus_tag LOCUS_38280 103925 103113 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119643.1 protein_id gnl|my_center|LOCUS_38280 104222 103983 gene locus_tag LOCUS_38290 104222 103983 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106204.1 protein_id gnl|my_center|LOCUS_38290 105228 104236 gene locus_tag LOCUS_38300 105228 104236 CDS product beta-ketoacyl-ACP synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091712.1 protein_id gnl|my_center|LOCUS_38300 105657 105232 gene locus_tag LOCUS_38310 105657 105232 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091711.1 protein_id gnl|my_center|LOCUS_38310 106910 105654 gene locus_tag LOCUS_38320 106910 105654 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106199.1 protein_id gnl|my_center|LOCUS_38320 107817 106903 gene locus_tag LOCUS_38330 107817 106903 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106196.1 protein_id gnl|my_center|LOCUS_38330 109144 107819 gene locus_tag LOCUS_38340 109144 107819 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119646.1 protein_id gnl|my_center|LOCUS_38340 110310 109144 gene locus_tag LOCUS_38350 110310 109144 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091709.1 protein_id gnl|my_center|LOCUS_38350 117365 110307 gene locus_tag LOCUS_38360 117365 110307 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113143.1 protein_id gnl|my_center|LOCUS_38360 117847 118452 gene locus_tag LOCUS_38370 117847 118452 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091706.1 protein_id gnl|my_center|LOCUS_38370 119682 118795 gene locus_tag LOCUS_38380 119682 118795 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113144.1 protein_id gnl|my_center|LOCUS_38380 121470 119692 gene locus_tag LOCUS_38390 121470 119692 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113145.1 protein_id gnl|my_center|LOCUS_38390 122342 121467 gene locus_tag LOCUS_38400 122342 121467 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113146.1 protein_id gnl|my_center|LOCUS_38400 122654 123466 gene locus_tag LOCUS_38410 122654 123466 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003143427.1 protein_id gnl|my_center|LOCUS_38410 124388 123474 gene locus_tag LOCUS_38420 124388 123474 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113148.1 protein_id gnl|my_center|LOCUS_38420 124477 124932 gene locus_tag LOCUS_38430 124477 124932 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091697.1 protein_id gnl|my_center|LOCUS_38430 125163 127241 gene locus_tag LOCUS_38440 125163 127241 CDS product phospholipase C, phosphocholine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113149.1 protein_id gnl|my_center|LOCUS_38440 127799 127299 gene locus_tag LOCUS_38450 127799 127299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113150.1 protein_id gnl|my_center|LOCUS_38450 128593 127865 gene locus_tag LOCUS_38460 128593 127865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113151.1 protein_id gnl|my_center|LOCUS_38460 129487 128717 gene locus_tag LOCUS_38470 gene phnE 129487 128717 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113152.1 protein_id gnl|my_center|LOCUS_38470 130317 129484 gene locus_tag LOCUS_38480 130317 129484 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113153.1 protein_id gnl|my_center|LOCUS_38480 131114 130311 gene locus_tag LOCUS_38490 131114 130311 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113154.1 protein_id gnl|my_center|LOCUS_38490 131968 131111 gene locus_tag LOCUS_38500 131968 131111 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119656.1 protein_id gnl|my_center|LOCUS_38500 132117 133007 gene locus_tag LOCUS_38510 132117 133007 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113156.1 protein_id gnl|my_center|LOCUS_38510 135191 133011 gene locus_tag LOCUS_38520 135191 133011 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895656.1 protein_id gnl|my_center|LOCUS_38520 135518 137173 gene locus_tag LOCUS_38530 135518 137173 CDS product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091675.1 protein_id gnl|my_center|LOCUS_38530 137697 137242 gene locus_tag LOCUS_38540 137697 137242 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091672.1 protein_id gnl|my_center|LOCUS_38540 140826 137980 gene locus_tag LOCUS_38550 gene rapA 140826 137980 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119658.1 protein_id gnl|my_center|LOCUS_38550 141068 141376 gene locus_tag LOCUS_38560 141068 141376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091664.1 protein_id gnl|my_center|LOCUS_38560 141430 142032 gene locus_tag LOCUS_38570 141430 142032 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115462.1 protein_id gnl|my_center|LOCUS_38570 142029 142190 gene locus_tag LOCUS_38580 142029 142190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 142761 144755 gene locus_tag LOCUS_38590 142761 144755 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113160.1 protein_id gnl|my_center|LOCUS_38590 144742 144945 gene locus_tag LOCUS_38600 144742 144945 CDS product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091655.1 protein_id gnl|my_center|LOCUS_38600 144972 145829 gene locus_tag LOCUS_38610 144972 145829 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091654.1 protein_id gnl|my_center|LOCUS_38610 146985 145810 gene locus_tag LOCUS_38620 146985 145810 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113161.1 protein_id gnl|my_center|LOCUS_38620 147516 147136 gene locus_tag LOCUS_38630 147516 147136 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091647.1 protein_id gnl|my_center|LOCUS_38630 148553 147603 gene locus_tag LOCUS_38640 148553 147603 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115465.1 protein_id gnl|my_center|LOCUS_38640 148800 150488 gene locus_tag LOCUS_38650 gene fadD2 148800 150488 CDS product long-chain-fatty-acid--CoA ligase FadD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091644.1 protein_id gnl|my_center|LOCUS_38650 150723 152411 gene locus_tag LOCUS_38660 gene fadD1 150723 152411 CDS product long-chain-fatty-acid--CoA ligase FadD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091643.1 protein_id gnl|my_center|LOCUS_38660 152823 156803 gene locus_tag LOCUS_38670 gene hrpA 152823 156803 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105494.1 protein_id gnl|my_center|LOCUS_38670 158306 156876 gene locus_tag LOCUS_38680 gene phoA 158306 156876 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113164.1 protein_id gnl|my_center|LOCUS_38680 158511 158948 gene locus_tag LOCUS_38690 158511 158948 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113165.1 protein_id gnl|my_center|LOCUS_38690 159177 161243 gene locus_tag LOCUS_38700 gene tssI 159177 161243 CDS product type VI secretion system tip protein TssI/VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147940.1 protein_id gnl|my_center|LOCUS_38700 161253 162068 gene locus_tag LOCUS_38710 161253 162068 CDS product DUF4123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114071.1 protein_id gnl|my_center|LOCUS_38710 162570 162827 gene locus_tag LOCUS_38720 162570 162827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38720 163107 163658 gene locus_tag LOCUS_38730 163107 163658 CDS product DUF3304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107600.1 protein_id gnl|my_center|LOCUS_38730 164189 166324 gene locus_tag LOCUS_38740 164189 166324 CDS product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895654.1 protein_id gnl|my_center|LOCUS_38740 166776 166363 gene locus_tag LOCUS_38750 166776 166363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091632.1 protein_id gnl|my_center|LOCUS_38750 166889 167359 gene locus_tag LOCUS_38760 166889 167359 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119669.1 protein_id gnl|my_center|LOCUS_38760 167878 167363 gene locus_tag LOCUS_38770 167878 167363 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091630.1 protein_id gnl|my_center|LOCUS_38770 168369 169490 gene locus_tag LOCUS_38780 168369 169490 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119670.1 protein_id gnl|my_center|LOCUS_38780 169493 170104 gene locus_tag LOCUS_38790 169493 170104 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091628.1 protein_id gnl|my_center|LOCUS_38790 170098 170337 gene locus_tag LOCUS_38800 170098 170337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 170743 171057 gene locus_tag LOCUS_38810 170743 171057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091625.1 protein_id gnl|my_center|LOCUS_38810 171076 171930 gene locus_tag LOCUS_38820 171076 171930 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114074.1 protein_id gnl|my_center|LOCUS_38820 171927 172661 gene locus_tag LOCUS_38830 171927 172661 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114075.1 protein_id gnl|my_center|LOCUS_38830 172664 173254 gene locus_tag LOCUS_38840 172664 173254 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114076.1 protein_id gnl|my_center|LOCUS_38840 173501 174817 gene locus_tag LOCUS_38850 gene oprO 173501 174817 CDS product outer membrane porin OprO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104423.1 protein_id gnl|my_center|LOCUS_38850 175327 176598 gene locus_tag LOCUS_38860 gene oprP 175327 176598 CDS product outer membrane porin OprP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119678.1 protein_id gnl|my_center|LOCUS_38860 176767 177066 gene locus_tag LOCUS_38870 176767 177066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091621.1 protein_id gnl|my_center|LOCUS_38870 177191 178003 gene locus_tag LOCUS_38880 177191 178003 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114078.1 protein_id gnl|my_center|LOCUS_38880 178236 178658 gene locus_tag LOCUS_38890 178236 178658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091617.1 protein_id gnl|my_center|LOCUS_38890 178655 178984 gene locus_tag LOCUS_38900 178655 178984 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111657.1 protein_id gnl|my_center|LOCUS_38900 179350 179063 gene locus_tag LOCUS_38910 179350 179063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091615.1 protein_id gnl|my_center|LOCUS_38910 179517 179900 gene locus_tag LOCUS_38920 179517 179900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091614.1 protein_id gnl|my_center|LOCUS_38920 179969 184315 gene locus_tag LOCUS_38930 179969 184315 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147933.1 protein_id gnl|my_center|LOCUS_38930 187802 184323 gene locus_tag LOCUS_38940 187802 184323 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114080.1 protein_id gnl|my_center|LOCUS_38940 188086 188655 gene locus_tag LOCUS_38950 188086 188655 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119682.1 protein_id gnl|my_center|LOCUS_38950 188722 189576 gene locus_tag LOCUS_38960 188722 189576 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115566.1 protein_id gnl|my_center|LOCUS_38960 189673 191838 gene locus_tag LOCUS_38970 189673 191838 CDS product TonB-dependent receptor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115567.1 protein_id gnl|my_center|LOCUS_38970 192013 193887 gene locus_tag LOCUS_38980 192013 193887 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091605.1 protein_id gnl|my_center|LOCUS_38980 194157 193948 gene locus_tag LOCUS_38990 194157 193948 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115568.1 protein_id gnl|my_center|LOCUS_38990 194686 194372 gene locus_tag LOCUS_39000 gene sugE 194686 194372 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091603.1 protein_id gnl|my_center|LOCUS_39000 195761 194826 gene locus_tag LOCUS_39010 195761 194826 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115569.1 protein_id gnl|my_center|LOCUS_39010 196768 195848 gene locus_tag LOCUS_39020 gene rdgC 196768 195848 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115570.1 protein_id gnl|my_center|LOCUS_39020 196933 197008 gene locus_tag LOCUS_t00360 196933 197008 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence14 381 1631 gene locus_tag LOCUS_39030 381 1631 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148382.1 protein_id gnl|my_center|LOCUS_39030 1725 2045 gene locus_tag LOCUS_39040 1725 2045 CDS product sarcosine oxidase subunit delta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096781.1 protein_id gnl|my_center|LOCUS_39040 2042 5059 gene locus_tag LOCUS_39050 2042 5059 CDS product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003142077.1 protein_id gnl|my_center|LOCUS_39050 5153 5788 gene locus_tag LOCUS_39060 5153 5788 CDS product sarcosine oxidase subunit gamma family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096784.1 protein_id gnl|my_center|LOCUS_39060 5838 6695 gene locus_tag LOCUS_39070 5838 6695 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096786.1 protein_id gnl|my_center|LOCUS_39070 6902 8101 gene locus_tag LOCUS_39080 gene fdhA 6902 8101 CDS product formaldehyde dehydrogenase, glutathione-independent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096788.1 protein_id gnl|my_center|LOCUS_39080 8224 9141 gene locus_tag LOCUS_39090 8224 9141 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895705.1 protein_id gnl|my_center|LOCUS_39090 9755 9207 gene locus_tag LOCUS_39100 9755 9207 CDS product DUF3299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114096.1 protein_id gnl|my_center|LOCUS_39100 10062 9817 gene locus_tag LOCUS_39110 10062 9817 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096795.1 protein_id gnl|my_center|LOCUS_39110 11259 10177 gene locus_tag LOCUS_39120 11259 10177 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096798.1 protein_id gnl|my_center|LOCUS_39120 11781 11290 gene locus_tag LOCUS_39130 gene purE 11781 11290 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106314.1 protein_id gnl|my_center|LOCUS_39130 12162 13157 gene locus_tag LOCUS_39140 gene adhP 12162 13157 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096816.1 protein_id gnl|my_center|LOCUS_39140 14102 13194 gene locus_tag LOCUS_39150 14102 13194 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096819.1 protein_id gnl|my_center|LOCUS_39150 14278 15702 gene locus_tag LOCUS_39160 gene aspA 14278 15702 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096822.1 protein_id gnl|my_center|LOCUS_39160 17280 16066 gene locus_tag LOCUS_39170 17280 16066 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114098.1 protein_id gnl|my_center|LOCUS_39170 18792 17317 gene locus_tag LOCUS_39180 18792 17317 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114099.1 protein_id gnl|my_center|LOCUS_39180 18920 19369 gene locus_tag LOCUS_39190 18920 19369 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096834.1 protein_id gnl|my_center|LOCUS_39190 19378 20052 gene locus_tag LOCUS_39200 19378 20052 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114100.1 protein_id gnl|my_center|LOCUS_39200 21273 20077 gene locus_tag LOCUS_39210 gene mtr 21273 20077 CDS product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895706.1 protein_id gnl|my_center|LOCUS_39210 23334 21511 gene locus_tag LOCUS_39220 gene oadA 23334 21511 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105555.1 protein_id gnl|my_center|LOCUS_39220 24765 23350 gene locus_tag LOCUS_39230 24765 23350 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096848.1 protein_id gnl|my_center|LOCUS_39230 25057 25914 gene locus_tag LOCUS_39240 gene pycR 25057 25914 CDS product LysR family transcriptional regulator PycR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121355.1 protein_id gnl|my_center|LOCUS_39240 26083 25868 gene locus_tag LOCUS_39250 26083 25868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105559.1 protein_id gnl|my_center|LOCUS_39250 27071 26190 gene locus_tag LOCUS_39260 gene hexR 27071 26190 CDS product transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096857.1 protein_id gnl|my_center|LOCUS_39260 27157 28623 gene locus_tag LOCUS_39270 gene zwf 27157 28623 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096859.1 protein_id gnl|my_center|LOCUS_39270 28704 30098 gene locus_tag LOCUS_39280 gene yegQ 28704 30098 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105560.1 protein_id gnl|my_center|LOCUS_39280 30817 30092 gene locus_tag LOCUS_39290 30817 30092 CDS product DUF3142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707337.1 protein_id gnl|my_center|LOCUS_39290 33015 30814 gene locus_tag LOCUS_39300 33015 30814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114102.1 protein_id gnl|my_center|LOCUS_39300 35929 33074 gene locus_tag LOCUS_39310 35929 33074 CDS product GGDEF and EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096868.1 protein_id gnl|my_center|LOCUS_39310 36106 38292 gene locus_tag LOCUS_39320 gene uvrD 36106 38292 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096872.1 protein_id gnl|my_center|LOCUS_39320 38330 38758 gene locus_tag LOCUS_39330 38330 38758 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114104.1 protein_id gnl|my_center|LOCUS_39330 38856 40349 gene locus_tag LOCUS_39340 38856 40349 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096875.1 protein_id gnl|my_center|LOCUS_39340 40727 40930 gene locus_tag LOCUS_39350 40727 40930 CDS product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096877.1 protein_id gnl|my_center|LOCUS_39350 42131 40986 gene locus_tag LOCUS_39360 gene wbpZ 42131 40986 CDS product D-rhamnosyltransferase WbpZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114105.1 protein_id gnl|my_center|LOCUS_39360 43259 42132 gene locus_tag LOCUS_39370 43259 42132 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102573.1 protein_id gnl|my_center|LOCUS_39370 44625 43243 gene locus_tag LOCUS_39380 44625 43243 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096882.1 protein_id gnl|my_center|LOCUS_39380 45887 44622 gene locus_tag LOCUS_39390 45887 44622 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096884.1 protein_id gnl|my_center|LOCUS_39390 46684 45887 gene locus_tag LOCUS_39400 46684 45887 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096887.1 protein_id gnl|my_center|LOCUS_39400 48123 46684 gene locus_tag LOCUS_39410 48123 46684 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114106.1 protein_id gnl|my_center|LOCUS_39410 49098 48127 gene locus_tag LOCUS_39420 gene gmd 49098 48127 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096890.1 protein_id gnl|my_center|LOCUS_39420 50009 49095 gene locus_tag LOCUS_39430 gene rmd 50009 49095 CDS product GDP-6-deoxy-D-mannose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114107.1 protein_id gnl|my_center|LOCUS_39430 50417 52045 gene locus_tag LOCUS_39440 50417 52045 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114108.1 protein_id gnl|my_center|LOCUS_39440 52039 53340 gene locus_tag LOCUS_39450 52039 53340 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114109.1 protein_id gnl|my_center|LOCUS_39450 53337 54200 gene locus_tag LOCUS_39460 53337 54200 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114110.1 protein_id gnl|my_center|LOCUS_39460 54197 55339 gene locus_tag LOCUS_39470 54197 55339 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114111.1 protein_id gnl|my_center|LOCUS_39470 55333 56169 gene locus_tag LOCUS_39480 55333 56169 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096902.1 protein_id gnl|my_center|LOCUS_39480 56640 56957 gene locus_tag LOCUS_39490 56640 56957 CDS product DUF2388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096907.1 protein_id gnl|my_center|LOCUS_39490 57082 57375 gene locus_tag LOCUS_39500 57082 57375 CDS product DUF2388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096909.1 protein_id gnl|my_center|LOCUS_39500 57404 57739 gene locus_tag LOCUS_39510 57404 57739 CDS product DUF2388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096910.1 protein_id gnl|my_center|LOCUS_39510 57736 59694 gene locus_tag LOCUS_39520 57736 59694 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114114.1 protein_id gnl|my_center|LOCUS_39520 60221 59802 gene locus_tag LOCUS_39530 60221 59802 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102545.1 protein_id gnl|my_center|LOCUS_39530 60289 61233 gene locus_tag LOCUS_39540 60289 61233 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096914.1 protein_id gnl|my_center|LOCUS_39540 61230 61592 gene locus_tag LOCUS_39550 61230 61592 CDS product DUF2388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102543.1 protein_id gnl|my_center|LOCUS_39550 61872 63176 gene locus_tag LOCUS_39560 61872 63176 CDS product CitMHS family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096918.1 protein_id gnl|my_center|LOCUS_39560 63197 63961 gene locus_tag LOCUS_39570 63197 63961 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096920.1 protein_id gnl|my_center|LOCUS_39570 64581 63967 gene locus_tag LOCUS_39580 gene prfH 64581 63967 CDS product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114116.1 protein_id gnl|my_center|LOCUS_39580 65717 64578 gene locus_tag LOCUS_39590 65717 64578 CDS product RNA ligase RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114117.1 protein_id gnl|my_center|LOCUS_39590 66879 66085 gene locus_tag LOCUS_39600 66879 66085 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121370.1 protein_id gnl|my_center|LOCUS_39600 67239 68987 gene locus_tag LOCUS_39610 67239 68987 CDS product sodium-dependent inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096931.1 protein_id gnl|my_center|LOCUS_39610 69056 70429 gene locus_tag LOCUS_39620 69056 70429 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102849.1 protein_id gnl|my_center|LOCUS_39620 70995 70435 gene locus_tag LOCUS_39630 70995 70435 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096934.1 protein_id gnl|my_center|LOCUS_39630 72427 71138 gene locus_tag LOCUS_39640 72427 71138 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096941.1 protein_id gnl|my_center|LOCUS_39640 72801 73841 gene locus_tag LOCUS_39650 72801 73841 CDS product DUF5924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114118.1 protein_id gnl|my_center|LOCUS_39650 75089 73860 gene locus_tag LOCUS_39660 75089 73860 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102844.1 protein_id gnl|my_center|LOCUS_39660 76528 75194 gene locus_tag LOCUS_39670 gene gltP 76528 75194 CDS product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096956.1 protein_id gnl|my_center|LOCUS_39670 77708 77241 gene locus_tag LOCUS_39680 77708 77241 CDS product inhibitor of vertebrate lysozyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114119.1 protein_id gnl|my_center|LOCUS_39680 77891 77730 gene locus_tag LOCUS_39690 77891 77730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 78365 79714 gene locus_tag LOCUS_39700 gene algB 78365 79714 CDS product sigma-54-dependent response regulator transcription factor AlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102840.1 protein_id gnl|my_center|LOCUS_39700 79711 81498 gene locus_tag LOCUS_39710 79711 81498 CDS product KinB sensor domain-containing domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114120.1 protein_id gnl|my_center|LOCUS_39710 82312 81533 gene locus_tag LOCUS_39720 gene ampDh2 82312 81533 CDS product N-acetylmuramoyl-L-alanine amidase AmpDh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096970.1 protein_id gnl|my_center|LOCUS_39720 82933 82340 gene locus_tag LOCUS_39730 82933 82340 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102836.1 protein_id gnl|my_center|LOCUS_39730 85066 83051 gene locus_tag LOCUS_39740 gene dgcP 85066 83051 CDS product diguanylate cyclase DgcP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114121.1 protein_id gnl|my_center|LOCUS_39740 85941 85063 gene locus_tag LOCUS_39750 85941 85063 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096975.1 protein_id gnl|my_center|LOCUS_39750 86592 85957 gene locus_tag LOCUS_39760 gene dsbA 86592 85957 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096976.1 protein_id gnl|my_center|LOCUS_39760 87365 86760 gene locus_tag LOCUS_39770 87365 86760 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102831.1 protein_id gnl|my_center|LOCUS_39770 87704 87411 gene locus_tag LOCUS_39780 87704 87411 CDS product cytochrome c5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096979.1 protein_id gnl|my_center|LOCUS_39780 87888 88535 gene locus_tag LOCUS_39790 gene yihA 87888 88535 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096980.1 protein_id gnl|my_center|LOCUS_39790 91540 88799 gene locus_tag LOCUS_39800 gene polA 91540 88799 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114123.1 protein_id gnl|my_center|LOCUS_39800 91618 91908 gene locus_tag LOCUS_39810 91618 91908 CDS product DUF2782 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096984.1 protein_id gnl|my_center|LOCUS_39810 91942 92892 gene locus_tag LOCUS_39820 91942 92892 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114124.1 protein_id gnl|my_center|LOCUS_39820 93870 93181 gene locus_tag LOCUS_39830 93870 93181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096987.1 protein_id gnl|my_center|LOCUS_39830 96091 93887 gene locus_tag LOCUS_39840 96091 93887 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895708.1 protein_id gnl|my_center|LOCUS_39840 97124 96201 gene locus_tag LOCUS_39850 97124 96201 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114126.1 protein_id gnl|my_center|LOCUS_39850 97194 97697 gene locus_tag LOCUS_39860 gene zur 97194 97697 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096992.1 protein_id gnl|my_center|LOCUS_39860 97697 98506 gene locus_tag LOCUS_39870 gene znuC 97697 98506 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114128.1 protein_id gnl|my_center|LOCUS_39870 98499 99287 gene locus_tag LOCUS_39880 gene znuB 98499 99287 CDS product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096998.1 protein_id gnl|my_center|LOCUS_39880 99326 100117 gene locus_tag LOCUS_39890 99326 100117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003142141.1 protein_id gnl|my_center|LOCUS_39890 100324 101331 gene locus_tag LOCUS_39900 100324 101331 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097002.1 protein_id gnl|my_center|LOCUS_39900 101331 102008 gene locus_tag LOCUS_39910 101331 102008 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097004.1 protein_id gnl|my_center|LOCUS_39910 102085 102867 gene locus_tag LOCUS_39920 102085 102867 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099728.1 protein_id gnl|my_center|LOCUS_39920 103070 103927 gene locus_tag LOCUS_39930 gene qapR 103070 103927 CDS product transcriptional repressor QapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099726.1 protein_id gnl|my_center|LOCUS_39930 103932 104585 gene locus_tag LOCUS_39940 103932 104585 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099724.1 protein_id gnl|my_center|LOCUS_39940 104582 105913 gene locus_tag LOCUS_39950 104582 105913 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114130.1 protein_id gnl|my_center|LOCUS_39950 105897 106649 gene locus_tag LOCUS_39960 105897 106649 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122323.1 protein_id gnl|my_center|LOCUS_39960 106751 108100 gene locus_tag LOCUS_39970 106751 108100 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099715.1 protein_id gnl|my_center|LOCUS_39970 109462 108119 gene locus_tag LOCUS_39980 109462 108119 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099712.1 protein_id gnl|my_center|LOCUS_39980 111225 109459 gene locus_tag LOCUS_39990 111225 109459 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114131.1 protein_id gnl|my_center|LOCUS_39990 110589 110683 gene locus_tag LOCUS_t00370 110589 110683 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 111307 112185 gene locus_tag LOCUS_40000 gene poxA 111307 112185 CDS product alpha/beta hydrolase PoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114132.1 protein_id gnl|my_center|LOCUS_40000 112256 113044 gene locus_tag LOCUS_40010 gene blaOXA 112256 113044 CDS product oxacillin-hydrolyzing class D beta-lactamase OXA-50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099707.1 protein_id gnl|my_center|LOCUS_40010 113464 113057 gene locus_tag LOCUS_40020 113464 113057 CDS product DUF3301 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895709.1 protein_id gnl|my_center|LOCUS_40020 113590 114456 gene locus_tag LOCUS_40030 gene pdxY 113590 114456 CDS product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114134.1 protein_id gnl|my_center|LOCUS_40030 115078 114494 gene locus_tag LOCUS_40040 115078 114494 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114135.1 protein_id gnl|my_center|LOCUS_40040 116783 115080 gene locus_tag LOCUS_40050 gene ybaL 116783 115080 CDS product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114136.1 protein_id gnl|my_center|LOCUS_40050 117644 117162 gene locus_tag LOCUS_40060 117644 117162 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121395.1 protein_id gnl|my_center|LOCUS_40060 117592 117774 gene locus_tag LOCUS_40070 117592 117774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 117805 118548 gene locus_tag LOCUS_40080 117805 118548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114137.1 protein_id gnl|my_center|LOCUS_40080 119354 118596 gene locus_tag LOCUS_40090 119354 118596 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097046.1 protein_id gnl|my_center|LOCUS_40090 120816 119449 gene locus_tag LOCUS_40100 120816 119449 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114138.1 protein_id gnl|my_center|LOCUS_40100 122212 120818 gene locus_tag LOCUS_40110 122212 120818 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004347154.1 protein_id gnl|my_center|LOCUS_40110 122328 123110 gene locus_tag LOCUS_40120 122328 123110 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099690.1 protein_id gnl|my_center|LOCUS_40120 123175 123855 gene locus_tag LOCUS_40130 123175 123855 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114140.1 protein_id gnl|my_center|LOCUS_40130 124084 123872 gene locus_tag LOCUS_40140 124084 123872 CDS product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097061.1 protein_id gnl|my_center|LOCUS_40140 124703 124302 gene locus_tag LOCUS_40150 124703 124302 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099687.1 protein_id gnl|my_center|LOCUS_40150 125754 124900 gene locus_tag LOCUS_40160 125754 124900 CDS product Tim44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099685.1 protein_id gnl|my_center|LOCUS_40160 126116 127873 gene locus_tag LOCUS_40170 126116 127873 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099684.1 protein_id gnl|my_center|LOCUS_40170 128189 129496 gene locus_tag LOCUS_40180 128189 129496 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097074.1 protein_id gnl|my_center|LOCUS_40180 130898 129912 gene locus_tag LOCUS_40190 gene tonB1 130898 129912 CDS product energy transducer TonB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895710.1 protein_id gnl|my_center|LOCUS_40190 131959 130991 gene locus_tag LOCUS_40200 131959 130991 CDS product CobW family GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269408.1 protein_id gnl|my_center|LOCUS_40200 132062 132430 gene locus_tag LOCUS_40210 132062 132430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099679.1 protein_id gnl|my_center|LOCUS_40210 133197 132583 gene locus_tag LOCUS_40220 133197 132583 CDS product DUF1826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114143.1 protein_id gnl|my_center|LOCUS_40220 134423 133221 gene locus_tag LOCUS_40230 gene zigA 134423 133221 CDS product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099674.1 protein_id gnl|my_center|LOCUS_40230 134842 134438 gene locus_tag LOCUS_40240 gene dksA 134842 134438 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097086.1 protein_id gnl|my_center|LOCUS_40240 134955 135371 gene locus_tag LOCUS_40250 134955 135371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097088.1 protein_id gnl|my_center|LOCUS_40250 136542 135349 gene locus_tag LOCUS_40260 136542 135349 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114144.1 protein_id gnl|my_center|LOCUS_40260 136642 137538 gene locus_tag LOCUS_40270 gene folE2 136642 137538 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099665.1 protein_id gnl|my_center|LOCUS_40270 137535 138095 gene locus_tag LOCUS_40280 137535 138095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099663.1 protein_id gnl|my_center|LOCUS_40280 138098 139435 gene locus_tag LOCUS_40290 138098 139435 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097095.1 protein_id gnl|my_center|LOCUS_40290 140724 139480 gene locus_tag LOCUS_40300 140724 139480 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114146.1 protein_id gnl|my_center|LOCUS_40300 141209 140811 gene locus_tag LOCUS_40310 141209 140811 CDS product DUF1850 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099655.1 protein_id gnl|my_center|LOCUS_40310 143230 141206 gene locus_tag LOCUS_40320 143230 141206 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099653.1 protein_id gnl|my_center|LOCUS_40320 144264 143305 gene locus_tag LOCUS_40330 144264 143305 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114147.1 protein_id gnl|my_center|LOCUS_40330 145612 144428 gene locus_tag LOCUS_40340 gene cfaB 145612 144428 CDS product C17 cyclopropane fatty acid synthase CfaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114148.1 protein_id gnl|my_center|LOCUS_40340 145850 146473 gene locus_tag LOCUS_40350 145850 146473 CDS product HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099642.1 protein_id gnl|my_center|LOCUS_40350 146831 148036 gene locus_tag LOCUS_40360 146831 148036 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114655.1 protein_id gnl|my_center|LOCUS_40360 149926 148091 gene locus_tag LOCUS_40370 gene glmS 149926 148091 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114654.1 protein_id gnl|my_center|LOCUS_40370 150715 149942 gene locus_tag LOCUS_40380 150715 149942 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114653.1 protein_id gnl|my_center|LOCUS_40380 151292 150783 gene locus_tag LOCUS_40390 151292 150783 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114652.1 protein_id gnl|my_center|LOCUS_40390 152670 151306 gene locus_tag LOCUS_40400 gene glmU 152670 151306 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114651.1 protein_id gnl|my_center|LOCUS_40400 153216 152791 gene locus_tag LOCUS_40410 153216 152791 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097128.1 protein_id gnl|my_center|LOCUS_40410 154634 153258 gene locus_tag LOCUS_40420 gene atpD 154634 153258 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097130.1 protein_id gnl|my_center|LOCUS_40420 155525 154665 gene locus_tag LOCUS_40430 gene atpG 155525 154665 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097132.1 protein_id gnl|my_center|LOCUS_40430 157120 155576 gene locus_tag LOCUS_40440 gene atpA 157120 155576 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097134.1 protein_id gnl|my_center|LOCUS_40440 157675 157139 gene locus_tag LOCUS_40450 157675 157139 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097135.1 protein_id gnl|my_center|LOCUS_40450 158157 157687 gene locus_tag LOCUS_40460 158157 157687 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100235.1 protein_id gnl|my_center|LOCUS_40460 158472 158215 gene locus_tag LOCUS_40470 158472 158215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 159391 158522 gene locus_tag LOCUS_40480 gene atpB 159391 158522 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100237.1 protein_id gnl|my_center|LOCUS_40480 159788 159408 gene locus_tag LOCUS_40490 159788 159408 CDS product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097239.1 protein_id gnl|my_center|LOCUS_40490 160824 159952 gene locus_tag LOCUS_40500 160824 159952 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_40500 161622 160834 gene locus_tag LOCUS_40510 gene soj 161622 160834 CDS product chromosome partitioning protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097243.1 protein_id gnl|my_center|LOCUS_40510 162286 161642 gene locus_tag LOCUS_40520 gene rsmG 162286 161642 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100242.1 protein_id gnl|my_center|LOCUS_40520 164181 162286 gene locus_tag LOCUS_40530 gene mnmG 164181 162286 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114649.1 protein_id gnl|my_center|LOCUS_40530 164874 164650 gene locus_tag LOCUS_40540 164874 164650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40540 166734 165367 gene locus_tag LOCUS_40550 gene mnmE 166734 165367 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100248.1 protein_id gnl|my_center|LOCUS_40550 168542 166806 gene locus_tag LOCUS_40560 gene yidC 168542 166806 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114648.1 protein_id gnl|my_center|LOCUS_40560 169190 168783 gene locus_tag LOCUS_40570 gene rnpA 169190 168783 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100251.1 protein_id gnl|my_center|LOCUS_40570 169865 171409 gene locus_tag LOCUS_40580 gene dnaA 169865 171409 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109151.1 protein_id gnl|my_center|LOCUS_40580 171438 172541 gene locus_tag LOCUS_40590 gene dnaN 171438 172541 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097262.1 protein_id gnl|my_center|LOCUS_40590 172551 173660 gene locus_tag LOCUS_40600 gene recF 172551 173660 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097265.1 protein_id gnl|my_center|LOCUS_40600 173657 176077 gene locus_tag LOCUS_40610 gene gyrB 173657 176077 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097268.1 protein_id gnl|my_center|LOCUS_40610 >Feature sequence15 3 854 gene locus_tag LOCUS_40620 3 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 882 1331 gene locus_tag LOCUS_40630 882 1331 CDS product DUF6484 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101196.1 protein_id gnl|my_center|LOCUS_40630 1348 2460 gene locus_tag LOCUS_40640 1348 2460 CDS product DUF2169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123798.1 protein_id gnl|my_center|LOCUS_40640 2457 3494 gene locus_tag LOCUS_40650 2457 3494 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115088.1 protein_id gnl|my_center|LOCUS_40650 3494 4654 gene locus_tag LOCUS_40660 gene tse7 3494 4654 CDS product type VI secretion system effector Dnase Tse7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115783.1 protein_id gnl|my_center|LOCUS_40660 4676 5596 gene locus_tag LOCUS_40670 gene tsi7 4676 5596 CDS product type IV secretion system immunity protein Tsi7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115069.1 protein_id gnl|my_center|LOCUS_40670 5593 6825 gene locus_tag LOCUS_40680 5593 6825 CDS product TIGR02270 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895495.1 protein_id gnl|my_center|LOCUS_40680 7201 7929 gene locus_tag LOCUS_40690 7201 7929 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115027.1 protein_id gnl|my_center|LOCUS_40690 8140 9711 gene locus_tag LOCUS_40700 8140 9711 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115028.1 protein_id gnl|my_center|LOCUS_40700 10336 9698 gene locus_tag LOCUS_40710 10336 9698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115620.1 protein_id gnl|my_center|LOCUS_40710 10732 11832 gene locus_tag LOCUS_40720 gene coxB 10732 11832 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101203.1 protein_id gnl|my_center|LOCUS_40720 11842 13434 gene locus_tag LOCUS_40730 gene ctaD 11842 13434 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083723.1 protein_id gnl|my_center|LOCUS_40730 13445 13999 gene locus_tag LOCUS_40740 13445 13999 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083725.1 protein_id gnl|my_center|LOCUS_40740 14010 14897 gene locus_tag LOCUS_40750 14010 14897 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115030.1 protein_id gnl|my_center|LOCUS_40750 15122 14913 gene locus_tag LOCUS_40760 15122 14913 CDS product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101213.1 protein_id gnl|my_center|LOCUS_40760 15138 15932 gene locus_tag LOCUS_40770 15138 15932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119510.1 protein_id gnl|my_center|LOCUS_40770 15907 16485 gene locus_tag LOCUS_40780 15907 16485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083738.1 protein_id gnl|my_center|LOCUS_40780 16550 17623 gene locus_tag LOCUS_40790 16550 17623 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115033.1 protein_id gnl|my_center|LOCUS_40790 17649 18563 gene locus_tag LOCUS_40800 gene cyoE 17649 18563 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083746.1 protein_id gnl|my_center|LOCUS_40800 18589 19224 gene locus_tag LOCUS_40810 gene senC 18589 19224 CDS product cytochrome c oxidase copper chaperone SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083748.1 protein_id gnl|my_center|LOCUS_40810 19716 19264 gene locus_tag LOCUS_40820 19716 19264 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083750.1 protein_id gnl|my_center|LOCUS_40820 19848 20321 gene locus_tag LOCUS_40830 19848 20321 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083753.1 protein_id gnl|my_center|LOCUS_40830 20578 21306 gene locus_tag LOCUS_40840 20578 21306 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115034.1 protein_id gnl|my_center|LOCUS_40840 21331 21918 gene locus_tag LOCUS_40850 21331 21918 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115035.1 protein_id gnl|my_center|LOCUS_40850 22148 23497 gene locus_tag LOCUS_40860 22148 23497 CDS product C4-dicarboxylate transporter DctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003142411.1 protein_id gnl|my_center|LOCUS_40860 23546 24232 gene locus_tag LOCUS_40870 23546 24232 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083762.1 protein_id gnl|my_center|LOCUS_40870 24333 25067 gene locus_tag LOCUS_40880 24333 25067 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115036.1 protein_id gnl|my_center|LOCUS_40880 25247 25657 gene locus_tag LOCUS_40890 25247 25657 CDS product aegerolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101225.1 protein_id gnl|my_center|LOCUS_40890 26597 25689 gene locus_tag LOCUS_40900 26597 25689 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083769.1 protein_id gnl|my_center|LOCUS_40900 27178 26897 gene locus_tag LOCUS_40910 gene parE 27178 26897 CDS product type II toxin-antitoxin system toxin ParE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083773.1 protein_id gnl|my_center|LOCUS_40910 27402 27175 gene locus_tag LOCUS_40920 27402 27175 CDS product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112628.1 protein_id gnl|my_center|LOCUS_40920 28198 27578 gene locus_tag LOCUS_40930 28198 27578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101226.1 protein_id gnl|my_center|LOCUS_40930 28299 28799 gene locus_tag LOCUS_40940 28299 28799 CDS product LEA type 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112629.1 protein_id gnl|my_center|LOCUS_40940 28872 29213 gene locus_tag LOCUS_40950 28872 29213 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101229.1 protein_id gnl|my_center|LOCUS_40950 30722 29295 gene locus_tag LOCUS_40960 gene gabP 30722 29295 CDS product GABA permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083784.1 protein_id gnl|my_center|LOCUS_40960 32384 30891 gene locus_tag LOCUS_40970 32384 30891 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101230.1 protein_id gnl|my_center|LOCUS_40970 32755 32468 gene locus_tag LOCUS_40980 gene bauB 32755 32468 CDS product beta-alanine degradation protein BauB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083790.1 protein_id gnl|my_center|LOCUS_40980 34101 32755 gene locus_tag LOCUS_40990 gene bauA 34101 32755 CDS product beta-alanine--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083801.1 protein_id gnl|my_center|LOCUS_40990 34236 35153 gene locus_tag LOCUS_41000 gene bauR 34236 35153 CDS product HTH-type transcriptional activator BauR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083805.1 protein_id gnl|my_center|LOCUS_41000 36636 35266 gene locus_tag LOCUS_41010 gene guaD 36636 35266 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003142418.1 protein_id gnl|my_center|LOCUS_41010 37747 39318 gene locus_tag LOCUS_41020 37747 39318 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112630.1 protein_id gnl|my_center|LOCUS_41020 39318 40415 gene locus_tag LOCUS_41030 39318 40415 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112631.1 protein_id gnl|my_center|LOCUS_41030 40437 41363 gene locus_tag LOCUS_41040 40437 41363 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112632.1 protein_id gnl|my_center|LOCUS_41040 41528 42091 gene locus_tag LOCUS_41050 gene ahpC 41528 42091 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083828.1 protein_id gnl|my_center|LOCUS_41050 42236 43801 gene locus_tag LOCUS_41060 gene ahpF 42236 43801 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111221.1 protein_id gnl|my_center|LOCUS_41060 44954 43881 gene locus_tag LOCUS_41070 gene ppk2 44954 43881 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121626.1 protein_id gnl|my_center|LOCUS_41070 45235 46584 gene locus_tag LOCUS_41080 45235 46584 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112635.1 protein_id gnl|my_center|LOCUS_41080 46692 47744 gene locus_tag LOCUS_41090 46692 47744 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147076.1 protein_id gnl|my_center|LOCUS_41090 48398 47772 gene locus_tag LOCUS_41100 48398 47772 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112637.1 protein_id gnl|my_center|LOCUS_41100 49066 48548 gene locus_tag LOCUS_41110 49066 48548 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112638.1 protein_id gnl|my_center|LOCUS_41110 49305 50402 gene locus_tag LOCUS_41120 49305 50402 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895496.1 protein_id gnl|my_center|LOCUS_41120 50475 51437 gene locus_tag LOCUS_41130 50475 51437 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112640.1 protein_id gnl|my_center|LOCUS_41130 51542 52492 gene locus_tag LOCUS_41140 51542 52492 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112641.1 protein_id gnl|my_center|LOCUS_41140 52647 53234 gene locus_tag LOCUS_41150 52647 53234 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112642.1 protein_id gnl|my_center|LOCUS_41150 53231 54226 gene locus_tag LOCUS_41160 53231 54226 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112643.1 protein_id gnl|my_center|LOCUS_41160 54374 56761 gene locus_tag LOCUS_41170 54374 56761 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112644.1 protein_id gnl|my_center|LOCUS_41170 57047 57964 gene locus_tag LOCUS_41180 gene pcaQ 57047 57964 CDS product pca operon transcription factor PcaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765677.1 protein_id gnl|my_center|LOCUS_41180 58099 58818 gene locus_tag LOCUS_41190 gene pcaH 58099 58818 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102187.1 protein_id gnl|my_center|LOCUS_41190 58829 59434 gene locus_tag LOCUS_41200 gene pcaG 58829 59434 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112645.1 protein_id gnl|my_center|LOCUS_41200 59641 60480 gene locus_tag LOCUS_41210 59641 60480 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083866.1 protein_id gnl|my_center|LOCUS_41210 60681 61784 gene locus_tag LOCUS_41220 gene triA 60681 61784 CDS product triclosan efflux RND transporter adaptor protein TriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118583.1 protein_id gnl|my_center|LOCUS_41220 61781 62851 gene locus_tag LOCUS_41230 gene triB 61781 62851 CDS product triclosan efflux RND transporter adaptor protein TriB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083872.1 protein_id gnl|my_center|LOCUS_41230 62848 65895 gene locus_tag LOCUS_41240 gene triC 62848 65895 CDS product triclosan efflux RND transporter permease subunit TriC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102199.1 protein_id gnl|my_center|LOCUS_41240 66094 67032 gene locus_tag LOCUS_41250 66094 67032 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895497.1 protein_id gnl|my_center|LOCUS_41250 67148 67333 gene locus_tag LOCUS_41260 67148 67333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083879.1 protein_id gnl|my_center|LOCUS_41260 67920 69254 gene locus_tag LOCUS_41270 67920 69254 CDS product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112647.1 protein_id gnl|my_center|LOCUS_41270 70080 69283 gene locus_tag LOCUS_41280 70080 69283 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083886.1 protein_id gnl|my_center|LOCUS_41280 70158 71774 gene locus_tag LOCUS_41290 70158 71774 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112648.1 protein_id gnl|my_center|LOCUS_41290 72377 72120 gene locus_tag LOCUS_41300 72377 72120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 72446 73282 gene locus_tag LOCUS_41310 72446 73282 CDS product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102209.1 protein_id gnl|my_center|LOCUS_41310 73524 74930 gene locus_tag LOCUS_41320 73524 74930 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102211.1 protein_id gnl|my_center|LOCUS_41320 75023 75688 gene locus_tag LOCUS_41330 75023 75688 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083903.1 protein_id gnl|my_center|LOCUS_41330 75694 76284 gene locus_tag LOCUS_41340 75694 76284 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102213.1 protein_id gnl|my_center|LOCUS_41340 77118 76291 gene locus_tag LOCUS_41350 gene siaD 77118 76291 CDS product biofilm regulation diguanylate cyclase SiaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118588.1 protein_id gnl|my_center|LOCUS_41350 77505 77125 gene locus_tag LOCUS_41360 gene siaC 77505 77125 CDS product biofilm formation regulator SiaD modulator protein SiaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083913.1 protein_id gnl|my_center|LOCUS_41360 78074 77532 gene locus_tag LOCUS_41370 gene siaB 78074 77532 CDS product biofilm formation regulator kinase SiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083916.1 protein_id gnl|my_center|LOCUS_41370 80074 78083 gene locus_tag LOCUS_41380 gene siaA 80074 78083 CDS product biofilm regulation protein phosphatase SiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112649.1 protein_id gnl|my_center|LOCUS_41380 81386 80337 gene locus_tag LOCUS_41390 81386 80337 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083922.1 protein_id gnl|my_center|LOCUS_41390 82008 81406 gene locus_tag LOCUS_41400 gene cheD 82008 81406 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102220.1 protein_id gnl|my_center|LOCUS_41400 82856 82014 gene locus_tag LOCUS_41410 82856 82014 CDS product Chemotaxis protein methyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102222.1 protein_id gnl|my_center|LOCUS_41410 84965 82926 gene locus_tag LOCUS_41420 gene aer2 84965 82926 CDS product aerotaxis transducer Aer2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112650.1 protein_id gnl|my_center|LOCUS_41420 85486 85001 gene locus_tag LOCUS_41430 85486 85001 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083938.1 protein_id gnl|my_center|LOCUS_41430 87392 85473 gene locus_tag LOCUS_41440 87392 85473 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895499.1 protein_id gnl|my_center|LOCUS_41440 87785 87420 gene locus_tag LOCUS_41450 87785 87420 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083943.1 protein_id gnl|my_center|LOCUS_41450 89155 87983 gene locus_tag LOCUS_41460 gene cttP 89155 87983 CDS product trichloroethylene chemotactic transducer CttP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106690.1 protein_id gnl|my_center|LOCUS_41460 90278 89346 gene locus_tag LOCUS_41470 90278 89346 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112652.1 protein_id gnl|my_center|LOCUS_41470 90395 91147 gene locus_tag LOCUS_41480 90395 91147 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106691.1 protein_id gnl|my_center|LOCUS_41480 92857 91247 gene locus_tag LOCUS_41490 gene atsA 92857 91247 CDS product arylsulfatase AtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106692.1 protein_id gnl|my_center|LOCUS_41490 93784 92945 gene locus_tag LOCUS_41500 93784 92945 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112653.1 protein_id gnl|my_center|LOCUS_41500 95397 93781 gene locus_tag LOCUS_41510 95397 93781 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106694.1 protein_id gnl|my_center|LOCUS_41510 95664 96725 gene locus_tag LOCUS_41520 95664 96725 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112655.1 protein_id gnl|my_center|LOCUS_41520 97143 97958 gene locus_tag LOCUS_41530 97143 97958 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112656.1 protein_id gnl|my_center|LOCUS_41530 97955 98836 gene locus_tag LOCUS_41540 97955 98836 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112657.1 protein_id gnl|my_center|LOCUS_41540 100232 98874 gene locus_tag LOCUS_41550 100232 98874 CDS product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112658.1 protein_id gnl|my_center|LOCUS_41550 100480 101205 gene locus_tag LOCUS_41560 100480 101205 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083962.1 protein_id gnl|my_center|LOCUS_41560 102146 101229 gene locus_tag LOCUS_41570 102146 101229 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083964.1 protein_id gnl|my_center|LOCUS_41570 102496 104868 gene locus_tag LOCUS_41580 102496 104868 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112659.1 protein_id gnl|my_center|LOCUS_41580 104909 105811 gene locus_tag LOCUS_41590 104909 105811 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112660.1 protein_id gnl|my_center|LOCUS_41590 105879 106778 gene locus_tag LOCUS_41600 105879 106778 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112661.1 protein_id gnl|my_center|LOCUS_41600 107425 108543 gene locus_tag LOCUS_41610 107425 108543 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112662.1 protein_id gnl|my_center|LOCUS_41610 108619 108927 gene locus_tag LOCUS_41620 108619 108927 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083974.1 protein_id gnl|my_center|LOCUS_41620 108927 110363 gene locus_tag LOCUS_41630 108927 110363 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083975.1 protein_id gnl|my_center|LOCUS_41630 110706 111527 gene locus_tag LOCUS_41640 110706 111527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 111556 112275 gene locus_tag LOCUS_41650 111556 112275 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083979.1 protein_id gnl|my_center|LOCUS_41650 112277 112678 gene locus_tag LOCUS_41660 112277 112678 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106175.1 protein_id gnl|my_center|LOCUS_41660 113071 112859 gene locus_tag LOCUS_41670 113071 112859 CDS product DUF3079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111981.1 protein_id gnl|my_center|LOCUS_41670 113287 113868 gene locus_tag LOCUS_41680 113287 113868 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106176.1 protein_id gnl|my_center|LOCUS_41680 113979 115643 gene locus_tag LOCUS_41690 gene mdcA 113979 115643 CDS product malonate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112666.1 protein_id gnl|my_center|LOCUS_41690 115643 116524 gene locus_tag LOCUS_41700 115643 116524 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112667.1 protein_id gnl|my_center|LOCUS_41700 116526 116825 gene locus_tag LOCUS_41710 116526 116825 CDS product malonate decarboxylase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084001.1 protein_id gnl|my_center|LOCUS_41710 116818 117681 gene locus_tag LOCUS_41720 116818 117681 CDS product biotin-independent malonate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084003.1 protein_id gnl|my_center|LOCUS_41720 117678 118484 gene locus_tag LOCUS_41730 gene mdcE 117678 118484 CDS product biotin-independent malonate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112668.1 protein_id gnl|my_center|LOCUS_41730 118500 119192 gene locus_tag LOCUS_41740 118500 119192 CDS product malonate decarboxylase holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031628460.1 protein_id gnl|my_center|LOCUS_41740 119189 120121 gene locus_tag LOCUS_41750 gene mdcH 119189 120121 CDS product malonate decarboxylase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112670.1 protein_id gnl|my_center|LOCUS_41750 120178 120582 gene locus_tag LOCUS_41760 gene madL 120178 120582 CDS product malonate transporter subunit MadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112671.1 protein_id gnl|my_center|LOCUS_41760 120588 121352 gene locus_tag LOCUS_41770 gene madM 120588 121352 CDS product malonate transporter subunit MadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084016.1 protein_id gnl|my_center|LOCUS_41770 122366 121437 gene locus_tag LOCUS_41780 122366 121437 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084019.1 protein_id gnl|my_center|LOCUS_41780 123624 122704 gene locus_tag LOCUS_41790 123624 122704 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084035.1 protein_id gnl|my_center|LOCUS_41790 123975 125465 gene locus_tag LOCUS_41800 123975 125465 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112672.1 protein_id gnl|my_center|LOCUS_41800 125523 126956 gene locus_tag LOCUS_41810 125523 126956 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084045.1 protein_id gnl|my_center|LOCUS_41810 126987 128369 gene locus_tag LOCUS_41820 126987 128369 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112673.1 protein_id gnl|my_center|LOCUS_41820 128533 129591 gene locus_tag LOCUS_41830 128533 129591 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101898.1 protein_id gnl|my_center|LOCUS_41830 130552 129671 gene locus_tag LOCUS_41840 130552 129671 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101895.1 protein_id gnl|my_center|LOCUS_41840 131394 130612 gene locus_tag LOCUS_41850 131394 130612 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084054.1 protein_id gnl|my_center|LOCUS_41850 131549 132088 gene locus_tag LOCUS_41860 131549 132088 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112674.1 protein_id gnl|my_center|LOCUS_41860 132239 133090 gene locus_tag LOCUS_41870 132239 133090 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084060.1 protein_id gnl|my_center|LOCUS_41870 133087 133869 gene locus_tag LOCUS_41880 133087 133869 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084062.1 protein_id gnl|my_center|LOCUS_41880 133866 135071 gene locus_tag LOCUS_41890 gene pcaF 133866 135071 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101891.1 protein_id gnl|my_center|LOCUS_41890 135221 136519 gene locus_tag LOCUS_41900 135221 136519 CDS product MFS family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101889.1 protein_id gnl|my_center|LOCUS_41900 136542 137921 gene locus_tag LOCUS_41910 136542 137921 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112675.1 protein_id gnl|my_center|LOCUS_41910 137936 138727 gene locus_tag LOCUS_41920 gene pcaD 137936 138727 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084070.1 protein_id gnl|my_center|LOCUS_41920 138738 139139 gene locus_tag LOCUS_41930 gene pcaC 138738 139139 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112676.1 protein_id gnl|my_center|LOCUS_41930 139314 140255 gene locus_tag LOCUS_41940 139314 140255 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084073.1 protein_id gnl|my_center|LOCUS_41940 140446 141279 gene locus_tag LOCUS_41950 140446 141279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112677.1 protein_id gnl|my_center|LOCUS_41950 143169 141823 gene locus_tag LOCUS_41960 143169 141823 CDS product 4-hydroxybenzoate transporter PcaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101875.1 protein_id gnl|my_center|LOCUS_41960 143475 144254 gene locus_tag LOCUS_41970 143475 144254 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101874.1 protein_id gnl|my_center|LOCUS_41970 144484 145539 gene locus_tag LOCUS_41980 144484 145539 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112678.1 protein_id gnl|my_center|LOCUS_41980 145562 146377 gene locus_tag LOCUS_41990 145562 146377 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084082.1 protein_id gnl|my_center|LOCUS_41990 146527 147405 gene locus_tag LOCUS_42000 146527 147405 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101866.1 protein_id gnl|my_center|LOCUS_42000 148681 147431 gene locus_tag LOCUS_42010 148681 147431 CDS product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101864.1 protein_id gnl|my_center|LOCUS_42010 150072 148747 gene locus_tag LOCUS_42020 150072 148747 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101861.1 protein_id gnl|my_center|LOCUS_42020 150619 152523 gene locus_tag LOCUS_42030 gene quiC1 150619 152523 CDS product 3-dehydroshikimate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112679.1 protein_id gnl|my_center|LOCUS_42030 152616 153284 gene locus_tag LOCUS_42040 152616 153284 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101858.1 protein_id gnl|my_center|LOCUS_42040 154178 153324 gene locus_tag LOCUS_42050 154178 153324 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112680.1 protein_id gnl|my_center|LOCUS_42050 154621 154175 gene locus_tag LOCUS_42060 gene aroQ 154621 154175 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106162.1 protein_id gnl|my_center|LOCUS_42060 156243 154738 gene locus_tag LOCUS_42070 156243 154738 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115723.1 protein_id gnl|my_center|LOCUS_42070 157602 156418 gene locus_tag LOCUS_42080 gene pobA 157602 156418 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112685.1 protein_id gnl|my_center|LOCUS_42080 157780 158646 gene locus_tag LOCUS_42090 157780 158646 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084097.1 protein_id gnl|my_center|LOCUS_42090 159089 158643 gene locus_tag LOCUS_42100 159089 158643 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084100.1 protein_id gnl|my_center|LOCUS_42100 159601 159167 gene locus_tag LOCUS_42110 159601 159167 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112686.1 protein_id gnl|my_center|LOCUS_42110 160397 159756 gene locus_tag LOCUS_42120 160397 159756 CDS product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112687.1 protein_id gnl|my_center|LOCUS_42120 160916 160662 gene locus_tag LOCUS_42130 160916 160662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123838.1 protein_id gnl|my_center|LOCUS_42130 161505 161041 gene locus_tag LOCUS_42140 161505 161041 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121665.1 protein_id gnl|my_center|LOCUS_42140 163048 161558 gene locus_tag LOCUS_42150 gene hudA 163048 161558 CDS product UbiD family decarboxylase HudA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115722.1 protein_id gnl|my_center|LOCUS_42150 163245 163667 gene locus_tag LOCUS_42160 163245 163667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 164373 163687 gene locus_tag LOCUS_42170 164373 163687 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106170.1 protein_id gnl|my_center|LOCUS_42170 165469 164537 gene locus_tag LOCUS_42180 165469 164537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084116.1 protein_id gnl|my_center|LOCUS_42180 166124 165732 gene locus_tag LOCUS_42190 166124 165732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42190 166862 166548 gene locus_tag LOCUS_42200 166862 166548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42200 168499 166913 gene locus_tag LOCUS_42210 168499 166913 CDS product DUF2875 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895500.1 protein_id gnl|my_center|LOCUS_42210 170655 168499 gene locus_tag LOCUS_42220 170655 168499 CDS product DUF3274 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112695.1 protein_id gnl|my_center|LOCUS_42220 171149 170652 gene locus_tag LOCUS_42230 171149 170652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112696.1 protein_id gnl|my_center|LOCUS_42230 <172083 171153 gene locus_tag LOCUS_42240 <172083 171153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003147109.1:type VI secretion system tip protein VgrG >Feature sequence16 1071 184 gene locus_tag LOCUS_42250 1071 184 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092195.1 protein_id gnl|my_center|LOCUS_42250 1185 2912 gene locus_tag LOCUS_42260 1185 2912 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113882.1 protein_id gnl|my_center|LOCUS_42260 2951 4138 gene locus_tag LOCUS_42270 2951 4138 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113883.1 protein_id gnl|my_center|LOCUS_42270 4198 4995 gene locus_tag LOCUS_42280 4198 4995 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098468.1 protein_id gnl|my_center|LOCUS_42280 4992 6524 gene locus_tag LOCUS_42290 4992 6524 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113884.1 protein_id gnl|my_center|LOCUS_42290 6547 7752 gene locus_tag LOCUS_42300 6547 7752 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098466.1 protein_id gnl|my_center|LOCUS_42300 7805 9055 gene locus_tag LOCUS_42310 7805 9055 CDS product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098463.1 protein_id gnl|my_center|LOCUS_42310 9981 9061 gene locus_tag LOCUS_42320 gene metR 9981 9061 CDS product transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092181.1 protein_id gnl|my_center|LOCUS_42320 10280 11266 gene locus_tag LOCUS_42330 10280 11266 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098462.1 protein_id gnl|my_center|LOCUS_42330 11621 11283 gene locus_tag LOCUS_42340 11621 11283 CDS product GlpM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119370.1 protein_id gnl|my_center|LOCUS_42340 13283 11745 gene locus_tag LOCUS_42350 gene glpD 13283 11745 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098460.1 protein_id gnl|my_center|LOCUS_42350 14316 13561 gene locus_tag LOCUS_42360 14316 13561 CDS product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092173.1 protein_id gnl|my_center|LOCUS_42360 16039 14522 gene locus_tag LOCUS_42370 gene glpK 16039 14522 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113886.1 protein_id gnl|my_center|LOCUS_42370 16918 16079 gene locus_tag LOCUS_42380 gene glpF 16918 16079 CDS product glycerol uptake facilitator protein GlpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092166.1 protein_id gnl|my_center|LOCUS_42380 17183 17653 gene locus_tag LOCUS_42390 gene ybaK 17183 17653 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098459.1 protein_id gnl|my_center|LOCUS_42390 17717 19201 gene locus_tag LOCUS_42400 gene glpK 17717 19201 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113887.1 protein_id gnl|my_center|LOCUS_42400 19397 20182 gene locus_tag LOCUS_42410 19397 20182 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092159.1 protein_id gnl|my_center|LOCUS_42410 21106 20684 gene locus_tag LOCUS_42420 21106 20684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113888.1 protein_id gnl|my_center|LOCUS_42420 21736 21206 gene locus_tag LOCUS_42430 21736 21206 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113889.1 protein_id gnl|my_center|LOCUS_42430 21919 22116 gene locus_tag LOCUS_42440 21919 22116 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092153.1 protein_id gnl|my_center|LOCUS_42440 22733 22095 gene locus_tag LOCUS_42450 gene nalD 22733 22095 CDS product efflux system transcriptional repressor NalD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092152.1 protein_id gnl|my_center|LOCUS_42450 23099 24277 gene locus_tag LOCUS_42460 23099 24277 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092150.1 protein_id gnl|my_center|LOCUS_42460 24461 24285 gene locus_tag LOCUS_42470 24461 24285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104346.1 protein_id gnl|my_center|LOCUS_42470 25511 24588 gene locus_tag LOCUS_42480 gene mmsR 25511 24588 CDS product MmsAB operon transcriptional regulator MmsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122160.1 protein_id gnl|my_center|LOCUS_42480 25643 27136 gene locus_tag LOCUS_42490 gene mmsA 25643 27136 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104350.1 protein_id gnl|my_center|LOCUS_42490 27152 28048 gene locus_tag LOCUS_42500 gene mmsB 27152 28048 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113890.1 protein_id gnl|my_center|LOCUS_42500 28150 30036 gene locus_tag LOCUS_42510 28150 30036 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104354.1 protein_id gnl|my_center|LOCUS_42510 31107 30094 gene locus_tag LOCUS_42520 31107 30094 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104356.1 protein_id gnl|my_center|LOCUS_42520 31422 31129 gene locus_tag LOCUS_42530 31422 31129 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104358.1 protein_id gnl|my_center|LOCUS_42530 31518 32438 gene locus_tag LOCUS_42540 31518 32438 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092132.1 protein_id gnl|my_center|LOCUS_42540 32423 32725 gene locus_tag LOCUS_42550 32423 32725 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029361.1 protein_id gnl|my_center|LOCUS_42550 33505 32726 gene locus_tag LOCUS_42560 33505 32726 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122162.1 protein_id gnl|my_center|LOCUS_42560 34505 33516 gene locus_tag LOCUS_42570 gene cra 34505 33516 CDS product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104372.1 protein_id gnl|my_center|LOCUS_42570 34833 37703 gene locus_tag LOCUS_42580 gene ptsP 34833 37703 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119534.1 protein_id gnl|my_center|LOCUS_42580 37703 38647 gene locus_tag LOCUS_42590 gene pfkB 37703 38647 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112874.1 protein_id gnl|my_center|LOCUS_42590 38649 40406 gene locus_tag LOCUS_42600 38649 40406 CDS product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107161.1 protein_id gnl|my_center|LOCUS_42600 41954 40560 gene locus_tag LOCUS_42610 41954 40560 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112875.1 protein_id gnl|my_center|LOCUS_42610 42364 41951 gene locus_tag LOCUS_42620 gene arnF 42364 41951 CDS product 4-amino-4-deoxy-L-arabinose-phosphoundecaprenol flippase subunit ArnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110472.1 protein_id gnl|my_center|LOCUS_42620 42708 42361 gene locus_tag LOCUS_42630 42708 42361 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112876.1 protein_id gnl|my_center|LOCUS_42630 44354 42705 gene locus_tag LOCUS_42640 gene arnT 44354 42705 CDS product lipid IV(A) 4-amino-4-deoxy-L-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112877.1 protein_id gnl|my_center|LOCUS_42640 45238 44351 gene locus_tag LOCUS_42650 gene arnD 45238 44351 CDS product 4-deoxy-4-formamido-L-arabinose-phosphoundecaprenol deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112878.1 protein_id gnl|my_center|LOCUS_42650 47223 45235 gene locus_tag LOCUS_42660 gene arnA 47223 45235 CDS product bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112879.1 protein_id gnl|my_center|LOCUS_42660 48239 47220 gene locus_tag LOCUS_42670 gene arnC 48239 47220 CDS product undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112880.1 protein_id gnl|my_center|LOCUS_42670 49384 48236 gene locus_tag LOCUS_42680 gene arnB 49384 48236 CDS product UDP-4-amino-4-deoxy-L-arabinose aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112882.1 protein_id gnl|my_center|LOCUS_42680 51217 49772 gene locus_tag LOCUS_42690 51217 49772 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092113.1 protein_id gnl|my_center|LOCUS_42690 52064 51414 gene locus_tag LOCUS_42700 gene algF 52064 51414 CDS product alginate O-acetyltransferase AlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092112.1 protein_id gnl|my_center|LOCUS_42700 53312 52137 gene locus_tag LOCUS_42710 gene algJ 53312 52137 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092111.1 protein_id gnl|my_center|LOCUS_42710 54889 53327 gene locus_tag LOCUS_42720 54889 53327 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112884.1 protein_id gnl|my_center|LOCUS_42720 56234 55131 gene locus_tag LOCUS_42730 gene algL 56234 55131 CDS product alginate biosynthesis protein AlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092108.1 protein_id gnl|my_center|LOCUS_42730 57662 56238 gene locus_tag LOCUS_42740 gene algX 57662 56238 CDS product alginate biosynthesis protein AlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112885.1 protein_id gnl|my_center|LOCUS_42740 59306 57675 gene locus_tag LOCUS_42750 gene algG 59306 57675 CDS product mannuronan 5-epimerase AlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110465.1 protein_id gnl|my_center|LOCUS_42750 60799 59327 gene locus_tag LOCUS_42760 gene algE 60799 59327 CDS product outer membrane porin AlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092105.1 protein_id gnl|my_center|LOCUS_42760 62223 60796 gene locus_tag LOCUS_42770 gene algK 62223 60796 CDS product alginate biosynthesis TPR repeat lipoprotein AlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112887.1 protein_id gnl|my_center|LOCUS_42770 63406 62237 gene locus_tag LOCUS_42780 gene alg44 63406 62237 CDS product alginate biosynthesis protein Alg44 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092101.1 protein_id gnl|my_center|LOCUS_42780 64982 63489 gene locus_tag LOCUS_42790 gene alg8 64982 63489 CDS product mannuronan synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119545.1 protein_id gnl|my_center|LOCUS_42790 66339 65113 gene locus_tag LOCUS_42800 gene algD 66339 65113 CDS product GDP-mannose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110461.1 protein_id gnl|my_center|LOCUS_42800 68104 67325 gene locus_tag LOCUS_42810 gene yaaA 68104 67325 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092094.1 protein_id gnl|my_center|LOCUS_42810 69293 68211 gene locus_tag LOCUS_42820 69293 68211 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092092.1 protein_id gnl|my_center|LOCUS_42820 70215 69298 gene locus_tag LOCUS_42830 gene argF 70215 69298 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092090.1 protein_id gnl|my_center|LOCUS_42830 70530 70961 gene locus_tag LOCUS_42840 70530 70961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119546.1 protein_id gnl|my_center|LOCUS_42840 74342 71355 gene locus_tag LOCUS_42850 74342 71355 CDS product autotransporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104263.1 protein_id gnl|my_center|LOCUS_42850 74641 76749 gene locus_tag LOCUS_42860 74641 76749 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 protein_id gnl|my_center|LOCUS_42860 76862 77188 gene locus_tag LOCUS_42870 gene grxD 76862 77188 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092082.1 protein_id gnl|my_center|LOCUS_42870 77271 78422 gene locus_tag LOCUS_42880 77271 78422 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104266.1 protein_id gnl|my_center|LOCUS_42880 78965 78489 gene locus_tag LOCUS_42890 gene bfrB 78965 78489 CDS product bacterioferritin BfrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092078.1 protein_id gnl|my_center|LOCUS_42890 79396 79175 gene locus_tag LOCUS_42900 79396 79175 CDS product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092075.1 protein_id gnl|my_center|LOCUS_42900 79656 80258 gene locus_tag LOCUS_42910 79656 80258 CDS product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092073.1 protein_id gnl|my_center|LOCUS_42910 81111 80437 gene locus_tag LOCUS_42920 gene rnt 81111 80437 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092070.1 protein_id gnl|my_center|LOCUS_42920 82154 81108 gene locus_tag LOCUS_42930 gene pyrC 82154 81108 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112889.1 protein_id gnl|my_center|LOCUS_42930 82287 83252 gene locus_tag LOCUS_42940 gene motY 82287 83252 CDS product flagellar protein MotY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104269.1 protein_id gnl|my_center|LOCUS_42940 83370 84587 gene locus_tag LOCUS_42950 83370 84587 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_42950 85092 84679 gene locus_tag LOCUS_42960 gene gloA 85092 84679 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112890.1 protein_id gnl|my_center|LOCUS_42960 85441 86598 gene locus_tag LOCUS_42970 gene mexP 85441 86598 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MexP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119548.1 protein_id gnl|my_center|LOCUS_42970 86595 89756 gene locus_tag LOCUS_42980 gene mexQ 86595 89756 CDS product multidrug efflux RND transporter permease subunit MexQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112892.1 protein_id gnl|my_center|LOCUS_42980 89753 91372 gene locus_tag LOCUS_42990 gene opmE 89753 91372 CDS product multidrug efflux transporter outer membrane subunit OpmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112893.1 protein_id gnl|my_center|LOCUS_42990 91825 92019 gene locus_tag LOCUS_43000 91825 92019 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092060.1 protein_id gnl|my_center|LOCUS_43000 92534 93457 gene locus_tag LOCUS_43010 92534 93457 CDS product HOASN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119554.1 protein_id gnl|my_center|LOCUS_43010 93490 94476 gene locus_tag LOCUS_43020 93490 94476 CDS product HOASN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112894.1 protein_id gnl|my_center|LOCUS_43020 94507 95940 gene locus_tag LOCUS_43030 gene purB 94507 95940 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004345327.1 protein_id gnl|my_center|LOCUS_43030 95940 97391 gene locus_tag LOCUS_43040 95940 97391 CDS product adenylosuccinate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092055.1 protein_id gnl|my_center|LOCUS_43040 97441 98514 gene locus_tag LOCUS_43050 97441 98514 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092054.1 protein_id gnl|my_center|LOCUS_43050 98893 98714 gene locus_tag LOCUS_43060 98893 98714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092052.1 protein_id gnl|my_center|LOCUS_43060 99640 99002 gene locus_tag LOCUS_43070 gene nth 99640 99002 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092050.1 protein_id gnl|my_center|LOCUS_43070 100353 99637 gene locus_tag LOCUS_43080 100353 99637 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112914.1 protein_id gnl|my_center|LOCUS_43080 100990 100346 gene locus_tag LOCUS_43090 gene rsxG 100990 100346 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092047.1 protein_id gnl|my_center|LOCUS_43090 102024 100990 gene locus_tag LOCUS_43100 102024 100990 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092045.1 protein_id gnl|my_center|LOCUS_43100 104351 102027 gene locus_tag LOCUS_43110 gene rsxC 104351 102027 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112915.1 protein_id gnl|my_center|LOCUS_43110 104914 104348 gene locus_tag LOCUS_43120 gene rsxB 104914 104348 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103780.1 protein_id gnl|my_center|LOCUS_43120 105495 104911 gene locus_tag LOCUS_43130 gene rsxA 105495 104911 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092041.1 protein_id gnl|my_center|LOCUS_43130 106069 105632 gene locus_tag LOCUS_43140 gene tsi3 106069 105632 CDS product T6SS effector muramidase immunity protein Tsi3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113900.1 protein_id gnl|my_center|LOCUS_43140 107292 106066 gene locus_tag LOCUS_43150 gene tse3 107292 106066 CDS product type VI secretion system effector muramidase Tse3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092026.1 protein_id gnl|my_center|LOCUS_43150 108179 107379 gene locus_tag LOCUS_43160 108179 107379 CDS product DUF4349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113899.1 protein_id gnl|my_center|LOCUS_43160 110246 108213 gene locus_tag LOCUS_43170 gene metG 110246 108213 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113898.1 protein_id gnl|my_center|LOCUS_43170 110377 111471 gene locus_tag LOCUS_43180 gene apbC 110377 111471 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092020.1 protein_id gnl|my_center|LOCUS_43180 111572 112138 gene locus_tag LOCUS_43190 gene dcd 111572 112138 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092017.1 protein_id gnl|my_center|LOCUS_43190 112562 113449 gene locus_tag LOCUS_43200 gene rhlA 112562 113449 CDS product 3-(3-hydroxydecanoyloxy)decanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113897.1 protein_id gnl|my_center|LOCUS_43200 113515 114795 gene locus_tag LOCUS_43210 113515 114795 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092007.1 protein_id gnl|my_center|LOCUS_43210 114941 115645 gene locus_tag LOCUS_43220 gene rhlR 114941 115645 CDS product transcriptional regulator RhlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119559.1 protein_id gnl|my_center|LOCUS_43220 115825 116430 gene locus_tag LOCUS_43230 gene rhlI 115825 116430 CDS product acyl-homoserine-lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113896.1 protein_id gnl|my_center|LOCUS_43230 116585 117391 gene locus_tag LOCUS_43240 gene pheC 116585 117391 CDS product cyclohexadienyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092003.1 protein_id gnl|my_center|LOCUS_43240 117486 117289 gene locus_tag LOCUS_43250 117486 117289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 117485 118345 gene locus_tag LOCUS_43260 117485 118345 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092000.1 protein_id gnl|my_center|LOCUS_43260 118342 119241 gene locus_tag LOCUS_43270 gene rarD 118342 119241 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103767.1 protein_id gnl|my_center|LOCUS_43270 119858 119262 gene locus_tag LOCUS_43280 119858 119262 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103763.1 protein_id gnl|my_center|LOCUS_43280 120315 122009 gene locus_tag LOCUS_43290 120315 122009 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103761.1 protein_id gnl|my_center|LOCUS_43290 122589 122131 gene locus_tag LOCUS_43300 122589 122131 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113894.1 protein_id gnl|my_center|LOCUS_43300 123128 122586 gene locus_tag LOCUS_43310 123128 122586 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103756.1 protein_id gnl|my_center|LOCUS_43310 124476 123148 gene locus_tag LOCUS_43320 124476 123148 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103754.1 protein_id gnl|my_center|LOCUS_43320 126011 124644 gene locus_tag LOCUS_43330 126011 124644 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113893.1 protein_id gnl|my_center|LOCUS_43330 126212 127537 gene locus_tag LOCUS_43340 126212 127537 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122185.1 protein_id gnl|my_center|LOCUS_43340 129374 127659 gene locus_tag LOCUS_43350 129374 127659 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103747.1 protein_id gnl|my_center|LOCUS_43350 129591 130916 gene locus_tag LOCUS_43360 129591 130916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113892.1 protein_id gnl|my_center|LOCUS_43360 131390 131160 gene locus_tag LOCUS_43370 131390 131160 CDS product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091959.1 protein_id gnl|my_center|LOCUS_43370 134207 131442 gene locus_tag LOCUS_43380 134207 131442 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115063.1 protein_id gnl|my_center|LOCUS_43380 135540 134344 gene locus_tag LOCUS_43390 135540 134344 CDS product osmoprotectant NAGGN system M42 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111432.1 protein_id gnl|my_center|LOCUS_43390 137294 135537 gene locus_tag LOCUS_43400 gene ngg 137294 135537 CDS product N-acetylglutaminylglutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111433.1 protein_id gnl|my_center|LOCUS_43400 139104 137335 gene locus_tag LOCUS_43410 139104 137335 CDS product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106635.1 protein_id gnl|my_center|LOCUS_43410 139247 139720 gene locus_tag LOCUS_43420 139247 139720 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091943.1 protein_id gnl|my_center|LOCUS_43420 140627 139875 gene locus_tag LOCUS_43430 140627 139875 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147982.1 protein_id gnl|my_center|LOCUS_43430 142692 140728 gene locus_tag LOCUS_43440 gene mnmC 142692 140728 CDS product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114497.1 protein_id gnl|my_center|LOCUS_43440 142836 144326 gene locus_tag LOCUS_43450 gene pap 142836 144326 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091935.1 protein_id gnl|my_center|LOCUS_43450 144479 145663 gene locus_tag LOCUS_43460 144479 145663 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114496.1 protein_id gnl|my_center|LOCUS_43460 145792 146457 gene locus_tag LOCUS_43470 145792 146457 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091932.1 protein_id gnl|my_center|LOCUS_43470 148234 146681 gene locus_tag LOCUS_43480 148234 146681 CDS product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102300.1 protein_id gnl|my_center|LOCUS_43480 148664 148455 gene locus_tag LOCUS_43490 148664 148455 CDS product DUF6316 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102301.1 protein_id gnl|my_center|LOCUS_43490 148870 149508 gene locus_tag LOCUS_43500 148870 149508 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114495.1 protein_id gnl|my_center|LOCUS_43500 149759 150760 gene locus_tag LOCUS_43510 149759 150760 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114494.1 protein_id gnl|my_center|LOCUS_43510 150764 151588 gene locus_tag LOCUS_43520 150764 151588 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102304.1 protein_id gnl|my_center|LOCUS_43520 151585 152334 gene locus_tag LOCUS_43530 151585 152334 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091922.1 protein_id gnl|my_center|LOCUS_43530 152487 153080 gene locus_tag LOCUS_43540 gene ssuE 152487 153080 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091915.1 protein_id gnl|my_center|LOCUS_43540 153199 154170 gene locus_tag LOCUS_43550 153199 154170 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091913.1 protein_id gnl|my_center|LOCUS_43550 154248 155396 gene locus_tag LOCUS_43560 gene ssuD 154248 155396 CDS product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091910.1 protein_id gnl|my_center|LOCUS_43560 155417 156205 gene locus_tag LOCUS_43570 gene ssuC 155417 156205 CDS product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102309.1 protein_id gnl|my_center|LOCUS_43570 156202 157026 gene locus_tag LOCUS_43580 gene ssuB 156202 157026 CDS product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102311.1 protein_id gnl|my_center|LOCUS_43580 157067 157282 gene locus_tag LOCUS_43590 157067 157282 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091900.1 protein_id gnl|my_center|LOCUS_43590 157801 157463 gene locus_tag LOCUS_43600 157801 157463 CDS product HopJ type III effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091899.1 protein_id gnl|my_center|LOCUS_43600 158164 157853 gene locus_tag LOCUS_43610 158164 157853 CDS product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091898.1 protein_id gnl|my_center|LOCUS_43610 158664 158293 gene locus_tag LOCUS_43620 gene folX 158664 158293 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091897.1 protein_id gnl|my_center|LOCUS_43620 159226 158666 gene locus_tag LOCUS_43630 gene folE 159226 158666 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091896.1 protein_id gnl|my_center|LOCUS_43630 159948 159244 gene locus_tag LOCUS_43640 gene folM 159948 159244 CDS product dihydromonapterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091895.1 protein_id gnl|my_center|LOCUS_43640 160616 160059 gene locus_tag LOCUS_43650 160616 160059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111015.1 protein_id gnl|my_center|LOCUS_43650 160896 161348 gene locus_tag LOCUS_43660 160896 161348 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102319.1 protein_id gnl|my_center|LOCUS_43660 >Feature sequence17 <1 1257 gene locus_tag LOCUS_43670 <1 1257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003116413.1:carbohydrate porin OprB 1411 3822 gene locus_tag LOCUS_43680 1411 3822 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089344.1 protein_id gnl|my_center|LOCUS_43680 3954 6086 gene locus_tag LOCUS_43690 3954 6086 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113760.1 protein_id gnl|my_center|LOCUS_43690 6207 6494 gene locus_tag LOCUS_43700 6207 6494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113759.1 protein_id gnl|my_center|LOCUS_43700 7142 6507 gene locus_tag LOCUS_43710 7142 6507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113758.1 protein_id gnl|my_center|LOCUS_43710 8199 7405 gene locus_tag LOCUS_43720 8199 7405 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104521.1 protein_id gnl|my_center|LOCUS_43720 8953 8498 gene locus_tag LOCUS_43730 8953 8498 CDS product phage tail assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895512.1 protein_id gnl|my_center|LOCUS_43730 10959 8953 gene locus_tag LOCUS_43740 10959 8953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 11513 10959 gene locus_tag LOCUS_43750 11513 10959 CDS product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138756.1 protein_id gnl|my_center|LOCUS_43750 12627 11506 gene locus_tag LOCUS_43760 12627 11506 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219103.1 protein_id gnl|my_center|LOCUS_43760 12988 12605 gene locus_tag LOCUS_43770 12988 12605 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859114.1 protein_id gnl|my_center|LOCUS_43770 13094 13780 gene locus_tag LOCUS_43780 13094 13780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 14291 13761 gene locus_tag LOCUS_43790 14291 13761 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148263.1 protein_id gnl|my_center|LOCUS_43790 15382 14288 gene locus_tag LOCUS_43800 15382 14288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 15585 15370 gene locus_tag LOCUS_43810 15585 15370 CDS product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478224.1 protein_id gnl|my_center|LOCUS_43810 16454 15585 gene locus_tag LOCUS_43820 16454 15585 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458386.1 protein_id gnl|my_center|LOCUS_43820 19141 16454 gene locus_tag LOCUS_43830 19141 16454 CDS product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016537.1 protein_id gnl|my_center|LOCUS_43830 19134 19418 gene locus_tag LOCUS_43840 19134 19418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 19792 19478 gene locus_tag LOCUS_43850 19792 19478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 20187 19960 gene locus_tag LOCUS_43860 20187 19960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 20186 20629 gene locus_tag LOCUS_43870 20186 20629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 21154 20630 gene locus_tag LOCUS_43880 21154 20630 CDS product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034292.1 protein_id gnl|my_center|LOCUS_43880 22582 21155 gene locus_tag LOCUS_43890 22582 21155 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729834.1 protein_id gnl|my_center|LOCUS_43890 22815 22579 gene locus_tag LOCUS_43900 22815 22579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 23291 22812 gene locus_tag LOCUS_43910 23291 22812 CDS product Gp37 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101804.1 protein_id gnl|my_center|LOCUS_43910 23722 23291 gene locus_tag LOCUS_43920 23722 23291 CDS product DUF1320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271668.1 protein_id gnl|my_center|LOCUS_43920 24057 23725 gene locus_tag LOCUS_43930 24057 23725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43930 24390 24061 gene locus_tag LOCUS_43940 24390 24061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 25321 24398 gene locus_tag LOCUS_43950 25321 24398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286902.1 protein_id gnl|my_center|LOCUS_43950 26467 25337 gene locus_tag LOCUS_43960 26467 25337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273067.1 protein_id gnl|my_center|LOCUS_43960 27157 26675 gene locus_tag LOCUS_43970 27157 26675 CDS product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070993.1 protein_id gnl|my_center|LOCUS_43970 27966 27154 gene locus_tag LOCUS_43980 27966 27154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 29471 27969 gene locus_tag LOCUS_43990 29471 27969 CDS product DUF935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090679.1 protein_id gnl|my_center|LOCUS_43990 30592 29468 gene locus_tag LOCUS_44000 30592 29468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44000 31087 30701 gene locus_tag LOCUS_44010 31087 30701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44010 31635 31084 gene locus_tag LOCUS_44020 31635 31084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 31930 31637 gene locus_tag LOCUS_44030 31930 31637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072623.1 protein_id gnl|my_center|LOCUS_44030 32205 31927 gene locus_tag LOCUS_44040 32205 31927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 32438 32211 gene locus_tag LOCUS_44050 32438 32211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 33056 32445 gene locus_tag LOCUS_44060 33056 32445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264661.1 protein_id gnl|my_center|LOCUS_44060 33452 33231 gene locus_tag LOCUS_44070 33452 33231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 33916 33449 gene locus_tag LOCUS_44080 33916 33449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 34666 34067 gene locus_tag LOCUS_44090 34666 34067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 35092 34679 gene locus_tag LOCUS_44100 35092 34679 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786773.1 protein_id gnl|my_center|LOCUS_44100 35211 35435 gene locus_tag LOCUS_44110 35211 35435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 35649 35371 gene locus_tag LOCUS_44120 35649 35371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 35770 36249 gene locus_tag LOCUS_44130 35770 36249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 36246 36464 gene locus_tag LOCUS_44140 36246 36464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 36461 36775 gene locus_tag LOCUS_44150 36461 36775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 36785 37780 gene locus_tag LOCUS_44160 36785 37780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44160 37780 39579 gene locus_tag LOCUS_44170 37780 39579 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992438.1 protein_id gnl|my_center|LOCUS_44170 39589 40821 gene locus_tag LOCUS_44180 39589 40821 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960679.1 protein_id gnl|my_center|LOCUS_44180 40823 41161 gene locus_tag LOCUS_44190 40823 41161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 41158 41463 gene locus_tag LOCUS_44200 41158 41463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 41463 42107 gene locus_tag LOCUS_44210 41463 42107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 42100 42723 gene locus_tag LOCUS_44220 42100 42723 CDS product DUF3164 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072605.1 protein_id gnl|my_center|LOCUS_44220 42725 42928 gene locus_tag LOCUS_44230 42725 42928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 42930 43619 gene locus_tag LOCUS_44240 42930 43619 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706579.1 protein_id gnl|my_center|LOCUS_44240 43621 44040 gene locus_tag LOCUS_44250 43621 44040 CDS product regulatory protein GemA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170114.1 protein_id gnl|my_center|LOCUS_44250 44025 44405 gene locus_tag LOCUS_44260 44025 44405 CDS product Mor transcription activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281695.1 protein_id gnl|my_center|LOCUS_44260 45892 44498 gene locus_tag LOCUS_44270 45892 44498 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113757.1 protein_id gnl|my_center|LOCUS_44270 46555 45893 gene locus_tag LOCUS_44280 46555 45893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089328.1 protein_id gnl|my_center|LOCUS_44280 47160 46552 gene locus_tag LOCUS_44290 47160 46552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122739.1 protein_id gnl|my_center|LOCUS_44290 48677 47220 gene locus_tag LOCUS_44300 48677 47220 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113755.1 protein_id gnl|my_center|LOCUS_44300 49112 48684 gene locus_tag LOCUS_44310 49112 48684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089323.1 protein_id gnl|my_center|LOCUS_44310 49286 50254 gene locus_tag LOCUS_44320 49286 50254 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122741.1 protein_id gnl|my_center|LOCUS_44320 50959 50267 gene locus_tag LOCUS_44330 gene arsH 50959 50267 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113752.1 protein_id gnl|my_center|LOCUS_44330 51441 50971 gene locus_tag LOCUS_44340 51441 50971 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112098.1 protein_id gnl|my_center|LOCUS_44340 52756 51473 gene locus_tag LOCUS_44350 52756 51473 CDS product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113751.1 protein_id gnl|my_center|LOCUS_44350 53120 52770 gene locus_tag LOCUS_44360 53120 52770 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089312.1 protein_id gnl|my_center|LOCUS_44360 54089 53199 gene locus_tag LOCUS_44370 54089 53199 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113750.1 protein_id gnl|my_center|LOCUS_44370 54300 55361 gene locus_tag LOCUS_44380 54300 55361 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113749.1 protein_id gnl|my_center|LOCUS_44380 55763 55386 gene locus_tag LOCUS_44390 gene pumA 55763 55386 CDS product monooxygenase PumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113748.1 protein_id gnl|my_center|LOCUS_44390 55841 56311 gene locus_tag LOCUS_44400 gene soxR 55841 56311 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089301.1 protein_id gnl|my_center|LOCUS_44400 58016 56319 gene locus_tag LOCUS_44410 58016 56319 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113747.1 protein_id gnl|my_center|LOCUS_44410 58653 58138 gene locus_tag LOCUS_44420 58653 58138 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089295.1 protein_id gnl|my_center|LOCUS_44420 59251 58661 gene locus_tag LOCUS_44430 59251 58661 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113746.1 protein_id gnl|my_center|LOCUS_44430 59398 60588 gene locus_tag LOCUS_44440 59398 60588 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113745.1 protein_id gnl|my_center|LOCUS_44440 61622 60552 gene locus_tag LOCUS_44450 61622 60552 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113744.1 protein_id gnl|my_center|LOCUS_44450 61709 62605 gene locus_tag LOCUS_44460 61709 62605 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113743.1 protein_id gnl|my_center|LOCUS_44460 63997 62678 gene locus_tag LOCUS_44470 63997 62678 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113742.1 protein_id gnl|my_center|LOCUS_44470 65784 64009 gene locus_tag LOCUS_44480 65784 64009 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110747.1 protein_id gnl|my_center|LOCUS_44480 66503 65787 gene locus_tag LOCUS_44490 66503 65787 CDS product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110746.1 protein_id gnl|my_center|LOCUS_44490 67657 66671 gene locus_tag LOCUS_44500 67657 66671 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113741.1 protein_id gnl|my_center|LOCUS_44500 68983 67676 gene locus_tag LOCUS_44510 68983 67676 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113740.1 protein_id gnl|my_center|LOCUS_44510 69996 69046 gene locus_tag LOCUS_44520 69996 69046 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089272.1 protein_id gnl|my_center|LOCUS_44520 70771 69989 gene locus_tag LOCUS_44530 70771 69989 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113739.1 protein_id gnl|my_center|LOCUS_44530 71865 70843 gene locus_tag LOCUS_44540 gene ptxS 71865 70843 CDS product transcriptional regulator PtxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113738.1 protein_id gnl|my_center|LOCUS_44540 72428 73366 gene locus_tag LOCUS_44550 gene ptxR 72428 73366 CDS product HTH-type transcriptional regulator PtxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089264.1 protein_id gnl|my_center|LOCUS_44550 74120 73473 gene locus_tag LOCUS_44560 gene pvcD 74120 73473 CDS product paerucumarin biosynthesis heme-binding protein PvcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113737.1 protein_id gnl|my_center|LOCUS_44560 75615 74113 gene locus_tag LOCUS_44570 gene pvcC 75615 74113 CDS product paerucumarin biosynthesis protein PvcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113736.1 protein_id gnl|my_center|LOCUS_44570 76542 75667 gene locus_tag LOCUS_44580 gene pvcB 76542 75667 CDS product paerucumarin biosynthesis oxygenase PvcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115812.1 protein_id gnl|my_center|LOCUS_44580 77546 76560 gene locus_tag LOCUS_44590 gene pvcA 77546 76560 CDS product paerucumarin biosynthesis protein PvcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113733.1 protein_id gnl|my_center|LOCUS_44590 78747 77761 gene locus_tag LOCUS_44600 78747 77761 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113732.1 protein_id gnl|my_center|LOCUS_44600 80292 78847 gene locus_tag LOCUS_44610 80292 78847 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113731.1 protein_id gnl|my_center|LOCUS_44610 80461 81279 gene locus_tag LOCUS_44620 80461 81279 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113730.1 protein_id gnl|my_center|LOCUS_44620 82806 81412 gene locus_tag LOCUS_44630 gene lpdA 82806 81412 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113729.1 protein_id gnl|my_center|LOCUS_44630 84096 82810 gene locus_tag LOCUS_44640 84096 82810 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113728.1 protein_id gnl|my_center|LOCUS_44640 85149 84097 gene locus_tag LOCUS_44650 85149 84097 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089248.1 protein_id gnl|my_center|LOCUS_44650 86378 85146 gene locus_tag LOCUS_44660 86378 85146 CDS product 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111886.1 protein_id gnl|my_center|LOCUS_44660 86688 87149 gene locus_tag LOCUS_44670 86688 87149 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089245.1 protein_id gnl|my_center|LOCUS_44670 87221 87514 gene locus_tag LOCUS_44680 87221 87514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 88516 87515 gene locus_tag LOCUS_44690 88516 87515 CDS product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113726.1 protein_id gnl|my_center|LOCUS_44690 90305 88572 gene locus_tag LOCUS_44700 90305 88572 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113725.1 protein_id gnl|my_center|LOCUS_44700 91559 90492 gene locus_tag LOCUS_44710 91559 90492 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003160261.1 protein_id gnl|my_center|LOCUS_44710 93051 91642 gene locus_tag LOCUS_44720 93051 91642 CDS product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113723.1 protein_id gnl|my_center|LOCUS_44720 94489 93053 gene locus_tag LOCUS_44730 94489 93053 CDS product biofilm formation protein PslJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089234.1 protein_id gnl|my_center|LOCUS_44730 95595 94492 gene locus_tag LOCUS_44740 95595 94492 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113722.1 protein_id gnl|my_center|LOCUS_44740 96794 95586 gene locus_tag LOCUS_44750 96794 95586 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113721.1 protein_id gnl|my_center|LOCUS_44750 98131 96803 gene locus_tag LOCUS_44760 98131 96803 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089230.1 protein_id gnl|my_center|LOCUS_44760 99308 98121 gene locus_tag LOCUS_44770 99308 98121 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113720.1 protein_id gnl|my_center|LOCUS_44770 101296 99308 gene locus_tag LOCUS_44780 101296 99308 CDS product exopolysaccharide transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113719.1 protein_id gnl|my_center|LOCUS_44780 102081 101311 gene locus_tag LOCUS_44790 102081 101311 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089227.1 protein_id gnl|my_center|LOCUS_44790 103022 102111 gene locus_tag LOCUS_44800 103022 102111 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113718.1 protein_id gnl|my_center|LOCUS_44800 104488 103022 gene locus_tag LOCUS_44810 104488 103022 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113717.1 protein_id gnl|my_center|LOCUS_44810 105924 104488 gene locus_tag LOCUS_44820 105924 104488 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111160.1 protein_id gnl|my_center|LOCUS_44820 107047 106451 gene locus_tag LOCUS_44830 107047 106451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122761.1 protein_id gnl|my_center|LOCUS_44830 107887 107168 gene locus_tag LOCUS_44840 107887 107168 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113716.1 protein_id gnl|my_center|LOCUS_44840 108829 110040 gene locus_tag LOCUS_44850 108829 110040 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113715.1 protein_id gnl|my_center|LOCUS_44850 110037 111026 gene locus_tag LOCUS_44860 gene vqsM 110037 111026 CDS product HTH-type transcriptional regulator VqsM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113714.1 protein_id gnl|my_center|LOCUS_44860 111061 111561 gene locus_tag LOCUS_44870 111061 111561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124674.1 protein_id gnl|my_center|LOCUS_44870 111605 112021 gene locus_tag LOCUS_44880 111605 112021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115932.1 protein_id gnl|my_center|LOCUS_44880 112504 112998 gene locus_tag LOCUS_44890 112504 112998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 113031 114050 gene locus_tag LOCUS_44900 113031 114050 CDS product pesticin C-terminus-like muramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895604.1 protein_id gnl|my_center|LOCUS_44900 114062 114709 gene locus_tag LOCUS_44910 114062 114709 CDS product DUF3218 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113710.1 protein_id gnl|my_center|LOCUS_44910 116590 115232 gene locus_tag LOCUS_44920 116590 115232 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003160256.1 protein_id gnl|my_center|LOCUS_44920 118275 117271 gene locus_tag LOCUS_44930 118275 117271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 118861 118304 gene locus_tag LOCUS_44940 118861 118304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 119899 119003 gene locus_tag LOCUS_44950 119899 119003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 120387 119896 gene locus_tag LOCUS_44960 120387 119896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 121328 120384 gene locus_tag LOCUS_44970 121328 120384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 121603 122502 gene locus_tag LOCUS_44980 121603 122502 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 protein_id gnl|my_center|LOCUS_44980 122549 124075 gene locus_tag LOCUS_44990 122549 124075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 124259 124591 gene locus_tag LOCUS_45000 124259 124591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 124761 125249 gene locus_tag LOCUS_45010 124761 125249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45010 126327 126869 gene locus_tag LOCUS_45020 126327 126869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 128091 126892 gene locus_tag LOCUS_45030 128091 126892 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908097.1 protein_id gnl|my_center|LOCUS_45030 128385 129251 gene locus_tag LOCUS_45040 128385 129251 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086755.1 protein_id gnl|my_center|LOCUS_45040 130298 129336 gene locus_tag LOCUS_45050 130298 129336 CDS product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104718.1 protein_id gnl|my_center|LOCUS_45050 132624 130309 gene locus_tag LOCUS_45060 132624 130309 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 protein_id gnl|my_center|LOCUS_45060 134306 132720 gene locus_tag LOCUS_45070 134306 132720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 135745 134390 gene locus_tag LOCUS_45080 135745 134390 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_45080 136935 136369 gene locus_tag LOCUS_45090 136935 136369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111193.1 protein_id gnl|my_center|LOCUS_45090 138494 137127 gene locus_tag LOCUS_45100 138494 137127 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114353.1 protein_id gnl|my_center|LOCUS_45100 139428 138556 gene locus_tag LOCUS_45110 139428 138556 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086755.1 protein_id gnl|my_center|LOCUS_45110 139892 140473 gene locus_tag LOCUS_45120 139892 140473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 140917 142383 gene locus_tag LOCUS_45130 gene ethA 140917 142383 CDS product FAD-containing monooxygenase EthA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899731.1 protein_id gnl|my_center|LOCUS_45130 142380 143255 gene locus_tag LOCUS_45140 142380 143255 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226336.1 protein_id gnl|my_center|LOCUS_45140 143486 144643 gene locus_tag LOCUS_45150 143486 144643 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065465.1 protein_id gnl|my_center|LOCUS_45150 144656 145987 gene locus_tag LOCUS_45160 144656 145987 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113879.1 protein_id gnl|my_center|LOCUS_45160 146066 147490 gene locus_tag LOCUS_45170 gene patD 146066 147490 CDS product aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366409.1 protein_id gnl|my_center|LOCUS_45170 147536 148789 gene locus_tag LOCUS_45180 gene ectB 147536 148789 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729399.1 protein_id gnl|my_center|LOCUS_45180 148878 149798 gene locus_tag LOCUS_45190 148878 149798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 149872 150024 gene locus_tag LOCUS_45200 149872 150024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 151760 150102 gene locus_tag LOCUS_45210 151760 150102 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388393.1 protein_id gnl|my_center|LOCUS_45210 152080 151757 gene locus_tag LOCUS_45220 152080 151757 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705924.1 protein_id gnl|my_center|LOCUS_45220 153786 152137 gene locus_tag LOCUS_45230 153786 152137 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093598.1 protein_id gnl|my_center|LOCUS_45230 154637 153870 gene locus_tag LOCUS_45240 154637 153870 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090610.1 protein_id gnl|my_center|LOCUS_45240 155809 154637 gene locus_tag LOCUS_45250 155809 154637 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083642.1 protein_id gnl|my_center|LOCUS_45250 156216 155860 gene locus_tag LOCUS_45260 156216 155860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 157328 156213 gene locus_tag LOCUS_45270 157328 156213 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229262.1 protein_id gnl|my_center|LOCUS_45270 157465 159417 gene locus_tag LOCUS_45280 gene prpR 157465 159417 CDS product propionate catabolism operon regulatory protein PrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040036.1 protein_id gnl|my_center|LOCUS_45280 159986 159483 gene locus_tag LOCUS_45290 159986 159483 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112942.1 protein_id gnl|my_center|LOCUS_45290 >Feature sequence18 866 585 gene locus_tag LOCUS_45300 866 585 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113105.1 protein_id gnl|my_center|LOCUS_45300 1828 863 gene locus_tag LOCUS_45310 1828 863 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113104.1 protein_id gnl|my_center|LOCUS_45310 2679 1825 gene locus_tag LOCUS_45320 2679 1825 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113103.1 protein_id gnl|my_center|LOCUS_45320 3473 2676 gene locus_tag LOCUS_45330 3473 2676 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113102.1 protein_id gnl|my_center|LOCUS_45330 4904 3498 gene locus_tag LOCUS_45340 4904 3498 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113101.1 protein_id gnl|my_center|LOCUS_45340 5284 5039 gene locus_tag LOCUS_45350 5284 5039 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089354.1 protein_id gnl|my_center|LOCUS_45350 7064 5370 gene locus_tag LOCUS_45360 7064 5370 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113100.1 protein_id gnl|my_center|LOCUS_45360 7840 7091 gene locus_tag LOCUS_45370 7840 7091 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113099.1 protein_id gnl|my_center|LOCUS_45370 9467 8016 gene locus_tag LOCUS_45380 9467 8016 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089363.1 protein_id gnl|my_center|LOCUS_45380 10229 9687 gene locus_tag LOCUS_45390 10229 9687 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089366.1 protein_id gnl|my_center|LOCUS_45390 16674 10297 gene locus_tag LOCUS_45400 16674 10297 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895606.1 protein_id gnl|my_center|LOCUS_45400 17653 16694 gene locus_tag LOCUS_45410 17653 16694 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113096.1 protein_id gnl|my_center|LOCUS_45410 18717 17710 gene locus_tag LOCUS_45420 18717 17710 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115897.1 protein_id gnl|my_center|LOCUS_45420 22577 18828 gene locus_tag LOCUS_45430 22577 18828 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113094.1 protein_id gnl|my_center|LOCUS_45430 23290 22673 gene locus_tag LOCUS_45440 23290 22673 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113093.1 protein_id gnl|my_center|LOCUS_45440 24266 23400 gene locus_tag LOCUS_45450 24266 23400 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113092.1 protein_id gnl|my_center|LOCUS_45450 25131 24283 gene locus_tag LOCUS_45460 25131 24283 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113091.1 protein_id gnl|my_center|LOCUS_45460 26161 25139 gene locus_tag LOCUS_45470 26161 25139 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089389.1 protein_id gnl|my_center|LOCUS_45470 27089 26202 gene locus_tag LOCUS_45480 27089 26202 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113090.1 protein_id gnl|my_center|LOCUS_45480 27379 27537 gene locus_tag LOCUS_45490 27379 27537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089396.1 protein_id gnl|my_center|LOCUS_45490 27541 28173 gene locus_tag LOCUS_45500 27541 28173 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122724.1 protein_id gnl|my_center|LOCUS_45500 28753 28250 gene locus_tag LOCUS_45510 28753 28250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113089.1 protein_id gnl|my_center|LOCUS_45510 28638 28871 gene locus_tag LOCUS_45520 28638 28871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 30306 29053 gene locus_tag LOCUS_45530 30306 29053 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113088.1 protein_id gnl|my_center|LOCUS_45530 31481 30306 gene locus_tag LOCUS_45540 31481 30306 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113087.1 protein_id gnl|my_center|LOCUS_45540 31596 32489 gene locus_tag LOCUS_45550 31596 32489 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113086.1 protein_id gnl|my_center|LOCUS_45550 32593 33891 gene locus_tag LOCUS_45560 32593 33891 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089406.1 protein_id gnl|my_center|LOCUS_45560 33924 34289 gene locus_tag LOCUS_45570 33924 34289 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089408.1 protein_id gnl|my_center|LOCUS_45570 35908 34877 gene locus_tag LOCUS_45580 gene gntR 35908 34877 CDS product LacI family DNA-binding transcriptional regulator GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107131.1 protein_id gnl|my_center|LOCUS_45580 36103 36624 gene locus_tag LOCUS_45590 36103 36624 CDS product gluconokinase, GntK/IdnK-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107130.1 protein_id gnl|my_center|LOCUS_45590 36721 38073 gene locus_tag LOCUS_45600 36721 38073 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107128.1 protein_id gnl|my_center|LOCUS_45600 38406 40031 gene locus_tag LOCUS_45610 38406 40031 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115067.1 protein_id gnl|my_center|LOCUS_45610 40249 41508 gene locus_tag LOCUS_45620 40249 41508 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115478.1 protein_id gnl|my_center|LOCUS_45620 41539 42774 gene locus_tag LOCUS_45630 41539 42774 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107493.1 protein_id gnl|my_center|LOCUS_45630 44243 42834 gene locus_tag LOCUS_45640 44243 42834 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107490.1 protein_id gnl|my_center|LOCUS_45640 45447 44683 gene locus_tag LOCUS_45650 45447 44683 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107734.1 protein_id gnl|my_center|LOCUS_45650 46643 45444 gene locus_tag LOCUS_45660 46643 45444 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107732.1 protein_id gnl|my_center|LOCUS_45660 47445 46609 gene locus_tag LOCUS_45670 47445 46609 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115101.1 protein_id gnl|my_center|LOCUS_45670 48509 47442 gene locus_tag LOCUS_45680 48509 47442 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003117847.1 protein_id gnl|my_center|LOCUS_45680 49119 48559 gene locus_tag LOCUS_45690 49119 48559 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089433.1 protein_id gnl|my_center|LOCUS_45690 49224 50129 gene locus_tag LOCUS_45700 49224 50129 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089436.1 protein_id gnl|my_center|LOCUS_45700 51746 50130 gene locus_tag LOCUS_45710 51746 50130 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114996.1 protein_id gnl|my_center|LOCUS_45710 52754 51843 gene locus_tag LOCUS_45720 52754 51843 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105356.1 protein_id gnl|my_center|LOCUS_45720 52904 55273 gene locus_tag LOCUS_45730 52904 55273 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114997.1 protein_id gnl|my_center|LOCUS_45730 55296 56636 gene locus_tag LOCUS_45740 55296 56636 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003144052.1 protein_id gnl|my_center|LOCUS_45740 56788 57693 gene locus_tag LOCUS_45750 56788 57693 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089438.1 protein_id gnl|my_center|LOCUS_45750 57851 59161 gene locus_tag LOCUS_45760 57851 59161 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105362.1 protein_id gnl|my_center|LOCUS_45760 59237 60169 gene locus_tag LOCUS_45770 59237 60169 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105364.1 protein_id gnl|my_center|LOCUS_45770 60180 61013 gene locus_tag LOCUS_45780 60180 61013 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105365.1 protein_id gnl|my_center|LOCUS_45780 61053 62165 gene locus_tag LOCUS_45790 gene ugpC 61053 62165 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115000.1 protein_id gnl|my_center|LOCUS_45790 62188 63663 gene locus_tag LOCUS_45800 62188 63663 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105368.1 protein_id gnl|my_center|LOCUS_45800 63678 65168 gene locus_tag LOCUS_45810 gene xylB 63678 65168 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122708.1 protein_id gnl|my_center|LOCUS_45810 65209 66141 gene locus_tag LOCUS_45820 65209 66141 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115002.1 protein_id gnl|my_center|LOCUS_45820 67419 66184 gene locus_tag LOCUS_45830 67419 66184 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106867.1 protein_id gnl|my_center|LOCUS_45830 67442 67834 gene locus_tag LOCUS_45840 67442 67834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 67838 69073 gene locus_tag LOCUS_45850 67838 69073 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106870.1 protein_id gnl|my_center|LOCUS_45850 69084 70301 gene locus_tag LOCUS_45860 69084 70301 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089457.1 protein_id gnl|my_center|LOCUS_45860 70319 71707 gene locus_tag LOCUS_45870 70319 71707 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115003.1 protein_id gnl|my_center|LOCUS_45870 71739 72533 gene locus_tag LOCUS_45880 71739 72533 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115004.1 protein_id gnl|my_center|LOCUS_45880 72539 73639 gene locus_tag LOCUS_45890 72539 73639 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895607.1 protein_id gnl|my_center|LOCUS_45890 73623 74276 gene locus_tag LOCUS_45900 73623 74276 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111646.1 protein_id gnl|my_center|LOCUS_45900 74454 75581 gene locus_tag LOCUS_45910 74454 75581 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115005.1 protein_id gnl|my_center|LOCUS_45910 76801 75647 gene locus_tag LOCUS_45920 gene zapE 76801 75647 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111446.1 protein_id gnl|my_center|LOCUS_45920 78103 76973 gene locus_tag LOCUS_45930 78103 76973 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115336.1 protein_id gnl|my_center|LOCUS_45930 79284 78100 gene locus_tag LOCUS_45940 79284 78100 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104714.1 protein_id gnl|my_center|LOCUS_45940 80459 79314 gene locus_tag LOCUS_45950 gene ssuD 80459 79314 CDS product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104713.1 protein_id gnl|my_center|LOCUS_45950 81029 80469 gene locus_tag LOCUS_45960 gene msuE 81029 80469 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089470.1 protein_id gnl|my_center|LOCUS_45960 81455 81189 gene locus_tag LOCUS_45970 81455 81189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 82776 81691 gene locus_tag LOCUS_45980 82776 81691 CDS product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115339.1 protein_id gnl|my_center|LOCUS_45980 83986 82886 gene locus_tag LOCUS_45990 gene tssA 83986 82886 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115340.1 protein_id gnl|my_center|LOCUS_45990 87798 83983 gene locus_tag LOCUS_46000 87798 83983 CDS product type VI secretion system membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114521.1 protein_id gnl|my_center|LOCUS_46000 88553 87795 gene locus_tag LOCUS_46010 88553 87795 CDS product DotU family type IV/VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104706.1 protein_id gnl|my_center|LOCUS_46010 89902 88571 gene locus_tag LOCUS_46020 gene tssK 89902 88571 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122697.1 protein_id gnl|my_center|LOCUS_46020 90438 89962 gene locus_tag LOCUS_46030 90438 89962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104701.1 protein_id gnl|my_center|LOCUS_46030 90647 91192 gene locus_tag LOCUS_46040 gene tssB 90647 91192 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089493.1 protein_id gnl|my_center|LOCUS_46040 91215 92699 gene locus_tag LOCUS_46050 gene tssC 91215 92699 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089494.1 protein_id gnl|my_center|LOCUS_46050 92773 93270 gene locus_tag LOCUS_46060 92773 93270 CDS product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089495.1 protein_id gnl|my_center|LOCUS_46060 93283 93708 gene locus_tag LOCUS_46070 gene tssE 93283 93708 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114519.1 protein_id gnl|my_center|LOCUS_46070 93692 95485 gene locus_tag LOCUS_46080 gene tssF 93692 95485 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114518.1 protein_id gnl|my_center|LOCUS_46080 95449 96465 gene locus_tag LOCUS_46090 gene tssG 95449 96465 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114517.1 protein_id gnl|my_center|LOCUS_46090 96467 99016 gene locus_tag LOCUS_46100 gene tssH 96467 99016 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114516.1 protein_id gnl|my_center|LOCUS_46100 99198 99623 gene locus_tag LOCUS_46110 99198 99623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 99662 100729 gene locus_tag LOCUS_46120 99662 100729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46120 100766 102772 gene locus_tag LOCUS_46130 100766 102772 CDS product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114515.1 protein_id gnl|my_center|LOCUS_46130 102783 103319 gene locus_tag LOCUS_46140 102783 103319 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114514.1 protein_id gnl|my_center|LOCUS_46140 103737 103342 gene locus_tag LOCUS_46150 103737 103342 CDS product DUF4280 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089513.1 protein_id gnl|my_center|LOCUS_46150 104014 104655 gene locus_tag LOCUS_46160 104014 104655 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110901.1 protein_id gnl|my_center|LOCUS_46160 104856 106061 gene locus_tag LOCUS_46170 104856 106061 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122690.1 protein_id gnl|my_center|LOCUS_46170 108793 106478 gene locus_tag LOCUS_46180 108793 106478 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114512.1 protein_id gnl|my_center|LOCUS_46180 109260 108790 gene locus_tag LOCUS_46190 109260 108790 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089521.1 protein_id gnl|my_center|LOCUS_46190 109762 109526 gene locus_tag LOCUS_46200 109762 109526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104944.1 protein_id gnl|my_center|LOCUS_46200 110057 110299 gene locus_tag LOCUS_46210 110057 110299 CDS product DUF1654 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089526.1 protein_id gnl|my_center|LOCUS_46210 111527 110376 gene locus_tag LOCUS_46220 gene lldA 111527 110376 CDS product L-lactate dehydrogenase LldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104946.1 protein_id gnl|my_center|LOCUS_46220 112544 111624 gene locus_tag LOCUS_46230 112544 111624 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114511.1 protein_id gnl|my_center|LOCUS_46230 112909 112586 gene locus_tag LOCUS_46240 112909 112586 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089535.1 protein_id gnl|my_center|LOCUS_46240 115378 113090 gene locus_tag LOCUS_46250 gene pvdQ 115378 113090 CDS product acyl-homoserine lactone acylase PvdQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115642.1 protein_id gnl|my_center|LOCUS_46250 116832 115501 gene locus_tag LOCUS_46260 gene pvdA 116832 115501 CDS product L-ornithine N(5)-monooxygenase PvdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114509.1 protein_id gnl|my_center|LOCUS_46260 117444 116965 gene locus_tag LOCUS_46270 gene fpvI 117444 116965 CDS product pyoverdine signaling pathway sigma factor FpvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103620.1 protein_id gnl|my_center|LOCUS_46270 117608 118603 gene locus_tag LOCUS_46280 gene fpvR 117608 118603 CDS product pyoverdine signaling pathway anti-sigma factor FpvR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115643.1 protein_id gnl|my_center|LOCUS_46280 118704 119879 gene locus_tag LOCUS_46290 gene pvdR 118704 119879 CDS product pyoverdine export/recycling transporter periplasmic adaptor subunit PvdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114507.1 protein_id gnl|my_center|LOCUS_46290 119879 121870 gene locus_tag LOCUS_46300 gene pvdT 119879 121870 CDS product pyoverdine export/recycling transporter ATP-binding/permease subunit PvdT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114506.1 protein_id gnl|my_center|LOCUS_46300 121882 123300 gene locus_tag LOCUS_46310 gene ompQ 121882 123300 CDS product pyoverdine export/recycling transporter outer membrane subunit OmpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895610.1 protein_id gnl|my_center|LOCUS_46310 124959 123349 gene locus_tag LOCUS_46320 gene pvdP 124959 123349 CDS product pyoverdine maturation tyrosinase PvdP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003139293.1 protein_id gnl|my_center|LOCUS_46320 125199 126545 gene locus_tag LOCUS_46330 gene pvdM 125199 126545 CDS product pyoverdine-tailoring dipeptidase-like protein PvdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103610.1 protein_id gnl|my_center|LOCUS_46330 126568 127851 gene locus_tag LOCUS_46340 gene pvdN 126568 127851 CDS product pyoverdine-tailoring periplasmic protein PvdN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114503.1 protein_id gnl|my_center|LOCUS_46340 127880 128734 gene locus_tag LOCUS_46350 127880 128734 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114502.1 protein_id gnl|my_center|LOCUS_46350 129630 128803 gene locus_tag LOCUS_46360 gene pvdF 129630 128803 CDS product pyoverdine biosynthesis hydroxyornithine transformylase PvdF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114501.1 protein_id gnl|my_center|LOCUS_46360 130008 131657 gene locus_tag LOCUS_46370 gene pvdE 130008 131657 CDS product pyoverdine export ABC transporter PvdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103601.1 protein_id gnl|my_center|LOCUS_46370 131805 134207 gene locus_tag LOCUS_46380 gene fpvA 131805 134207 CDS product ferripyoverdine/pyocin S3 receptor FpvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004349900.1 protein_id gnl|my_center|LOCUS_46380 <135553 134371 gene locus_tag LOCUS_46390 <135553 134371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895611.1:pyoverdine non-ribosomal peptide synthetase PvdD >Feature sequence19 385 861 gene locus_tag LOCUS_46400 385 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 2007 1195 gene locus_tag LOCUS_46410 2007 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46410 2708 2004 gene locus_tag LOCUS_46420 2708 2004 CDS product RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964070.1 protein_id gnl|my_center|LOCUS_46420 3245 2715 gene locus_tag LOCUS_46430 3245 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258560.1 protein_id gnl|my_center|LOCUS_46430 4639 3242 gene locus_tag LOCUS_46440 4639 3242 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258559.1 protein_id gnl|my_center|LOCUS_46440 6676 4733 gene locus_tag LOCUS_46450 6676 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46450 11149 6683 gene locus_tag LOCUS_46460 11149 6683 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256730.1 protein_id gnl|my_center|LOCUS_46460 13957 11174 gene locus_tag LOCUS_46470 13957 11174 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 protein_id gnl|my_center|LOCUS_46470 19236 13963 gene locus_tag LOCUS_46480 19236 13963 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883981.1 protein_id gnl|my_center|LOCUS_46480 20430 20699 gene locus_tag LOCUS_46490 20430 20699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46490 20696 21043 gene locus_tag LOCUS_46500 20696 21043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46500 21534 22040 gene locus_tag LOCUS_46510 gene radC 21534 22040 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148675.1 protein_id gnl|my_center|LOCUS_46510 22887 22075 gene locus_tag LOCUS_46520 22887 22075 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108427.1 protein_id gnl|my_center|LOCUS_46520 23213 22959 gene locus_tag LOCUS_46530 23213 22959 CDS product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212003.1 protein_id gnl|my_center|LOCUS_46530 24483 23218 gene locus_tag LOCUS_46540 24483 23218 CDS product S-type pyocin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073579396.1 protein_id gnl|my_center|LOCUS_46540 25280 24774 gene locus_tag LOCUS_46550 25280 24774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46550 25524 25982 gene locus_tag LOCUS_46560 25524 25982 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010434385.1 protein_id gnl|my_center|LOCUS_46560 26266 26778 gene locus_tag LOCUS_46570 26266 26778 CDS product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946710.1 protein_id gnl|my_center|LOCUS_46570 27285 27656 gene locus_tag LOCUS_46580 27285 27656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 27668 28495 gene locus_tag LOCUS_46590 27668 28495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 28740 29378 gene locus_tag LOCUS_46600 gene parA 28740 29378 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082882.1 protein_id gnl|my_center|LOCUS_46600 29375 29617 gene locus_tag LOCUS_46610 29375 29617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46610 29614 30141 gene locus_tag LOCUS_46620 29614 30141 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533277.1 protein_id gnl|my_center|LOCUS_46620 30491 32440 gene locus_tag LOCUS_46630 gene rlxS 30491 32440 CDS product relaxase/mobilization nuclease RlxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533275.1 protein_id gnl|my_center|LOCUS_46630 33310 32456 gene locus_tag LOCUS_46640 33310 32456 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388870.1 protein_id gnl|my_center|LOCUS_46640 33467 34699 gene locus_tag LOCUS_46650 gene hemA 33467 34699 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533608.1 protein_id gnl|my_center|LOCUS_46650 34701 35204 gene locus_tag LOCUS_46660 34701 35204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 35201 36271 gene locus_tag LOCUS_46670 35201 36271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46670 36294 38147 gene locus_tag LOCUS_46680 gene asnB 36294 38147 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223784.1 protein_id gnl|my_center|LOCUS_46680 38233 39432 gene locus_tag LOCUS_46690 38233 39432 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222736.1 protein_id gnl|my_center|LOCUS_46690 39446 40372 gene locus_tag LOCUS_46700 39446 40372 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213173803.1 protein_id gnl|my_center|LOCUS_46700 40543 41841 gene locus_tag LOCUS_46710 40543 41841 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967861.1 protein_id gnl|my_center|LOCUS_46710 42800 41859 gene locus_tag LOCUS_46720 42800 41859 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097898.1 protein_id gnl|my_center|LOCUS_46720 43624 42974 gene locus_tag LOCUS_46730 gene pcp 43624 42974 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209662.1 protein_id gnl|my_center|LOCUS_46730 44655 43993 gene locus_tag LOCUS_46740 44655 43993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087175.1 protein_id gnl|my_center|LOCUS_46740 45405 44668 gene locus_tag LOCUS_46750 45405 44668 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008460272.1 protein_id gnl|my_center|LOCUS_46750 45869 45453 gene locus_tag LOCUS_46760 45869 45453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46760 45926 46213 gene locus_tag LOCUS_46770 45926 46213 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268096.1 protein_id gnl|my_center|LOCUS_46770 46225 47361 gene locus_tag LOCUS_46780 46225 47361 CDS product Ni(II)/Co(II) efflux transporter permease subunit NcrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196366.1 protein_id gnl|my_center|LOCUS_46780 47363 47803 gene locus_tag LOCUS_46790 47363 47803 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764689.1 protein_id gnl|my_center|LOCUS_46790 47800 48507 gene locus_tag LOCUS_46800 47800 48507 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103135.1 protein_id gnl|my_center|LOCUS_46800 48991 48539 gene locus_tag LOCUS_46810 48991 48539 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201060.1 protein_id gnl|my_center|LOCUS_46810 49328 49005 gene locus_tag LOCUS_46820 49328 49005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46820 50701 49340 gene locus_tag LOCUS_46830 gene chrA 50701 49340 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096587.1 protein_id gnl|my_center|LOCUS_46830 51614 50694 gene locus_tag LOCUS_46840 51614 50694 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196334.1 protein_id gnl|my_center|LOCUS_46840 52862 51900 gene locus_tag LOCUS_46850 52862 51900 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114126.1 protein_id gnl|my_center|LOCUS_46850 53198 55189 gene locus_tag LOCUS_46860 53198 55189 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533272.1 protein_id gnl|my_center|LOCUS_46860 55186 55620 gene locus_tag LOCUS_46870 55186 55620 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388569.1 protein_id gnl|my_center|LOCUS_46870 55617 56648 gene locus_tag LOCUS_46880 gene trbB 55617 56648 CDS product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090996.1 protein_id gnl|my_center|LOCUS_46880 56620 56961 gene locus_tag LOCUS_46890 56620 56961 CDS product TrbC/VirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533269.1 protein_id gnl|my_center|LOCUS_46890 56958 57230 gene locus_tag LOCUS_46900 56958 57230 CDS product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026312513.1 protein_id gnl|my_center|LOCUS_46900 57241 59670 gene locus_tag LOCUS_46910 gene trbE 57241 59670 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533267.1 protein_id gnl|my_center|LOCUS_46910 59667 60401 gene locus_tag LOCUS_46920 59667 60401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46920 60414 60599 gene locus_tag LOCUS_46930 60414 60599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 60596 61756 gene locus_tag LOCUS_46940 60596 61756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46940 61769 62476 gene locus_tag LOCUS_46950 gene trbF 61769 62476 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368415.1 protein_id gnl|my_center|LOCUS_46950 62473 63459 gene locus_tag LOCUS_46960 gene trbG 62473 63459 CDS product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090988.1 protein_id gnl|my_center|LOCUS_46960 63462 64724 gene locus_tag LOCUS_46970 63462 64724 CDS product TrbI/VirB10 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084435.1 protein_id gnl|my_center|LOCUS_46970 64721 64954 gene locus_tag LOCUS_46980 64721 64954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46980 65048 65326 gene locus_tag LOCUS_46990 65048 65326 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737444.1 protein_id gnl|my_center|LOCUS_46990 65344 65631 gene locus_tag LOCUS_47000 65344 65631 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103139.1 protein_id gnl|my_center|LOCUS_47000 66889 65954 gene locus_tag LOCUS_47010 66889 65954 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133037023.1 protein_id gnl|my_center|LOCUS_47010 67469 66873 gene locus_tag LOCUS_47020 67469 66873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47020 68655 67819 gene locus_tag LOCUS_47030 68655 67819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47030 68581 68763 gene locus_tag LOCUS_47040 68581 68763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47040 69592 70791 gene locus_tag LOCUS_47050 69592 70791 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947770.1 protein_id gnl|my_center|LOCUS_47050 70963 70887 gene locus_tag LOCUS_t00380 70963 70887 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 71409 71053 gene locus_tag LOCUS_47060 71409 71053 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090655.1 protein_id gnl|my_center|LOCUS_47060 71692 71390 gene locus_tag LOCUS_47070 gene ihfA 71692 71390 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090661.1 protein_id gnl|my_center|LOCUS_47070 74074 71696 gene locus_tag LOCUS_47080 gene pheT 74074 71696 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114408.1 protein_id gnl|my_center|LOCUS_47080 75125 74109 gene locus_tag LOCUS_47090 gene pheS 75125 74109 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114409.1 protein_id gnl|my_center|LOCUS_47090 75579 75223 gene locus_tag LOCUS_47100 gene rplT 75579 75223 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099086.1 protein_id gnl|my_center|LOCUS_47100 75797 75603 gene locus_tag LOCUS_47110 gene rpmI 75797 75603 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090673.1 protein_id gnl|my_center|LOCUS_47110 76392 75859 gene locus_tag LOCUS_47120 gene infC 76392 75859 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119938.1 protein_id gnl|my_center|LOCUS_47120 78332 76410 gene locus_tag LOCUS_47130 gene thrS 78332 76410 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090677.1 protein_id gnl|my_center|LOCUS_47130 79445 78582 gene locus_tag LOCUS_47140 79445 78582 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114410.1 protein_id gnl|my_center|LOCUS_47140 79637 79963 gene locus_tag LOCUS_47150 79637 79963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090681.1 protein_id gnl|my_center|LOCUS_47150 80048 80224 gene locus_tag LOCUS_47160 80048 80224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099098.1 protein_id gnl|my_center|LOCUS_47160 80837 80550 gene locus_tag LOCUS_47170 80837 80550 CDS product DUF3509 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090684.1 protein_id gnl|my_center|LOCUS_47170 81269 81036 gene locus_tag LOCUS_47180 81269 81036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090686.1 protein_id gnl|my_center|LOCUS_47180 82105 81323 gene locus_tag LOCUS_47190 gene map 82105 81323 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114411.1 protein_id gnl|my_center|LOCUS_47190 82323 82102 gene locus_tag LOCUS_47200 82323 82102 CDS product ParD-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192010.1 protein_id gnl|my_center|LOCUS_47200 82480 83193 gene locus_tag LOCUS_47210 82480 83193 CDS product endonuclease I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099106.1 protein_id gnl|my_center|LOCUS_47210 83212 83730 gene locus_tag LOCUS_47220 83212 83730 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114413.1 protein_id gnl|my_center|LOCUS_47220 83935 83705 gene locus_tag LOCUS_47230 83935 83705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090795.1 protein_id gnl|my_center|LOCUS_47230 84234 84001 gene locus_tag LOCUS_47240 84234 84001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 84457 85356 gene locus_tag LOCUS_47250 84457 85356 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090797.1 protein_id gnl|my_center|LOCUS_47250 85663 85346 gene locus_tag LOCUS_47260 85663 85346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 86262 85819 gene locus_tag LOCUS_47270 86262 85819 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114414.1 protein_id gnl|my_center|LOCUS_47270 86398 86772 gene locus_tag LOCUS_47280 86398 86772 CDS product DUF5064 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090800.1 protein_id gnl|my_center|LOCUS_47280 86883 87212 gene locus_tag LOCUS_47290 86883 87212 CDS product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114415.1 protein_id gnl|my_center|LOCUS_47290 87475 87278 gene locus_tag LOCUS_47300 87475 87278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090804.1 protein_id gnl|my_center|LOCUS_47300 87654 87884 gene locus_tag LOCUS_47310 87654 87884 CDS product DUF2789 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090806.1 protein_id gnl|my_center|LOCUS_47310 88232 88702 gene locus_tag LOCUS_47320 gene eco 88232 88702 CDS product serine protease inhibitor ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114416.1 protein_id gnl|my_center|LOCUS_47320 89057 88755 gene locus_tag LOCUS_47330 89057 88755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 89771 89328 gene locus_tag LOCUS_47340 89771 89328 CDS product PACE efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090812.1 protein_id gnl|my_center|LOCUS_47340 89874 90761 gene locus_tag LOCUS_47350 89874 90761 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099119.1 protein_id gnl|my_center|LOCUS_47350 91287 91030 gene locus_tag LOCUS_47360 91287 91030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47360 91652 92932 gene locus_tag LOCUS_47370 91652 92932 CDS product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099122.1 protein_id gnl|my_center|LOCUS_47370 93089 93460 gene locus_tag LOCUS_47380 93089 93460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895636.1 protein_id gnl|my_center|LOCUS_47380 93847 93503 gene locus_tag LOCUS_47390 93847 93503 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090818.1 protein_id gnl|my_center|LOCUS_47390 94168 93959 gene locus_tag LOCUS_47400 94168 93959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090820.1 protein_id gnl|my_center|LOCUS_47400 94438 94626 gene locus_tag LOCUS_47410 94438 94626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090821.1 protein_id gnl|my_center|LOCUS_47410 94850 94641 gene locus_tag LOCUS_47420 94850 94641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47420 95181 95876 gene locus_tag LOCUS_47430 95181 95876 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114420.1 protein_id gnl|my_center|LOCUS_47430 96805 95924 gene locus_tag LOCUS_47440 96805 95924 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119903.1 protein_id gnl|my_center|LOCUS_47440 97746 97165 gene locus_tag LOCUS_47450 97746 97165 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090825.1 protein_id gnl|my_center|LOCUS_47450 97834 98802 gene locus_tag LOCUS_47460 97834 98802 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114421.1 protein_id gnl|my_center|LOCUS_47460 98808 99290 gene locus_tag LOCUS_47470 98808 99290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114422.1 protein_id gnl|my_center|LOCUS_47470 99851 99441 gene locus_tag LOCUS_47480 99851 99441 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114423.1 protein_id gnl|my_center|LOCUS_47480 100652 99873 gene locus_tag LOCUS_47490 100652 99873 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114424.1 protein_id gnl|my_center|LOCUS_47490 100978 100739 gene locus_tag LOCUS_47500 100978 100739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47500 101310 102335 gene locus_tag LOCUS_47510 101310 102335 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114426.1 protein_id gnl|my_center|LOCUS_47510 102563 102342 gene locus_tag LOCUS_47520 102563 102342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47520 102827 102997 gene locus_tag LOCUS_47530 102827 102997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099153.1 protein_id gnl|my_center|LOCUS_47530 103425 103090 gene locus_tag LOCUS_47540 103425 103090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47540 103635 103907 gene locus_tag LOCUS_47550 103635 103907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 104396 103809 gene locus_tag LOCUS_47560 gene tse4 104396 103809 CDS product type IV secretion system toxin Tse4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099160.1 protein_id gnl|my_center|LOCUS_47560 104838 104401 gene locus_tag LOCUS_47570 gene tsi4 104838 104401 CDS product type VI secretion system immunity protein Tsi4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114429.1 protein_id gnl|my_center|LOCUS_47570 105106 105030 gene locus_tag LOCUS_t00390 105106 105030 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 105290 106573 gene locus_tag LOCUS_47580 105290 106573 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114430.1 protein_id gnl|my_center|LOCUS_47580 107589 106624 gene locus_tag LOCUS_47590 107589 106624 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115216.1 protein_id gnl|my_center|LOCUS_47590 108639 107662 gene locus_tag LOCUS_47600 108639 107662 CDS product PA2778 family cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895637.1 protein_id gnl|my_center|LOCUS_47600 109022 108624 gene locus_tag LOCUS_47610 109022 108624 CDS product PA2779 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090843.1 protein_id gnl|my_center|LOCUS_47610 109430 109774 gene locus_tag LOCUS_47620 109430 109774 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115217.1 protein_id gnl|my_center|LOCUS_47620 109771 110112 gene locus_tag LOCUS_47630 109771 110112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119898.1 protein_id gnl|my_center|LOCUS_47630 110591 111250 gene locus_tag LOCUS_47640 gene bamI 110591 111250 CDS product biofilm-associated metzincin protease inhibitor BamI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124476.1 protein_id gnl|my_center|LOCUS_47640 111328 113127 gene locus_tag LOCUS_47650 gene mep72 111328 113127 CDS product metalloendopeptidase Mep72 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114786.1 protein_id gnl|my_center|LOCUS_47650 113299 113856 gene locus_tag LOCUS_47660 113299 113856 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114785.1 protein_id gnl|my_center|LOCUS_47660 113865 114083 gene locus_tag LOCUS_47670 113865 114083 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108924.1 protein_id gnl|my_center|LOCUS_47670 114198 114665 gene locus_tag LOCUS_47680 114198 114665 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104034.1 protein_id gnl|my_center|LOCUS_47680 114732 115970 gene locus_tag LOCUS_47690 114732 115970 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114784.1 protein_id gnl|my_center|LOCUS_47690 117587 115992 gene locus_tag LOCUS_47700 gene mcpN 117587 115992 CDS product nitrate chemoreceptor McpN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114783.1 protein_id gnl|my_center|LOCUS_47700 117831 118910 gene locus_tag LOCUS_47710 117831 118910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114782.1 protein_id gnl|my_center|LOCUS_47710 119453 119830 gene locus_tag LOCUS_47720 119453 119830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122543.1 protein_id gnl|my_center|LOCUS_47720 120209 119919 gene locus_tag LOCUS_47730 120209 119919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104043.1 protein_id gnl|my_center|LOCUS_47730 120899 120303 gene locus_tag LOCUS_47740 120899 120303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114780.1 protein_id gnl|my_center|LOCUS_47740 122014 120980 gene locus_tag LOCUS_47750 122014 120980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090863.1 protein_id gnl|my_center|LOCUS_47750 122937 122281 gene locus_tag LOCUS_47760 122937 122281 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532264.1 protein_id gnl|my_center|LOCUS_47760 123042 124256 gene locus_tag LOCUS_47770 123042 124256 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532265.1 protein_id gnl|my_center|LOCUS_47770 124284 124877 gene locus_tag LOCUS_47780 124284 124877 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103735.1 protein_id gnl|my_center|LOCUS_47780 126050 125667 gene locus_tag LOCUS_47790 126050 125667 CDS product DUF2388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102543.1 protein_id gnl|my_center|LOCUS_47790 126490 126143 gene locus_tag LOCUS_47800 126490 126143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47800 126865 126620 gene locus_tag LOCUS_47810 126865 126620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47810 127350 126862 gene locus_tag LOCUS_47820 127350 126862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47820 127718 127455 gene locus_tag LOCUS_47830 127718 127455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47830 128017 127754 gene locus_tag LOCUS_47840 128017 127754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47840 >Feature sequence20 297 46 gene locus_tag LOCUS_47850 297 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115979.1 protein_id gnl|my_center|LOCUS_47850 852 418 gene locus_tag LOCUS_47860 852 418 CDS product phage destabilizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115132.1 protein_id gnl|my_center|LOCUS_47860 1831 1541 gene locus_tag LOCUS_47870 1831 1541 CDS product DUF5447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895517.1 protein_id gnl|my_center|LOCUS_47870 2047 1835 gene locus_tag LOCUS_47880 2047 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47880 2265 2050 gene locus_tag LOCUS_47890 2265 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47890 2393 2659 gene locus_tag LOCUS_47900 2393 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47900 3016 3627 gene locus_tag LOCUS_47910 3016 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47910 3696 4097 gene locus_tag LOCUS_47920 3696 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47920 4152 4946 gene locus_tag LOCUS_47930 4152 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47930 5132 5359 gene locus_tag LOCUS_47940 5132 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 6298 5576 gene locus_tag LOCUS_47950 6298 5576 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095301.1 protein_id gnl|my_center|LOCUS_47950 6489 6929 gene locus_tag LOCUS_47960 6489 6929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114628.1 protein_id gnl|my_center|LOCUS_47960 7225 8025 gene locus_tag LOCUS_47970 7225 8025 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114629.1 protein_id gnl|my_center|LOCUS_47970 8022 8600 gene locus_tag LOCUS_47980 8022 8600 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114630.1 protein_id gnl|my_center|LOCUS_47980 9351 8623 gene locus_tag LOCUS_47990 9351 8623 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114631.1 protein_id gnl|my_center|LOCUS_47990 9935 9468 gene locus_tag LOCUS_48000 9935 9468 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102267.1 protein_id gnl|my_center|LOCUS_48000 10309 9932 gene locus_tag LOCUS_48010 10309 9932 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095286.1 protein_id gnl|my_center|LOCUS_48010 10781 10299 gene locus_tag LOCUS_48020 10781 10299 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111411.1 protein_id gnl|my_center|LOCUS_48020 11346 10783 gene locus_tag LOCUS_48030 11346 10783 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095282.1 protein_id gnl|my_center|LOCUS_48030 11478 12413 gene locus_tag LOCUS_48040 11478 12413 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112918.1 protein_id gnl|my_center|LOCUS_48040 13018 12398 gene locus_tag LOCUS_48050 13018 12398 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102259.1 protein_id gnl|my_center|LOCUS_48050 13833 13084 gene locus_tag LOCUS_48060 13833 13084 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111303.1 protein_id gnl|my_center|LOCUS_48060 14135 13830 gene locus_tag LOCUS_48070 14135 13830 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102255.1 protein_id gnl|my_center|LOCUS_48070 15074 14217 gene locus_tag LOCUS_48080 15074 14217 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095272.1 protein_id gnl|my_center|LOCUS_48080 15335 16336 gene locus_tag LOCUS_48090 15335 16336 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095270.1 protein_id gnl|my_center|LOCUS_48090 17766 16411 gene locus_tag LOCUS_48100 17766 16411 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112919.1 protein_id gnl|my_center|LOCUS_48100 18021 19298 gene locus_tag LOCUS_48110 18021 19298 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102247.1 protein_id gnl|my_center|LOCUS_48110 20089 19622 gene locus_tag LOCUS_48120 20089 19622 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095262.1 protein_id gnl|my_center|LOCUS_48120 20244 21134 gene locus_tag LOCUS_48130 gene yedA 20244 21134 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112921.1 protein_id gnl|my_center|LOCUS_48130 21168 21413 gene locus_tag LOCUS_48140 21168 21413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102243.1 protein_id gnl|my_center|LOCUS_48140 21521 22702 gene locus_tag LOCUS_48150 21521 22702 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102241.1 protein_id gnl|my_center|LOCUS_48150 22826 23719 gene locus_tag LOCUS_48160 22826 23719 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095255.1 protein_id gnl|my_center|LOCUS_48160 23809 24702 gene locus_tag LOCUS_48170 23809 24702 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102239.1 protein_id gnl|my_center|LOCUS_48170 24699 25265 gene locus_tag LOCUS_48180 24699 25265 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701718.1 protein_id gnl|my_center|LOCUS_48180 25632 25234 gene locus_tag LOCUS_48190 gene cueR 25632 25234 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095248.1 protein_id gnl|my_center|LOCUS_48190 27129 25696 gene locus_tag LOCUS_48200 gene pmrB 27129 25696 CDS product two-component system sensor histidine kinase PmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112923.1 protein_id gnl|my_center|LOCUS_48200 27818 27153 gene locus_tag LOCUS_48210 gene pmrA 27818 27153 CDS product two-component system response regulator PrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102236.1 protein_id gnl|my_center|LOCUS_48210 28691 27831 gene locus_tag LOCUS_48220 28691 27831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102235.1 protein_id gnl|my_center|LOCUS_48220 29821 28694 gene locus_tag LOCUS_48230 29821 28694 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121084.1 protein_id gnl|my_center|LOCUS_48230 30303 29821 gene locus_tag LOCUS_48240 gene speD 30303 29821 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095236.1 protein_id gnl|my_center|LOCUS_48240 33548 30732 gene locus_tag LOCUS_48250 33548 30732 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123510.1 protein_id gnl|my_center|LOCUS_48250 34760 33615 gene locus_tag LOCUS_48260 gene lldD 34760 33615 CDS product FMN-dependent L-lactate dehydrogenase LldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100494.1 protein_id gnl|my_center|LOCUS_48260 36597 34915 gene locus_tag LOCUS_48270 36597 34915 CDS product lactate permease LctP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113903.1 protein_id gnl|my_center|LOCUS_48270 36926 37699 gene locus_tag LOCUS_48280 36926 37699 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095221.1 protein_id gnl|my_center|LOCUS_48280 38201 37722 gene locus_tag LOCUS_48290 gene smpB 38201 37722 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100496.1 protein_id gnl|my_center|LOCUS_48290 38477 38911 gene locus_tag LOCUS_48300 38477 38911 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100497.1 protein_id gnl|my_center|LOCUS_48300 38904 39209 gene locus_tag LOCUS_48310 38904 39209 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095218.1 protein_id gnl|my_center|LOCUS_48310 39807 39277 gene locus_tag LOCUS_48320 39807 39277 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113904.1 protein_id gnl|my_center|LOCUS_48320 39905 40309 gene locus_tag LOCUS_48330 gene fur 39905 40309 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095216.1 protein_id gnl|my_center|LOCUS_48330 42055 40379 gene locus_tag LOCUS_48340 gene recN 42055 40379 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113905.1 protein_id gnl|my_center|LOCUS_48340 42223 42783 gene locus_tag LOCUS_48350 gene grpE 42223 42783 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095213.1 protein_id gnl|my_center|LOCUS_48350 42873 44786 gene locus_tag LOCUS_48360 gene dnaK 42873 44786 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095212.1 protein_id gnl|my_center|LOCUS_48360 44902 46035 gene locus_tag LOCUS_48370 gene dnaJ 44902 46035 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095211.1 protein_id gnl|my_center|LOCUS_48370 46092 46898 gene locus_tag LOCUS_48380 gene dapB 46092 46898 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095210.1 protein_id gnl|my_center|LOCUS_48380 47081 48217 gene locus_tag LOCUS_48390 gene carA 47081 48217 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095209.1 protein_id gnl|my_center|LOCUS_48390 48229 48879 gene locus_tag LOCUS_48400 gene leuE 48229 48879 CDS product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095208.1 protein_id gnl|my_center|LOCUS_48400 48899 52120 gene locus_tag LOCUS_48410 gene carB 48899 52120 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095207.1 protein_id gnl|my_center|LOCUS_48410 52117 52593 gene locus_tag LOCUS_48420 gene greA 52117 52593 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095206.1 protein_id gnl|my_center|LOCUS_48420 52604 53011 gene locus_tag LOCUS_48430 52604 53011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113906.1 protein_id gnl|my_center|LOCUS_48430 53366 53052 gene locus_tag LOCUS_48440 gene yhbY 53366 53052 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095204.1 protein_id gnl|my_center|LOCUS_48440 53461 54084 gene locus_tag LOCUS_48450 gene rlmE 53461 54084 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095202.1 protein_id gnl|my_center|LOCUS_48450 54274 56202 gene locus_tag LOCUS_48460 gene ftsH 54274 56202 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095200.1 protein_id gnl|my_center|LOCUS_48460 56212 57063 gene locus_tag LOCUS_48470 gene folP 56212 57063 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113907.1 protein_id gnl|my_center|LOCUS_48470 57080 58417 gene locus_tag LOCUS_48480 gene glmM 57080 58417 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095196.1 protein_id gnl|my_center|LOCUS_48480 58483 59238 gene locus_tag LOCUS_48490 gene tpiA 58483 59238 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100513.1 protein_id gnl|my_center|LOCUS_48490 59241 59630 gene locus_tag LOCUS_48500 gene secG 59241 59630 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095194.1 protein_id gnl|my_center|LOCUS_48500 59644 59729 gene locus_tag LOCUS_t00400 59644 59729 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 59820 59896 gene locus_tag LOCUS_t00410 59820 59896 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 60023 60481 gene locus_tag LOCUS_48510 gene rimP 60023 60481 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095193.1 protein_id gnl|my_center|LOCUS_48510 60526 62007 gene locus_tag LOCUS_48520 gene nusA 60526 62007 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095192.1 protein_id gnl|my_center|LOCUS_48520 62035 64557 gene locus_tag LOCUS_48530 gene infB 62035 64557 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113908.1 protein_id gnl|my_center|LOCUS_48530 64660 65052 gene locus_tag LOCUS_48540 gene rbfA 64660 65052 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095188.1 protein_id gnl|my_center|LOCUS_48540 65055 65969 gene locus_tag LOCUS_48550 gene truB 65055 65969 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100522.1 protein_id gnl|my_center|LOCUS_48550 66065 66334 gene locus_tag LOCUS_48560 gene rpsO 66065 66334 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095184.1 protein_id gnl|my_center|LOCUS_48560 66508 68613 gene locus_tag LOCUS_48570 gene pnp 66508 68613 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095181.1 protein_id gnl|my_center|LOCUS_48570 68886 69230 gene locus_tag LOCUS_48580 68886 69230 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095177.1 protein_id gnl|my_center|LOCUS_48580 69280 69477 gene locus_tag LOCUS_48590 69280 69477 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095174.1 protein_id gnl|my_center|LOCUS_48590 69851 69537 gene locus_tag LOCUS_48600 69851 69537 CDS product DUF2845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100526.1 protein_id gnl|my_center|LOCUS_48600 70141 69848 gene locus_tag LOCUS_48610 70141 69848 CDS product DUF2845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100541.1 protein_id gnl|my_center|LOCUS_48610 73412 70146 gene locus_tag LOCUS_48620 73412 70146 CDS product DUF748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113909.1 protein_id gnl|my_center|LOCUS_48620 74418 73537 gene locus_tag LOCUS_48630 74418 73537 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113910.1 protein_id gnl|my_center|LOCUS_48630 76453 74516 gene locus_tag LOCUS_48640 gene acs 76453 74516 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113911.1 protein_id gnl|my_center|LOCUS_48640 78311 76647 gene locus_tag LOCUS_48650 gene pgi 78311 76647 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100194.1 protein_id gnl|my_center|LOCUS_48650 78781 78401 gene locus_tag LOCUS_48660 78781 78401 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113912.1 protein_id gnl|my_center|LOCUS_48660 79726 78875 gene locus_tag LOCUS_48670 gene panC 79726 78875 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109313.1 protein_id gnl|my_center|LOCUS_48670 80523 79723 gene locus_tag LOCUS_48680 gene panB 80523 79723 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113913.1 protein_id gnl|my_center|LOCUS_48680 81243 80773 gene locus_tag LOCUS_48690 gene folK 81243 80773 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095144.1 protein_id gnl|my_center|LOCUS_48690 82661 81258 gene locus_tag LOCUS_48700 82661 81258 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095142.1 protein_id gnl|my_center|LOCUS_48700 84996 83560 gene locus_tag LOCUS_48710 gene cbrB 84996 83560 CDS product two-component system response regulator CbrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113914.1 protein_id gnl|my_center|LOCUS_48710 87974 85023 gene locus_tag LOCUS_48720 gene cbrA 87974 85023 CDS product two-component system sensor histidine kinase CbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113915.1 protein_id gnl|my_center|LOCUS_48720 88134 87958 gene locus_tag LOCUS_48730 88134 87958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095129.1 protein_id gnl|my_center|LOCUS_48730 89085 88204 gene locus_tag LOCUS_48740 gene gluQRS 89085 88204 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115557.1 protein_id gnl|my_center|LOCUS_48740 89599 89153 gene locus_tag LOCUS_48750 gene dksA 89599 89153 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095122.1 protein_id gnl|my_center|LOCUS_48750 89792 90964 gene locus_tag LOCUS_48760 89792 90964 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113459.1 protein_id gnl|my_center|LOCUS_48760 90964 91671 gene locus_tag LOCUS_48770 gene sfsA 90964 91671 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113458.1 protein_id gnl|my_center|LOCUS_48770 92796 91705 gene locus_tag LOCUS_48780 gene trmA 92796 91705 CDS product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113457.1 protein_id gnl|my_center|LOCUS_48780 94046 92793 gene locus_tag LOCUS_48790 94046 92793 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095114.1 protein_id gnl|my_center|LOCUS_48790 94502 94978 gene locus_tag LOCUS_48800 94502 94978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100175.1 protein_id gnl|my_center|LOCUS_48800 95893 95000 gene locus_tag LOCUS_48810 95893 95000 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095112.1 protein_id gnl|my_center|LOCUS_48810 96815 95961 gene locus_tag LOCUS_48820 96815 95961 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113456.1 protein_id gnl|my_center|LOCUS_48820 96985 98220 gene locus_tag LOCUS_48830 gene alaC 96985 98220 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100170.1 protein_id gnl|my_center|LOCUS_48830 98728 98279 gene locus_tag LOCUS_48840 98728 98279 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095106.1 protein_id gnl|my_center|LOCUS_48840 98978 99427 gene locus_tag LOCUS_48850 98978 99427 CDS product DUF4345 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095105.1 protein_id gnl|my_center|LOCUS_48850 99943 99431 gene locus_tag LOCUS_48860 99943 99431 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113455.1 protein_id gnl|my_center|LOCUS_48860 100347 100024 gene locus_tag LOCUS_48870 100347 100024 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895682.1 protein_id gnl|my_center|LOCUS_48870 102768 100474 gene locus_tag LOCUS_48880 gene phuR 102768 100474 CDS product heme/hemoglobin uptake receptor PhuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113453.1 protein_id gnl|my_center|LOCUS_48880 102949 104013 gene locus_tag LOCUS_48890 102949 104013 CDS product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113452.1 protein_id gnl|my_center|LOCUS_48890 104023 104916 gene locus_tag LOCUS_48900 104023 104916 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095100.1 protein_id gnl|my_center|LOCUS_48900 104913 105950 gene locus_tag LOCUS_48910 104913 105950 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121063.1 protein_id gnl|my_center|LOCUS_48910 105950 106717 gene locus_tag LOCUS_48920 105950 106717 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095098.1 protein_id gnl|my_center|LOCUS_48920 106728 107615 gene locus_tag LOCUS_48930 106728 107615 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113451.1 protein_id gnl|my_center|LOCUS_48930 108876 108079 gene locus_tag LOCUS_48940 gene cbpA 108876 108079 CDS product cAMP-binding protein CbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095096.1 protein_id gnl|my_center|LOCUS_48940 109253 108981 gene locus_tag LOCUS_48950 109253 108981 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095094.1 protein_id gnl|my_center|LOCUS_48950 109826 109479 gene locus_tag LOCUS_48960 109826 109479 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095090.1 protein_id gnl|my_center|LOCUS_48960 111480 109918 gene locus_tag LOCUS_48970 111480 109918 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095088.1 protein_id gnl|my_center|LOCUS_48970 111693 114017 gene locus_tag LOCUS_48980 gene mrcB 111693 114017 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100154.1 protein_id gnl|my_center|LOCUS_48980 114034 114813 gene locus_tag LOCUS_48990 gene lpoP 114034 114813 CDS product penicillin-binding protein activator LpoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095080.1 protein_id gnl|my_center|LOCUS_48990 114813 115142 gene locus_tag LOCUS_49000 114813 115142 CDS product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100152.1 protein_id gnl|my_center|LOCUS_49000 115706 115254 gene locus_tag LOCUS_49010 115706 115254 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095076.1 protein_id gnl|my_center|LOCUS_49010 116281 117981 gene locus_tag LOCUS_49020 116281 117981 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095071.1 protein_id gnl|my_center|LOCUS_49020 117984 118475 gene locus_tag LOCUS_49030 gene ilvN 117984 118475 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095069.1 protein_id gnl|my_center|LOCUS_49030 118518 119534 gene locus_tag LOCUS_49040 gene ilvC 118518 119534 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095066.1 protein_id gnl|my_center|LOCUS_49040 119689 120504 gene locus_tag LOCUS_49050 gene pssA 119689 120504 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_49050 120565 121578 gene locus_tag LOCUS_49060 gene msrP 120565 121578 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113450.1 protein_id gnl|my_center|LOCUS_49060 121578 122186 gene locus_tag LOCUS_49070 gene msrQ 121578 122186 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113449.1 protein_id gnl|my_center|LOCUS_49070 122733 124263 gene locus_tag LOCUS_r00010 122733 124263 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 124329 124405 gene locus_tag LOCUS_t00420 124329 124405 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 124434 124509 gene locus_tag LOCUS_t00430 124434 124509 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence21 1661 1140 gene locus_tag LOCUS_49080 1661 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49080 4184 1701 gene locus_tag LOCUS_49090 4184 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49090 4589 4287 gene locus_tag LOCUS_49100 4589 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49100 5292 4651 gene locus_tag LOCUS_49110 5292 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49110 6126 5374 gene locus_tag LOCUS_49120 6126 5374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49120 6322 6128 gene locus_tag LOCUS_49130 6322 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49130 6796 6326 gene locus_tag LOCUS_49140 6796 6326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49140 7122 6793 gene locus_tag LOCUS_49150 7122 6793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49150 7436 7119 gene locus_tag LOCUS_49160 7436 7119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49160 9596 7503 gene locus_tag LOCUS_49170 9596 7503 CDS product Clp protease ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081097245.1 protein_id gnl|my_center|LOCUS_49170 11202 9556 gene locus_tag LOCUS_49180 11202 9556 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985957.1 protein_id gnl|my_center|LOCUS_49180 11417 11202 gene locus_tag LOCUS_49190 11417 11202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49190 13372 11408 gene locus_tag LOCUS_49200 13372 11408 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027282.1 protein_id gnl|my_center|LOCUS_49200 13889 13344 gene locus_tag LOCUS_49210 13889 13344 CDS product terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867569.1 protein_id gnl|my_center|LOCUS_49210 14752 14009 gene locus_tag LOCUS_49220 14752 14009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975805.1 protein_id gnl|my_center|LOCUS_49220 15219 14749 gene locus_tag LOCUS_49230 15219 14749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49230 15455 15216 gene locus_tag LOCUS_49240 15455 15216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49240 16072 15455 gene locus_tag LOCUS_49250 16072 15455 CDS product glycoside hydrolase family 19 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113192.1 protein_id gnl|my_center|LOCUS_49250 16401 16069 gene locus_tag LOCUS_49260 16401 16069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49260 16746 16486 gene locus_tag LOCUS_49270 16746 16486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49270 16852 17064 gene locus_tag LOCUS_49280 16852 17064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49280 17920 17552 gene locus_tag LOCUS_49290 17920 17552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49290 18216 17938 gene locus_tag LOCUS_49300 18216 17938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49300 20024 18213 gene locus_tag LOCUS_49310 20024 18213 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058461124.1 protein_id gnl|my_center|LOCUS_49310 21124 20018 gene locus_tag LOCUS_49320 21124 20018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49320 21546 21121 gene locus_tag LOCUS_49330 21546 21121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49330 21860 21543 gene locus_tag LOCUS_49340 21860 21543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49340 21991 21857 gene locus_tag LOCUS_49350 21991 21857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49350 22351 21995 gene locus_tag LOCUS_49360 22351 21995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49360 23112 22348 gene locus_tag LOCUS_49370 23112 22348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49370 23600 23109 gene locus_tag LOCUS_49380 23600 23109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49380 23920 23597 gene locus_tag LOCUS_49390 23920 23597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49390 24204 23917 gene locus_tag LOCUS_49400 24204 23917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49400 24512 24201 gene locus_tag LOCUS_49410 24512 24201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49410 25110 24601 gene locus_tag LOCUS_49420 25110 24601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49420 25427 25107 gene locus_tag LOCUS_49430 25427 25107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49430 25530 26318 gene locus_tag LOCUS_49440 gene prtR 25530 26318 CDS product transcriptional regulator PrtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113202.1 protein_id gnl|my_center|LOCUS_49440 26670 27053 gene locus_tag LOCUS_49450 26670 27053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49450 27056 27289 gene locus_tag LOCUS_49460 27056 27289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49460 27809 28075 gene locus_tag LOCUS_49470 27809 28075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49470 28072 28839 gene locus_tag LOCUS_49480 28072 28839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49480 28919 29149 gene locus_tag LOCUS_49490 28919 29149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49490 29152 30030 gene locus_tag LOCUS_49500 29152 30030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49500 30027 30554 gene locus_tag LOCUS_49510 30027 30554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49510 30667 30858 gene locus_tag LOCUS_49520 30667 30858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49520 30855 31034 gene locus_tag LOCUS_49530 30855 31034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49530 31031 31276 gene locus_tag LOCUS_49540 31031 31276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49540 31273 32112 gene locus_tag LOCUS_49550 31273 32112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49550 32109 32438 gene locus_tag LOCUS_49560 32109 32438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49560 32422 32664 gene locus_tag LOCUS_49570 32422 32664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49570 32706 33713 gene locus_tag LOCUS_49580 32706 33713 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268019.1 protein_id gnl|my_center|LOCUS_49580 36560 33861 gene locus_tag LOCUS_49590 gene fimV 36560 33861 CDS product motility hub landmark protein FimV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003163304.1 protein_id gnl|my_center|LOCUS_49590 37799 36789 gene locus_tag LOCUS_49600 37799 36789 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115016.1 protein_id gnl|my_center|LOCUS_49600 39013 37901 gene locus_tag LOCUS_49610 gene asd 39013 37901 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111187.1 protein_id gnl|my_center|LOCUS_49610 40165 39083 gene locus_tag LOCUS_49620 gene leuB 40165 39083 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091395.1 protein_id gnl|my_center|LOCUS_49620 40985 40224 gene locus_tag LOCUS_49630 40985 40224 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115017.1 protein_id gnl|my_center|LOCUS_49630 41695 41057 gene locus_tag LOCUS_49640 gene leuD 41695 41057 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091398.1 protein_id gnl|my_center|LOCUS_49640 43131 41707 gene locus_tag LOCUS_49650 gene leuC 43131 41707 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091399.1 protein_id gnl|my_center|LOCUS_49650 43294 44187 gene locus_tag LOCUS_49660 43294 44187 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091401.1 protein_id gnl|my_center|LOCUS_49660 44657 44280 gene locus_tag LOCUS_49670 44657 44280 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115018.1 protein_id gnl|my_center|LOCUS_49670 45648 44737 gene locus_tag LOCUS_49680 45648 44737 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115019.1 protein_id gnl|my_center|LOCUS_49680 45760 47088 gene locus_tag LOCUS_49690 45760 47088 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147894.1 protein_id gnl|my_center|LOCUS_49690 47581 47132 gene locus_tag LOCUS_49700 47581 47132 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091405.1 protein_id gnl|my_center|LOCUS_49700 47739 48542 gene locus_tag LOCUS_49710 47739 48542 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115021.1 protein_id gnl|my_center|LOCUS_49710 48559 49305 gene locus_tag LOCUS_49720 48559 49305 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115022.1 protein_id gnl|my_center|LOCUS_49720 50279 49320 gene locus_tag LOCUS_49730 50279 49320 CDS product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104220.1 protein_id gnl|my_center|LOCUS_49730 50809 50372 gene locus_tag LOCUS_49740 50809 50372 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107647.1 protein_id gnl|my_center|LOCUS_49740 51456 50809 gene locus_tag LOCUS_49750 51456 50809 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115023.1 protein_id gnl|my_center|LOCUS_49750 52426 51569 gene locus_tag LOCUS_49760 52426 51569 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115024.1 protein_id gnl|my_center|LOCUS_49760 52980 52438 gene locus_tag LOCUS_49770 52980 52438 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115025.1 protein_id gnl|my_center|LOCUS_49770 53214 53139 gene locus_tag LOCUS_t00440 53214 53139 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 53336 53261 gene locus_tag LOCUS_t00450 53336 53261 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 53505 53430 gene locus_tag LOCUS_t00460 53505 53430 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 53629 53554 gene locus_tag LOCUS_t00470 53629 53554 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 55315 53831 gene locus_tag LOCUS_49780 gene gltX 55315 53831 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104596.1 protein_id gnl|my_center|LOCUS_49780 56273 55353 gene locus_tag LOCUS_49790 56273 55353 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091419.1 protein_id gnl|my_center|LOCUS_49790 56376 57410 gene locus_tag LOCUS_49800 56376 57410 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119737.1 protein_id gnl|my_center|LOCUS_49800 57400 58959 gene locus_tag LOCUS_49810 57400 58959 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130539.1 protein_id gnl|my_center|LOCUS_49810 60975 58963 gene locus_tag LOCUS_49820 gene uvrB 60975 58963 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104590.1 protein_id gnl|my_center|LOCUS_49820 61163 62359 gene locus_tag LOCUS_49830 61163 62359 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104588.1 protein_id gnl|my_center|LOCUS_49830 62428 62503 gene locus_tag LOCUS_t00480 62428 62503 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 62905 62576 gene locus_tag LOCUS_49840 62905 62576 CDS product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104586.1 protein_id gnl|my_center|LOCUS_49840 64958 63096 gene locus_tag LOCUS_49850 64958 63096 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895647.1 protein_id gnl|my_center|LOCUS_49850 66151 65912 gene locus_tag LOCUS_49860 66151 65912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49860 66629 66087 gene locus_tag LOCUS_49870 66629 66087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895648.1 protein_id gnl|my_center|LOCUS_49870 67852 66845 gene locus_tag LOCUS_49880 67852 66845 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113413.1 protein_id gnl|my_center|LOCUS_49880 68764 67925 gene locus_tag LOCUS_49890 68764 67925 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124383.1 protein_id gnl|my_center|LOCUS_49890 69882 68884 gene locus_tag LOCUS_49900 69882 68884 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119729.1 protein_id gnl|my_center|LOCUS_49900 71233 70169 gene locus_tag LOCUS_49910 gene wecB 71233 70169 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113418.1 protein_id gnl|my_center|LOCUS_49910 72366 71230 gene locus_tag LOCUS_49920 72366 71230 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115615.1 protein_id gnl|my_center|LOCUS_49920 73496 72366 gene locus_tag LOCUS_49930 73496 72366 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119728.1 protein_id gnl|my_center|LOCUS_49930 74389 73634 gene locus_tag LOCUS_49940 74389 73634 CDS product AglZ/HisF2 family acetamidino modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113421.1 protein_id gnl|my_center|LOCUS_49940 74997 74389 gene locus_tag LOCUS_49950 gene hisH 74997 74389 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113422.1 protein_id gnl|my_center|LOCUS_49950 76229 74994 gene locus_tag LOCUS_49960 gene wzx 76229 74994 CDS product O-antigen flipase Wzx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119725.1 protein_id gnl|my_center|LOCUS_49960 77542 76226 gene locus_tag LOCUS_49970 77542 76226 CDS product O-antigen polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124381.1 protein_id gnl|my_center|LOCUS_49970 78631 77546 gene locus_tag LOCUS_49980 gene wbpE 78631 77546 CDS product UDP-2-acetamido-2-deoxy-3-oxo-D-glucuronate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113425.1 protein_id gnl|my_center|LOCUS_49980 79203 78628 gene locus_tag LOCUS_49990 gene wbpD 79203 78628 CDS product UDP-2-acetamido-3-amino-2,3-dideoxy-D-glucuronate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113426.1 protein_id gnl|my_center|LOCUS_49990 81089 79200 gene locus_tag LOCUS_50000 81089 79200 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895649.1 protein_id gnl|my_center|LOCUS_50000 82108 81158 gene locus_tag LOCUS_50010 gene wbpB 82108 81158 CDS product UDP-N-acetyl-2-amino-2-deoxy-D-glucuronate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113428.1 protein_id gnl|my_center|LOCUS_50010 83492 82182 gene locus_tag LOCUS_50020 gene wbpA 83492 82182 CDS product UDP-N-acetyl-D-glucosamine 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113429.1 protein_id gnl|my_center|LOCUS_50020 85345 84299 gene locus_tag LOCUS_50030 85345 84299 CDS product LPS O-antigen chain length determinant protein WzzB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113430.1 protein_id gnl|my_center|LOCUS_50030 86077 85781 gene locus_tag LOCUS_50040 86077 85781 CDS product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766750.1 protein_id gnl|my_center|LOCUS_50040 86392 86108 gene locus_tag LOCUS_50050 gene ihfB 86392 86108 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091441.1 protein_id gnl|my_center|LOCUS_50050 88208 86529 gene locus_tag LOCUS_50060 gene rpsA 88208 86529 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091442.1 protein_id gnl|my_center|LOCUS_50060 89165 88476 gene locus_tag LOCUS_50070 gene cmk 89165 88476 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106707.1 protein_id gnl|my_center|LOCUS_50070 91405 89165 gene locus_tag LOCUS_50080 91405 89165 CDS product bifunctional prephenate dehydrogenase/3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207213.1 protein_id gnl|my_center|LOCUS_50080 92543 91398 gene locus_tag LOCUS_50090 gene hisC 92543 91398 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_50090 93673 92576 gene locus_tag LOCUS_50100 gene pheA 93673 92576 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091446.1 protein_id gnl|my_center|LOCUS_50100 94758 93673 gene locus_tag LOCUS_50110 gene serC 94758 93673 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106701.1 protein_id gnl|my_center|LOCUS_50110 97617 94846 gene locus_tag LOCUS_50120 gene gyrA 97617 94846 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091448.1 protein_id gnl|my_center|LOCUS_50120 98930 97854 gene locus_tag LOCUS_50130 gene mtnA 98930 97854 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091449.1 protein_id gnl|my_center|LOCUS_50130 99040 100374 gene locus_tag LOCUS_50140 99040 100374 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113433.1 protein_id gnl|my_center|LOCUS_50140 100525 101223 gene locus_tag LOCUS_50150 100525 101223 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113434.1 protein_id gnl|my_center|LOCUS_50150 101229 101900 gene locus_tag LOCUS_50160 gene mupP 101229 101900 CDS product N-acetylmuramic acid 6-phosphate phosphatase MupP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895650.1 protein_id gnl|my_center|LOCUS_50160 101965 102705 gene locus_tag LOCUS_50170 101965 102705 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113436.1 protein_id gnl|my_center|LOCUS_50170 102859 103587 gene locus_tag LOCUS_50180 102859 103587 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113437.1 protein_id gnl|my_center|LOCUS_50180 103603 104538 gene locus_tag LOCUS_50190 gene hutG 103603 104538 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113438.1 protein_id gnl|my_center|LOCUS_50190 104577 105791 gene locus_tag LOCUS_50200 gene gltS 104577 105791 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105930.1 protein_id gnl|my_center|LOCUS_50200 106020 106943 gene locus_tag LOCUS_50210 106020 106943 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105929.1 protein_id gnl|my_center|LOCUS_50210 107427 107050 gene locus_tag LOCUS_50220 107427 107050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105927.1 protein_id gnl|my_center|LOCUS_50220 108681 107521 gene locus_tag LOCUS_50230 gene rluB 108681 107521 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113439.1 protein_id gnl|my_center|LOCUS_50230 108829 109266 gene locus_tag LOCUS_50240 108829 109266 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107683.1 protein_id gnl|my_center|LOCUS_50240 110018 109356 gene locus_tag LOCUS_50250 110018 109356 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113440.1 protein_id gnl|my_center|LOCUS_50250 110752 110036 gene locus_tag LOCUS_50260 gene pgl 110752 110036 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113441.1 protein_id gnl|my_center|LOCUS_50260 112145 110739 gene locus_tag LOCUS_50270 gene zwf 112145 110739 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113442.1 protein_id gnl|my_center|LOCUS_50270 112395 113252 gene locus_tag LOCUS_50280 112395 113252 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091466.1 protein_id gnl|my_center|LOCUS_50280 114112 113261 gene locus_tag LOCUS_50290 114112 113261 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113443.1 protein_id gnl|my_center|LOCUS_50290 114445 114326 gene locus_tag LOCUS_50300 114445 114326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50300 >Feature sequence22 34 318 gene locus_tag LOCUS_50310 34 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103318.1 protein_id gnl|my_center|LOCUS_50310 315 974 gene locus_tag LOCUS_50320 315 974 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010793894.1 protein_id gnl|my_center|LOCUS_50320 1189 971 gene locus_tag LOCUS_50330 1189 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50330 1398 1829 gene locus_tag LOCUS_50340 1398 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50340 1829 2767 gene locus_tag LOCUS_50350 1829 2767 CDS product TIGR03756 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103309.1 protein_id gnl|my_center|LOCUS_50350 2785 4173 gene locus_tag LOCUS_50360 2785 4173 CDS product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029572036.1 protein_id gnl|my_center|LOCUS_50360 4173 4517 gene locus_tag LOCUS_50370 4173 4517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50370 4514 6025 gene locus_tag LOCUS_50380 4514 6025 CDS product conjugal transfer protein TraG N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267006.1 protein_id gnl|my_center|LOCUS_50380 6413 6063 gene locus_tag LOCUS_50390 6413 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50390 6532 6804 gene locus_tag LOCUS_50400 6532 6804 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844596.1 protein_id gnl|my_center|LOCUS_50400 6808 7158 gene locus_tag LOCUS_50410 6808 7158 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312649.1 protein_id gnl|my_center|LOCUS_50410 7331 7561 gene locus_tag LOCUS_50420 7331 7561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50420 8512 7841 gene locus_tag LOCUS_50430 8512 7841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50430 8415 9083 gene locus_tag LOCUS_50440 8415 9083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50440 9674 11500 gene locus_tag LOCUS_50450 gene mobH 9674 11500 CDS product MobH family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004409737.1 protein_id gnl|my_center|LOCUS_50450 11497 12777 gene locus_tag LOCUS_50460 11497 12777 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267003.1 protein_id gnl|my_center|LOCUS_50460 13222 13147 gene locus_tag LOCUS_t00490 13222 13147 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 13309 13233 gene locus_tag LOCUS_t00500 13309 13233 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 13394 13319 gene locus_tag LOCUS_t00510 13394 13319 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 16193 13629 gene locus_tag LOCUS_50470 gene clpB 16193 13629 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094682.1 protein_id gnl|my_center|LOCUS_50470 17077 16349 gene locus_tag LOCUS_50480 gene pgeF 17077 16349 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112833.1 protein_id gnl|my_center|LOCUS_50480 18036 17074 gene locus_tag LOCUS_50490 gene rluD 18036 17074 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094686.1 protein_id gnl|my_center|LOCUS_50490 18182 19207 gene locus_tag LOCUS_50500 18182 19207 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102590.1 protein_id gnl|my_center|LOCUS_50500 19325 19609 gene locus_tag LOCUS_50510 19325 19609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50510 19599 21191 gene locus_tag LOCUS_50520 gene pilS 19599 21191 CDS product two-component system sensor histidine kinase PilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094692.1 protein_id gnl|my_center|LOCUS_50520 21206 22543 gene locus_tag LOCUS_50530 gene pilR 21206 22543 CDS product two-component system response regulator PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094694.1 protein_id gnl|my_center|LOCUS_50530 23662 22589 gene locus_tag LOCUS_50540 gene thiO 23662 22589 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895678.1 protein_id gnl|my_center|LOCUS_50540 23818 24327 gene locus_tag LOCUS_50550 23818 24327 CDS product Tfp pilus assembly protein FimT/FimU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112829.1 protein_id gnl|my_center|LOCUS_50550 24433 24939 gene locus_tag LOCUS_50560 24433 24939 CDS product Tfp pilus assembly protein FimT/FimU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102598.1 protein_id gnl|my_center|LOCUS_50560 24930 25487 gene locus_tag LOCUS_50570 gene pilV 24930 25487 CDS product type 4a pilus minor pilin PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119423.1 protein_id gnl|my_center|LOCUS_50570 25484 26308 gene locus_tag LOCUS_50580 gene pilW 25484 26308 CDS product type 4a pilus minor pilin PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119422.1 protein_id gnl|my_center|LOCUS_50580 26305 26892 gene locus_tag LOCUS_50590 gene pilX 26305 26892 CDS product type 4a pilus minor pilin PilX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112826.1 protein_id gnl|my_center|LOCUS_50590 26904 30395 gene locus_tag LOCUS_50600 gene pilY1 26904 30395 CDS product type 4a pilus biogenesis protein PilY1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115287.1 protein_id gnl|my_center|LOCUS_50600 30397 30744 gene locus_tag LOCUS_50610 gene pilY2 30397 30744 CDS product type 4a fimbrial biogenesis protein PilY2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102609.1 protein_id gnl|my_center|LOCUS_50610 30741 31166 gene locus_tag LOCUS_50620 gene pilE 30741 31166 CDS product type 4a pilus minor pilin PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094721.1 protein_id gnl|my_center|LOCUS_50620 32157 31213 gene locus_tag LOCUS_50630 gene ispH 32157 31213 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112824.1 protein_id gnl|my_center|LOCUS_50630 32683 32243 gene locus_tag LOCUS_50640 gene fkpB 32683 32243 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102613.1 protein_id gnl|my_center|LOCUS_50640 33185 32676 gene locus_tag LOCUS_50650 gene lspA 33185 32676 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112823.1 protein_id gnl|my_center|LOCUS_50650 36009 33178 gene locus_tag LOCUS_50660 gene ileS 36009 33178 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112822.1 protein_id gnl|my_center|LOCUS_50660 36971 36033 gene locus_tag LOCUS_50670 gene ribF 36971 36033 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102619.1 protein_id gnl|my_center|LOCUS_50670 38564 37068 gene locus_tag LOCUS_50680 gene murJ 38564 37068 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102622.1 protein_id gnl|my_center|LOCUS_50680 38890 39165 gene locus_tag LOCUS_50690 gene rpsT 38890 39165 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094744.1 protein_id gnl|my_center|LOCUS_50690 39696 39232 gene locus_tag LOCUS_50700 39696 39232 CDS product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094746.1 protein_id gnl|my_center|LOCUS_50700 40826 39708 gene locus_tag LOCUS_50710 gene proB 40826 39708 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094756.1 protein_id gnl|my_center|LOCUS_50710 42117 40897 gene locus_tag LOCUS_50720 gene cgtA 42117 40897 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094758.1 protein_id gnl|my_center|LOCUS_50720 42516 42259 gene locus_tag LOCUS_50730 gene rpmA 42516 42259 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094760.1 protein_id gnl|my_center|LOCUS_50730 42851 42540 gene locus_tag LOCUS_50740 gene rplU 42851 42540 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094761.1 protein_id gnl|my_center|LOCUS_50740 43074 44060 gene locus_tag LOCUS_50750 43074 44060 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094763.1 protein_id gnl|my_center|LOCUS_50750 44198 44422 gene locus_tag LOCUS_50760 44198 44422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094765.1 protein_id gnl|my_center|LOCUS_50760 44765 46792 gene locus_tag LOCUS_50770 44765 46792 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112821.1 protein_id gnl|my_center|LOCUS_50770 47479 46862 gene locus_tag LOCUS_50780 47479 46862 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094769.1 protein_id gnl|my_center|LOCUS_50780 47869 47564 gene locus_tag LOCUS_50790 47869 47564 CDS product DUF6482 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105116.1 protein_id gnl|my_center|LOCUS_50790 48614 48126 gene locus_tag LOCUS_50800 48614 48126 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094773.1 protein_id gnl|my_center|LOCUS_50800 49129 48788 gene locus_tag LOCUS_50810 49129 48788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094775.1 protein_id gnl|my_center|LOCUS_50810 51733 49280 gene locus_tag LOCUS_50820 51733 49280 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112820.1 protein_id gnl|my_center|LOCUS_50820 52158 51832 gene locus_tag LOCUS_50830 52158 51832 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112819.1 protein_id gnl|my_center|LOCUS_50830 52393 52881 gene locus_tag LOCUS_50840 52393 52881 CDS product DUF3015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094783.1 protein_id gnl|my_center|LOCUS_50840 52940 54796 gene locus_tag LOCUS_50850 52940 54796 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112817.1 protein_id gnl|my_center|LOCUS_50850 55344 54790 gene locus_tag LOCUS_50860 55344 54790 CDS product NADAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112815.1 protein_id gnl|my_center|LOCUS_50860 56995 55400 gene locus_tag LOCUS_50870 gene rtcR 56995 55400 CDS product RNA repair transcriptional activator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112813.1 protein_id gnl|my_center|LOCUS_50870 57310 57383 gene locus_tag LOCUS_t00520 57310 57383 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 57655 58800 gene locus_tag LOCUS_50880 57655 58800 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112812.1 protein_id gnl|my_center|LOCUS_50880 58856 60070 gene locus_tag LOCUS_50890 58856 60070 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112811.1 protein_id gnl|my_center|LOCUS_50890 60107 60919 gene locus_tag LOCUS_50900 60107 60919 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105094.1 protein_id gnl|my_center|LOCUS_50900 60916 61941 gene locus_tag LOCUS_50910 gene rtcA 60916 61941 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112809.1 protein_id gnl|my_center|LOCUS_50910 62043 62420 gene locus_tag LOCUS_50920 62043 62420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50920 62544 63584 gene locus_tag LOCUS_50930 gene ccpA 62544 63584 CDS product cytochrome-c peroxidase CcpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094815.1 protein_id gnl|my_center|LOCUS_50930 64980 63643 gene locus_tag LOCUS_50940 gene gdhA 64980 63643 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094817.1 protein_id gnl|my_center|LOCUS_50940 66712 65276 gene locus_tag LOCUS_50950 66712 65276 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123403.1 protein_id gnl|my_center|LOCUS_50950 66751 67002 gene locus_tag LOCUS_50960 66751 67002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50960 67352 66927 gene locus_tag LOCUS_50970 gene praA 67352 66927 CDS product alkane oxidation protein activator PraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119407.1 protein_id gnl|my_center|LOCUS_50970 67267 67467 gene locus_tag LOCUS_50980 67267 67467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50980 69289 68012 gene locus_tag LOCUS_50990 69289 68012 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112807.1 protein_id gnl|my_center|LOCUS_50990 70760 69279 gene locus_tag LOCUS_51000 70760 69279 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103137.1 protein_id gnl|my_center|LOCUS_51000 71946 70753 gene locus_tag LOCUS_51010 71946 70753 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112805.1 protein_id gnl|my_center|LOCUS_51010 72656 71943 gene locus_tag LOCUS_51020 72656 71943 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112804.1 protein_id gnl|my_center|LOCUS_51020 74800 73136 gene locus_tag LOCUS_51030 gene ettA 74800 73136 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110721.1 protein_id gnl|my_center|LOCUS_51030 74911 75096 gene locus_tag LOCUS_51040 74911 75096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51040 75176 75811 gene locus_tag LOCUS_51050 gene escR 75176 75811 CDS product TetR/AcrR family transcriptional regulator EscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094834.1 protein_id gnl|my_center|LOCUS_51050 77301 75862 gene locus_tag LOCUS_51060 gene oprJ 77301 75862 CDS product multidrug efflux transporter outer membrane subunit OprJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112802.1 protein_id gnl|my_center|LOCUS_51060 80438 77307 gene locus_tag LOCUS_51070 gene mexD 80438 77307 CDS product multidrug efflux RND transporter permease subunit MexD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112801.1 protein_id gnl|my_center|LOCUS_51070 81530 80466 gene locus_tag LOCUS_51080 gene mexC 81530 80466 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MexC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003116286.1 protein_id gnl|my_center|LOCUS_51080 81790 82353 gene locus_tag LOCUS_51090 gene nfxB 81790 82353 CDS product efflux pump transcriptional repressor NfxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094842.1 protein_id gnl|my_center|LOCUS_51090 82597 86853 gene locus_tag LOCUS_51100 gene morA 82597 86853 CDS product cyclic di-GMP receptor MorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112799.1 protein_id gnl|my_center|LOCUS_51100 86976 88229 gene locus_tag LOCUS_51110 86976 88229 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112798.1 protein_id gnl|my_center|LOCUS_51110 88681 88307 gene locus_tag LOCUS_51120 88681 88307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121337.1 protein_id gnl|my_center|LOCUS_51120 89714 88710 gene locus_tag LOCUS_51130 gene yjiA 89714 88710 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094852.1 protein_id gnl|my_center|LOCUS_51130 89977 89774 gene locus_tag LOCUS_51140 89977 89774 CDS product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094856.1 protein_id gnl|my_center|LOCUS_51140 92092 90026 gene locus_tag LOCUS_51150 92092 90026 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094859.1 protein_id gnl|my_center|LOCUS_51150 92936 92430 gene locus_tag LOCUS_51160 92936 92430 CDS product DUF3015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094862.1 protein_id gnl|my_center|LOCUS_51160 93139 93516 gene locus_tag LOCUS_51170 gene mapZ 93139 93516 CDS product cyclic di-GMP-binding protein MapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094864.1 protein_id gnl|my_center|LOCUS_51170 94884 93523 gene locus_tag LOCUS_51180 gene radA 94884 93523 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094867.1 protein_id gnl|my_center|LOCUS_51180 94994 95428 gene locus_tag LOCUS_51190 94994 95428 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112796.1 protein_id gnl|my_center|LOCUS_51190 95744 95490 gene locus_tag LOCUS_51200 95744 95490 CDS product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104887.1 protein_id gnl|my_center|LOCUS_51200 96361 95819 gene locus_tag LOCUS_51210 96361 95819 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895679.1 protein_id gnl|my_center|LOCUS_51210 97965 96424 gene locus_tag LOCUS_51220 gene katB 97965 96424 CDS product catalase KatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094881.1 protein_id gnl|my_center|LOCUS_51220 98493 98906 gene locus_tag LOCUS_51230 gene mscL 98493 98906 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104883.1 protein_id gnl|my_center|LOCUS_51230 99787 99011 gene locus_tag LOCUS_51240 99787 99011 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110878.1 protein_id gnl|my_center|LOCUS_51240 100892 99894 gene locus_tag LOCUS_51250 100892 99894 CDS product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112794.1 protein_id gnl|my_center|LOCUS_51250 101220 102344 gene locus_tag LOCUS_51260 101220 102344 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112793.1 protein_id gnl|my_center|LOCUS_51260 102920 102345 gene locus_tag LOCUS_51270 102920 102345 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762703.1 protein_id gnl|my_center|LOCUS_51270 103891 102920 gene locus_tag LOCUS_51280 103891 102920 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104873.1 protein_id gnl|my_center|LOCUS_51280 105142 103895 gene locus_tag LOCUS_51290 105142 103895 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112792.1 protein_id gnl|my_center|LOCUS_51290 105684 105145 gene locus_tag LOCUS_51300 105684 105145 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094903.1 protein_id gnl|my_center|LOCUS_51300 108508 105677 gene locus_tag LOCUS_51310 108508 105677 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112791.1 protein_id gnl|my_center|LOCUS_51310 108819 110030 gene locus_tag LOCUS_51320 108819 110030 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094912.1 protein_id gnl|my_center|LOCUS_51320 110579 110190 gene locus_tag LOCUS_51330 110579 110190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106768.1 protein_id gnl|my_center|LOCUS_51330 112588 110882 gene locus_tag LOCUS_51340 gene cdrB 112588 110882 CDS product two-partner secretion system transporter CdrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895680.1 protein_id gnl|my_center|LOCUS_51340 113715 112651 gene locus_tag LOCUS_51350 113715 112651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51350 >Feature sequence23 2660 1158 gene locus_tag LOCUS_51360 gene mapR 2660 1158 CDS product GntR family transcriptional regulator MpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113004.1 protein_id gnl|my_center|LOCUS_51360 4101 2671 gene locus_tag LOCUS_51370 gene ccoG 4101 2671 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895670.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51370 4498 6171 gene locus_tag LOCUS_51380 4498 6171 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113006.1 protein_id gnl|my_center|LOCUS_51380 6168 6656 gene locus_tag LOCUS_51390 6168 6656 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093457.1 protein_id gnl|my_center|LOCUS_51390 7544 6738 gene locus_tag LOCUS_51400 gene hpaI 7544 6738 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113007.1 protein_id gnl|my_center|LOCUS_51400 8360 7557 gene locus_tag LOCUS_51410 gene hpaH 8360 7557 CDS product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101261.1 protein_id gnl|my_center|LOCUS_51410 9682 8378 gene locus_tag LOCUS_51420 9682 8378 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101263.1 protein_id gnl|my_center|LOCUS_51420 10167 9775 gene locus_tag LOCUS_51430 10167 9775 CDS product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101265.1 protein_id gnl|my_center|LOCUS_51430 11101 10178 gene locus_tag LOCUS_51440 gene hpaD 11101 10178 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093449.1 protein_id gnl|my_center|LOCUS_51440 12693 11233 gene locus_tag LOCUS_51450 gene hpaE 12693 11233 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110130.1 protein_id gnl|my_center|LOCUS_51450 13469 12690 gene locus_tag LOCUS_51460 13469 12690 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113008.1 protein_id gnl|my_center|LOCUS_51460 14139 13480 gene locus_tag LOCUS_51470 14139 13480 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113009.1 protein_id gnl|my_center|LOCUS_51470 14359 15270 gene locus_tag LOCUS_51480 gene hpaA 14359 15270 CDS product 4-hydroxyphenylacetate catabolism regulatory protein HpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113010.1 protein_id gnl|my_center|LOCUS_51480 15322 16128 gene locus_tag LOCUS_51490 15322 16128 CDS product aminoglycoside O-phosphotransferase APH(3')-IIb inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113011.1 protein_id gnl|my_center|LOCUS_51490 16821 16252 gene locus_tag LOCUS_51500 16821 16252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093439.1 protein_id gnl|my_center|LOCUS_51500 19085 16899 gene locus_tag LOCUS_51510 gene bphP 19085 16899 CDS product bacteriophytochrome BphP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101278.1 protein_id gnl|my_center|LOCUS_51510 19700 19113 gene locus_tag LOCUS_51520 19700 19113 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003159301.1 protein_id gnl|my_center|LOCUS_51520 21203 19818 gene locus_tag LOCUS_51530 gene ppnN 21203 19818 CDS product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093432.1 protein_id gnl|my_center|LOCUS_51530 21623 22132 gene locus_tag LOCUS_51540 21623 22132 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101282.1 protein_id gnl|my_center|LOCUS_51540 22286 23476 gene locus_tag LOCUS_51550 22286 23476 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093428.1 protein_id gnl|my_center|LOCUS_51550 23604 27857 gene locus_tag LOCUS_51560 23604 27857 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113014.1 protein_id gnl|my_center|LOCUS_51560 28419 28021 gene locus_tag LOCUS_51570 28419 28021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093424.1 protein_id gnl|my_center|LOCUS_51570 29677 28484 gene locus_tag LOCUS_51580 gene blaPDC 29677 28484 CDS product cephalosporin-hydrolyzing class C beta-lactamase PDC-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101289.1 protein_id gnl|my_center|LOCUS_51580 29826 30716 gene locus_tag LOCUS_51590 gene ampR 29826 30716 CDS product LysR family transcriptional regulator AmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101291.1 protein_id gnl|my_center|LOCUS_51590 31119 30733 gene locus_tag LOCUS_51600 31119 30733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51600 32519 31275 gene locus_tag LOCUS_51610 32519 31275 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 protein_id gnl|my_center|LOCUS_51610 32843 33310 gene locus_tag LOCUS_51620 32843 33310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113016.1 protein_id gnl|my_center|LOCUS_51620 33385 34215 gene locus_tag LOCUS_51630 33385 34215 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113017.1 protein_id gnl|my_center|LOCUS_51630 34208 34963 gene locus_tag LOCUS_51640 34208 34963 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113019.1 protein_id gnl|my_center|LOCUS_51640 35618 35109 gene locus_tag LOCUS_51650 35618 35109 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113020.1 protein_id gnl|my_center|LOCUS_51650 36279 35650 gene locus_tag LOCUS_51660 36279 35650 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113021.1 protein_id gnl|my_center|LOCUS_51660 37713 36409 gene locus_tag LOCUS_51670 37713 36409 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113022.1 protein_id gnl|my_center|LOCUS_51670 38450 37710 gene locus_tag LOCUS_51680 gene bfmR 38450 37710 CDS product two-component system response regulator BfmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113023.1 protein_id gnl|my_center|LOCUS_51680 38663 39067 gene locus_tag LOCUS_51690 38663 39067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51690 40810 39068 gene locus_tag LOCUS_51700 40810 39068 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113025.1 protein_id gnl|my_center|LOCUS_51700 42206 40902 gene locus_tag LOCUS_51710 42206 40902 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093407.1 protein_id gnl|my_center|LOCUS_51710 43016 42291 gene locus_tag LOCUS_51720 43016 42291 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093405.1 protein_id gnl|my_center|LOCUS_51720 44089 43031 gene locus_tag LOCUS_51730 44089 43031 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113026.1 protein_id gnl|my_center|LOCUS_51730 45345 44086 gene locus_tag LOCUS_51740 45345 44086 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113027.1 protein_id gnl|my_center|LOCUS_51740 45949 45416 gene locus_tag LOCUS_51750 45949 45416 CDS product 2,4'-dihydroxyacetophenone dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113028.1 protein_id gnl|my_center|LOCUS_51750 46268 47227 gene locus_tag LOCUS_51760 46268 47227 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093398.1 protein_id gnl|my_center|LOCUS_51760 47275 47691 gene locus_tag LOCUS_51770 47275 47691 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104529.1 protein_id gnl|my_center|LOCUS_51770 48267 47755 gene locus_tag LOCUS_51780 gene hpaC 48267 47755 CDS product 4-hydroxyphenylacetate 3-monooxygenase, reductase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104531.1 protein_id gnl|my_center|LOCUS_51780 49859 48297 gene locus_tag LOCUS_51790 gene hpaB 49859 48297 CDS product 4-hydroxyphenylacetate 3-monooxygenase, oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104533.1 protein_id gnl|my_center|LOCUS_51790 50315 50025 gene locus_tag LOCUS_51800 50315 50025 CDS product DUF2218 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093387.1 protein_id gnl|my_center|LOCUS_51800 51377 50616 gene locus_tag LOCUS_51810 51377 50616 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113029.1 protein_id gnl|my_center|LOCUS_51810 52759 51374 gene locus_tag LOCUS_51820 52759 51374 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113030.1 protein_id gnl|my_center|LOCUS_51820 53592 52768 gene locus_tag LOCUS_51830 53592 52768 CDS product molybdenum cofactor biosynthesis F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113031.1 protein_id gnl|my_center|LOCUS_51830 54036 54632 gene locus_tag LOCUS_51840 54036 54632 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113032.1 protein_id gnl|my_center|LOCUS_51840 54663 55409 gene locus_tag LOCUS_51850 gene cupB2 54663 55409 CDS product molecular chaperone CupB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113033.1 protein_id gnl|my_center|LOCUS_51850 55758 58265 gene locus_tag LOCUS_51860 gene cupB3 55758 58265 CDS product fimbrial biogenesis outer membrane usher protein CupB3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895669.1 protein_id gnl|my_center|LOCUS_51860 58262 59002 gene locus_tag LOCUS_51870 58262 59002 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113035.1 protein_id gnl|my_center|LOCUS_51870 59090 62146 gene locus_tag LOCUS_51880 59090 62146 CDS product GLUG motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113036.1 protein_id gnl|my_center|LOCUS_51880 62246 63391 gene locus_tag LOCUS_51890 62246 63391 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113037.1 protein_id gnl|my_center|LOCUS_51890 64035 64679 gene locus_tag LOCUS_51900 64035 64679 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118222.1 protein_id gnl|my_center|LOCUS_51900 65383 64694 gene locus_tag LOCUS_51910 65383 64694 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113039.1 protein_id gnl|my_center|LOCUS_51910 68431 65456 gene locus_tag LOCUS_51920 68431 65456 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113040.1 protein_id gnl|my_center|LOCUS_51920 68847 68641 gene locus_tag LOCUS_51930 68847 68641 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093358.1 protein_id gnl|my_center|LOCUS_51930 69218 68844 gene locus_tag LOCUS_51940 69218 68844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105252.1 protein_id gnl|my_center|LOCUS_51940 69325 70161 gene locus_tag LOCUS_51950 69325 70161 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113041.1 protein_id gnl|my_center|LOCUS_51950 70826 70158 gene locus_tag LOCUS_51960 70826 70158 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113042.1 protein_id gnl|my_center|LOCUS_51960 71055 72542 gene locus_tag LOCUS_51970 71055 72542 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113043.1 protein_id gnl|my_center|LOCUS_51970 72710 74200 gene locus_tag LOCUS_51980 72710 74200 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113044.1 protein_id gnl|my_center|LOCUS_51980 74175 74753 gene locus_tag LOCUS_51990 74175 74753 CDS product DUF3156 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105260.1 protein_id gnl|my_center|LOCUS_51990 74914 75864 gene locus_tag LOCUS_52000 gene feaR 74914 75864 CDS product transcriptional regulator FeaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105262.1 protein_id gnl|my_center|LOCUS_52000 76118 77017 gene locus_tag LOCUS_52010 76118 77017 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113045.1 protein_id gnl|my_center|LOCUS_52010 77010 77939 gene locus_tag LOCUS_52020 77010 77939 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093339.1 protein_id gnl|my_center|LOCUS_52020 78296 77940 gene locus_tag LOCUS_52030 78296 77940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52030 79078 78380 gene locus_tag LOCUS_52040 gene oprG 79078 78380 CDS product outer membrane protein OprG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093337.1 protein_id gnl|my_center|LOCUS_52040 79744 79226 gene locus_tag LOCUS_52050 79744 79226 CDS product DUF3299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105266.1 protein_id gnl|my_center|LOCUS_52050 81027 79762 gene locus_tag LOCUS_52060 81027 79762 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113046.1 protein_id gnl|my_center|LOCUS_52060 81734 81030 gene locus_tag LOCUS_52070 81734 81030 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093325.1 protein_id gnl|my_center|LOCUS_52070 82407 81823 gene locus_tag LOCUS_52080 82407 81823 CDS product DUF2796 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113048.1 protein_id gnl|my_center|LOCUS_52080 82540 82896 gene locus_tag LOCUS_52090 82540 82896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105273.1 protein_id gnl|my_center|LOCUS_52090 83790 82921 gene locus_tag LOCUS_52100 gene trxA 83790 82921 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105274.1 protein_id gnl|my_center|LOCUS_52100 84524 83862 gene locus_tag LOCUS_52110 84524 83862 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103234.1 protein_id gnl|my_center|LOCUS_52110 84979 84521 gene locus_tag LOCUS_52120 84979 84521 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379143.1 protein_id gnl|my_center|LOCUS_52120 85132 85641 gene locus_tag LOCUS_52130 gene nrdR 85132 85641 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107181.1 protein_id gnl|my_center|LOCUS_52130 85638 86759 gene locus_tag LOCUS_52140 gene ribD 85638 86759 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113051.1 protein_id gnl|my_center|LOCUS_52140 87187 87846 gene locus_tag LOCUS_52150 87187 87846 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 protein_id gnl|my_center|LOCUS_52150 87873 88970 gene locus_tag LOCUS_52160 gene ribBA 87873 88970 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093313.1 protein_id gnl|my_center|LOCUS_52160 89088 89564 gene locus_tag LOCUS_52170 gene ribE 89088 89564 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093311.1 protein_id gnl|my_center|LOCUS_52170 89561 90040 gene locus_tag LOCUS_52180 gene nusB 89561 90040 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093308.1 protein_id gnl|my_center|LOCUS_52180 90059 91027 gene locus_tag LOCUS_52190 gene thiL 90059 91027 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113052.1 protein_id gnl|my_center|LOCUS_52190 91020 91535 gene locus_tag LOCUS_52200 91020 91535 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113053.1 protein_id gnl|my_center|LOCUS_52200 91544 92290 gene locus_tag LOCUS_52210 91544 92290 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102821.1 protein_id gnl|my_center|LOCUS_52210 92293 92937 gene locus_tag LOCUS_52220 92293 92937 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093301.1 protein_id gnl|my_center|LOCUS_52220 93068 93685 gene locus_tag LOCUS_52230 gene ribA 93068 93685 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110510.1 protein_id gnl|my_center|LOCUS_52230 93682 94101 gene locus_tag LOCUS_52240 93682 94101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102818.1 protein_id gnl|my_center|LOCUS_52240 94101 94898 gene locus_tag LOCUS_52250 94101 94898 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102817.1 protein_id gnl|my_center|LOCUS_52250 97038 95137 gene locus_tag LOCUS_52260 gene dxs 97038 95137 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102816.1 protein_id gnl|my_center|LOCUS_52260 98016 97129 gene locus_tag LOCUS_52270 98016 97129 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114915.1 protein_id gnl|my_center|LOCUS_52270 98255 98013 gene locus_tag LOCUS_52280 98255 98013 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093283.1 protein_id gnl|my_center|LOCUS_52280 98413 99582 gene locus_tag LOCUS_52290 98413 99582 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114914.1 protein_id gnl|my_center|LOCUS_52290 100402 100734 gene locus_tag LOCUS_52300 100402 100734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52300 102133 101372 gene locus_tag LOCUS_52310 102133 101372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52310 102235 103467 gene locus_tag LOCUS_52320 102235 103467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52320 103516 103728 gene locus_tag LOCUS_52330 103516 103728 CDS product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205185.1 protein_id gnl|my_center|LOCUS_52330 104119 105072 gene locus_tag LOCUS_52340 104119 105072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52340 105253 105828 gene locus_tag LOCUS_52350 105253 105828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52350 <106647 106011 gene locus_tag LOCUS_52360 <106647 106011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001163403.1:IS21-like element IS1326 family helper ATPase IstB >Feature sequence24 513 1484 gene locus_tag LOCUS_52370 gene pstS 513 1484 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 protein_id gnl|my_center|LOCUS_52370 1655 3940 gene locus_tag LOCUS_52380 1655 3940 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895703.1 protein_id gnl|my_center|LOCUS_52380 3960 5636 gene locus_tag LOCUS_52390 gene pstA 3960 5636 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114377.1 protein_id gnl|my_center|LOCUS_52390 5652 6485 gene locus_tag LOCUS_52400 gene pstB 5652 6485 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096663.1 protein_id gnl|my_center|LOCUS_52400 6581 7309 gene locus_tag LOCUS_52410 gene phoU 6581 7309 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096661.1 protein_id gnl|my_center|LOCUS_52410 7428 8330 gene locus_tag LOCUS_52420 7428 8330 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096657.1 protein_id gnl|my_center|LOCUS_52420 8446 9345 gene locus_tag LOCUS_52430 8446 9345 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096656.1 protein_id gnl|my_center|LOCUS_52430 10720 9380 gene locus_tag LOCUS_52440 10720 9380 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114376.1 protein_id gnl|my_center|LOCUS_52440 12142 10823 gene locus_tag LOCUS_52450 gene phoR 12142 10823 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121316.1 protein_id gnl|my_center|LOCUS_52450 12916 12227 gene locus_tag LOCUS_52460 gene phoB 12916 12227 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096653.1 protein_id gnl|my_center|LOCUS_52460 13093 13476 gene locus_tag LOCUS_52470 13093 13476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121315.1 protein_id gnl|my_center|LOCUS_52470 14390 13500 gene locus_tag LOCUS_52480 gene ubiA 14390 13500 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104612.1 protein_id gnl|my_center|LOCUS_52480 14953 14417 gene locus_tag LOCUS_52490 14953 14417 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114374.1 protein_id gnl|my_center|LOCUS_52490 15788 15033 gene locus_tag LOCUS_52500 gene glcC 15788 15033 CDS product transcriptional regulator GlcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115387.1 protein_id gnl|my_center|LOCUS_52500 15993 17492 gene locus_tag LOCUS_52510 gene glcD 15993 17492 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114372.1 protein_id gnl|my_center|LOCUS_52510 17492 18571 gene locus_tag LOCUS_52520 gene glcE 17492 18571 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114371.1 protein_id gnl|my_center|LOCUS_52520 18581 19807 gene locus_tag LOCUS_52530 gene glcF 18581 19807 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114370.1 protein_id gnl|my_center|LOCUS_52530 19812 20213 gene locus_tag LOCUS_52540 19812 20213 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098332.1 protein_id gnl|my_center|LOCUS_52540 20347 20514 gene locus_tag LOCUS_52550 20347 20514 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098330.1 protein_id gnl|my_center|LOCUS_52550 20698 20865 gene locus_tag LOCUS_52560 20698 20865 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098329.1 protein_id gnl|my_center|LOCUS_52560 20917 22071 gene locus_tag LOCUS_52570 gene alkT 20917 22071 CDS product rubredoxin-NAD(+) reductase AlkT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114369.1 protein_id gnl|my_center|LOCUS_52570 22273 22545 gene locus_tag LOCUS_52580 22273 22545 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096630.1 protein_id gnl|my_center|LOCUS_52580 22681 23073 gene locus_tag LOCUS_52590 22681 23073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096629.1 protein_id gnl|my_center|LOCUS_52590 24554 23145 gene locus_tag LOCUS_52600 24554 23145 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114368.1 protein_id gnl|my_center|LOCUS_52600 23864 23774 gene locus_tag LOCUS_t00530 23864 23774 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 26719 24644 gene locus_tag LOCUS_52610 gene recG 26719 24644 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096624.1 protein_id gnl|my_center|LOCUS_52610 27648 26716 gene locus_tag LOCUS_52620 gene oxyR 27648 26716 CDS product oxidative stress transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096622.1 protein_id gnl|my_center|LOCUS_52620 27786 28637 gene locus_tag LOCUS_52630 27786 28637 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096618.1 protein_id gnl|my_center|LOCUS_52630 28637 29437 gene locus_tag LOCUS_52640 28637 29437 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114367.1 protein_id gnl|my_center|LOCUS_52640 29504 30124 gene locus_tag LOCUS_52650 29504 30124 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096613.1 protein_id gnl|my_center|LOCUS_52650 30862 30131 gene locus_tag LOCUS_52660 30862 30131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114366.1 protein_id gnl|my_center|LOCUS_52660 31297 30917 gene locus_tag LOCUS_52670 31297 30917 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096609.1 protein_id gnl|my_center|LOCUS_52670 33464 31359 gene locus_tag LOCUS_52680 gene spoT 33464 31359 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 protein_id gnl|my_center|LOCUS_52680 33796 33530 gene locus_tag LOCUS_52690 gene rpoZ 33796 33530 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096602.1 protein_id gnl|my_center|LOCUS_52690 34496 33885 gene locus_tag LOCUS_52700 gene gmk 34496 33885 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098317.1 protein_id gnl|my_center|LOCUS_52700 35418 34555 gene locus_tag LOCUS_52710 35418 34555 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098315.1 protein_id gnl|my_center|LOCUS_52710 35599 36318 gene locus_tag LOCUS_52720 gene rph 35599 36318 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096595.1 protein_id gnl|my_center|LOCUS_52720 36365 36736 gene locus_tag LOCUS_52730 36365 36736 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096590.1 protein_id gnl|my_center|LOCUS_52730 37574 36795 gene locus_tag LOCUS_52740 37574 36795 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098313.1 protein_id gnl|my_center|LOCUS_52740 37655 38296 gene locus_tag LOCUS_52750 gene pyrE 37655 38296 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096586.1 protein_id gnl|my_center|LOCUS_52750 38317 38934 gene locus_tag LOCUS_52760 38317 38934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003161150.1 protein_id gnl|my_center|LOCUS_52760 39378 38914 gene locus_tag LOCUS_52770 39378 38914 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098308.1 protein_id gnl|my_center|LOCUS_52770 39552 39941 gene locus_tag LOCUS_52780 39552 39941 CDS product cytochrome c5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115372.1 protein_id gnl|my_center|LOCUS_52780 39953 41347 gene locus_tag LOCUS_52790 39953 41347 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114363.1 protein_id gnl|my_center|LOCUS_52790 41361 42638 gene locus_tag LOCUS_52800 41361 42638 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003146627.1 protein_id gnl|my_center|LOCUS_52800 43659 42709 gene locus_tag LOCUS_52810 43659 42709 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114361.1 protein_id gnl|my_center|LOCUS_52810 43884 44954 gene locus_tag LOCUS_52820 gene sphR 43884 44954 CDS product AraC family transcriptional regulator SphR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114360.1 protein_id gnl|my_center|LOCUS_52820 45905 45000 gene locus_tag LOCUS_52830 gene argB 45905 45000 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096572.1 protein_id gnl|my_center|LOCUS_52830 48528 45922 gene locus_tag LOCUS_52840 48528 45922 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114359.1 protein_id gnl|my_center|LOCUS_52840 49020 48565 gene locus_tag LOCUS_52850 gene dut 49020 48565 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098293.1 protein_id gnl|my_center|LOCUS_52850 50236 49028 gene locus_tag LOCUS_52860 gene coaBC 50236 49028 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114358.1 protein_id gnl|my_center|LOCUS_52860 50376 51050 gene locus_tag LOCUS_52870 gene radC 50376 51050 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114357.1 protein_id gnl|my_center|LOCUS_52870 51615 51067 gene locus_tag LOCUS_52880 51615 51067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098290.1 protein_id gnl|my_center|LOCUS_52880 53221 51641 gene locus_tag LOCUS_52890 53221 51641 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098288.1 protein_id gnl|my_center|LOCUS_52890 53576 53812 gene locus_tag LOCUS_52900 gene rpmB 53576 53812 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096556.1 protein_id gnl|my_center|LOCUS_52900 53824 53979 gene locus_tag LOCUS_52910 gene rpmG 53824 53979 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096555.1 protein_id gnl|my_center|LOCUS_52910 54475 54113 gene locus_tag LOCUS_52920 54475 54113 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096551.1 protein_id gnl|my_center|LOCUS_52920 55876 54542 gene locus_tag LOCUS_52930 55876 54542 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895702.1 protein_id gnl|my_center|LOCUS_52930 56106 57599 gene locus_tag LOCUS_52940 56106 57599 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098285.1 protein_id gnl|my_center|LOCUS_52940 57746 58909 gene locus_tag LOCUS_52950 57746 58909 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114355.1 protein_id gnl|my_center|LOCUS_52950 60466 58913 gene locus_tag LOCUS_52960 60466 58913 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895701.1 protein_id gnl|my_center|LOCUS_52960 61907 60588 gene locus_tag LOCUS_52970 61907 60588 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114353.1 protein_id gnl|my_center|LOCUS_52970 62573 62085 gene locus_tag LOCUS_52980 gene dadR 62573 62085 CDS product transcriptional regulator DadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096535.1 protein_id gnl|my_center|LOCUS_52980 62751 65294 gene locus_tag LOCUS_52990 62751 65294 CDS product YdbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895700.1 protein_id gnl|my_center|LOCUS_52990 65315 65506 gene locus_tag LOCUS_53000 65315 65506 CDS product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096523.1 protein_id gnl|my_center|LOCUS_53000 65519 65863 gene locus_tag LOCUS_53010 65519 65863 CDS product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098276.1 protein_id gnl|my_center|LOCUS_53010 66220 67518 gene locus_tag LOCUS_53020 gene dadA 66220 67518 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098274.1 protein_id gnl|my_center|LOCUS_53020 67493 67846 gene locus_tag LOCUS_53030 67493 67846 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098273.1 protein_id gnl|my_center|LOCUS_53030 67937 69010 gene locus_tag LOCUS_53040 gene alr 67937 69010 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114351.1 protein_id gnl|my_center|LOCUS_53040 69161 69709 gene locus_tag LOCUS_53050 69161 69709 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096513.1 protein_id gnl|my_center|LOCUS_53050 69913 70341 gene locus_tag LOCUS_53060 69913 70341 CDS product cytochrome c5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098270.1 protein_id gnl|my_center|LOCUS_53060 70521 72410 gene locus_tag LOCUS_53070 70521 72410 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123719.1 protein_id gnl|my_center|LOCUS_53070 72990 72418 gene locus_tag LOCUS_53080 72990 72418 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110452.1 protein_id gnl|my_center|LOCUS_53080 72907 73086 gene locus_tag LOCUS_53090 72907 73086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53090 74872 73154 gene locus_tag LOCUS_53100 74872 73154 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098265.1 protein_id gnl|my_center|LOCUS_53100 77015 75006 gene locus_tag LOCUS_53110 gene rep 77015 75006 CDS product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110454.1 protein_id gnl|my_center|LOCUS_53110 77203 78879 gene locus_tag LOCUS_53120 77203 78879 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121292.1 protein_id gnl|my_center|LOCUS_53120 80257 78791 gene locus_tag LOCUS_53130 80257 78791 CDS product NorM family multidrug efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114349.1 protein_id gnl|my_center|LOCUS_53130 80406 81323 gene locus_tag LOCUS_53140 80406 81323 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098255.1 protein_id gnl|my_center|LOCUS_53140 81474 82523 gene locus_tag LOCUS_53150 gene pchP 81474 82523 CDS product phosphorylcholine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110458.1 protein_id gnl|my_center|LOCUS_53150 84551 82566 gene locus_tag LOCUS_53160 gene betT 84551 82566 CDS product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096496.1 protein_id gnl|my_center|LOCUS_53160 86169 84676 gene locus_tag LOCUS_53170 86169 84676 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098248.1 protein_id gnl|my_center|LOCUS_53170 86470 86210 gene locus_tag LOCUS_53180 86470 86210 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096478.1 protein_id gnl|my_center|LOCUS_53180 86910 87248 gene locus_tag LOCUS_53190 gene glnK 86910 87248 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096476.1 protein_id gnl|my_center|LOCUS_53190 87288 88616 gene locus_tag LOCUS_53200 gene amt 87288 88616 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109815.1 protein_id gnl|my_center|LOCUS_53200 88877 89302 gene locus_tag LOCUS_53210 88877 89302 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096441.1 protein_id gnl|my_center|LOCUS_53210 89380 89697 gene locus_tag LOCUS_53220 89380 89697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53220 90112 91026 gene locus_tag LOCUS_53230 90112 91026 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114348.1 protein_id gnl|my_center|LOCUS_53230 92427 91051 gene locus_tag LOCUS_53240 92427 91051 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098233.1 protein_id gnl|my_center|LOCUS_53240 92590 93759 gene locus_tag LOCUS_53250 92590 93759 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114347.1 protein_id gnl|my_center|LOCUS_53250 94488 93790 gene locus_tag LOCUS_53260 94488 93790 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114346.1 protein_id gnl|my_center|LOCUS_53260 95396 94485 gene locus_tag LOCUS_53270 gene xerC 95396 94485 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114345.1 protein_id gnl|my_center|LOCUS_53270 96117 95416 gene locus_tag LOCUS_53280 96117 95416 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096433.1 protein_id gnl|my_center|LOCUS_53280 96978 96148 gene locus_tag LOCUS_53290 gene dapF 96978 96148 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114344.1 protein_id gnl|my_center|LOCUS_53290 98236 96989 gene locus_tag LOCUS_53300 gene lysA 98236 96989 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114343.1 protein_id gnl|my_center|LOCUS_53300 98387 98247 gene locus_tag LOCUS_53310 98387 98247 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096430.1 protein_id gnl|my_center|LOCUS_53310 98650 98976 gene locus_tag LOCUS_53320 gene cyaY 98650 98976 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121284.1 protein_id gnl|my_center|LOCUS_53320 98954 99163 gene locus_tag LOCUS_53330 98954 99163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53330 99299 99703 gene locus_tag LOCUS_53340 gene rnk 99299 99703 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096424.1 protein_id gnl|my_center|LOCUS_53340 100460 99747 gene locus_tag LOCUS_53350 100460 99747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114342.1 protein_id gnl|my_center|LOCUS_53350 103353 100501 gene locus_tag LOCUS_53360 103353 100501 CDS product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114341.1 protein_id gnl|my_center|LOCUS_53360 103246 103512 gene locus_tag LOCUS_53370 103246 103512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53370 103735 103502 gene locus_tag LOCUS_53380 103735 103502 CDS product TIGR02647 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096418.1 protein_id gnl|my_center|LOCUS_53380 104545 103778 gene locus_tag LOCUS_53390 104545 103778 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004347357.1 protein_id gnl|my_center|LOCUS_53390 104953 104678 gene locus_tag LOCUS_53400 104953 104678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114340.1 protein_id gnl|my_center|LOCUS_53400 105055 106035 gene locus_tag LOCUS_53410 105055 106035 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114339.1 protein_id gnl|my_center|LOCUS_53410 >Feature sequence25 848 411 gene locus_tag LOCUS_53420 gene pedF 848 411 CDS product cytochrome c-550 PedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113462.1 protein_id gnl|my_center|LOCUS_53420 1161 3032 gene locus_tag LOCUS_53430 gene exaA 1161 3032 CDS product quinoprotein ethanol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088524.1 protein_id gnl|my_center|LOCUS_53430 3086 3733 gene locus_tag LOCUS_53440 3086 3733 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088520.1 protein_id gnl|my_center|LOCUS_53440 4436 3759 gene locus_tag LOCUS_53450 4436 3759 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113463.1 protein_id gnl|my_center|LOCUS_53450 5099 4449 gene locus_tag LOCUS_53460 5099 4449 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107757.1 protein_id gnl|my_center|LOCUS_53460 5248 5108 gene locus_tag LOCUS_53470 5248 5108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53470 5764 6429 gene locus_tag LOCUS_53480 gene agmR 5764 6429 CDS product response regulator AgmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107754.1 protein_id gnl|my_center|LOCUS_53480 6439 7302 gene locus_tag LOCUS_53490 6439 7302 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113465.1 protein_id gnl|my_center|LOCUS_53490 9892 7304 gene locus_tag LOCUS_53500 9892 7304 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895594.1 protein_id gnl|my_center|LOCUS_53500 11042 9879 gene locus_tag LOCUS_53510 11042 9879 CDS product FIST signal transduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106998.1 protein_id gnl|my_center|LOCUS_53510 12344 11145 gene locus_tag LOCUS_53520 12344 11145 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107001.1 protein_id gnl|my_center|LOCUS_53520 14896 12611 gene locus_tag LOCUS_53530 gene pqqF 14896 12611 CDS product pyrroloquinoline quinone biosynthesis protein PqqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895593.1 protein_id gnl|my_center|LOCUS_53530 16718 15015 gene locus_tag LOCUS_53540 16718 15015 CDS product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113468.1 protein_id gnl|my_center|LOCUS_53540 17244 18557 gene locus_tag LOCUS_53550 gene brnQ 17244 18557 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113469.1 protein_id gnl|my_center|LOCUS_53550 18793 19032 gene locus_tag LOCUS_53560 18793 19032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088496.1 protein_id gnl|my_center|LOCUS_53560 19446 19099 gene locus_tag LOCUS_53570 19446 19099 CDS product I78 family peptidase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119147.1 protein_id gnl|my_center|LOCUS_53570 19771 19538 gene locus_tag LOCUS_53580 19771 19538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004349483.1 protein_id gnl|my_center|LOCUS_53580 19956 20456 gene locus_tag LOCUS_53590 19956 20456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113471.1 protein_id gnl|my_center|LOCUS_53590 20848 20477 gene locus_tag LOCUS_53600 20848 20477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088488.1 protein_id gnl|my_center|LOCUS_53600 21251 20916 gene locus_tag LOCUS_53610 21251 20916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113472.1 protein_id gnl|my_center|LOCUS_53610 21993 21460 gene locus_tag LOCUS_53620 21993 21460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53620 23104 23487 gene locus_tag LOCUS_53630 23104 23487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53630 23610 25199 gene locus_tag LOCUS_53640 23610 25199 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088336.1 protein_id gnl|my_center|LOCUS_53640 25551 25285 gene locus_tag LOCUS_53650 25551 25285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088334.1 protein_id gnl|my_center|LOCUS_53650 26266 25658 gene locus_tag LOCUS_53660 gene azoR2 26266 25658 CDS product FMN-dependent NADH-azoreductase AzoR2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113473.1 protein_id gnl|my_center|LOCUS_53660 26414 27349 gene locus_tag LOCUS_53670 26414 27349 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113474.1 protein_id gnl|my_center|LOCUS_53670 28082 27360 gene locus_tag LOCUS_53680 28082 27360 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895592.1 protein_id gnl|my_center|LOCUS_53680 28986 28153 gene locus_tag LOCUS_53690 28986 28153 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113476.1 protein_id gnl|my_center|LOCUS_53690 29270 29845 gene locus_tag LOCUS_53700 gene pnuC 29270 29845 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088324.1 protein_id gnl|my_center|LOCUS_53700 29842 30369 gene locus_tag LOCUS_53710 29842 30369 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113477.1 protein_id gnl|my_center|LOCUS_53710 30672 31160 gene locus_tag LOCUS_53720 30672 31160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113478.1 protein_id gnl|my_center|LOCUS_53720 31157 31726 gene locus_tag LOCUS_53730 31157 31726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113479.1 protein_id gnl|my_center|LOCUS_53730 31783 32805 gene locus_tag LOCUS_53740 31783 32805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113480.1 protein_id gnl|my_center|LOCUS_53740 32867 33547 gene locus_tag LOCUS_53750 32867 33547 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113481.1 protein_id gnl|my_center|LOCUS_53750 33561 34313 gene locus_tag LOCUS_53760 33561 34313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895591.1 protein_id gnl|my_center|LOCUS_53760 34374 35639 gene locus_tag LOCUS_53770 34374 35639 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088309.1 protein_id gnl|my_center|LOCUS_53770 36682 35756 gene locus_tag LOCUS_53780 gene rbsK 36682 35756 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113483.1 protein_id gnl|my_center|LOCUS_53780 37740 36736 gene locus_tag LOCUS_53790 37740 36736 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119158.1 protein_id gnl|my_center|LOCUS_53790 38751 37753 gene locus_tag LOCUS_53800 38751 37753 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088303.1 protein_id gnl|my_center|LOCUS_53800 40307 38775 gene locus_tag LOCUS_53810 40307 38775 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111272.1 protein_id gnl|my_center|LOCUS_53810 41288 40329 gene locus_tag LOCUS_53820 41288 40329 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113485.1 protein_id gnl|my_center|LOCUS_53820 42835 41507 gene locus_tag LOCUS_53830 42835 41507 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113486.1 protein_id gnl|my_center|LOCUS_53830 44458 42971 gene locus_tag LOCUS_53840 44458 42971 CDS product RimK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088294.1 protein_id gnl|my_center|LOCUS_53840 44649 45746 gene locus_tag LOCUS_53850 44649 45746 CDS product GNAT family N-acetyltransferase/peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113487.1 protein_id gnl|my_center|LOCUS_53850 45904 46038 gene locus_tag LOCUS_53860 45904 46038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53860 46350 48245 gene locus_tag LOCUS_53870 46350 48245 CDS product di-heme-cytochrome C peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113489.1 protein_id gnl|my_center|LOCUS_53870 48355 49563 gene locus_tag LOCUS_53880 48355 49563 CDS product catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113490.1 protein_id gnl|my_center|LOCUS_53880 49815 50189 gene locus_tag LOCUS_53890 49815 50189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53890 50373 50957 gene locus_tag LOCUS_53900 50373 50957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53900 52080 51700 gene locus_tag LOCUS_53910 52080 51700 CDS product DUF4354 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114920.1 protein_id gnl|my_center|LOCUS_53910 54778 52574 gene locus_tag LOCUS_53920 54778 52574 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114921.1 protein_id gnl|my_center|LOCUS_53920 55764 54775 gene locus_tag LOCUS_53930 55764 54775 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102358.1 protein_id gnl|my_center|LOCUS_53930 56273 55761 gene locus_tag LOCUS_53940 56273 55761 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088271.1 protein_id gnl|my_center|LOCUS_53940 57738 56443 gene locus_tag LOCUS_53950 57738 56443 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114922.1 protein_id gnl|my_center|LOCUS_53950 58110 58406 gene locus_tag LOCUS_53960 58110 58406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114923.1 protein_id gnl|my_center|LOCUS_53960 58399 59022 gene locus_tag LOCUS_53970 58399 59022 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119171.1 protein_id gnl|my_center|LOCUS_53970 61384 59084 gene locus_tag LOCUS_53980 gene metE 61384 59084 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114925.1 protein_id gnl|my_center|LOCUS_53980 63724 61517 gene locus_tag LOCUS_53990 63724 61517 CDS product OsmC domain/YcaO domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206168.1 protein_id gnl|my_center|LOCUS_53990 64194 63868 gene locus_tag LOCUS_54000 64194 63868 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088238.1 protein_id gnl|my_center|LOCUS_54000 64670 64194 gene locus_tag LOCUS_54010 64670 64194 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088234.1 protein_id gnl|my_center|LOCUS_54010 68512 64667 gene locus_tag LOCUS_54020 gene cobN 68512 64667 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114926.1 protein_id gnl|my_center|LOCUS_54020 68169 68080 gene locus_tag LOCUS_t00540 68169 68080 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 70473 68512 gene locus_tag LOCUS_54030 70473 68512 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114927.1 protein_id gnl|my_center|LOCUS_54030 70641 71450 gene locus_tag LOCUS_54040 70641 71450 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088221.1 protein_id gnl|my_center|LOCUS_54040 71608 73635 gene locus_tag LOCUS_54050 71608 73635 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111559.1 protein_id gnl|my_center|LOCUS_54050 73679 73825 gene locus_tag LOCUS_54060 73679 73825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54060 73822 74520 gene locus_tag LOCUS_54070 73822 74520 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114930.1 protein_id gnl|my_center|LOCUS_54070 74714 76114 gene locus_tag LOCUS_54080 74714 76114 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114931.1 protein_id gnl|my_center|LOCUS_54080 76127 76474 gene locus_tag LOCUS_54090 76127 76474 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088200.1 protein_id gnl|my_center|LOCUS_54090 76519 77751 gene locus_tag LOCUS_54100 76519 77751 CDS product aromatic amino acid transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105845.1 protein_id gnl|my_center|LOCUS_54100 77815 79362 gene locus_tag LOCUS_54110 77815 79362 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114932.1 protein_id gnl|my_center|LOCUS_54110 79608 79799 gene locus_tag LOCUS_54120 79608 79799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54120 79930 81156 gene locus_tag LOCUS_54130 79930 81156 CDS product DUF2599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112111.1 protein_id gnl|my_center|LOCUS_54130 81263 81943 gene locus_tag LOCUS_54140 81263 81943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114933.1 protein_id gnl|my_center|LOCUS_54140 82035 82541 gene locus_tag LOCUS_54150 82035 82541 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088185.1 protein_id gnl|my_center|LOCUS_54150 82538 83488 gene locus_tag LOCUS_54160 82538 83488 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114934.1 protein_id gnl|my_center|LOCUS_54160 83697 86111 gene locus_tag LOCUS_54170 83697 86111 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114936.1 protein_id gnl|my_center|LOCUS_54170 86152 87303 gene locus_tag LOCUS_54180 86152 87303 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088170.1 protein_id gnl|my_center|LOCUS_54180 87300 87488 gene locus_tag LOCUS_54190 87300 87488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54190 87490 88701 gene locus_tag LOCUS_54200 87490 88701 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147483.1 protein_id gnl|my_center|LOCUS_54200 88698 90338 gene locus_tag LOCUS_54210 88698 90338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115906.1 protein_id gnl|my_center|LOCUS_54210 90380 90916 gene locus_tag LOCUS_54220 90380 90916 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115078.1 protein_id gnl|my_center|LOCUS_54220 >Feature sequence26 <1 666 gene locus_tag LOCUS_54230 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003093467.1:cytochrome-c oxidase, cbb3-type subunit I 750 992 gene locus_tag LOCUS_54240 750 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093468.1 protein_id gnl|my_center|LOCUS_54240 1430 1008 gene locus_tag LOCUS_54250 gene hpaR 1430 1008 CDS product homoprotocatechuate degradation operon regulator HpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093470.1 protein_id gnl|my_center|LOCUS_54250 2724 1516 gene locus_tag LOCUS_54260 2724 1516 CDS product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003159295.1 protein_id gnl|my_center|LOCUS_54260 3089 4345 gene locus_tag LOCUS_54270 3089 4345 CDS product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105682.1 protein_id gnl|my_center|LOCUS_54270 5612 4374 gene locus_tag LOCUS_54280 gene tyrS 5612 4374 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113003.1 protein_id gnl|my_center|LOCUS_54280 6371 6670 gene locus_tag LOCUS_54290 6371 6670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093477.1 protein_id gnl|my_center|LOCUS_54290 6802 8595 gene locus_tag LOCUS_54300 6802 8595 CDS product cholesterol oxidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113002.1 protein_id gnl|my_center|LOCUS_54300 8904 9203 gene locus_tag LOCUS_54310 8904 9203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093484.1 protein_id gnl|my_center|LOCUS_54310 9300 10556 gene locus_tag LOCUS_54320 9300 10556 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093492.1 protein_id gnl|my_center|LOCUS_54320 10566 12725 gene locus_tag LOCUS_54330 10566 12725 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105688.1 protein_id gnl|my_center|LOCUS_54330 12725 14140 gene locus_tag LOCUS_54340 12725 14140 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113001.1 protein_id gnl|my_center|LOCUS_54340 14206 15126 gene locus_tag LOCUS_54350 14206 15126 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093500.1 protein_id gnl|my_center|LOCUS_54350 15724 15113 gene locus_tag LOCUS_54360 15724 15113 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023187660.1 protein_id gnl|my_center|LOCUS_54360 17806 15929 gene locus_tag LOCUS_54370 17806 15929 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113000.1 protein_id gnl|my_center|LOCUS_54370 18138 18938 gene locus_tag LOCUS_54380 18138 18938 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104791.1 protein_id gnl|my_center|LOCUS_54380 18935 19975 gene locus_tag LOCUS_54390 18935 19975 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112999.1 protein_id gnl|my_center|LOCUS_54390 19998 20972 gene locus_tag LOCUS_54400 19998 20972 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112998.1 protein_id gnl|my_center|LOCUS_54400 21005 22024 gene locus_tag LOCUS_54410 21005 22024 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104786.1 protein_id gnl|my_center|LOCUS_54410 22021 23133 gene locus_tag LOCUS_54420 22021 23133 CDS product acetoin dehydrogenase dihydrolipoyllysine-residue acetyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112997.1 protein_id gnl|my_center|LOCUS_54420 23147 24238 gene locus_tag LOCUS_54430 23147 24238 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119007.1 protein_id gnl|my_center|LOCUS_54430 24990 24322 gene locus_tag LOCUS_54440 24990 24322 CDS product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104779.1 protein_id gnl|my_center|LOCUS_54440 26735 25428 gene locus_tag LOCUS_54450 26735 25428 CDS product NtaA/DmoA family FMN-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112996.1 protein_id gnl|my_center|LOCUS_54450 28887 26803 gene locus_tag LOCUS_54460 28887 26803 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112995.1 protein_id gnl|my_center|LOCUS_54460 29113 29931 gene locus_tag LOCUS_54470 29113 29931 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119004.1 protein_id gnl|my_center|LOCUS_54470 30735 29938 gene locus_tag LOCUS_54480 30735 29938 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093530.1 protein_id gnl|my_center|LOCUS_54480 30862 31767 gene locus_tag LOCUS_54490 gene fepB 30862 31767 CDS product Fe2+-enterobactin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112994.1 protein_id gnl|my_center|LOCUS_54490 31798 32820 gene locus_tag LOCUS_54500 31798 32820 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112993.1 protein_id gnl|my_center|LOCUS_54500 32817 33848 gene locus_tag LOCUS_54510 32817 33848 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112992.1 protein_id gnl|my_center|LOCUS_54510 34574 33858 gene locus_tag LOCUS_54520 34574 33858 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101310.1 protein_id gnl|my_center|LOCUS_54520 34879 36588 gene locus_tag LOCUS_54530 34879 36588 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101313.1 protein_id gnl|my_center|LOCUS_54530 36650 36976 gene locus_tag LOCUS_54540 36650 36976 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112991.1 protein_id gnl|my_center|LOCUS_54540 38482 36992 gene locus_tag LOCUS_54550 38482 36992 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101316.1 protein_id gnl|my_center|LOCUS_54550 38614 39072 gene locus_tag LOCUS_54560 38614 39072 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101319.1 protein_id gnl|my_center|LOCUS_54560 39957 39139 gene locus_tag LOCUS_54570 gene dkgB 39957 39139 CDS product 2,5-didehydrogluconate reductase DkgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112990.1 protein_id gnl|my_center|LOCUS_54570 40300 42708 gene locus_tag LOCUS_54580 40300 42708 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112989.1 protein_id gnl|my_center|LOCUS_54580 43201 42773 gene locus_tag LOCUS_54590 43201 42773 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115857.1 protein_id gnl|my_center|LOCUS_54590 43327 44214 gene locus_tag LOCUS_54600 43327 44214 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118999.1 protein_id gnl|my_center|LOCUS_54600 44350 44913 gene locus_tag LOCUS_54610 44350 44913 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112987.1 protein_id gnl|my_center|LOCUS_54610 44936 45736 gene locus_tag LOCUS_54620 gene xth 44936 45736 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101332.1 protein_id gnl|my_center|LOCUS_54620 46166 45768 gene locus_tag LOCUS_54630 46166 45768 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101334.1 protein_id gnl|my_center|LOCUS_54630 46307 47230 gene locus_tag LOCUS_54640 46307 47230 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101343.1 protein_id gnl|my_center|LOCUS_54640 47765 49153 gene locus_tag LOCUS_54650 gene piv 47765 49153 CDS product protease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112986.1 protein_id gnl|my_center|LOCUS_54650 49877 49596 gene locus_tag LOCUS_54660 49877 49596 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101349.1 protein_id gnl|my_center|LOCUS_54660 50020 50421 gene locus_tag LOCUS_54670 50020 50421 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112985.1 protein_id gnl|my_center|LOCUS_54670 50521 51264 gene locus_tag LOCUS_54680 gene eftM 50521 51264 CDS product class I SAM-dependent methyltransferase EftM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112983.1 protein_id gnl|my_center|LOCUS_54680 51501 52796 gene locus_tag LOCUS_54690 51501 52796 CDS product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101355.1 protein_id gnl|my_center|LOCUS_54690 54482 52839 gene locus_tag LOCUS_54700 54482 52839 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101357.1 protein_id gnl|my_center|LOCUS_54700 54783 55502 gene locus_tag LOCUS_54710 54783 55502 CDS product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112978.1 protein_id gnl|my_center|LOCUS_54710 55530 56168 gene locus_tag LOCUS_54720 55530 56168 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112977.1 protein_id gnl|my_center|LOCUS_54720 56594 56172 gene locus_tag LOCUS_54730 56594 56172 CDS product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118992.1 protein_id gnl|my_center|LOCUS_54730 57687 56665 gene locus_tag LOCUS_54740 57687 56665 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121890.1 protein_id gnl|my_center|LOCUS_54740 57994 58722 gene locus_tag LOCUS_54750 57994 58722 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101372.1 protein_id gnl|my_center|LOCUS_54750 58815 60134 gene locus_tag LOCUS_54760 58815 60134 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112975.1 protein_id gnl|my_center|LOCUS_54760 60270 61598 gene locus_tag LOCUS_54770 60270 61598 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101374.1 protein_id gnl|my_center|LOCUS_54770 61663 62574 gene locus_tag LOCUS_54780 61663 62574 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093588.1 protein_id gnl|my_center|LOCUS_54780 62567 64057 gene locus_tag LOCUS_54790 62567 64057 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101377.1 protein_id gnl|my_center|LOCUS_54790 64225 65421 gene locus_tag LOCUS_54800 gene pqsL 64225 65421 CDS product FAD-dependent monooxygenase PqsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101379.1 protein_id gnl|my_center|LOCUS_54800 66466 65462 gene locus_tag LOCUS_54810 66466 65462 CDS product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101381.1 protein_id gnl|my_center|LOCUS_54810 67218 66475 gene locus_tag LOCUS_54820 67218 66475 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114714.1 protein_id gnl|my_center|LOCUS_54820 67919 67215 gene locus_tag LOCUS_54830 67919 67215 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114715.1 protein_id gnl|my_center|LOCUS_54830 68614 67916 gene locus_tag LOCUS_54840 68614 67916 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101388.1 protein_id gnl|my_center|LOCUS_54840 69529 68699 gene locus_tag LOCUS_54850 69529 68699 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114716.1 protein_id gnl|my_center|LOCUS_54850 70329 69685 gene locus_tag LOCUS_54860 gene bfiR 70329 69685 CDS product two-component system response regulator BfiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114717.1 protein_id gnl|my_center|LOCUS_54860 72608 70332 gene locus_tag LOCUS_54870 gene bfiS 72608 70332 CDS product two-component system sensor histidine kinase BfiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114718.1 protein_id gnl|my_center|LOCUS_54870 72854 74476 gene locus_tag LOCUS_54880 72854 74476 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093598.1 protein_id gnl|my_center|LOCUS_54880 74594 76375 gene locus_tag LOCUS_54890 74594 76375 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114720.1 protein_id gnl|my_center|LOCUS_54890 76573 77439 gene locus_tag LOCUS_54900 76573 77439 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114721.1 protein_id gnl|my_center|LOCUS_54900 78519 77479 gene locus_tag LOCUS_54910 78519 77479 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114722.1 protein_id gnl|my_center|LOCUS_54910 79670 78615 gene locus_tag LOCUS_54920 gene nmoA 79670 78615 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114723.1 protein_id gnl|my_center|LOCUS_54920 79778 80632 gene locus_tag LOCUS_54930 gene nmoR 79778 80632 CDS product LysR family transcriptional regulator NmoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114724.1 protein_id gnl|my_center|LOCUS_54930 80712 81878 gene locus_tag LOCUS_54940 gene ppgL 80712 81878 CDS product gluconolactonase PpgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114725.1 protein_id gnl|my_center|LOCUS_54940 82529 82975 gene locus_tag LOCUS_54950 gene mexG 82529 82975 CDS product multidrug efflux RND transporter inhibitory subunit MexG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093607.1 protein_id gnl|my_center|LOCUS_54950 82983 84095 gene locus_tag LOCUS_54960 gene mexH 82983 84095 CDS product multidrug efflux RND transporter periplasmic adaptor MexH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104731.1 protein_id gnl|my_center|LOCUS_54960 84108 87197 gene locus_tag LOCUS_54970 gene mexI 84108 87197 CDS product multidrug efflux RND transporter permease MexI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114727.1 protein_id gnl|my_center|LOCUS_54970 87194 88657 gene locus_tag LOCUS_54980 gene opmD 87194 88657 CDS product multidrug efflux transporter outer membrane subunit OpmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104727.1 protein_id gnl|my_center|LOCUS_54980 89672 88668 gene locus_tag LOCUS_54990 gene phzM 89672 88668 CDS product phenazine-1-carboxylate N-methyltransferase PhzM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093617.1 protein_id gnl|my_center|LOCUS_54990 >Feature sequence27 1453 293 gene locus_tag LOCUS_55000 gene ugpC 1453 293 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114840.1 protein_id gnl|my_center|LOCUS_55000 2331 1486 gene locus_tag LOCUS_55010 2331 1486 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091470.1 protein_id gnl|my_center|LOCUS_55010 3256 2324 gene locus_tag LOCUS_55020 3256 2324 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091471.1 protein_id gnl|my_center|LOCUS_55020 4619 3357 gene locus_tag LOCUS_55030 4619 3357 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091472.1 protein_id gnl|my_center|LOCUS_55030 6592 5144 gene locus_tag LOCUS_55040 gene gtrS 6592 5144 CDS product two-component system sensor histidine kinase GtrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114839.1 protein_id gnl|my_center|LOCUS_55040 7317 6589 gene locus_tag LOCUS_55050 gene gltR 7317 6589 CDS product two-component system response regulator GltR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091475.1 protein_id gnl|my_center|LOCUS_55050 8347 7352 gene locus_tag LOCUS_55060 8347 7352 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114838.1 protein_id gnl|my_center|LOCUS_55060 10276 8450 gene locus_tag LOCUS_55070 gene edd 10276 8450 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091478.1 protein_id gnl|my_center|LOCUS_55070 10406 11410 gene locus_tag LOCUS_55080 gene gap 10406 11410 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114837.1 protein_id gnl|my_center|LOCUS_55080 11647 11417 gene locus_tag LOCUS_55090 11647 11417 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767716.1 protein_id gnl|my_center|LOCUS_55090 12244 11714 gene locus_tag LOCUS_55100 12244 11714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114836.1 protein_id gnl|my_center|LOCUS_55100 13323 12325 gene locus_tag LOCUS_55110 gene scpB 13323 12325 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114835.1 protein_id gnl|my_center|LOCUS_55110 14358 13468 gene locus_tag LOCUS_55120 14358 13468 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124353.1 protein_id gnl|my_center|LOCUS_55120 15022 14393 gene locus_tag LOCUS_55130 15022 14393 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091486.1 protein_id gnl|my_center|LOCUS_55130 15906 15019 gene locus_tag LOCUS_55140 15906 15019 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114833.1 protein_id gnl|my_center|LOCUS_55140 16083 16709 gene locus_tag LOCUS_55150 16083 16709 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091488.1 protein_id gnl|my_center|LOCUS_55150 16711 17010 gene locus_tag LOCUS_55160 16711 17010 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091489.1 protein_id gnl|my_center|LOCUS_55160 17189 17548 gene locus_tag LOCUS_55170 17189 17548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114832.1 protein_id gnl|my_center|LOCUS_55170 17559 18236 gene locus_tag LOCUS_55180 17559 18236 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091491.1 protein_id gnl|my_center|LOCUS_55180 18365 18805 gene locus_tag LOCUS_55190 18365 18805 CDS product Spy/CpxP family protein refolding chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114831.1 protein_id gnl|my_center|LOCUS_55190 18920 20257 gene locus_tag LOCUS_55200 18920 20257 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114830.1 protein_id gnl|my_center|LOCUS_55200 20297 20776 gene locus_tag LOCUS_55210 20297 20776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114829.1 protein_id gnl|my_center|LOCUS_55210 21317 20757 gene locus_tag LOCUS_55220 21317 20757 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114828.1 protein_id gnl|my_center|LOCUS_55220 21699 21382 gene locus_tag LOCUS_55230 21699 21382 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114826.1 protein_id gnl|my_center|LOCUS_55230 21911 23365 gene locus_tag LOCUS_55240 21911 23365 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114825.1 protein_id gnl|my_center|LOCUS_55240 23432 24577 gene locus_tag LOCUS_55250 23432 24577 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114824.1 protein_id gnl|my_center|LOCUS_55250 24574 25368 gene locus_tag LOCUS_55260 24574 25368 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114823.1 protein_id gnl|my_center|LOCUS_55260 25370 26308 gene locus_tag LOCUS_55270 25370 26308 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114822.1 protein_id gnl|my_center|LOCUS_55270 26305 26949 gene locus_tag LOCUS_55280 26305 26949 CDS product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109195.1 protein_id gnl|my_center|LOCUS_55280 27985 26972 gene locus_tag LOCUS_55290 27985 26972 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114821.1 protein_id gnl|my_center|LOCUS_55290 28128 28445 gene locus_tag LOCUS_55300 28128 28445 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114819.1 protein_id gnl|my_center|LOCUS_55300 28713 30053 gene locus_tag LOCUS_55310 28713 30053 CDS product protein CyaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124349.1 protein_id gnl|my_center|LOCUS_55310 30990 30043 gene locus_tag LOCUS_55320 30990 30043 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185574.1 protein_id gnl|my_center|LOCUS_55320 31907 31095 gene locus_tag LOCUS_55330 31907 31095 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091510.1 protein_id gnl|my_center|LOCUS_55330 32054 32818 gene locus_tag LOCUS_55340 32054 32818 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114816.1 protein_id gnl|my_center|LOCUS_55340 32883 33218 gene locus_tag LOCUS_55350 32883 33218 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109191.1 protein_id gnl|my_center|LOCUS_55350 33228 34127 gene locus_tag LOCUS_55360 33228 34127 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114815.1 protein_id gnl|my_center|LOCUS_55360 34873 34232 gene locus_tag LOCUS_55370 gene azoR3 34873 34232 CDS product FMN-dependent NADH-azoreductase AzoR3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114814.1 protein_id gnl|my_center|LOCUS_55370 35337 35020 gene locus_tag LOCUS_55380 35337 35020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091533.1 protein_id gnl|my_center|LOCUS_55380 35537 36466 gene locus_tag LOCUS_55390 35537 36466 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091534.1 protein_id gnl|my_center|LOCUS_55390 36473 37300 gene locus_tag LOCUS_55400 36473 37300 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114813.1 protein_id gnl|my_center|LOCUS_55400 37282 37845 gene locus_tag LOCUS_55410 gene ppiA 37282 37845 CDS product peptidylprolyl isomerase PpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114812.1 protein_id gnl|my_center|LOCUS_55410 37908 39740 gene locus_tag LOCUS_55420 37908 39740 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109184.1 protein_id gnl|my_center|LOCUS_55420 40022 40288 gene locus_tag LOCUS_55430 40022 40288 CDS product DUF2790 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091540.1 protein_id gnl|my_center|LOCUS_55430 41445 40321 gene locus_tag LOCUS_55440 41445 40321 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114811.1 protein_id gnl|my_center|LOCUS_55440 41878 41720 gene locus_tag LOCUS_55450 41878 41720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55450 42613 41987 gene locus_tag LOCUS_55460 42613 41987 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114810.1 protein_id gnl|my_center|LOCUS_55460 44409 42610 gene locus_tag LOCUS_55470 44409 42610 CDS product cyclic nucleotide-binding/CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114809.1 protein_id gnl|my_center|LOCUS_55470 46154 44499 gene locus_tag LOCUS_55480 46154 44499 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091546.1 protein_id gnl|my_center|LOCUS_55480 46462 46151 gene locus_tag LOCUS_55490 46462 46151 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091547.1 protein_id gnl|my_center|LOCUS_55490 47492 46680 gene locus_tag LOCUS_55500 47492 46680 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114808.1 protein_id gnl|my_center|LOCUS_55500 47830 48051 gene locus_tag LOCUS_55510 47830 48051 CDS product DUF2061 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091551.1 protein_id gnl|my_center|LOCUS_55510 48194 49555 gene locus_tag LOCUS_55520 48194 49555 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114807.1 protein_id gnl|my_center|LOCUS_55520 49559 50362 gene locus_tag LOCUS_55530 49559 50362 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114806.1 protein_id gnl|my_center|LOCUS_55530 50502 51359 gene locus_tag LOCUS_55540 50502 51359 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114805.1 protein_id gnl|my_center|LOCUS_55540 52592 51423 gene locus_tag LOCUS_55550 52592 51423 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114804.1 protein_id gnl|my_center|LOCUS_55550 53598 52660 gene locus_tag LOCUS_55560 53598 52660 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114803.1 protein_id gnl|my_center|LOCUS_55560 53758 54549 gene locus_tag LOCUS_55570 gene minC 53758 54549 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114802.1 protein_id gnl|my_center|LOCUS_55570 54611 55426 gene locus_tag LOCUS_55580 gene minD 54611 55426 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091579.1 protein_id gnl|my_center|LOCUS_55580 55423 55677 gene locus_tag LOCUS_55590 gene minE 55423 55677 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091581.1 protein_id gnl|my_center|LOCUS_55590 55766 56416 gene locus_tag LOCUS_55600 55766 56416 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114801.1 protein_id gnl|my_center|LOCUS_55600 56585 57874 gene locus_tag LOCUS_55610 56585 57874 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114800.1 protein_id gnl|my_center|LOCUS_55610 58468 57917 gene locus_tag LOCUS_55620 58468 57917 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114799.1 protein_id gnl|my_center|LOCUS_55620 59250 58534 gene locus_tag LOCUS_55630 59250 58534 CDS product UTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091585.1 protein_id gnl|my_center|LOCUS_55630 59613 60671 gene locus_tag LOCUS_55640 59613 60671 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091586.1 protein_id gnl|my_center|LOCUS_55640 60726 61535 gene locus_tag LOCUS_55650 60726 61535 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114798.1 protein_id gnl|my_center|LOCUS_55650 61532 62371 gene locus_tag LOCUS_55660 61532 62371 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091588.1 protein_id gnl|my_center|LOCUS_55660 62358 63155 gene locus_tag LOCUS_55670 62358 63155 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091589.1 protein_id gnl|my_center|LOCUS_55670 63158 64153 gene locus_tag LOCUS_55680 63158 64153 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114797.1 protein_id gnl|my_center|LOCUS_55680 64153 64803 gene locus_tag LOCUS_55690 64153 64803 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122231.1 protein_id gnl|my_center|LOCUS_55690 65832 64870 gene locus_tag LOCUS_55700 65832 64870 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114796.1 protein_id gnl|my_center|LOCUS_55700 65929 68058 gene locus_tag LOCUS_55710 65929 68058 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_55710 68154 69902 gene locus_tag LOCUS_55720 68154 69902 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895651.1 protein_id gnl|my_center|LOCUS_55720 70395 69916 gene locus_tag LOCUS_55730 70395 69916 CDS product sel1 repeat family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114794.1 protein_id gnl|my_center|LOCUS_55730 70750 70385 gene locus_tag LOCUS_55740 70750 70385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430937.1 protein_id gnl|my_center|LOCUS_55740 71064 70753 gene locus_tag LOCUS_55750 71064 70753 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114792.1 protein_id gnl|my_center|LOCUS_55750 71189 71902 gene locus_tag LOCUS_55760 71189 71902 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895652.1 protein_id gnl|my_center|LOCUS_55760 72321 71890 gene locus_tag LOCUS_55770 72321 71890 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408555.1 protein_id gnl|my_center|LOCUS_55770 73452 72691 gene locus_tag LOCUS_55780 73452 72691 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091600.1 protein_id gnl|my_center|LOCUS_55780 73785 73709 gene locus_tag LOCUS_t00550 73785 73709 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence28 5016 5987 gene locus_tag LOCUS_55790 5016 5987 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 protein_id gnl|my_center|LOCUS_55790 6097 7095 gene locus_tag LOCUS_55800 6097 7095 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099371.1 protein_id gnl|my_center|LOCUS_55800 7190 8653 gene locus_tag LOCUS_55810 7190 8653 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114709.1 protein_id gnl|my_center|LOCUS_55810 9006 9584 gene locus_tag LOCUS_55820 9006 9584 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094926.1 protein_id gnl|my_center|LOCUS_55820 9701 10144 gene locus_tag LOCUS_55830 9701 10144 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114708.1 protein_id gnl|my_center|LOCUS_55830 11143 10154 gene locus_tag LOCUS_55840 11143 10154 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121034.1 protein_id gnl|my_center|LOCUS_55840 12144 11323 gene locus_tag LOCUS_55850 12144 11323 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099360.1 protein_id gnl|my_center|LOCUS_55850 12307 14445 gene locus_tag LOCUS_55860 12307 14445 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099358.1 protein_id gnl|my_center|LOCUS_55860 15062 14448 gene locus_tag LOCUS_55870 15062 14448 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114707.1 protein_id gnl|my_center|LOCUS_55870 15488 16192 gene locus_tag LOCUS_55880 15488 16192 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094941.1 protein_id gnl|my_center|LOCUS_55880 16468 16205 gene locus_tag LOCUS_55890 16468 16205 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094943.1 protein_id gnl|my_center|LOCUS_55890 16650 16468 gene locus_tag LOCUS_55900 16650 16468 CDS product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094945.1 protein_id gnl|my_center|LOCUS_55900 16751 17908 gene locus_tag LOCUS_55910 16751 17908 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114706.1 protein_id gnl|my_center|LOCUS_55910 18307 18029 gene locus_tag LOCUS_55920 18307 18029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114705.1 protein_id gnl|my_center|LOCUS_55920 18591 18797 gene locus_tag LOCUS_55930 18591 18797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379241.1 protein_id gnl|my_center|LOCUS_55930 19442 18855 gene locus_tag LOCUS_55940 19442 18855 CDS product YajG family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094953.1 protein_id gnl|my_center|LOCUS_55940 20141 19932 gene locus_tag LOCUS_55950 20141 19932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55950 20284 21807 gene locus_tag LOCUS_55960 gene mqo 20284 21807 CDS product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099345.1 protein_id gnl|my_center|LOCUS_55960 22270 21857 gene locus_tag LOCUS_55970 22270 21857 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550737.1 protein_id gnl|my_center|LOCUS_55970 22834 22544 gene locus_tag LOCUS_55980 22834 22544 CDS product PA4642 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094960.1 protein_id gnl|my_center|LOCUS_55980 23402 22917 gene locus_tag LOCUS_55990 23402 22917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094962.1 protein_id gnl|my_center|LOCUS_55990 23943 23470 gene locus_tag LOCUS_56000 23943 23470 CDS product WbuC family cupin fold metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094965.1 protein_id gnl|my_center|LOCUS_56000 24502 23945 gene locus_tag LOCUS_56010 24502 23945 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099341.1 protein_id gnl|my_center|LOCUS_56010 24670 25308 gene locus_tag LOCUS_56020 gene upp 24670 25308 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094968.1 protein_id gnl|my_center|LOCUS_56020 25311 26594 gene locus_tag LOCUS_56030 25311 26594 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094970.1 protein_id gnl|my_center|LOCUS_56030 26928 27476 gene locus_tag LOCUS_56040 26928 27476 CDS product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099340.1 protein_id gnl|my_center|LOCUS_56040 27507 28040 gene locus_tag LOCUS_56050 27507 28040 CDS product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003146046.1 protein_id gnl|my_center|LOCUS_56050 28046 28582 gene locus_tag LOCUS_56060 28046 28582 CDS product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099337.1 protein_id gnl|my_center|LOCUS_56060 28601 29389 gene locus_tag LOCUS_56070 28601 29389 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114703.1 protein_id gnl|my_center|LOCUS_56070 29406 31778 gene locus_tag LOCUS_56080 29406 31778 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114701.1 protein_id gnl|my_center|LOCUS_56080 31775 32722 gene locus_tag LOCUS_56090 31775 32722 CDS product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099330.1 protein_id gnl|my_center|LOCUS_56090 34097 32724 gene locus_tag LOCUS_56100 34097 32724 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099328.1 protein_id gnl|my_center|LOCUS_56100 35399 34377 gene locus_tag LOCUS_56110 gene hemH 35399 34377 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099324.1 protein_id gnl|my_center|LOCUS_56110 36313 35396 gene locus_tag LOCUS_56120 36313 35396 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114699.1 protein_id gnl|my_center|LOCUS_56120 36727 37710 gene locus_tag LOCUS_56130 36727 37710 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114698.1 protein_id gnl|my_center|LOCUS_56130 37863 38819 gene locus_tag LOCUS_56140 37863 38819 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099314.1 protein_id gnl|my_center|LOCUS_56140 38829 39728 gene locus_tag LOCUS_56150 38829 39728 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094990.1 protein_id gnl|my_center|LOCUS_56150 39740 41170 gene locus_tag LOCUS_56160 gene phrB 39740 41170 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114697.1 protein_id gnl|my_center|LOCUS_56160 41817 41296 gene locus_tag LOCUS_56170 gene pagL 41817 41296 CDS product lipid A 3-O-deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099307.1 protein_id gnl|my_center|LOCUS_56170 42748 41951 gene locus_tag LOCUS_56180 gene murI 42748 41951 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099300.1 protein_id gnl|my_center|LOCUS_56180 43496 42738 gene locus_tag LOCUS_56190 43496 42738 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114696.1 protein_id gnl|my_center|LOCUS_56190 44320 43490 gene locus_tag LOCUS_56200 gene prmC 44320 43490 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114694.1 protein_id gnl|my_center|LOCUS_56200 45404 44322 gene locus_tag LOCUS_56210 gene prfA 45404 44322 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114692.1 protein_id gnl|my_center|LOCUS_56210 46690 45422 gene locus_tag LOCUS_56220 gene hemA 46690 45422 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095001.1 protein_id gnl|my_center|LOCUS_56220 46879 48606 gene locus_tag LOCUS_56230 gene lbcA 46879 48606 CDS product proteolytic complex protein LbcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004352693.1 protein_id gnl|my_center|LOCUS_56230 48611 49228 gene locus_tag LOCUS_56240 gene lolB 48611 49228 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095005.1 protein_id gnl|my_center|LOCUS_56240 49230 50078 gene locus_tag LOCUS_56250 gene ispE 49230 50078 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099284.1 protein_id gnl|my_center|LOCUS_56250 50115 50189 gene locus_tag LOCUS_t00560 50115 50189 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 50158 51186 gene locus_tag LOCUS_56260 50158 51186 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099281.1 protein_id gnl|my_center|LOCUS_56260 51303 51917 gene locus_tag LOCUS_56270 51303 51917 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099279.1 protein_id gnl|my_center|LOCUS_56270 51959 52543 gene locus_tag LOCUS_56280 gene pth 51959 52543 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099278.1 protein_id gnl|my_center|LOCUS_56280 52584 53684 gene locus_tag LOCUS_56290 gene ychF 52584 53684 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099270.1 protein_id gnl|my_center|LOCUS_56290 53864 53940 gene locus_tag LOCUS_t00570 53864 53940 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 54396 54091 gene locus_tag LOCUS_56300 54396 54091 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113527.1 protein_id gnl|my_center|LOCUS_56300 54686 54408 gene locus_tag LOCUS_56310 54686 54408 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 protein_id gnl|my_center|LOCUS_56310 55015 57243 gene locus_tag LOCUS_56320 55015 57243 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113525.1 protein_id gnl|my_center|LOCUS_56320 57960 57313 gene locus_tag LOCUS_56330 gene can 57960 57313 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095021.1 protein_id gnl|my_center|LOCUS_56330 59260 58022 gene locus_tag LOCUS_56340 59260 58022 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113524.1 protein_id gnl|my_center|LOCUS_56340 59911 59459 gene locus_tag LOCUS_56350 gene rimI 59911 59459 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095025.1 protein_id gnl|my_center|LOCUS_56350 60705 59908 gene locus_tag LOCUS_56360 60705 59908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121053.1 protein_id gnl|my_center|LOCUS_56360 61405 60869 gene locus_tag LOCUS_56370 61405 60869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113522.1 protein_id gnl|my_center|LOCUS_56370 62455 61436 gene locus_tag LOCUS_56380 62455 61436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113521.1 protein_id gnl|my_center|LOCUS_56380 63503 62457 gene locus_tag LOCUS_56390 63503 62457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106143.1 protein_id gnl|my_center|LOCUS_56390 64310 63708 gene locus_tag LOCUS_56400 64310 63708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095035.1 protein_id gnl|my_center|LOCUS_56400 64595 65893 gene locus_tag LOCUS_56410 gene mksB 64595 65893 CDS product Mks condensin complex protein MksB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095037.1 protein_id gnl|my_center|LOCUS_56410 65883 66578 gene locus_tag LOCUS_56420 gene mksE 65883 66578 CDS product Mks condensin complex protein MksE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095041.1 protein_id gnl|my_center|LOCUS_56420 66575 69421 gene locus_tag LOCUS_56430 gene mksF 66575 69421 CDS product Mks condensin complex protein MksF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113519.1 protein_id gnl|my_center|LOCUS_56430 69533 70540 gene locus_tag LOCUS_56440 69533 70540 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095046.1 protein_id gnl|my_center|LOCUS_56440 70537 72099 gene locus_tag LOCUS_56450 70537 72099 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123435.1 protein_id gnl|my_center|LOCUS_56450 >Feature sequence29 <1 672 gene locus_tag LOCUS_56460 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113609.1:cytochrome-c oxidase, cbb3-type subunit I 675 896 gene locus_tag LOCUS_56470 675 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098206.1 protein_id gnl|my_center|LOCUS_56470 988 2145 gene locus_tag LOCUS_56480 988 2145 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113608.1 protein_id gnl|my_center|LOCUS_56480 2996 2133 gene locus_tag LOCUS_56490 2996 2133 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098205.1 protein_id gnl|my_center|LOCUS_56490 3281 3556 gene locus_tag LOCUS_56500 3281 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098204.1 protein_id gnl|my_center|LOCUS_56500 4811 3606 gene locus_tag LOCUS_56510 4811 3606 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098203.1 protein_id gnl|my_center|LOCUS_56510 5061 6065 gene locus_tag LOCUS_56520 5061 6065 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113607.1 protein_id gnl|my_center|LOCUS_56520 6088 6330 gene locus_tag LOCUS_56530 6088 6330 CDS product DUF1272 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113606.1 protein_id gnl|my_center|LOCUS_56530 6335 7504 gene locus_tag LOCUS_56540 6335 7504 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113605.1 protein_id gnl|my_center|LOCUS_56540 8147 7563 gene locus_tag LOCUS_56550 gene nfuA 8147 7563 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088034.1 protein_id gnl|my_center|LOCUS_56550 10558 8270 gene locus_tag LOCUS_56560 10558 8270 CDS product fatty acid cis/trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113604.1 protein_id gnl|my_center|LOCUS_56560 10920 11438 gene locus_tag LOCUS_56570 gene tsi1 10920 11438 CDS product type IV secretion system immunity protein Tsi1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113603.1 protein_id gnl|my_center|LOCUS_56570 11480 11944 gene locus_tag LOCUS_56580 gene tse1 11480 11944 CDS product type VI secretion system effector peptidoglycanhydrolase Tse1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088027.1 protein_id gnl|my_center|LOCUS_56580 12217 15921 gene locus_tag LOCUS_56590 gene metH 12217 15921 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113602.1 protein_id gnl|my_center|LOCUS_56590 15936 16298 gene locus_tag LOCUS_56600 15936 16298 CDS product 50S ribosome-binding protein YggL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098191.1 protein_id gnl|my_center|LOCUS_56600 16835 16350 gene locus_tag LOCUS_56610 16835 16350 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003144704.1 protein_id gnl|my_center|LOCUS_56610 17223 16861 gene locus_tag LOCUS_56620 17223 16861 CDS product DUF1883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122824.1 protein_id gnl|my_center|LOCUS_56620 17261 18301 gene locus_tag LOCUS_56630 17261 18301 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088017.1 protein_id gnl|my_center|LOCUS_56630 18366 18593 gene locus_tag LOCUS_56640 18366 18593 CDS product DUF2970 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098182.1 protein_id gnl|my_center|LOCUS_56640 18773 18618 gene locus_tag LOCUS_56650 18773 18618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56650 19004 20662 gene locus_tag LOCUS_56660 19004 20662 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098180.1 protein_id gnl|my_center|LOCUS_56660 20646 21143 gene locus_tag LOCUS_56670 20646 21143 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088003.1 protein_id gnl|my_center|LOCUS_56670 21789 21208 gene locus_tag LOCUS_56680 21789 21208 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098179.1 protein_id gnl|my_center|LOCUS_56680 21912 22349 gene locus_tag LOCUS_56690 21912 22349 CDS product hotdog fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098177.1 protein_id gnl|my_center|LOCUS_56690 22444 23319 gene locus_tag LOCUS_56700 22444 23319 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087999.1 protein_id gnl|my_center|LOCUS_56700 24298 23306 gene locus_tag LOCUS_56710 24298 23306 CDS product YhdH/YhfP family quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087998.1 protein_id gnl|my_center|LOCUS_56710 25382 24357 gene locus_tag LOCUS_56720 gene sohB 25382 24357 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087997.1 protein_id gnl|my_center|LOCUS_56720 25616 26326 gene locus_tag LOCUS_56730 25616 26326 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113600.1 protein_id gnl|my_center|LOCUS_56730 26387 26701 gene locus_tag LOCUS_56740 26387 26701 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087993.1 protein_id gnl|my_center|LOCUS_56740 26959 28029 gene locus_tag LOCUS_56750 26959 28029 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098170.1 protein_id gnl|my_center|LOCUS_56750 28054 28821 gene locus_tag LOCUS_56760 28054 28821 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087987.1 protein_id gnl|my_center|LOCUS_56760 29743 28982 gene locus_tag LOCUS_56770 29743 28982 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113599.1 protein_id gnl|my_center|LOCUS_56770 29875 30780 gene locus_tag LOCUS_56780 29875 30780 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113598.1 protein_id gnl|my_center|LOCUS_56780 31421 30777 gene locus_tag LOCUS_56790 31421 30777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113597.1 protein_id gnl|my_center|LOCUS_56790 31522 32301 gene locus_tag LOCUS_56800 31522 32301 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113596.1 protein_id gnl|my_center|LOCUS_56800 33105 32269 gene locus_tag LOCUS_56810 gene nudC 33105 32269 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113595.1 protein_id gnl|my_center|LOCUS_56810 34793 33105 gene locus_tag LOCUS_56820 gene fimL 34793 33105 CDS product type IV pilus/biofilm regulator FimL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098159.1 protein_id gnl|my_center|LOCUS_56820 35645 34833 gene locus_tag LOCUS_56830 35645 34833 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087972.1 protein_id gnl|my_center|LOCUS_56830 35869 37371 gene locus_tag LOCUS_56840 gene nhaB 35869 37371 CDS product sodium/proton antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113594.1 protein_id gnl|my_center|LOCUS_56840 38710 37355 gene locus_tag LOCUS_56850 38710 37355 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003117687.1 protein_id gnl|my_center|LOCUS_56850 40989 38734 gene locus_tag LOCUS_56860 gene ldcA 40989 38734 CDS product lysine-specific pyridoxal 5'-phosphate-dependent carboxylase LdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113592.1 protein_id gnl|my_center|LOCUS_56860 41183 41572 gene locus_tag LOCUS_56870 41183 41572 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113591.1 protein_id gnl|my_center|LOCUS_56870 42340 41600 gene locus_tag LOCUS_56880 gene dnaQ 42340 41600 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087958.1 protein_id gnl|my_center|LOCUS_56880 42830 42405 gene locus_tag LOCUS_56890 gene rnhA 42830 42405 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087954.1 protein_id gnl|my_center|LOCUS_56890 43615 42854 gene locus_tag LOCUS_56900 43615 42854 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087952.1 protein_id gnl|my_center|LOCUS_56900 43717 44493 gene locus_tag LOCUS_56910 gene gloB 43717 44493 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087949.1 protein_id gnl|my_center|LOCUS_56910 44571 46175 gene locus_tag LOCUS_56920 44571 46175 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120244.1 protein_id gnl|my_center|LOCUS_56920 46315 48195 gene locus_tag LOCUS_56930 46315 48195 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113590.1 protein_id gnl|my_center|LOCUS_56930 48192 50039 gene locus_tag LOCUS_56940 48192 50039 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098136.1 protein_id gnl|my_center|LOCUS_56940 50046 51128 gene locus_tag LOCUS_56950 50046 51128 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098134.1 protein_id gnl|my_center|LOCUS_56950 51133 52152 gene locus_tag LOCUS_56960 51133 52152 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087942.1 protein_id gnl|my_center|LOCUS_56960 52154 53764 gene locus_tag LOCUS_56970 52154 53764 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087940.1 protein_id gnl|my_center|LOCUS_56970 53786 54583 gene locus_tag LOCUS_56980 gene fabI 53786 54583 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087936.1 protein_id gnl|my_center|LOCUS_56980 56547 54682 gene locus_tag LOCUS_56990 56547 54682 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098131.1 protein_id gnl|my_center|LOCUS_56990 56727 56651 gene locus_tag LOCUS_t00580 56727 56651 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 57051 56779 gene locus_tag LOCUS_57000 gene hupB 57051 56779 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087931.1 protein_id gnl|my_center|LOCUS_57000 59583 57187 gene locus_tag LOCUS_57010 gene lon 59583 57187 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087926.1 protein_id gnl|my_center|LOCUS_57010 60995 59715 gene locus_tag LOCUS_57020 gene clpX 60995 59715 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087924.1 protein_id gnl|my_center|LOCUS_57020 61741 61100 gene locus_tag LOCUS_57030 gene clpP 61741 61100 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098129.1 protein_id gnl|my_center|LOCUS_57030 63145 61835 gene locus_tag LOCUS_57040 gene tig 63145 61835 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087920.1 protein_id gnl|my_center|LOCUS_57040 64978 63275 gene locus_tag LOCUS_57050 gene ltrA 64978 63275 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235893157.1 protein_id gnl|my_center|LOCUS_57050 66343 66011 gene locus_tag LOCUS_57060 66343 66011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57060 66233 66940 gene locus_tag LOCUS_57070 gene parR 66233 66940 CDS product response regulator transcription factor ParR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098126.1 protein_id gnl|my_center|LOCUS_57070 66941 68227 gene locus_tag LOCUS_57080 gene parS 66941 68227 CDS product sensor histidine kinase ParS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113589.1 protein_id gnl|my_center|LOCUS_57080 68344 70176 gene locus_tag LOCUS_57090 68344 70176 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895584.1 protein_id gnl|my_center|LOCUS_57090 70678 70463 gene locus_tag LOCUS_57100 70678 70463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087901.1 protein_id gnl|my_center|LOCUS_57100 70948 70873 gene locus_tag LOCUS_t00590 70948 70873 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 71524 71216 gene locus_tag LOCUS_57110 71524 71216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118919.1 protein_id gnl|my_center|LOCUS_57110 71578 71784 gene locus_tag LOCUS_57120 71578 71784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57120 71774 71992 gene locus_tag LOCUS_57130 71774 71992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344389.1 protein_id gnl|my_center|LOCUS_57130 >Feature sequence30 20 400 gene locus_tag LOCUS_57140 20 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57140 758 423 gene locus_tag LOCUS_57150 gene tnpB 758 423 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266599.1 protein_id gnl|my_center|LOCUS_57150 1072 755 gene locus_tag LOCUS_57160 1072 755 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105580.1 protein_id gnl|my_center|LOCUS_57160 1626 1132 gene locus_tag LOCUS_57170 1626 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57170 1928 1626 gene locus_tag LOCUS_57180 1928 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57180 3305 2019 gene locus_tag LOCUS_57190 3305 2019 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478369.1 protein_id gnl|my_center|LOCUS_57190 3994 3416 gene locus_tag LOCUS_57200 3994 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57200 4099 4320 gene locus_tag LOCUS_57210 4099 4320 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463131.1 protein_id gnl|my_center|LOCUS_57210 4881 4453 gene locus_tag LOCUS_57220 4881 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005888823.1 protein_id gnl|my_center|LOCUS_57220 6932 4884 gene locus_tag LOCUS_57230 6932 4884 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105141.1 protein_id gnl|my_center|LOCUS_57230 8857 6929 gene locus_tag LOCUS_57240 8857 6929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443144.1 protein_id gnl|my_center|LOCUS_57240 10320 8854 gene locus_tag LOCUS_57250 10320 8854 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105143.1 protein_id gnl|my_center|LOCUS_57250 12889 10376 gene locus_tag LOCUS_57260 gene hrpB 12889 10376 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114322.1 protein_id gnl|my_center|LOCUS_57260 13031 13447 gene locus_tag LOCUS_57270 13031 13447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093116.1 protein_id gnl|my_center|LOCUS_57270 13536 14432 gene locus_tag LOCUS_57280 gene fieF 13536 14432 CDS product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093118.1 protein_id gnl|my_center|LOCUS_57280 15108 14425 gene locus_tag LOCUS_57290 15108 14425 CDS product DUF6515 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114323.1 protein_id gnl|my_center|LOCUS_57290 15523 16065 gene locus_tag LOCUS_57300 15523 16065 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119210.1 protein_id gnl|my_center|LOCUS_57300 16267 16476 gene locus_tag LOCUS_57310 16267 16476 CDS product DUF2788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093125.1 protein_id gnl|my_center|LOCUS_57310 16577 16969 gene locus_tag LOCUS_57320 16577 16969 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093127.1 protein_id gnl|my_center|LOCUS_57320 17572 17003 gene locus_tag LOCUS_57330 17572 17003 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114324.1 protein_id gnl|my_center|LOCUS_57330 17711 18796 gene locus_tag LOCUS_57340 17711 18796 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106059.1 protein_id gnl|my_center|LOCUS_57340 19320 18754 gene locus_tag LOCUS_57350 19320 18754 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106057.1 protein_id gnl|my_center|LOCUS_57350 20946 19471 gene locus_tag LOCUS_57360 gene amn 20946 19471 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119204.1 protein_id gnl|my_center|LOCUS_57360 21456 21025 gene locus_tag LOCUS_57370 21456 21025 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093139.1 protein_id gnl|my_center|LOCUS_57370 23117 21468 gene locus_tag LOCUS_57380 23117 21468 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114325.1 protein_id gnl|my_center|LOCUS_57380 23797 23114 gene locus_tag LOCUS_57390 23797 23114 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114326.1 protein_id gnl|my_center|LOCUS_57390 26254 23867 gene locus_tag LOCUS_57400 gene ladS 26254 23867 CDS product hybrid sensor histidine kinase/response regulator LadS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 protein_id gnl|my_center|LOCUS_57400 26492 27262 gene locus_tag LOCUS_57410 26492 27262 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 protein_id gnl|my_center|LOCUS_57410 27273 27902 gene locus_tag LOCUS_57420 gene thiE 27273 27902 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093148.1 protein_id gnl|my_center|LOCUS_57420 27940 29223 gene locus_tag LOCUS_57430 gene hemL 27940 29223 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093150.1 protein_id gnl|my_center|LOCUS_57430 29432 29980 gene locus_tag LOCUS_57440 29432 29980 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093155.1 protein_id gnl|my_center|LOCUS_57440 30328 29996 gene locus_tag LOCUS_57450 30328 29996 CDS product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 protein_id gnl|my_center|LOCUS_57450 30457 31797 gene locus_tag LOCUS_57460 gene miaB 30457 31797 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093158.1 protein_id gnl|my_center|LOCUS_57460 31966 32988 gene locus_tag LOCUS_57470 31966 32988 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093159.1 protein_id gnl|my_center|LOCUS_57470 32978 33460 gene locus_tag LOCUS_57480 gene ybeY 32978 33460 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093160.1 protein_id gnl|my_center|LOCUS_57480 33457 34296 gene locus_tag LOCUS_57490 33457 34296 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 protein_id gnl|my_center|LOCUS_57490 34482 36017 gene locus_tag LOCUS_57500 gene lnt 34482 36017 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118259.1 protein_id gnl|my_center|LOCUS_57500 36828 36067 gene locus_tag LOCUS_57510 36828 36067 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100328.1 protein_id gnl|my_center|LOCUS_57510 37332 36901 gene locus_tag LOCUS_57520 37332 36901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114329.1 protein_id gnl|my_center|LOCUS_57520 37503 40124 gene locus_tag LOCUS_57530 gene leuS 37503 40124 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100324.1 protein_id gnl|my_center|LOCUS_57530 40191 40814 gene locus_tag LOCUS_57540 gene lptE 40191 40814 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100322.1 protein_id gnl|my_center|LOCUS_57540 40852 41889 gene locus_tag LOCUS_57550 gene holA 40852 41889 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114330.1 protein_id gnl|my_center|LOCUS_57550 41981 42133 gene locus_tag LOCUS_57560 41981 42133 CDS product alternative ribosome-rescue factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093169.1 protein_id gnl|my_center|LOCUS_57560 42641 42249 gene locus_tag LOCUS_57570 42641 42249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57570 42709 44055 gene locus_tag LOCUS_57580 42709 44055 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114332.1 protein_id gnl|my_center|LOCUS_57580 45055 44165 gene locus_tag LOCUS_57590 45055 44165 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114092.1 protein_id gnl|my_center|LOCUS_57590 45151 46056 gene locus_tag LOCUS_57600 45151 46056 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119197.1 protein_id gnl|my_center|LOCUS_57600 47185 46202 gene locus_tag LOCUS_57610 gene lipA 47185 46202 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119196.1 protein_id gnl|my_center|LOCUS_57610 47835 47182 gene locus_tag LOCUS_57620 gene lipB 47835 47182 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093177.1 protein_id gnl|my_center|LOCUS_57620 48116 47835 gene locus_tag LOCUS_57630 48116 47835 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100311.1 protein_id gnl|my_center|LOCUS_57630 49266 48187 gene locus_tag LOCUS_57640 49266 48187 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_57640 50441 49413 gene locus_tag LOCUS_57650 gene rlpA 50441 49413 CDS product septal ring lytic transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100310.1 protein_id gnl|my_center|LOCUS_57650 51448 50438 gene locus_tag LOCUS_57660 gene mltB 51448 50438 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132500.1 protein_id gnl|my_center|LOCUS_57660 52614 51469 gene locus_tag LOCUS_57670 gene rodA 52614 51469 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114090.1 protein_id gnl|my_center|LOCUS_57670 54544 52604 gene locus_tag LOCUS_57680 gene mrdA 54544 52604 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_57680 55024 54557 gene locus_tag LOCUS_57690 gene rlmH 55024 54557 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093193.1 protein_id gnl|my_center|LOCUS_57690 55388 55032 gene locus_tag LOCUS_57700 gene rsfS 55388 55032 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100305.1 protein_id gnl|my_center|LOCUS_57700 56055 55411 gene locus_tag LOCUS_57710 gene nadD 56055 55411 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093199.1 protein_id gnl|my_center|LOCUS_57710 57320 56055 gene locus_tag LOCUS_57720 57320 56055 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 protein_id gnl|my_center|LOCUS_57720 57618 58841 gene locus_tag LOCUS_57730 57618 58841 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114088.1 protein_id gnl|my_center|LOCUS_57730 59706 58849 gene locus_tag LOCUS_57740 59706 58849 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093206.1 protein_id gnl|my_center|LOCUS_57740 59770 60489 gene locus_tag LOCUS_57750 59770 60489 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148099.1 protein_id gnl|my_center|LOCUS_57750 60486 61799 gene locus_tag LOCUS_57760 60486 61799 CDS product bifunctional DedA family/phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100297.1 protein_id gnl|my_center|LOCUS_57760 62403 61810 gene locus_tag LOCUS_57770 62403 61810 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093212.1 protein_id gnl|my_center|LOCUS_57770 63133 62423 gene locus_tag LOCUS_57780 63133 62423 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114086.1 protein_id gnl|my_center|LOCUS_57780 63495 63133 gene locus_tag LOCUS_57790 63495 63133 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122011.1 protein_id gnl|my_center|LOCUS_57790 63808 63566 gene locus_tag LOCUS_57800 63808 63566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57800 63689 64144 gene locus_tag LOCUS_57810 63689 64144 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093220.1 protein_id gnl|my_center|LOCUS_57810 64334 66073 gene locus_tag LOCUS_57820 64334 66073 CDS product C13 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114085.1 protein_id gnl|my_center|LOCUS_57820 66120 66761 gene locus_tag LOCUS_57830 66120 66761 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100290.1 protein_id gnl|my_center|LOCUS_57830 67056 66781 gene locus_tag LOCUS_57840 67056 66781 CDS product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114084.1 protein_id gnl|my_center|LOCUS_57840 67687 67058 gene locus_tag LOCUS_57850 gene ubiX 67687 67058 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093227.1 protein_id gnl|my_center|LOCUS_57850 69051 67696 gene locus_tag LOCUS_57860 gene mpl 69051 67696 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093229.1 protein_id gnl|my_center|LOCUS_57860 71092 69209 gene locus_tag LOCUS_57870 gene eatR 71092 69209 CDS product sigma-54-dependent transcriptional regulator EatR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114083.1 protein_id gnl|my_center|LOCUS_57870 70998 71216 gene locus_tag LOCUS_57880 70998 71216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57880 >Feature sequence31 313 1722 gene locus_tag LOCUS_57890 313 1722 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113084.1 protein_id gnl|my_center|LOCUS_57890 1816 2937 gene locus_tag LOCUS_57900 gene gcvT 1816 2937 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113083.1 protein_id gnl|my_center|LOCUS_57900 3687 2983 gene locus_tag LOCUS_57910 3687 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119384.1 protein_id gnl|my_center|LOCUS_57910 4817 3855 gene locus_tag LOCUS_57920 4817 3855 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113080.1 protein_id gnl|my_center|LOCUS_57920 5505 7505 gene locus_tag LOCUS_57930 5505 7505 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113078.1 protein_id gnl|my_center|LOCUS_57930 7517 8566 gene locus_tag LOCUS_57940 7517 8566 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113077.1 protein_id gnl|my_center|LOCUS_57940 8563 9603 gene locus_tag LOCUS_57950 8563 9603 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113076.1 protein_id gnl|my_center|LOCUS_57950 9757 10191 gene locus_tag LOCUS_57960 9757 10191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089693.1 protein_id gnl|my_center|LOCUS_57960 10220 12205 gene locus_tag LOCUS_57970 10220 12205 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113075.1 protein_id gnl|my_center|LOCUS_57970 12202 12747 gene locus_tag LOCUS_57980 12202 12747 CDS product DUF4946 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102966.1 protein_id gnl|my_center|LOCUS_57980 13152 12883 gene locus_tag LOCUS_57990 13152 12883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089681.1 protein_id gnl|my_center|LOCUS_57990 14181 13267 gene locus_tag LOCUS_58000 14181 13267 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089677.1 protein_id gnl|my_center|LOCUS_58000 14582 16756 gene locus_tag LOCUS_58010 14582 16756 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113074.1 protein_id gnl|my_center|LOCUS_58010 16746 16955 gene locus_tag LOCUS_58020 16746 16955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58020 16952 17956 gene locus_tag LOCUS_58030 16952 17956 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113071.1 protein_id gnl|my_center|LOCUS_58030 18238 17993 gene locus_tag LOCUS_58040 18238 17993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113070.1 protein_id gnl|my_center|LOCUS_58040 18500 19414 gene locus_tag LOCUS_58050 gene ppk2 18500 19414 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089666.1 protein_id gnl|my_center|LOCUS_58050 19501 19968 gene locus_tag LOCUS_58060 19501 19968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113069.1 protein_id gnl|my_center|LOCUS_58060 20548 19985 gene locus_tag LOCUS_58070 gene pvdS 20548 19985 CDS product pyoverdine signaling pathway sigma factor PvdS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113068.1 protein_id gnl|my_center|LOCUS_58070 21192 21956 gene locus_tag LOCUS_58080 gene pvdG 21192 21956 CDS product pyoverdine biosynthesis thioesterase PvdG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113067.1 protein_id gnl|my_center|LOCUS_58080 22029 35063 gene locus_tag LOCUS_58090 gene pvdL 22029 35063 CDS product pyoverdine non-ribosomal peptide synthetase/polyketide synthase PvdL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115540.1 protein_id gnl|my_center|LOCUS_58090 35414 35256 gene locus_tag LOCUS_58100 35414 35256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58100 36061 35549 gene locus_tag LOCUS_58110 36061 35549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58110 36456 37143 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcactgccgtataggcagctaagaaa 37831 37268 gene locus_tag LOCUS_58120 gene cas6f 37831 37268 CDS product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211866.1 protein_id gnl|my_center|LOCUS_58120 38863 37835 gene locus_tag LOCUS_58130 gene csy3 38863 37835 CDS product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211867.1 protein_id gnl|my_center|LOCUS_58130 39857 38874 gene locus_tag LOCUS_58140 gene csy2 39857 38874 CDS product type I-F CRISPR-associated protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211868.1 protein_id gnl|my_center|LOCUS_58140 41148 39844 gene locus_tag LOCUS_58150 gene csy1 41148 39844 CDS product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222491.1 protein_id gnl|my_center|LOCUS_58150 44436 41206 gene locus_tag LOCUS_58160 gene cas3f 44436 41206 CDS product type I-F CRISPR-associated helicase Cas3f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221142.1 protein_id gnl|my_center|LOCUS_58160 45407 44433 gene locus_tag LOCUS_58170 gene cas1f 45407 44433 CDS product type I-F CRISPR-associated endonuclease Cas1f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210191.1 protein_id gnl|my_center|LOCUS_58170 45669 46836 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttcttagctgcctacacggcagtgaac 47421 47107 gene locus_tag LOCUS_58180 47421 47107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113065.1 protein_id gnl|my_center|LOCUS_58180 47566 47414 gene locus_tag LOCUS_58190 47566 47414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58190 48816 47896 gene locus_tag LOCUS_58200 48816 47896 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113064.1 protein_id gnl|my_center|LOCUS_58200 50268 48850 gene locus_tag LOCUS_58210 50268 48850 CDS product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122368.1 protein_id gnl|my_center|LOCUS_58210 51035 50349 gene locus_tag LOCUS_58220 51035 50349 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111283.1 protein_id gnl|my_center|LOCUS_58220 51987 51127 gene locus_tag LOCUS_58230 51987 51127 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089646.1 protein_id gnl|my_center|LOCUS_58230 52088 53011 gene locus_tag LOCUS_58240 52088 53011 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113062.1 protein_id gnl|my_center|LOCUS_58240 53549 53974 gene locus_tag LOCUS_58250 53549 53974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113060.1 protein_id gnl|my_center|LOCUS_58250 53967 55286 gene locus_tag LOCUS_58260 53967 55286 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113059.1 protein_id gnl|my_center|LOCUS_58260 55465 56874 gene locus_tag LOCUS_58270 55465 56874 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089638.1 protein_id gnl|my_center|LOCUS_58270 56952 57170 gene locus_tag LOCUS_58280 56952 57170 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089636.1 protein_id gnl|my_center|LOCUS_58280 57171 57935 gene locus_tag LOCUS_58290 57171 57935 CDS product thioesterase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113058.1 protein_id gnl|my_center|LOCUS_58290 58952 58035 gene locus_tag LOCUS_58300 58952 58035 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113057.1 protein_id gnl|my_center|LOCUS_58300 59854 58949 gene locus_tag LOCUS_58310 59854 58949 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106903.1 protein_id gnl|my_center|LOCUS_58310 60606 59851 gene locus_tag LOCUS_58320 60606 59851 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113056.1 protein_id gnl|my_center|LOCUS_58320 61556 60603 gene locus_tag LOCUS_58330 61556 60603 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113055.1 protein_id gnl|my_center|LOCUS_58330 62149 61589 gene locus_tag LOCUS_58340 62149 61589 CDS product DUF6162 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089625.1 protein_id gnl|my_center|LOCUS_58340 62475 62146 gene locus_tag LOCUS_58350 62475 62146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089624.1 protein_id gnl|my_center|LOCUS_58350 63011 62472 gene locus_tag LOCUS_58360 63011 62472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111932.1 protein_id gnl|my_center|LOCUS_58360 64219 63008 gene locus_tag LOCUS_58370 64219 63008 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106912.1 protein_id gnl|my_center|LOCUS_58370 >Feature sequence32 3538 464 gene locus_tag LOCUS_58380 gene dnaE2 3538 464 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895514.1 protein_id gnl|my_center|LOCUS_58380 4950 3535 gene locus_tag LOCUS_58390 4950 3535 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112733.1 protein_id gnl|my_center|LOCUS_58390 5629 4958 gene locus_tag LOCUS_58400 gene imuA 5629 4958 CDS product translesion DNA synthesis-associated protein ImuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112732.1 protein_id gnl|my_center|LOCUS_58400 5815 6411 gene locus_tag LOCUS_58410 gene pigA 5815 6411 CDS product biliverdin-producing heme oxygenase PigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085321.1 protein_id gnl|my_center|LOCUS_58410 6849 6529 gene locus_tag LOCUS_58420 6849 6529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112731.1 protein_id gnl|my_center|LOCUS_58420 7048 7731 gene locus_tag LOCUS_58430 gene vreA 7048 7731 CDS product TonB-dependent outer membrane receptor VreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120815.1 protein_id gnl|my_center|LOCUS_58430 7728 8273 gene locus_tag LOCUS_58440 gene vreI 7728 8273 CDS product RNA polymerase sigma factor VreI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085329.1 protein_id gnl|my_center|LOCUS_58440 8343 9302 gene locus_tag LOCUS_58450 gene vreR 8343 9302 CDS product anti-sigma factor VreR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106396.1 protein_id gnl|my_center|LOCUS_58450 9953 9312 gene locus_tag LOCUS_58460 9953 9312 CDS product type II secretion system protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112729.1 protein_id gnl|my_center|LOCUS_58460 10386 9937 gene locus_tag LOCUS_58470 gene gspH 10386 9937 CDS product type II secretion system minor pseudopilin GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112728.1 protein_id gnl|my_center|LOCUS_58470 10533 10964 gene locus_tag LOCUS_58480 10533 10964 CDS product type II secretion system protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112727.1 protein_id gnl|my_center|LOCUS_58480 11497 10967 gene locus_tag LOCUS_58490 11497 10967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58490 11575 12024 gene locus_tag LOCUS_58500 gene gspG 11575 12024 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085349.1 protein_id gnl|my_center|LOCUS_58500 12032 12997 gene locus_tag LOCUS_58510 gene gspK 12032 12997 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112726.1 protein_id gnl|my_center|LOCUS_58510 12994 14205 gene locus_tag LOCUS_58520 12994 14205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58520 14192 14785 gene locus_tag LOCUS_58530 gene gspM 14192 14785 CDS product type II secretion system protein GspM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112724.1 protein_id gnl|my_center|LOCUS_58530 14782 17193 gene locus_tag LOCUS_58540 gene gspD 14782 17193 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009315212.1 protein_id gnl|my_center|LOCUS_58540 17190 18599 gene locus_tag LOCUS_58550 gene gspE 17190 18599 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112722.1 protein_id gnl|my_center|LOCUS_58550 18599 19813 gene locus_tag LOCUS_58560 gene gspF 18599 19813 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112721.1 protein_id gnl|my_center|LOCUS_58560 20327 21433 gene locus_tag LOCUS_58570 gene lapA 20327 21433 CDS product alkaline phosphatase LapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112123.1 protein_id gnl|my_center|LOCUS_58570 21519 22631 gene locus_tag LOCUS_58580 21519 22631 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112720.1 protein_id gnl|my_center|LOCUS_58580 22793 35356 gene locus_tag LOCUS_58590 22793 35356 CDS product filamentous hemagglutinin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147216.1 protein_id gnl|my_center|LOCUS_58590 35749 36351 gene locus_tag LOCUS_58600 35749 36351 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098455.1 protein_id gnl|my_center|LOCUS_58600 36515 38149 gene locus_tag LOCUS_58610 36515 38149 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112718.1 protein_id gnl|my_center|LOCUS_58610 38173 40020 gene locus_tag LOCUS_58620 38173 40020 CDS product DUF2341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112717.1 protein_id gnl|my_center|LOCUS_58620 40031 40450 gene locus_tag LOCUS_58630 40031 40450 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085366.1 protein_id gnl|my_center|LOCUS_58630 40459 41205 gene locus_tag LOCUS_58640 40459 41205 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098450.1 protein_id gnl|my_center|LOCUS_58640 41273 42979 gene locus_tag LOCUS_58650 41273 42979 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112715.1 protein_id gnl|my_center|LOCUS_58650 43014 43676 gene locus_tag LOCUS_58660 43014 43676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085372.1 protein_id gnl|my_center|LOCUS_58660 43705 44184 gene locus_tag LOCUS_58670 43705 44184 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085375.1 protein_id gnl|my_center|LOCUS_58670 44189 45133 gene locus_tag LOCUS_58680 44189 45133 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098445.1 protein_id gnl|my_center|LOCUS_58680 45133 45558 gene locus_tag LOCUS_58690 45133 45558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110838.1 protein_id gnl|my_center|LOCUS_58690 45568 46554 gene locus_tag LOCUS_58700 45568 46554 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098443.1 protein_id gnl|my_center|LOCUS_58700 46626 47291 gene locus_tag LOCUS_58710 46626 47291 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085387.1 protein_id gnl|my_center|LOCUS_58710 48179 47274 gene locus_tag LOCUS_58720 48179 47274 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085391.1 protein_id gnl|my_center|LOCUS_58720 49574 48258 gene locus_tag LOCUS_58730 49574 48258 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112713.1 protein_id gnl|my_center|LOCUS_58730 51039 49645 gene locus_tag LOCUS_58740 51039 49645 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112712.1 protein_id gnl|my_center|LOCUS_58740 52066 51167 gene locus_tag LOCUS_58750 gene migA 52066 51167 CDS product alpha-1,6-rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112710.1 protein_id gnl|my_center|LOCUS_58750 52959 52321 gene locus_tag LOCUS_58760 gene catB 52959 52321 CDS product type B-4 chloramphenicol O-acetyltransferase CatB7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112709.1 protein_id gnl|my_center|LOCUS_58760 53801 53052 gene locus_tag LOCUS_58770 gene toxR 53801 53052 CDS product toxA transcriptional regulator ToxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010793844.1 protein_id gnl|my_center|LOCUS_58770 54971 54117 gene locus_tag LOCUS_58780 54971 54117 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112707.1 protein_id gnl|my_center|LOCUS_58780 55087 55383 gene locus_tag LOCUS_58790 55087 55383 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085421.1 protein_id gnl|my_center|LOCUS_58790 55428 55823 gene locus_tag LOCUS_58800 gene gloA 55428 55823 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112706.1 protein_id gnl|my_center|LOCUS_58800 56373 55867 gene locus_tag LOCUS_58810 56373 55867 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112705.1 protein_id gnl|my_center|LOCUS_58810 56690 56433 gene locus_tag LOCUS_58820 56690 56433 CDS product YjhX family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085431.1 protein_id gnl|my_center|LOCUS_58820 57029 57322 gene locus_tag LOCUS_58830 57029 57322 CDS product DUF2845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003141121.1 protein_id gnl|my_center|LOCUS_58830 57608 58030 gene locus_tag LOCUS_58840 57608 58030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895516.1 protein_id gnl|my_center|LOCUS_58840 59007 58315 gene locus_tag LOCUS_58850 59007 58315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58850 59603 59079 gene locus_tag LOCUS_58860 59603 59079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58860 59602 59817 gene locus_tag LOCUS_58870 59602 59817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58870 59819 60031 gene locus_tag LOCUS_58880 59819 60031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58880 60035 60325 gene locus_tag LOCUS_58890 60035 60325 CDS product DUF5447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895517.1 protein_id gnl|my_center|LOCUS_58890 60841 61275 gene locus_tag LOCUS_58900 60841 61275 CDS product phage destabilizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115132.1 protein_id gnl|my_center|LOCUS_58900 61396 61647 gene locus_tag LOCUS_58910 61396 61647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115979.1 protein_id gnl|my_center|LOCUS_58910 >Feature sequence33 377 571 gene locus_tag LOCUS_58920 377 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58920 782 949 gene locus_tag LOCUS_58930 782 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58930 1159 1554 gene locus_tag LOCUS_58940 1159 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114584.1 protein_id gnl|my_center|LOCUS_58940 1828 1568 gene locus_tag LOCUS_58950 1828 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58950 3078 1825 gene locus_tag LOCUS_58960 3078 1825 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003128157.1 protein_id gnl|my_center|LOCUS_58960 3398 4771 gene locus_tag LOCUS_58970 gene exoT 3398 4771 CDS product T3SS effector bifunctional cytotoxin exoenzyme T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114583.1 protein_id gnl|my_center|LOCUS_58970 5267 5953 gene locus_tag LOCUS_58980 5267 5953 CDS product CsgG/HfaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111706.1 protein_id gnl|my_center|LOCUS_58980 5984 6337 gene locus_tag LOCUS_58990 5984 6337 CDS product DUF4810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083569.1 protein_id gnl|my_center|LOCUS_58990 6334 6999 gene locus_tag LOCUS_59000 6334 6999 CDS product DUF799 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118560.1 protein_id gnl|my_center|LOCUS_59000 7397 7014 gene locus_tag LOCUS_59010 7397 7014 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083575.1 protein_id gnl|my_center|LOCUS_59010 9340 7679 gene locus_tag LOCUS_59020 9340 7679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114581.1 protein_id gnl|my_center|LOCUS_59020 10915 12747 gene locus_tag LOCUS_59030 gene asnB 10915 12747 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114665.1 protein_id gnl|my_center|LOCUS_59030 13228 12800 gene locus_tag LOCUS_59040 13228 12800 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083588.1 protein_id gnl|my_center|LOCUS_59040 13495 13665 gene locus_tag LOCUS_59050 13495 13665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59050 13668 14138 gene locus_tag LOCUS_59060 13668 14138 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963896.1 protein_id gnl|my_center|LOCUS_59060 14703 14155 gene locus_tag LOCUS_59070 14703 14155 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111523.1 protein_id gnl|my_center|LOCUS_59070 15248 14742 gene locus_tag LOCUS_59080 15248 14742 CDS product DUF1993 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083593.1 protein_id gnl|my_center|LOCUS_59080 16234 15314 gene locus_tag LOCUS_59090 gene osaR 16234 15314 CDS product oxidative stress response transcriptional regulator OsaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083596.1 protein_id gnl|my_center|LOCUS_59090 16342 17229 gene locus_tag LOCUS_59100 16342 17229 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083599.1 protein_id gnl|my_center|LOCUS_59100 17292 17996 gene locus_tag LOCUS_59110 gene dsbM 17292 17996 CDS product disulfide reductase DsbM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114663.1 protein_id gnl|my_center|LOCUS_59110 18110 18535 gene locus_tag LOCUS_59120 18110 18535 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118563.1 protein_id gnl|my_center|LOCUS_59120 18646 18879 gene locus_tag LOCUS_59130 18646 18879 CDS product DUF1161 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114662.1 protein_id gnl|my_center|LOCUS_59130 19328 18891 gene locus_tag LOCUS_59140 19328 18891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083612.1 protein_id gnl|my_center|LOCUS_59140 19801 19385 gene locus_tag LOCUS_59150 19801 19385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083614.1 protein_id gnl|my_center|LOCUS_59150 20010 21020 gene locus_tag LOCUS_59160 20010 21020 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118564.1 protein_id gnl|my_center|LOCUS_59160 22011 21028 gene locus_tag LOCUS_59170 22011 21028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114660.1 protein_id gnl|my_center|LOCUS_59170 22709 22044 gene locus_tag LOCUS_59180 22709 22044 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114659.1 protein_id gnl|my_center|LOCUS_59180 23244 22702 gene locus_tag LOCUS_59190 23244 22702 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083618.1 protein_id gnl|my_center|LOCUS_59190 23322 25367 gene locus_tag LOCUS_59200 gene prlC 23322 25367 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114658.1 protein_id gnl|my_center|LOCUS_59200 25364 25639 gene locus_tag LOCUS_59210 25364 25639 CDS product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083624.1 protein_id gnl|my_center|LOCUS_59210 25728 26786 gene locus_tag LOCUS_59220 25728 26786 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083628.1 protein_id gnl|my_center|LOCUS_59220 27930 27016 gene locus_tag LOCUS_59230 gene tagQ 27930 27016 CDS product type VI secretion system-associated lipoprotein TagQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106614.1 protein_id gnl|my_center|LOCUS_59230 29704 27992 gene locus_tag LOCUS_59240 gene tagR 29704 27992 CDS product type VI secretion system-associated regulator TagR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106615.1 protein_id gnl|my_center|LOCUS_59240 30896 29697 gene locus_tag LOCUS_59250 gene tagS 30896 29697 CDS product type IV secretion associated ABC transporter permease TagS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083634.1 protein_id gnl|my_center|LOCUS_59250 31615 30896 gene locus_tag LOCUS_59260 gene tagT 31615 30896 CDS product type IV secretion associated ABC transporter ATP-binding protein TagT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114657.1 protein_id gnl|my_center|LOCUS_59260 34710 31612 gene locus_tag LOCUS_59270 gene ppkA 34710 31612 CDS product serine/threonine protein kinase PpkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147051.1 protein_id gnl|my_center|LOCUS_59270 35446 34718 gene locus_tag LOCUS_59280 gene pppA 35446 34718 CDS product serine/threonine phosphatase PppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106965.1 protein_id gnl|my_center|LOCUS_59280 36136 35456 gene locus_tag LOCUS_59290 gene tagF 36136 35456 CDS product type VI secretion system-associated protein TagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106966.1 protein_id gnl|my_center|LOCUS_59290 39663 36133 gene locus_tag LOCUS_59300 gene tssM 39663 36133 CDS product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895493.1 protein_id gnl|my_center|LOCUS_59300 41009 39660 gene locus_tag LOCUS_59310 41009 39660 CDS product DotU family type VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115051.1 protein_id gnl|my_center|LOCUS_59310 42350 41016 gene locus_tag LOCUS_59320 gene tssK 42350 41016 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115052.1 protein_id gnl|my_center|LOCUS_59320 42830 42366 gene locus_tag LOCUS_59330 gene tssJ 42830 42366 CDS product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083660.1 protein_id gnl|my_center|LOCUS_59330 44386 42875 gene locus_tag LOCUS_59340 gene tagH 44386 42875 CDS product type VI secretion system-associated FHA domain protein TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147054.1 protein_id gnl|my_center|LOCUS_59340 44754 45788 gene locus_tag LOCUS_59350 gene tssA 44754 45788 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115054.1 protein_id gnl|my_center|LOCUS_59350 45877 46395 gene locus_tag LOCUS_59360 gene tssB 45877 46395 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083666.1 protein_id gnl|my_center|LOCUS_59360 46408 47904 gene locus_tag LOCUS_59370 gene tssC 46408 47904 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111626.1 protein_id gnl|my_center|LOCUS_59370 47980 48468 gene locus_tag LOCUS_59380 gene hcp 47980 48468 CDS product type VI secretion system receptor/chaperone Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083670.1 protein_id gnl|my_center|LOCUS_59380 48696 49481 gene locus_tag LOCUS_59390 gene tagJ 48696 49481 CDS product type VI secretion system accessory protein TagJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119488.1 protein_id gnl|my_center|LOCUS_59390 49483 49992 gene locus_tag LOCUS_59400 gene tssE 49483 49992 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104971.1 protein_id gnl|my_center|LOCUS_59400 50025 51848 gene locus_tag LOCUS_59410 gene tssF 50025 51848 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115055.1 protein_id gnl|my_center|LOCUS_59410 51812 52858 gene locus_tag LOCUS_59420 gene tssG 51812 52858 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104969.1 protein_id gnl|my_center|LOCUS_59420 52851 55559 gene locus_tag LOCUS_59430 gene tssH 52851 55559 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115056.1 protein_id gnl|my_center|LOCUS_59430 55597 57537 gene locus_tag LOCUS_59440 gene vgrG1a 55597 57537 CDS product type VI secretion system spike protein VgrG1a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895494.1 protein_id gnl|my_center|LOCUS_59440 57936 57652 gene locus_tag LOCUS_59450 57936 57652 CDS product immunity protein Tsi6 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104961.1 protein_id gnl|my_center|LOCUS_59450 58182 57949 gene locus_tag LOCUS_59460 58182 57949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59460 59554 58172 gene locus_tag LOCUS_59470 59554 58172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59470 60004 59570 gene locus_tag LOCUS_59480 gene eagT6 60004 59570 CDS product type VI secretion system effector EagT6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083692.1 protein_id gnl|my_center|LOCUS_59480 >Feature sequence34 866 1576 gene locus_tag LOCUS_59490 866 1576 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113515.1 protein_id gnl|my_center|LOCUS_59490 1561 1872 gene locus_tag LOCUS_59500 1561 1872 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088669.1 protein_id gnl|my_center|LOCUS_59500 2115 3773 gene locus_tag LOCUS_59510 2115 3773 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113513.1 protein_id gnl|my_center|LOCUS_59510 4455 3781 gene locus_tag LOCUS_59520 4455 3781 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100350.1 protein_id gnl|my_center|LOCUS_59520 5363 4455 gene locus_tag LOCUS_59530 5363 4455 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100352.1 protein_id gnl|my_center|LOCUS_59530 6922 5498 gene locus_tag LOCUS_59540 6922 5498 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088661.1 protein_id gnl|my_center|LOCUS_59540 7102 7356 gene locus_tag LOCUS_59550 7102 7356 CDS product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100355.1 protein_id gnl|my_center|LOCUS_59550 7353 7610 gene locus_tag LOCUS_59560 7353 7610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100357.1 protein_id gnl|my_center|LOCUS_59560 7984 7685 gene locus_tag LOCUS_59570 7984 7685 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113511.1 protein_id gnl|my_center|LOCUS_59570 8481 8008 gene locus_tag LOCUS_59580 8481 8008 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100361.1 protein_id gnl|my_center|LOCUS_59580 8614 9006 gene locus_tag LOCUS_59590 8614 9006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088646.1 protein_id gnl|my_center|LOCUS_59590 9160 10161 gene locus_tag LOCUS_59600 9160 10161 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100363.1 protein_id gnl|my_center|LOCUS_59600 11571 10216 gene locus_tag LOCUS_59610 gene gorA 11571 10216 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100366.1 protein_id gnl|my_center|LOCUS_59610 11716 12138 gene locus_tag LOCUS_59620 11716 12138 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100368.1 protein_id gnl|my_center|LOCUS_59620 13158 12319 gene locus_tag LOCUS_59630 gene galU 13158 12319 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088639.1 protein_id gnl|my_center|LOCUS_59630 14567 13206 gene locus_tag LOCUS_59640 14567 13206 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113510.1 protein_id gnl|my_center|LOCUS_59640 14721 14945 gene locus_tag LOCUS_59650 14721 14945 CDS product DUF3203 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100372.1 protein_id gnl|my_center|LOCUS_59650 15583 14951 gene locus_tag LOCUS_59660 gene amrR 15583 14951 CDS product TetR family transcriptional regulator AmrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088626.1 protein_id gnl|my_center|LOCUS_59660 15748 16938 gene locus_tag LOCUS_59670 gene mexX 15748 16938 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MexX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113509.1 protein_id gnl|my_center|LOCUS_59670 16954 20091 gene locus_tag LOCUS_59680 gene mexY 16954 20091 CDS product multidrug efflux RND transporter permease subunit MexY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113508.1 protein_id gnl|my_center|LOCUS_59680 20091 20309 gene locus_tag LOCUS_59690 20091 20309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59690 21261 20332 gene locus_tag LOCUS_59700 21261 20332 CDS product YjiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088602.1 protein_id gnl|my_center|LOCUS_59700 21454 21858 gene locus_tag LOCUS_59710 gene liuR 21454 21858 CDS product liu genes transcriptional regulator LiuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100383.1 protein_id gnl|my_center|LOCUS_59710 21907 23070 gene locus_tag LOCUS_59720 gene liuA 21907 23070 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100385.1 protein_id gnl|my_center|LOCUS_59720 23193 24800 gene locus_tag LOCUS_59730 gene liuB 23193 24800 CDS product methylcrotonyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100387.1 protein_id gnl|my_center|LOCUS_59730 24814 25611 gene locus_tag LOCUS_59740 24814 25611 CDS product gamma-carboxygeranoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088598.1 protein_id gnl|my_center|LOCUS_59740 25608 27575 gene locus_tag LOCUS_59750 gene liuD 25608 27575 CDS product methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113506.1 protein_id gnl|my_center|LOCUS_59750 27596 28498 gene locus_tag LOCUS_59760 gene liuE 27596 28498 CDS product bifunctional 3-hydroxy-3-isohexenylglutaryl-CoA lyase/hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088593.1 protein_id gnl|my_center|LOCUS_59760 29369 28566 gene locus_tag LOCUS_59770 29369 28566 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111362.1 protein_id gnl|my_center|LOCUS_59770 29530 30828 gene locus_tag LOCUS_59780 gene hmgA 29530 30828 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100397.1 protein_id gnl|my_center|LOCUS_59780 30833 32131 gene locus_tag LOCUS_59790 gene fahA 30833 32131 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100400.1 protein_id gnl|my_center|LOCUS_59790 32128 32766 gene locus_tag LOCUS_59800 gene maiA 32128 32766 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113505.1 protein_id gnl|my_center|LOCUS_59800 32851 34203 gene locus_tag LOCUS_59810 32851 34203 CDS product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113504.1 protein_id gnl|my_center|LOCUS_59810 34272 35717 gene locus_tag LOCUS_59820 gene hbcR 34272 35717 CDS product sigma-54-dependent transcriptional regulator HbcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113503.1 protein_id gnl|my_center|LOCUS_59820 35979 37370 gene locus_tag LOCUS_59830 35979 37370 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113502.1 protein_id gnl|my_center|LOCUS_59830 37404 38174 gene locus_tag LOCUS_59840 gene bdhA 37404 38174 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113501.1 protein_id gnl|my_center|LOCUS_59840 39789 38365 gene locus_tag LOCUS_59850 39789 38365 CDS product TIGR00366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088572.1 protein_id gnl|my_center|LOCUS_59850 41183 40002 gene locus_tag LOCUS_59860 41183 40002 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113500.1 protein_id gnl|my_center|LOCUS_59860 41989 41333 gene locus_tag LOCUS_59870 41989 41333 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088567.1 protein_id gnl|my_center|LOCUS_59870 42722 42024 gene locus_tag LOCUS_59880 42722 42024 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088566.1 protein_id gnl|my_center|LOCUS_59880 42854 43774 gene locus_tag LOCUS_59890 42854 43774 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100419.1 protein_id gnl|my_center|LOCUS_59890 43842 45797 gene locus_tag LOCUS_59900 43842 45797 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113499.1 protein_id gnl|my_center|LOCUS_59900 45855 46133 gene locus_tag LOCUS_59910 45855 46133 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088559.1 protein_id gnl|my_center|LOCUS_59910 46152 46508 gene locus_tag LOCUS_59920 46152 46508 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113498.1 protein_id gnl|my_center|LOCUS_59920 46505 47068 gene locus_tag LOCUS_59930 46505 47068 CDS product putative glycolipid-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088555.1 protein_id gnl|my_center|LOCUS_59930 47193 48401 gene locus_tag LOCUS_59940 47193 48401 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113497.1 protein_id gnl|my_center|LOCUS_59940 50128 48434 gene locus_tag LOCUS_59950 50128 48434 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106469.1 protein_id gnl|my_center|LOCUS_59950 51287 50112 gene locus_tag LOCUS_59960 51287 50112 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088548.1 protein_id gnl|my_center|LOCUS_59960 53187 51361 gene locus_tag LOCUS_59970 53187 51361 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113496.1 protein_id gnl|my_center|LOCUS_59970 54304 53192 gene locus_tag LOCUS_59980 gene pqqE 54304 53192 CDS product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119136.1 protein_id gnl|my_center|LOCUS_59980 54587 54309 gene locus_tag LOCUS_59990 gene pqqD 54587 54309 CDS product pyrroloquinoline quinone biosynthesis peptide chaperone PqqD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088542.1 protein_id gnl|my_center|LOCUS_59990 55336 54584 gene locus_tag LOCUS_60000 gene pqqC 55336 54584 CDS product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111679.1 protein_id gnl|my_center|LOCUS_60000 56260 55346 gene locus_tag LOCUS_60010 gene pqqB 56260 55346 CDS product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113495.1 protein_id gnl|my_center|LOCUS_60010 >Feature sequence35 1071 52 gene locus_tag LOCUS_60020 1071 52 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975769.1 protein_id gnl|my_center|LOCUS_60020 1241 2179 gene locus_tag LOCUS_60030 gene dusA 1241 2179 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104050.1 protein_id gnl|my_center|LOCUS_60030 2259 3182 gene locus_tag LOCUS_60040 gene tal 2259 3182 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090868.1 protein_id gnl|my_center|LOCUS_60040 3752 3270 gene locus_tag LOCUS_60050 3752 3270 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104052.1 protein_id gnl|my_center|LOCUS_60050 4933 3749 gene locus_tag LOCUS_60060 4933 3749 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114778.1 protein_id gnl|my_center|LOCUS_60060 5180 5479 gene locus_tag LOCUS_60070 gene pilZ 5180 5479 CDS product cyclic di-GMP-binding protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104055.1 protein_id gnl|my_center|LOCUS_60070 6241 5537 gene locus_tag LOCUS_60080 6241 5537 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 protein_id gnl|my_center|LOCUS_60080 6344 6748 gene locus_tag LOCUS_60090 6344 6748 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114776.1 protein_id gnl|my_center|LOCUS_60090 7469 6750 gene locus_tag LOCUS_60100 7469 6750 CDS product UTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104061.1 protein_id gnl|my_center|LOCUS_60100 7603 8346 gene locus_tag LOCUS_60110 7603 8346 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114775.1 protein_id gnl|my_center|LOCUS_60110 8343 8924 gene locus_tag LOCUS_60120 8343 8924 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090877.1 protein_id gnl|my_center|LOCUS_60120 8998 9261 gene locus_tag LOCUS_60130 8998 9261 CDS product DUF4404 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090878.1 protein_id gnl|my_center|LOCUS_60130 10158 9328 gene locus_tag LOCUS_60140 gene queF 10158 9328 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114774.1 protein_id gnl|my_center|LOCUS_60140 10821 10276 gene locus_tag LOCUS_60150 10821 10276 CDS product plastocyanin/azurin family copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895638.1 protein_id gnl|my_center|LOCUS_60150 11256 11065 gene locus_tag LOCUS_60160 11256 11065 CDS product repressor PtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090881.1 protein_id gnl|my_center|LOCUS_60160 11382 12062 gene locus_tag LOCUS_60170 11382 12062 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098784.1 protein_id gnl|my_center|LOCUS_60170 12059 13390 gene locus_tag LOCUS_60180 12059 13390 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090883.1 protein_id gnl|my_center|LOCUS_60180 14219 13440 gene locus_tag LOCUS_60190 14219 13440 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090884.1 protein_id gnl|my_center|LOCUS_60190 15148 14216 gene locus_tag LOCUS_60200 15148 14216 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_60200 15844 15224 gene locus_tag LOCUS_60210 15844 15224 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108953.1 protein_id gnl|my_center|LOCUS_60210 16630 15959 gene locus_tag LOCUS_60220 16630 15959 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098789.1 protein_id gnl|my_center|LOCUS_60220 16783 19230 gene locus_tag LOCUS_60230 16783 19230 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108955.1 protein_id gnl|my_center|LOCUS_60230 19631 19368 gene locus_tag LOCUS_60240 19631 19368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60240 19602 19739 gene locus_tag LOCUS_60250 19602 19739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60250 19798 20208 gene locus_tag LOCUS_60260 19798 20208 CDS product PA2817 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090890.1 protein_id gnl|my_center|LOCUS_60260 20473 21198 gene locus_tag LOCUS_60270 20473 21198 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088801.1 protein_id gnl|my_center|LOCUS_60270 21264 21857 gene locus_tag LOCUS_60280 21264 21857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60280 21927 22169 gene locus_tag LOCUS_60290 21927 22169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60290 22200 22826 gene locus_tag LOCUS_60300 22200 22826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60300 22877 25018 gene locus_tag LOCUS_60310 22877 25018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60310 25029 25223 gene locus_tag LOCUS_60320 25029 25223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60320 25247 25486 gene locus_tag LOCUS_60330 25247 25486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60330 25540 26085 gene locus_tag LOCUS_60340 25540 26085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60340 26236 26556 gene locus_tag LOCUS_60350 26236 26556 CDS product RebB family R body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038031.1 protein_id gnl|my_center|LOCUS_60350 26619 26939 gene locus_tag LOCUS_60360 26619 26939 CDS product RebB family R body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038031.1 protein_id gnl|my_center|LOCUS_60360 27223 27148 gene locus_tag LOCUS_t00600 27223 27148 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 27870 27697 gene locus_tag LOCUS_60370 27870 27697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60370 28110 28856 gene locus_tag LOCUS_60380 28110 28856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036990101.1 protein_id gnl|my_center|LOCUS_60380 28975 29187 gene locus_tag LOCUS_60390 28975 29187 CDS product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205185.1 protein_id gnl|my_center|LOCUS_60390 29230 30105 gene locus_tag LOCUS_60400 29230 30105 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018076212.1 protein_id gnl|my_center|LOCUS_60400 30089 30358 gene locus_tag LOCUS_60410 30089 30358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60410 30351 32036 gene locus_tag LOCUS_60420 30351 32036 CDS product ParB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150625513.1 protein_id gnl|my_center|LOCUS_60420 32051 32611 gene locus_tag LOCUS_60430 32051 32611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60430 32615 33853 gene locus_tag LOCUS_60440 32615 33853 CDS product STY4528 family pathogenicity island replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136258754.1 protein_id gnl|my_center|LOCUS_60440 34282 35079 gene locus_tag LOCUS_60450 34282 35079 CDS product TIGR03761 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038897.1 protein_id gnl|my_center|LOCUS_60450 35076 35603 gene locus_tag LOCUS_60460 35076 35603 CDS product DUF3158 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895541.1 protein_id gnl|my_center|LOCUS_60460 35677 36117 gene locus_tag LOCUS_60470 35677 36117 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013721963.1 protein_id gnl|my_center|LOCUS_60470 36395 38407 gene locus_tag LOCUS_60480 36395 38407 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038895.1 protein_id gnl|my_center|LOCUS_60480 38927 40534 gene locus_tag LOCUS_60490 38927 40534 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186448606.1 protein_id gnl|my_center|LOCUS_60490 40777 41334 gene locus_tag LOCUS_60500 40777 41334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60500 41666 41878 gene locus_tag LOCUS_60510 41666 41878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958171.1 protein_id gnl|my_center|LOCUS_60510 41900 42292 gene locus_tag LOCUS_60520 41900 42292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003141051.1 protein_id gnl|my_center|LOCUS_60520 42466 43152 gene locus_tag LOCUS_60530 42466 43152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60530 43233 43970 gene locus_tag LOCUS_60540 43233 43970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038892.1 protein_id gnl|my_center|LOCUS_60540 44068 44346 gene locus_tag LOCUS_60550 44068 44346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60550 44636 45448 gene locus_tag LOCUS_60560 44636 45448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054019012.1 protein_id gnl|my_center|LOCUS_60560 45573 45926 gene locus_tag LOCUS_60570 45573 45926 CDS product DUF3085 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097141722.1 protein_id gnl|my_center|LOCUS_60570 46295 47212 gene locus_tag LOCUS_60580 46295 47212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60580 47270 47959 gene locus_tag LOCUS_60590 47270 47959 CDS product DUF3275 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038889.1 protein_id gnl|my_center|LOCUS_60590 48053 48376 gene locus_tag LOCUS_60600 48053 48376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60600 48479 48886 gene locus_tag LOCUS_60610 48479 48886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60610 48903 49163 gene locus_tag LOCUS_60620 48903 49163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60620 49237 49887 gene locus_tag LOCUS_60630 49237 49887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267038.1 protein_id gnl|my_center|LOCUS_60630 49952 51061 gene locus_tag LOCUS_60640 49952 51061 CDS product DUF6094 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104230471.1 protein_id gnl|my_center|LOCUS_60640 51112 51432 gene locus_tag LOCUS_60650 51112 51432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024889622.1 protein_id gnl|my_center|LOCUS_60650 51523 51828 gene locus_tag LOCUS_60660 51523 51828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024889622.1 protein_id gnl|my_center|LOCUS_60660 51964 53019 gene locus_tag LOCUS_60670 51964 53019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60670 53616 55334 gene locus_tag LOCUS_60680 gene ltrA 53616 55334 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138832.1 protein_id gnl|my_center|LOCUS_60680 >Feature sequence36 586 1227 gene locus_tag LOCUS_60690 586 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114452.1 protein_id gnl|my_center|LOCUS_60690 1266 2348 gene locus_tag LOCUS_60700 1266 2348 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105702.1 protein_id gnl|my_center|LOCUS_60700 3761 6190 gene locus_tag LOCUS_60710 3761 6190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895704.1 protein_id gnl|my_center|LOCUS_60710 7284 6184 gene locus_tag LOCUS_60720 gene gbcB 7284 6184 CDS product glycine-betaine demethylase subunit GbcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096769.1 protein_id gnl|my_center|LOCUS_60720 7709 8998 gene locus_tag LOCUS_60730 gene gbcA 7709 8998 CDS product glycine-betaine demethylase subunit GbcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096766.1 protein_id gnl|my_center|LOCUS_60730 9273 9833 gene locus_tag LOCUS_60740 9273 9833 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096765.1 protein_id gnl|my_center|LOCUS_60740 9838 10014 gene locus_tag LOCUS_60750 9838 10014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096763.1 protein_id gnl|my_center|LOCUS_60750 10301 10011 gene locus_tag LOCUS_60760 10301 10011 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105708.1 protein_id gnl|my_center|LOCUS_60760 10552 10298 gene locus_tag LOCUS_60770 10552 10298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096758.1 protein_id gnl|my_center|LOCUS_60770 10860 10627 gene locus_tag LOCUS_60780 10860 10627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105712.1 protein_id gnl|my_center|LOCUS_60780 11278 10874 gene locus_tag LOCUS_60790 11278 10874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114450.1 protein_id gnl|my_center|LOCUS_60790 11516 11310 gene locus_tag LOCUS_60800 11516 11310 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096753.1 protein_id gnl|my_center|LOCUS_60800 12093 11524 gene locus_tag LOCUS_60810 12093 11524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096751.1 protein_id gnl|my_center|LOCUS_60810 12991 12218 gene locus_tag LOCUS_60820 12991 12218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114449.1 protein_id gnl|my_center|LOCUS_60820 14259 13027 gene locus_tag LOCUS_60830 14259 13027 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114448.1 protein_id gnl|my_center|LOCUS_60830 16339 14378 gene locus_tag LOCUS_60840 gene dgcB 16339 14378 CDS product dimethylglycine demethylation protein DgcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114447.1 protein_id gnl|my_center|LOCUS_60840 18503 16443 gene locus_tag LOCUS_60850 gene dgcA 18503 16443 CDS product dimethylglycine demethylation protein DgcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114446.1 protein_id gnl|my_center|LOCUS_60850 19049 18519 gene locus_tag LOCUS_60860 19049 18519 CDS product DUF5943 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107282.1 protein_id gnl|my_center|LOCUS_60860 20153 19176 gene locus_tag LOCUS_60870 20153 19176 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114445.1 protein_id gnl|my_center|LOCUS_60870 20845 20375 gene locus_tag LOCUS_60880 20845 20375 CDS product DUF1348 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114444.1 protein_id gnl|my_center|LOCUS_60880 21039 22472 gene locus_tag LOCUS_60890 gene cls 21039 22472 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121332.1 protein_id gnl|my_center|LOCUS_60890 22766 24118 gene locus_tag LOCUS_60900 22766 24118 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114443.1 protein_id gnl|my_center|LOCUS_60900 24118 24540 gene locus_tag LOCUS_60910 24118 24540 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096732.1 protein_id gnl|my_center|LOCUS_60910 24554 25228 gene locus_tag LOCUS_60920 24554 25228 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106037.1 protein_id gnl|my_center|LOCUS_60920 25285 26439 gene locus_tag LOCUS_60930 gene argE 25285 26439 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106035.1 protein_id gnl|my_center|LOCUS_60930 27379 26369 gene locus_tag LOCUS_60940 gene cdhR 27379 26369 CDS product HTH-type transcriptional regulator CdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114442.1 protein_id gnl|my_center|LOCUS_60940 27590 28528 gene locus_tag LOCUS_60950 27590 28528 CDS product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096718.1 protein_id gnl|my_center|LOCUS_60950 28601 29485 gene locus_tag LOCUS_60960 28601 29485 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096716.1 protein_id gnl|my_center|LOCUS_60960 29536 30501 gene locus_tag LOCUS_60970 29536 30501 CDS product L-carnitine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096713.1 protein_id gnl|my_center|LOCUS_60970 30552 31031 gene locus_tag LOCUS_60980 30552 31031 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114441.1 protein_id gnl|my_center|LOCUS_60980 31037 32032 gene locus_tag LOCUS_60990 31037 32032 CDS product acylcarnitine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115631.1 protein_id gnl|my_center|LOCUS_60990 33043 31976 gene locus_tag LOCUS_61000 33043 31976 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114439.1 protein_id gnl|my_center|LOCUS_61000 33151 34044 gene locus_tag LOCUS_61010 33151 34044 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114438.1 protein_id gnl|my_center|LOCUS_61010 34184 34561 gene locus_tag LOCUS_61020 34184 34561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121325.1 protein_id gnl|my_center|LOCUS_61020 35711 34608 gene locus_tag LOCUS_61030 35711 34608 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096699.1 protein_id gnl|my_center|LOCUS_61030 37507 36131 gene locus_tag LOCUS_61040 37507 36131 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111339.1 protein_id gnl|my_center|LOCUS_61040 37971 38909 gene locus_tag LOCUS_61050 37971 38909 CDS product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104841.1 protein_id gnl|my_center|LOCUS_61050 38951 39790 gene locus_tag LOCUS_61060 gene choW 38951 39790 CDS product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096692.1 protein_id gnl|my_center|LOCUS_61060 39794 40972 gene locus_tag LOCUS_61070 gene choV 39794 40972 CDS product choline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096690.1 protein_id gnl|my_center|LOCUS_61070 42794 41190 gene locus_tag LOCUS_61080 42794 41190 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114437.1 protein_id gnl|my_center|LOCUS_61080 43073 43666 gene locus_tag LOCUS_61090 gene betI 43073 43666 CDS product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096684.1 protein_id gnl|my_center|LOCUS_61090 43727 45199 gene locus_tag LOCUS_61100 gene betB 43727 45199 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114436.1 protein_id gnl|my_center|LOCUS_61100 45335 47020 gene locus_tag LOCUS_61110 gene betA 45335 47020 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104848.1 protein_id gnl|my_center|LOCUS_61110 47470 47066 gene locus_tag LOCUS_61120 47470 47066 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096677.1 protein_id gnl|my_center|LOCUS_61120 47758 49074 gene locus_tag LOCUS_61130 47758 49074 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104851.1 protein_id gnl|my_center|LOCUS_61130 >Feature sequence37 476 787 gene locus_tag LOCUS_61140 gene rpsJ 476 787 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103876.1 protein_id gnl|my_center|LOCUS_61140 870 1505 gene locus_tag LOCUS_61150 gene rplC 870 1505 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103877.1 protein_id gnl|my_center|LOCUS_61150 1519 2121 gene locus_tag LOCUS_61160 gene rplD 1519 2121 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093737.1 protein_id gnl|my_center|LOCUS_61160 2118 2417 gene locus_tag LOCUS_61170 gene rplW 2118 2417 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093736.1 protein_id gnl|my_center|LOCUS_61170 2429 3250 gene locus_tag LOCUS_61180 gene rplB 2429 3250 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103878.1 protein_id gnl|my_center|LOCUS_61180 3267 3542 gene locus_tag LOCUS_61190 gene rpsS 3267 3542 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093734.1 protein_id gnl|my_center|LOCUS_61190 3555 3887 gene locus_tag LOCUS_61200 gene rplV 3555 3887 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103908.1 protein_id gnl|my_center|LOCUS_61200 3900 4586 gene locus_tag LOCUS_61210 gene rpsC 3900 4586 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093727.1 protein_id gnl|my_center|LOCUS_61210 4598 5011 gene locus_tag LOCUS_61220 gene rplP 4598 5011 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093723.1 protein_id gnl|my_center|LOCUS_61220 5011 5202 gene locus_tag LOCUS_61230 gene rpmC 5011 5202 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093720.1 protein_id gnl|my_center|LOCUS_61230 5205 5471 gene locus_tag LOCUS_61240 gene rpsQ 5205 5471 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093717.1 protein_id gnl|my_center|LOCUS_61240 5495 5863 gene locus_tag LOCUS_61250 gene rplN 5495 5863 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093714.1 protein_id gnl|my_center|LOCUS_61250 5876 6190 gene locus_tag LOCUS_61260 gene rplX 5876 6190 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093711.1 protein_id gnl|my_center|LOCUS_61260 6210 6749 gene locus_tag LOCUS_61270 gene rplE 6210 6749 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093703.1 protein_id gnl|my_center|LOCUS_61270 6763 7068 gene locus_tag LOCUS_61280 gene rpsN 6763 7068 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093701.1 protein_id gnl|my_center|LOCUS_61280 7258 7650 gene locus_tag LOCUS_61290 gene rpsH 7258 7650 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093700.1 protein_id gnl|my_center|LOCUS_61290 7662 8195 gene locus_tag LOCUS_61300 gene rplF 7662 8195 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093699.1 protein_id gnl|my_center|LOCUS_61300 8206 8556 gene locus_tag LOCUS_61310 gene rplR 8206 8556 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093698.1 protein_id gnl|my_center|LOCUS_61310 8560 9060 gene locus_tag LOCUS_61320 gene rpsE 8560 9060 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093697.1 protein_id gnl|my_center|LOCUS_61320 9063 9239 gene locus_tag LOCUS_61330 gene rpmD 9063 9239 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093696.1 protein_id gnl|my_center|LOCUS_61330 9243 9677 gene locus_tag LOCUS_61340 gene rplO 9243 9677 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093695.1 protein_id gnl|my_center|LOCUS_61340 9678 11006 gene locus_tag LOCUS_61350 gene secY 9678 11006 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093694.1 protein_id gnl|my_center|LOCUS_61350 11282 11638 gene locus_tag LOCUS_61360 gene rpsM 11282 11638 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093692.1 protein_id gnl|my_center|LOCUS_61360 11657 12046 gene locus_tag LOCUS_61370 gene rpsK 11657 12046 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093689.1 protein_id gnl|my_center|LOCUS_61370 12063 12683 gene locus_tag LOCUS_61380 gene rpsD 12063 12683 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093678.1 protein_id gnl|my_center|LOCUS_61380 12706 13707 gene locus_tag LOCUS_61390 gene rpoA 12706 13707 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093675.1 protein_id gnl|my_center|LOCUS_61390 13751 14140 gene locus_tag LOCUS_61400 gene rplQ 13751 14140 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093672.1 protein_id gnl|my_center|LOCUS_61400 14422 15870 gene locus_tag LOCUS_61410 gene katA 14422 15870 CDS product catalase KatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103909.1 protein_id gnl|my_center|LOCUS_61410 16001 16465 gene locus_tag LOCUS_61420 gene bfr 16001 16465 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093668.1 protein_id gnl|my_center|LOCUS_61420 19373 16536 gene locus_tag LOCUS_61430 gene uvrA 19373 16536 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093663.1 protein_id gnl|my_center|LOCUS_61430 19587 20975 gene locus_tag LOCUS_61440 19587 20975 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103910.1 protein_id gnl|my_center|LOCUS_61440 20992 21489 gene locus_tag LOCUS_61450 gene ssb 20992 21489 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114685.1 protein_id gnl|my_center|LOCUS_61450 23008 21578 gene locus_tag LOCUS_61460 gene pchA 23008 21578 CDS product isochorismate synthase PchA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114686.1 protein_id gnl|my_center|LOCUS_61460 23313 23005 gene locus_tag LOCUS_61470 gene pchB 23313 23005 CDS product isochorismate lyase PchB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106950.1 protein_id gnl|my_center|LOCUS_61470 24065 23310 gene locus_tag LOCUS_61480 gene pchC 24065 23310 CDS product pyochelin biosynthesis editing thioesterase PchC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114687.1 protein_id gnl|my_center|LOCUS_61480 25705 24062 gene locus_tag LOCUS_61490 gene pchD 25705 24062 CDS product pyochelin biosynthesis salicyl-AMP ligase PchD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114688.1 protein_id gnl|my_center|LOCUS_61490 25935 26825 gene locus_tag LOCUS_61500 gene pchR 25935 26825 CDS product pyochelin biosynthesis transcriptional regulator PchR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106955.1 protein_id gnl|my_center|LOCUS_61500 27019 31335 gene locus_tag LOCUS_61510 gene pchE 27019 31335 CDS product pyochelin non-ribosomal peptide synthetase PchE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148110.1 protein_id gnl|my_center|LOCUS_61510 31332 36761 gene locus_tag LOCUS_61520 gene pchF 31332 36761 CDS product pyochelin non-ribosomal peptide synthetase PchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148107.1 protein_id gnl|my_center|LOCUS_61520 36758 37807 gene locus_tag LOCUS_61530 gene pchG 36758 37807 CDS product pyochelin biosynthesis thiazoline reductase PchG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115080.1 protein_id gnl|my_center|LOCUS_61530 37804 39516 gene locus_tag LOCUS_61540 gene pchH 37804 39516 CDS product ABC transporter ATP-binding protein PchH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115081.1 protein_id gnl|my_center|LOCUS_61540 39513 41237 gene locus_tag LOCUS_61550 gene pchI 39513 41237 CDS product ABC transporter ATP-binding protein PchI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115082.1 protein_id gnl|my_center|LOCUS_61550 41347 43491 gene locus_tag LOCUS_61560 gene fptA 41347 43491 CDS product Fe(3+)-pyochelin receptor FptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111969.1 protein_id gnl|my_center|LOCUS_61560 43491 43772 gene locus_tag LOCUS_61570 43491 43772 CDS product protein FptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107348.1 protein_id gnl|my_center|LOCUS_61570 43774 45279 gene locus_tag LOCUS_61580 43774 45279 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115084.1 protein_id gnl|my_center|LOCUS_61580 45272 46516 gene locus_tag LOCUS_61590 45272 46516 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115085.1 protein_id gnl|my_center|LOCUS_61590 47829 46621 gene locus_tag LOCUS_61600 gene phzM 47829 46621 CDS product pyocyanin biosynthetic protein PhzM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115086.1 protein_id gnl|my_center|LOCUS_61600 >Feature sequence38 1439 234 gene locus_tag LOCUS_61610 1439 234 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101497.1 protein_id gnl|my_center|LOCUS_61610 1708 2232 gene locus_tag LOCUS_61620 1708 2232 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090553.1 protein_id gnl|my_center|LOCUS_61620 2403 2903 gene locus_tag LOCUS_61630 2403 2903 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090555.1 protein_id gnl|my_center|LOCUS_61630 3257 2931 gene locus_tag LOCUS_61640 3257 2931 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101499.1 protein_id gnl|my_center|LOCUS_61640 4441 3338 gene locus_tag LOCUS_61650 4441 3338 CDS product DUF1615 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122578.1 protein_id gnl|my_center|LOCUS_61650 5373 4555 gene locus_tag LOCUS_61660 5373 4555 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119473.1 protein_id gnl|my_center|LOCUS_61660 5899 5618 gene locus_tag LOCUS_61670 5899 5618 CDS product DUF1427 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114379.1 protein_id gnl|my_center|LOCUS_61670 6636 5956 gene locus_tag LOCUS_61680 6636 5956 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090561.1 protein_id gnl|my_center|LOCUS_61680 7103 9082 gene locus_tag LOCUS_61690 7103 9082 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114380.1 protein_id gnl|my_center|LOCUS_61690 9131 10438 gene locus_tag LOCUS_61700 9131 10438 CDS product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114381.1 protein_id gnl|my_center|LOCUS_61700 10441 12030 gene locus_tag LOCUS_61710 10441 12030 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114382.1 protein_id gnl|my_center|LOCUS_61710 12177 12653 gene locus_tag LOCUS_61720 gene tse2 12177 12653 CDS product type VI secretion system effector Tse2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101516.1 protein_id gnl|my_center|LOCUS_61720 12663 12896 gene locus_tag LOCUS_61730 gene tsi2 12663 12896 CDS product type IV secretion system immunity protein Tsi2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114383.1 protein_id gnl|my_center|LOCUS_61730 14208 13189 gene locus_tag LOCUS_61740 14208 13189 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101519.1 protein_id gnl|my_center|LOCUS_61740 13544 13641 gene locus_tag LOCUS_t00610 13544 13641 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 15503 14322 gene locus_tag LOCUS_61750 15503 14322 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101527.1 protein_id gnl|my_center|LOCUS_61750 15947 15552 gene locus_tag LOCUS_61760 15947 15552 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101529.1 protein_id gnl|my_center|LOCUS_61760 16857 16012 gene locus_tag LOCUS_61770 16857 16012 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090571.1 protein_id gnl|my_center|LOCUS_61770 18105 17020 gene locus_tag LOCUS_61780 18105 17020 CDS product DUF748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090572.1 protein_id gnl|my_center|LOCUS_61780 18226 19200 gene locus_tag LOCUS_61790 gene cysK 18226 19200 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090573.1 protein_id gnl|my_center|LOCUS_61790 19259 19873 gene locus_tag LOCUS_61800 19259 19873 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114384.1 protein_id gnl|my_center|LOCUS_61800 20072 21163 gene locus_tag LOCUS_61810 20072 21163 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114385.1 protein_id gnl|my_center|LOCUS_61810 21583 22446 gene locus_tag LOCUS_61820 21583 22446 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090576.1 protein_id gnl|my_center|LOCUS_61820 22973 22494 gene locus_tag LOCUS_61830 22973 22494 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090577.1 protein_id gnl|my_center|LOCUS_61830 23327 25636 gene locus_tag LOCUS_61840 23327 25636 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114386.1 protein_id gnl|my_center|LOCUS_61840 25653 25991 gene locus_tag LOCUS_61850 25653 25991 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090580.1 protein_id gnl|my_center|LOCUS_61850 27241 26006 gene locus_tag LOCUS_61860 27241 26006 CDS product NADH:flavin oxidoreductase/NADH oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114387.1 protein_id gnl|my_center|LOCUS_61860 28198 27368 gene locus_tag LOCUS_61870 28198 27368 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101542.1 protein_id gnl|my_center|LOCUS_61870 28431 28919 gene locus_tag LOCUS_61880 28431 28919 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114388.1 protein_id gnl|my_center|LOCUS_61880 29019 29705 gene locus_tag LOCUS_61890 29019 29705 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114389.1 protein_id gnl|my_center|LOCUS_61890 30503 29865 gene locus_tag LOCUS_61900 30503 29865 CDS product DUF6348 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114390.1 protein_id gnl|my_center|LOCUS_61900 30696 31175 gene locus_tag LOCUS_61910 30696 31175 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114391.1 protein_id gnl|my_center|LOCUS_61910 31207 31599 gene locus_tag LOCUS_61920 31207 31599 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114392.1 protein_id gnl|my_center|LOCUS_61920 31629 31907 gene locus_tag LOCUS_61930 31629 31907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114393.1 protein_id gnl|my_center|LOCUS_61930 31982 32521 gene locus_tag LOCUS_61940 31982 32521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114394.1 protein_id gnl|my_center|LOCUS_61940 32652 34481 gene locus_tag LOCUS_61950 32652 34481 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895630.1 protein_id gnl|my_center|LOCUS_61950 34483 35121 gene locus_tag LOCUS_61960 34483 35121 CDS product 4Fe-4S cluster-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114396.1 protein_id gnl|my_center|LOCUS_61960 35136 41432 gene locus_tag LOCUS_61970 35136 41432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61970 41429 42778 gene locus_tag LOCUS_61980 41429 42778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114398.1 protein_id gnl|my_center|LOCUS_61980 42943 43164 gene locus_tag LOCUS_61990 42943 43164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61990 43557 43937 gene locus_tag LOCUS_62000 43557 43937 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810206.1 protein_id gnl|my_center|LOCUS_62000 43965 45854 gene locus_tag LOCUS_62010 43965 45854 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858944.1 protein_id gnl|my_center|LOCUS_62010 46569 45829 gene locus_tag LOCUS_62020 46569 45829 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112570.1 protein_id gnl|my_center|LOCUS_62020 46991 46683 gene locus_tag LOCUS_62030 46991 46683 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112569.1 protein_id gnl|my_center|LOCUS_62030 >Feature sequence39 327 121 gene locus_tag LOCUS_62040 327 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62040 3217 380 gene locus_tag LOCUS_62050 3217 380 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161797787.1 protein_id gnl|my_center|LOCUS_62050 5451 3235 gene locus_tag LOCUS_62060 5451 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102946.1 protein_id gnl|my_center|LOCUS_62060 5807 5592 gene locus_tag LOCUS_62070 5807 5592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62070 6798 6025 gene locus_tag LOCUS_62080 6798 6025 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 protein_id gnl|my_center|LOCUS_62080 7346 6810 gene locus_tag LOCUS_62090 gene gmhB 7346 6810 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120688.1 protein_id gnl|my_center|LOCUS_62090 7677 9383 gene locus_tag LOCUS_62100 7677 9383 CDS product di-heme-cytochrome C peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114647.1 protein_id gnl|my_center|LOCUS_62100 11497 9440 gene locus_tag LOCUS_62110 gene glyS 11497 9440 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114646.1 protein_id gnl|my_center|LOCUS_62110 12441 11494 gene locus_tag LOCUS_62120 gene glyQ 12441 11494 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097276.1 protein_id gnl|my_center|LOCUS_62120 12546 13097 gene locus_tag LOCUS_62130 12546 13097 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097280.1 protein_id gnl|my_center|LOCUS_62130 13241 14128 gene locus_tag LOCUS_62140 13241 14128 CDS product lysophospholipid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097282.1 protein_id gnl|my_center|LOCUS_62140 14213 14479 gene locus_tag LOCUS_62150 14213 14479 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114645.1 protein_id gnl|my_center|LOCUS_62150 14626 15279 gene locus_tag LOCUS_62160 14626 15279 CDS product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097286.1 protein_id gnl|my_center|LOCUS_62160 15359 15595 gene locus_tag LOCUS_62170 15359 15595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62170 16220 15906 gene locus_tag LOCUS_62180 16220 15906 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120685.1 protein_id gnl|my_center|LOCUS_62180 17745 16372 gene locus_tag LOCUS_62190 gene trkA 17745 16372 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_62190 19077 17773 gene locus_tag LOCUS_62200 gene rsmB 19077 17773 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114643.1 protein_id gnl|my_center|LOCUS_62200 20018 19074 gene locus_tag LOCUS_62210 gene fmt 20018 19074 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114642.1 protein_id gnl|my_center|LOCUS_62210 20579 20073 gene locus_tag LOCUS_62220 gene def 20579 20073 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107059.1 protein_id gnl|my_center|LOCUS_62220 20718 21743 gene locus_tag LOCUS_62230 20718 21743 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_62230 21878 22966 gene locus_tag LOCUS_62240 gene dprA 21878 22966 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114641.1 protein_id gnl|my_center|LOCUS_62240 23007 23564 gene locus_tag LOCUS_62250 23007 23564 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097300.1 protein_id gnl|my_center|LOCUS_62250 24551 23574 gene locus_tag LOCUS_62260 24551 23574 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111202.1 protein_id gnl|my_center|LOCUS_62260 24742 25659 gene locus_tag LOCUS_62270 gene hemF 24742 25659 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097311.1 protein_id gnl|my_center|LOCUS_62270 25717 26541 gene locus_tag LOCUS_62280 gene aroE 25717 26541 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111201.1 protein_id gnl|my_center|LOCUS_62280 26652 27638 gene locus_tag LOCUS_62290 26652 27638 CDS product phospholipase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111200.1 protein_id gnl|my_center|LOCUS_62290 27619 28905 gene locus_tag LOCUS_62300 27619 28905 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114640.1 protein_id gnl|my_center|LOCUS_62300 28902 29504 gene locus_tag LOCUS_62310 28902 29504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114639.1 protein_id gnl|my_center|LOCUS_62310 31061 29508 gene locus_tag LOCUS_62320 31061 29508 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114638.1 protein_id gnl|my_center|LOCUS_62320 31989 31066 gene locus_tag LOCUS_62330 31989 31066 CDS product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115797.1 protein_id gnl|my_center|LOCUS_62330 33517 32006 gene locus_tag LOCUS_62340 gene betC 33517 32006 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114636.1 protein_id gnl|my_center|LOCUS_62340 33645 34544 gene locus_tag LOCUS_62350 33645 34544 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122286.1 protein_id gnl|my_center|LOCUS_62350 34555 34932 gene locus_tag LOCUS_62360 34555 34932 CDS product DOPA 4,5-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114635.1 protein_id gnl|my_center|LOCUS_62360 35276 34911 gene locus_tag LOCUS_62370 35276 34911 CDS product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097330.1 protein_id gnl|my_center|LOCUS_62370 35907 35284 gene locus_tag LOCUS_62380 35907 35284 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111192.1 protein_id gnl|my_center|LOCUS_62380 36899 36093 gene locus_tag LOCUS_62390 gene trpA 36899 36093 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115801.1 protein_id gnl|my_center|LOCUS_62390 38104 36896 gene locus_tag LOCUS_62400 gene trpB 38104 36896 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097340.1 protein_id gnl|my_center|LOCUS_62400 38208 39095 gene locus_tag LOCUS_62410 gene trpI 38208 39095 CDS product trpBA operon transcriptional activator TrpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114633.1 protein_id gnl|my_center|LOCUS_62410 39196 39411 gene locus_tag LOCUS_62420 39196 39411 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097345.1 protein_id gnl|my_center|LOCUS_62420 39613 39822 gene locus_tag LOCUS_62430 39613 39822 CDS product DUF1161 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097347.1 protein_id gnl|my_center|LOCUS_62430 >Feature sequence40 <1 607 gene locus_tag LOCUS_62440 <1 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_054991743.1:IS5-like element ISPsy2 family transposase 824 1159 gene locus_tag LOCUS_62450 824 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62450 1125 2135 gene locus_tag LOCUS_62460 1125 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62460 3559 2162 gene locus_tag LOCUS_62470 gene gabP 3559 2162 CDS product GABA permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407279.1 protein_id gnl|my_center|LOCUS_62470 4983 3739 gene locus_tag LOCUS_62480 gene gabT 4983 3739 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106268.1 protein_id gnl|my_center|LOCUS_62480 6604 5156 gene locus_tag LOCUS_62490 gene gabD 6604 5156 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106269.1 protein_id gnl|my_center|LOCUS_62490 7892 6642 gene locus_tag LOCUS_62500 gene lhgO 7892 6642 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271983.1 protein_id gnl|my_center|LOCUS_62500 8974 7997 gene locus_tag LOCUS_62510 gene glaH 8974 7997 CDS product glutarate dioxygenase GlaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993120.1 protein_id gnl|my_center|LOCUS_62510 9159 9848 gene locus_tag LOCUS_62520 gene csiR 9159 9848 CDS product DNA-binding transcriptional regulator CsiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126152.1 protein_id gnl|my_center|LOCUS_62520 10362 11645 gene locus_tag LOCUS_62530 10362 11645 CDS product allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188297.1 protein_id gnl|my_center|LOCUS_62530 11709 12884 gene locus_tag LOCUS_62540 11709 12884 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205957.1 protein_id gnl|my_center|LOCUS_62540 13169 14914 gene locus_tag LOCUS_62550 13169 14914 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729441.1 protein_id gnl|my_center|LOCUS_62550 14929 17013 gene locus_tag LOCUS_62560 14929 17013 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162491196.1 protein_id gnl|my_center|LOCUS_62560 17160 18116 gene locus_tag LOCUS_62570 17160 18116 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533169.1 protein_id gnl|my_center|LOCUS_62570 18529 19134 gene locus_tag LOCUS_62580 18529 19134 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113175.1 protein_id gnl|my_center|LOCUS_62580 19136 20185 gene locus_tag LOCUS_62590 gene trpD 19136 20185 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085203.1 protein_id gnl|my_center|LOCUS_62590 20182 21018 gene locus_tag LOCUS_62600 gene trpC 20182 21018 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113174.1 protein_id gnl|my_center|LOCUS_62600 21724 21080 gene locus_tag LOCUS_62610 gene crp 21724 21080 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085214.1 protein_id gnl|my_center|LOCUS_62610 21996 22418 gene locus_tag LOCUS_62620 21996 22418 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_62620 22738 23532 gene locus_tag LOCUS_62630 gene speD 22738 23532 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101641.1 protein_id gnl|my_center|LOCUS_62630 24234 23587 gene locus_tag LOCUS_62640 gene coq7 24234 23587 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085224.1 protein_id gnl|my_center|LOCUS_62640 24672 24334 gene locus_tag LOCUS_62650 24672 24334 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085225.1 protein_id gnl|my_center|LOCUS_62650 24751 26232 gene locus_tag LOCUS_62660 24751 26232 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113173.1 protein_id gnl|my_center|LOCUS_62660 27072 26272 gene locus_tag LOCUS_62670 27072 26272 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113172.1 protein_id gnl|my_center|LOCUS_62670 28209 27133 gene locus_tag LOCUS_62680 28209 27133 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113171.1 protein_id gnl|my_center|LOCUS_62680 29299 28331 gene locus_tag LOCUS_62690 29299 28331 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085244.1 protein_id gnl|my_center|LOCUS_62690 29738 29316 gene locus_tag LOCUS_62700 gene hemJ 29738 29316 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113170.1 protein_id gnl|my_center|LOCUS_62700 30029 31063 gene locus_tag LOCUS_62710 gene argC 30029 31063 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113169.1 protein_id gnl|my_center|LOCUS_62710 31063 31782 gene locus_tag LOCUS_62720 31063 31782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085249.1 protein_id gnl|my_center|LOCUS_62720 31792 32205 gene locus_tag LOCUS_62730 31792 32205 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120826.1 protein_id gnl|my_center|LOCUS_62730 32283 32633 gene locus_tag LOCUS_62740 gene erpA 32283 32633 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085254.1 protein_id gnl|my_center|LOCUS_62740 33778 32687 gene locus_tag LOCUS_62750 33778 32687 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113168.1 protein_id gnl|my_center|LOCUS_62750 35220 33781 gene locus_tag LOCUS_62760 35220 33781 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129241.1 protein_id gnl|my_center|LOCUS_62760 35409 36608 gene locus_tag LOCUS_62770 gene tyrS 35409 36608 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113167.1 protein_id gnl|my_center|LOCUS_62770 >Feature sequence41 1548 1472 gene locus_tag LOCUS_t00620 1548 1472 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2178 3629 gene locus_tag LOCUS_62780 gene gabD 2178 3629 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106269.1 protein_id gnl|my_center|LOCUS_62780 3874 5154 gene locus_tag LOCUS_62790 gene gabT 3874 5154 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106268.1 protein_id gnl|my_center|LOCUS_62790 5480 6679 gene locus_tag LOCUS_62800 5480 6679 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112926.1 protein_id gnl|my_center|LOCUS_62800 8271 6850 gene locus_tag LOCUS_62810 8271 6850 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106262.1 protein_id gnl|my_center|LOCUS_62810 8398 8835 gene locus_tag LOCUS_62820 8398 8835 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106260.1 protein_id gnl|my_center|LOCUS_62820 8847 9254 gene locus_tag LOCUS_62830 8847 9254 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112927.1 protein_id gnl|my_center|LOCUS_62830 9288 9572 gene locus_tag LOCUS_62840 9288 9572 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106257.1 protein_id gnl|my_center|LOCUS_62840 10501 9569 gene locus_tag LOCUS_62850 10501 9569 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112928.1 protein_id gnl|my_center|LOCUS_62850 11765 10551 gene locus_tag LOCUS_62860 11765 10551 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112929.1 protein_id gnl|my_center|LOCUS_62860 12698 11928 gene locus_tag LOCUS_62870 12698 11928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112930.1 protein_id gnl|my_center|LOCUS_62870 13493 12807 gene locus_tag LOCUS_62880 13493 12807 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107720.1 protein_id gnl|my_center|LOCUS_62880 13569 14084 gene locus_tag LOCUS_62890 13569 14084 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107722.1 protein_id gnl|my_center|LOCUS_62890 14882 14124 gene locus_tag LOCUS_62900 14882 14124 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112931.1 protein_id gnl|my_center|LOCUS_62900 15806 15054 gene locus_tag LOCUS_62910 15806 15054 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112932.1 protein_id gnl|my_center|LOCUS_62910 15900 16598 gene locus_tag LOCUS_62920 15900 16598 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112933.1 protein_id gnl|my_center|LOCUS_62920 17601 16612 gene locus_tag LOCUS_62930 17601 16612 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084237.1 protein_id gnl|my_center|LOCUS_62930 18474 17605 gene locus_tag LOCUS_62940 gene cysW 18474 17605 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084239.1 protein_id gnl|my_center|LOCUS_62940 19303 18485 gene locus_tag LOCUS_62950 gene cysT 19303 18485 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084241.1 protein_id gnl|my_center|LOCUS_62950 20463 19465 gene locus_tag LOCUS_62960 20463 19465 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084243.1 protein_id gnl|my_center|LOCUS_62960 20822 20640 gene locus_tag LOCUS_62970 gene oscA 20822 20640 CDS product sulfur starvation response protein OscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084246.1 protein_id gnl|my_center|LOCUS_62970 23268 20986 gene locus_tag LOCUS_62980 23268 20986 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084250.1 protein_id gnl|my_center|LOCUS_62980 23440 24618 gene locus_tag LOCUS_62990 23440 24618 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104496.1 protein_id gnl|my_center|LOCUS_62990 24847 26232 gene locus_tag LOCUS_63000 24847 26232 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104497.1 protein_id gnl|my_center|LOCUS_63000 26288 27244 gene locus_tag LOCUS_63010 gene speB 26288 27244 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112934.1 protein_id gnl|my_center|LOCUS_63010 27297 28259 gene locus_tag LOCUS_63020 27297 28259 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895502.1 protein_id gnl|my_center|LOCUS_63020 28372 29343 gene locus_tag LOCUS_63030 28372 29343 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104500.1 protein_id gnl|my_center|LOCUS_63030 29956 31338 gene locus_tag LOCUS_63040 29956 31338 CDS product OprD family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084265.1 protein_id gnl|my_center|LOCUS_63040 32579 31473 gene locus_tag LOCUS_63050 gene aguA 32579 31473 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104504.1 protein_id gnl|my_center|LOCUS_63050 33543 32665 gene locus_tag LOCUS_63060 gene aguB 33543 32665 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111119.1 protein_id gnl|my_center|LOCUS_63060 34371 33706 gene locus_tag LOCUS_63070 34371 33706 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112936.1 protein_id gnl|my_center|LOCUS_63070 35493 34432 gene locus_tag LOCUS_63080 35493 34432 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107781.1 protein_id gnl|my_center|LOCUS_63080 >Feature sequence42 <1 3621 gene locus_tag LOCUS_63090 <1 3621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003147473.1:Ig-like domain-containing protein 3621 4898 gene locus_tag LOCUS_63100 3621 4898 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102743.1 protein_id gnl|my_center|LOCUS_63100 4888 7059 gene locus_tag LOCUS_63110 4888 7059 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114950.1 protein_id gnl|my_center|LOCUS_63110 7049 8236 gene locus_tag LOCUS_63120 7049 8236 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102741.1 protein_id gnl|my_center|LOCUS_63120 8923 8345 gene locus_tag LOCUS_63130 8923 8345 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114949.1 protein_id gnl|my_center|LOCUS_63130 9566 9012 gene locus_tag LOCUS_63140 9566 9012 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088112.1 protein_id gnl|my_center|LOCUS_63140 11919 9724 gene locus_tag LOCUS_63150 11919 9724 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114948.1 protein_id gnl|my_center|LOCUS_63150 12385 11924 gene locus_tag LOCUS_63160 12385 11924 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102736.1 protein_id gnl|my_center|LOCUS_63160 12716 13039 gene locus_tag LOCUS_63170 12716 13039 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102734.1 protein_id gnl|my_center|LOCUS_63170 13052 13450 gene locus_tag LOCUS_63180 gene ndhC 13052 13450 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088123.1 protein_id gnl|my_center|LOCUS_63180 13998 13447 gene locus_tag LOCUS_63190 13998 13447 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102727.1 protein_id gnl|my_center|LOCUS_63190 14084 14617 gene locus_tag LOCUS_63200 14084 14617 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102722.1 protein_id gnl|my_center|LOCUS_63200 14683 17049 gene locus_tag LOCUS_63210 14683 17049 CDS product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895586.1 protein_id gnl|my_center|LOCUS_63210 17721 17053 gene locus_tag LOCUS_63220 17721 17053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114946.1 protein_id gnl|my_center|LOCUS_63220 19114 17705 gene locus_tag LOCUS_63230 19114 17705 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114945.1 protein_id gnl|my_center|LOCUS_63230 19775 19488 gene locus_tag LOCUS_63240 19775 19488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63240 19944 20327 gene locus_tag LOCUS_63250 19944 20327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63250 20964 20341 gene locus_tag LOCUS_63260 20964 20341 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088140.1 protein_id gnl|my_center|LOCUS_63260 21442 21053 gene locus_tag LOCUS_63270 21442 21053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088144.1 protein_id gnl|my_center|LOCUS_63270 22176 21439 gene locus_tag LOCUS_63280 22176 21439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088145.1 protein_id gnl|my_center|LOCUS_63280 24602 22173 gene locus_tag LOCUS_63290 24602 22173 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114943.1 protein_id gnl|my_center|LOCUS_63290 25251 24628 gene locus_tag LOCUS_63300 25251 24628 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118961.1 protein_id gnl|my_center|LOCUS_63300 26542 25268 gene locus_tag LOCUS_63310 26542 25268 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102695.1 protein_id gnl|my_center|LOCUS_63310 27730 26561 gene locus_tag LOCUS_63320 27730 26561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114942.1 protein_id gnl|my_center|LOCUS_63320 28503 27736 gene locus_tag LOCUS_63330 28503 27736 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102692.1 protein_id gnl|my_center|LOCUS_63330 29265 29978 gene locus_tag LOCUS_63340 gene qscR 29265 29978 CDS product quorum-sensing transcriptional repressor QscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118960.1 protein_id gnl|my_center|LOCUS_63340 30205 29954 gene locus_tag LOCUS_63350 30205 29954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63350 >Feature sequence43 320 1729 gene locus_tag LOCUS_63360 320 1729 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113881.1 protein_id gnl|my_center|LOCUS_63360 2799 1726 gene locus_tag LOCUS_63370 2799 1726 CDS product trifunctional transcriptional activator/DNA repair protein Ada/methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113880.1 protein_id gnl|my_center|LOCUS_63370 4211 2889 gene locus_tag LOCUS_63380 4211 2889 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113879.1 protein_id gnl|my_center|LOCUS_63380 5226 4411 gene locus_tag LOCUS_63390 5226 4411 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092205.1 protein_id gnl|my_center|LOCUS_63390 5354 6139 gene locus_tag LOCUS_63400 5354 6139 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092207.1 protein_id gnl|my_center|LOCUS_63400 6319 6167 gene locus_tag LOCUS_63410 gene ykgO 6319 6167 CDS product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092209.1 protein_id gnl|my_center|LOCUS_63410 6582 6319 gene locus_tag LOCUS_63420 6582 6319 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092213.1 protein_id gnl|my_center|LOCUS_63420 6826 8436 gene locus_tag LOCUS_63430 6826 8436 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092223.1 protein_id gnl|my_center|LOCUS_63430 8877 8506 gene locus_tag LOCUS_63440 8877 8506 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092226.1 protein_id gnl|my_center|LOCUS_63440 9602 8949 gene locus_tag LOCUS_63450 9602 8949 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092229.1 protein_id gnl|my_center|LOCUS_63450 9768 10661 gene locus_tag LOCUS_63460 9768 10661 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119360.1 protein_id gnl|my_center|LOCUS_63460 11381 10665 gene locus_tag LOCUS_63470 11381 10665 CDS product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098478.1 protein_id gnl|my_center|LOCUS_63470 11652 12731 gene locus_tag LOCUS_63480 11652 12731 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119359.1 protein_id gnl|my_center|LOCUS_63480 12736 13629 gene locus_tag LOCUS_63490 12736 13629 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092241.1 protein_id gnl|my_center|LOCUS_63490 13622 14392 gene locus_tag LOCUS_63500 13622 14392 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113878.1 protein_id gnl|my_center|LOCUS_63500 14484 15545 gene locus_tag LOCUS_63510 14484 15545 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113877.1 protein_id gnl|my_center|LOCUS_63510 15721 16131 gene locus_tag LOCUS_63520 15721 16131 CDS product quorum-sensing-regulated virulence factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092248.1 protein_id gnl|my_center|LOCUS_63520 16150 16371 gene locus_tag LOCUS_63530 16150 16371 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092249.1 protein_id gnl|my_center|LOCUS_63530 18899 16494 gene locus_tag LOCUS_63540 18899 16494 CDS product phosphoketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113876.1 protein_id gnl|my_center|LOCUS_63540 19079 20482 gene locus_tag LOCUS_63550 19079 20482 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113875.1 protein_id gnl|my_center|LOCUS_63550 20565 21635 gene locus_tag LOCUS_63560 20565 21635 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092255.1 protein_id gnl|my_center|LOCUS_63560 22118 21657 gene locus_tag LOCUS_63570 gene recX 22118 21657 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098485.1 protein_id gnl|my_center|LOCUS_63570 23164 22124 gene locus_tag LOCUS_63580 gene recA 23164 22124 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092260.1 protein_id gnl|my_center|LOCUS_63580 23804 23298 gene locus_tag LOCUS_63590 23804 23298 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092262.1 protein_id gnl|my_center|LOCUS_63590 23951 24958 gene locus_tag LOCUS_63600 23951 24958 CDS product TolB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113874.1 protein_id gnl|my_center|LOCUS_63600 25598 25326 gene locus_tag LOCUS_63610 25598 25326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63610 25866 25627 gene locus_tag LOCUS_63620 25866 25627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113176.1 protein_id gnl|my_center|LOCUS_63620 26165 25863 gene locus_tag LOCUS_63630 26165 25863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63630 >Feature sequence44 2173 1250 gene locus_tag LOCUS_63640 2173 1250 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098208.1 protein_id gnl|my_center|LOCUS_63640 3116 2289 gene locus_tag LOCUS_63650 3116 2289 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113610.1 protein_id gnl|my_center|LOCUS_63650 4012 3125 gene locus_tag LOCUS_63660 4012 3125 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098210.1 protein_id gnl|my_center|LOCUS_63660 4098 4925 gene locus_tag LOCUS_63670 4098 4925 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113611.1 protein_id gnl|my_center|LOCUS_63670 6032 4947 gene locus_tag LOCUS_63680 gene modC 6032 4947 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098212.1 protein_id gnl|my_center|LOCUS_63680 6720 6034 gene locus_tag LOCUS_63690 gene modB 6720 6034 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 protein_id gnl|my_center|LOCUS_63690 7599 6733 gene locus_tag LOCUS_63700 gene modA 7599 6733 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 protein_id gnl|my_center|LOCUS_63700 8255 7605 gene locus_tag LOCUS_63710 8255 7605 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113614.1 protein_id gnl|my_center|LOCUS_63710 8389 10068 gene locus_tag LOCUS_63720 gene fan1 8389 10068 CDS product nuclease Fan1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113615.1 protein_id gnl|my_center|LOCUS_63720 10061 12337 gene locus_tag LOCUS_63730 10061 12337 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113616.1 protein_id gnl|my_center|LOCUS_63730 12427 12636 gene locus_tag LOCUS_63740 12427 12636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088087.1 protein_id gnl|my_center|LOCUS_63740 12778 13305 gene locus_tag LOCUS_63750 12778 13305 CDS product type VI pilus biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113617.1 protein_id gnl|my_center|LOCUS_63750 13292 15622 gene locus_tag LOCUS_63760 gene gspD 13292 15622 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106682.1 protein_id gnl|my_center|LOCUS_63760 15790 16029 gene locus_tag LOCUS_63770 gene acpP 15790 16029 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106681.1 protein_id gnl|my_center|LOCUS_63770 16367 16738 gene locus_tag LOCUS_63780 16367 16738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120217.1 protein_id gnl|my_center|LOCUS_63780 17022 18278 gene locus_tag LOCUS_63790 gene lasA 17022 18278 CDS product elastinolytic metalloprotease LasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895585.1 protein_id gnl|my_center|LOCUS_63790 19196 18405 gene locus_tag LOCUS_63800 19196 18405 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106675.1 protein_id gnl|my_center|LOCUS_63800 20279 19257 gene locus_tag LOCUS_63810 20279 19257 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113619.1 protein_id gnl|my_center|LOCUS_63810 >Feature sequence45 113 38 gene locus_tag LOCUS_t00630 113 38 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 776 252 gene locus_tag LOCUS_63820 gene xcpZ 776 252 CDS product GspM family type II secretion system protein XcpZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091369.1 protein_id gnl|my_center|LOCUS_63820 1926 778 gene locus_tag LOCUS_63830 gene xcpY 1926 778 CDS product GspL family type II secretion system protein XcpY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103522.1 protein_id gnl|my_center|LOCUS_63830 2924 1923 gene locus_tag LOCUS_63840 gene xcpX 2924 1923 CDS product GspK family T2SS minor pseudopilin variant XcpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103524.1 protein_id gnl|my_center|LOCUS_63840 3634 2921 gene locus_tag LOCUS_63850 gene xcpW 3634 2921 CDS product GspJ family T2SS minor pseudopilin variant XcpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110067.1 protein_id gnl|my_center|LOCUS_63850 4020 3631 gene locus_tag LOCUS_63860 gene xcpV 4020 3631 CDS product GspI family T2SS minor pseudopilin variant XcpV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103528.1 protein_id gnl|my_center|LOCUS_63860 4535 4017 gene locus_tag LOCUS_63870 gene xcpU 4535 4017 CDS product GspH family T2SS minor pseudopilin variant XcpU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103530.1 protein_id gnl|my_center|LOCUS_63870 4970 4542 gene locus_tag LOCUS_63880 gene xcpT 4970 4542 CDS product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 protein_id gnl|my_center|LOCUS_63880 6210 4993 gene locus_tag LOCUS_63890 gene xcpS 6210 4993 CDS product GspF family T2SS innner membrane protein variant XcpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091376.1 protein_id gnl|my_center|LOCUS_63890 7718 6210 gene locus_tag LOCUS_63900 gene xcpR 7718 6210 CDS product GspE family T2SS ATPase variant XcpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091377.1 protein_id gnl|my_center|LOCUS_63900 7989 8645 gene locus_tag LOCUS_63910 gene xcpP 7989 8645 CDS product type II secretion system protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119750.1 protein_id gnl|my_center|LOCUS_63910 8650 10623 gene locus_tag LOCUS_63920 gene xcpQ 8650 10623 CDS product GspD family T2SS secretin variant XcpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113934.1 protein_id gnl|my_center|LOCUS_63920 11485 10718 gene locus_tag LOCUS_63930 11485 10718 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103539.1 protein_id gnl|my_center|LOCUS_63930 12693 11482 gene locus_tag LOCUS_63940 12693 11482 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113933.1 protein_id gnl|my_center|LOCUS_63940 14215 12710 gene locus_tag LOCUS_63950 gene purF 14215 12710 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091383.1 protein_id gnl|my_center|LOCUS_63950 14952 14437 gene locus_tag LOCUS_63960 14952 14437 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113932.1 protein_id gnl|my_center|LOCUS_63960 15712 15053 gene locus_tag LOCUS_63970 15712 15053 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267160.1 protein_id gnl|my_center|LOCUS_63970 17005 15716 gene locus_tag LOCUS_63980 gene folC 17005 15716 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115014.1 protein_id gnl|my_center|LOCUS_63980 17874 17002 gene locus_tag LOCUS_63990 gene accD 17874 17002 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104199.1 protein_id gnl|my_center|LOCUS_63990 18778 18143 gene locus_tag LOCUS_64000 18778 18143 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104200.1 protein_id gnl|my_center|LOCUS_64000 19722 18868 gene locus_tag LOCUS_64010 gene truA 19722 18868 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091390.1 protein_id gnl|my_center|LOCUS_64010 20283 20041 gene locus_tag LOCUS_64020 20283 20041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113176.1 protein_id gnl|my_center|LOCUS_64020 20582 20280 gene locus_tag LOCUS_64030 20582 20280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64030 >Feature sequence46 419 1432 gene locus_tag LOCUS_64040 419 1432 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213173803.1 protein_id gnl|my_center|LOCUS_64040 1429 2181 gene locus_tag LOCUS_64050 1429 2181 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085746.1 protein_id gnl|my_center|LOCUS_64050 2191 2838 gene locus_tag LOCUS_64060 gene alkB 2191 2838 CDS product DNA oxidative demethylase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815451.1 protein_id gnl|my_center|LOCUS_64060 2869 3099 gene locus_tag LOCUS_64070 2869 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64070 3144 3695 gene locus_tag LOCUS_64080 3144 3695 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815453.1 protein_id gnl|my_center|LOCUS_64080 3698 4333 gene locus_tag LOCUS_64090 3698 4333 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064359.1 protein_id gnl|my_center|LOCUS_64090 4407 5537 gene locus_tag LOCUS_64100 gene ada 4407 5537 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147548.1 protein_id gnl|my_center|LOCUS_64100 5540 6169 gene locus_tag LOCUS_64110 5540 6169 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530732.1 protein_id gnl|my_center|LOCUS_64110 6159 6449 gene locus_tag LOCUS_64120 6159 6449 CDS product Ada metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809126.1 protein_id gnl|my_center|LOCUS_64120 7802 6603 gene locus_tag LOCUS_64130 7802 6603 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114111.1 protein_id gnl|my_center|LOCUS_64130 8576 7830 gene locus_tag LOCUS_64140 8576 7830 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930222.1 protein_id gnl|my_center|LOCUS_64140 10344 8632 gene locus_tag LOCUS_64150 10344 8632 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040523.1 protein_id gnl|my_center|LOCUS_64150 11176 10412 gene locus_tag LOCUS_64160 11176 10412 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226013866.1 protein_id gnl|my_center|LOCUS_64160 11939 11211 gene locus_tag LOCUS_64170 11939 11211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64170 13700 11970 gene locus_tag LOCUS_64180 13700 11970 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085471.1 protein_id gnl|my_center|LOCUS_64180 14434 13721 gene locus_tag LOCUS_64190 14434 13721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64190 16910 14463 gene locus_tag LOCUS_64200 16910 14463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64200 17755 16958 gene locus_tag LOCUS_64210 17755 16958 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877622.1 protein_id gnl|my_center|LOCUS_64210 19089 17764 gene locus_tag LOCUS_64220 19089 17764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64220 19938 20162 gene locus_tag LOCUS_64230 19938 20162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64230 >Feature sequence47 <1 509 gene locus_tag LOCUS_64240 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895621.1:two-partner secretion system exoprotein TpsA1 506 847 gene locus_tag LOCUS_64250 506 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64250 1235 1390 gene locus_tag LOCUS_64260 1235 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_64260 1550 2335 gene locus_tag LOCUS_64270 1550 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_64270 2332 2733 gene locus_tag LOCUS_64280 2332 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64280 2951 3373 gene locus_tag LOCUS_64290 2951 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64290 3373 3768 gene locus_tag LOCUS_64300 3373 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64300 5491 5288 gene locus_tag LOCUS_64310 5491 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64310 6050 5514 gene locus_tag LOCUS_64320 6050 5514 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113538.1 protein_id gnl|my_center|LOCUS_64320 6898 6047 gene locus_tag LOCUS_64330 6898 6047 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113539.1 protein_id gnl|my_center|LOCUS_64330 7173 6952 gene locus_tag LOCUS_64340 7173 6952 CDS product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089729.1 protein_id gnl|my_center|LOCUS_64340 7330 8910 gene locus_tag LOCUS_64350 7330 8910 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146602274.1 protein_id gnl|my_center|LOCUS_64350 9112 10029 gene locus_tag LOCUS_64360 9112 10029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113541.1 protein_id gnl|my_center|LOCUS_64360 10111 11646 gene locus_tag LOCUS_64370 10111 11646 CDS product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105794.1 protein_id gnl|my_center|LOCUS_64370 13396 11654 gene locus_tag LOCUS_64380 13396 11654 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113542.1 protein_id gnl|my_center|LOCUS_64380 13519 14442 gene locus_tag LOCUS_64390 13519 14442 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089722.1 protein_id gnl|my_center|LOCUS_64390 14701 15084 gene locus_tag LOCUS_64400 gene gcvH 14701 15084 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089718.1 protein_id gnl|my_center|LOCUS_64400 15095 17974 gene locus_tag LOCUS_64410 gene gcvP 15095 17974 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115850.1 protein_id gnl|my_center|LOCUS_64410 >Feature sequence48 128 322 gene locus_tag LOCUS_64420 128 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64420 616 332 gene locus_tag LOCUS_64430 616 332 CDS product pyocin activator PrtN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267327.1 protein_id gnl|my_center|LOCUS_64430 1078 692 gene locus_tag LOCUS_64440 1078 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64440 1654 1151 gene locus_tag LOCUS_64450 1654 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64450 2642 1647 gene locus_tag LOCUS_64460 2642 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64460 3182 2967 gene locus_tag LOCUS_64470 3182 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64470 3312 3190 gene locus_tag LOCUS_64480 3312 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64480 3773 3309 gene locus_tag LOCUS_64490 3773 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64490 4270 3947 gene locus_tag LOCUS_64500 4270 3947 CDS product DUF4406 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014592.1 protein_id gnl|my_center|LOCUS_64500 4761 4267 gene locus_tag LOCUS_64510 4761 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64510 4741 6126 gene locus_tag LOCUS_64520 4741 6126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64520 6132 6470 gene locus_tag LOCUS_64530 6132 6470 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267966.1 protein_id gnl|my_center|LOCUS_64530 6467 7216 gene locus_tag LOCUS_64540 6467 7216 CDS product phage minor tail protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267965.1 protein_id gnl|my_center|LOCUS_64540 7219 7980 gene locus_tag LOCUS_64550 7219 7980 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267964.1 protein_id gnl|my_center|LOCUS_64550 8005 8247 gene locus_tag LOCUS_64560 8005 8247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64560 8461 8228 gene locus_tag LOCUS_64570 8461 8228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64570 8746 8477 gene locus_tag LOCUS_64580 8746 8477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64580 8977 9621 gene locus_tag LOCUS_64590 8977 9621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64590 9934 10338 gene locus_tag LOCUS_64600 9934 10338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64600 10335 10961 gene locus_tag LOCUS_64610 10335 10961 CDS product tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267961.1 protein_id gnl|my_center|LOCUS_64610 11006 11905 gene locus_tag LOCUS_64620 11006 11905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64620 11934 15596 gene locus_tag LOCUS_64630 11934 15596 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113182.1 protein_id gnl|my_center|LOCUS_64630 >Feature sequence49 375 450 gene locus_tag LOCUS_t00640 375 450 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 496 864 gene locus_tag LOCUS_64640 gene secE 496 864 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108030.1 protein_id gnl|my_center|LOCUS_64640 874 1407 gene locus_tag LOCUS_64650 gene nusG 874 1407 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108028.1 protein_id gnl|my_center|LOCUS_64650 1524 1955 gene locus_tag LOCUS_64660 gene rplK 1524 1955 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093751.1 protein_id gnl|my_center|LOCUS_64660 1955 2650 gene locus_tag LOCUS_64670 gene rplA 1955 2650 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093749.1 protein_id gnl|my_center|LOCUS_64670 2849 3349 gene locus_tag LOCUS_64680 gene rplJ 2849 3349 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093748.1 protein_id gnl|my_center|LOCUS_64680 3428 3796 gene locus_tag LOCUS_64690 gene rplL 3428 3796 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093747.1 protein_id gnl|my_center|LOCUS_64690 4018 8091 gene locus_tag LOCUS_64700 gene rpoB 4018 8091 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114335.1 protein_id gnl|my_center|LOCUS_64700 8157 12356 gene locus_tag LOCUS_64710 gene rpoC 8157 12356 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093745.1 protein_id gnl|my_center|LOCUS_64710 12508 12879 gene locus_tag LOCUS_64720 gene rpsL 12508 12879 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093744.1 protein_id gnl|my_center|LOCUS_64720 12979 13449 gene locus_tag LOCUS_64730 gene rpsG 12979 13449 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093742.1 protein_id gnl|my_center|LOCUS_64730 13480 15600 gene locus_tag LOCUS_64740 gene fusA 13480 15600 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093741.1 protein_id gnl|my_center|LOCUS_64740 >Feature sequence50 1051 3024 gene locus_tag LOCUS_64750 1051 3024 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424996.1 protein_id gnl|my_center|LOCUS_64750 3112 4236 gene locus_tag LOCUS_64760 3112 4236 CDS product TcpQ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267070.1 protein_id gnl|my_center|LOCUS_64760 4236 5945 gene locus_tag LOCUS_64770 4236 5945 CDS product PilN family type IVB pilus formation outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267069.1 protein_id gnl|my_center|LOCUS_64770 5949 7274 gene locus_tag LOCUS_64780 gene pilO2 5949 7274 CDS product type 4b pilus protein PilO2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267068.1 protein_id gnl|my_center|LOCUS_64780 7264 7797 gene locus_tag LOCUS_64790 7264 7797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64790 7845 9386 gene locus_tag LOCUS_64800 7845 9386 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267067.1 protein_id gnl|my_center|LOCUS_64800 9386 10465 gene locus_tag LOCUS_64810 9386 10465 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267066.1 protein_id gnl|my_center|LOCUS_64810 10487 11017 gene locus_tag LOCUS_64820 10487 11017 CDS product type 4 pilus major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317566.1 protein_id gnl|my_center|LOCUS_64820 >Feature sequence51 <1 811 gene locus_tag LOCUS_64830 <1 811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003317502.1:UvrD-helicase domain-containing protein 946 1167 gene locus_tag LOCUS_64840 946 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64840 1254 1403 gene locus_tag LOCUS_64850 1254 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64850 1421 1777 gene locus_tag LOCUS_64860 1421 1777 CDS product TIGR03745 family integrating conjugative element membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003294215.1 protein_id gnl|my_center|LOCUS_64860 1788 2174 gene locus_tag LOCUS_64870 1788 2174 CDS product TIGR03750 family conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267025.1 protein_id gnl|my_center|LOCUS_64870 2171 2830 gene locus_tag LOCUS_64880 2171 2830 CDS product TIGR03746 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267024.1 protein_id gnl|my_center|LOCUS_64880 2827 3711 gene locus_tag LOCUS_64890 2827 3711 CDS product TIGR03749 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267023.1 protein_id gnl|my_center|LOCUS_64890 3695 5200 gene locus_tag LOCUS_64900 3695 5200 CDS product TIGR03752 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769292.1 protein_id gnl|my_center|LOCUS_64900 5178 5621 gene locus_tag LOCUS_64910 5178 5621 CDS product TIGR03751 family conjugal transfer lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005740043.1 protein_id gnl|my_center|LOCUS_64910 5621 8563 gene locus_tag LOCUS_64920 5621 8563 CDS product conjugative transfer ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267020.1 protein_id gnl|my_center|LOCUS_64920 >Feature sequence52 1198 650 gene locus_tag LOCUS_64930 1198 650 CDS product DUF3158 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895541.1 protein_id gnl|my_center|LOCUS_64930 2073 1204 gene locus_tag LOCUS_64940 2073 1204 CDS product TIGR03761 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895544.1 protein_id gnl|my_center|LOCUS_64940 2286 2089 gene locus_tag LOCUS_64950 2286 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64950 4020 2689 gene locus_tag LOCUS_64960 4020 2689 CDS product STY4528 family pathogenicity island replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161469396.1 protein_id gnl|my_center|LOCUS_64960 4772 4017 gene locus_tag LOCUS_64970 4772 4017 CDS product DUF2857 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267074.1 protein_id gnl|my_center|LOCUS_64970 6533 4800 gene locus_tag LOCUS_64980 6533 4800 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267075.1 protein_id gnl|my_center|LOCUS_64980 6799 6530 gene locus_tag LOCUS_64990 6799 6530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64990 <7660 6820 gene locus_tag LOCUS_65000 <7660 6820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_077174050.1:DNA adenine methylase >Feature sequence53 1106 192 gene locus_tag LOCUS_65010 gene pfeE 1106 192 CDS product ferric enterobactin esterase PfeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090549.1 protein_id gnl|my_center|LOCUS_65010 3366 1126 gene locus_tag LOCUS_65020 gene pfeA 3366 1126 CDS product siderophore enterobactin receptor PfeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113404.1 protein_id gnl|my_center|LOCUS_65020 4805 3465 gene locus_tag LOCUS_65030 gene pfeS 4805 3465 CDS product two-component system sensor histidine kinase PfeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113403.1 protein_id gnl|my_center|LOCUS_65030 5521 4805 gene locus_tag LOCUS_65040 gene pfeR 5521 4805 CDS product two-component system response regulator PfeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895629.1 protein_id gnl|my_center|LOCUS_65040 >Feature sequence54 >Feature sequence55 >Feature sequence56 1 1218 gene locus_tag LOCUS_65050 gene phzC 1 1218 CDS product phenazine biosynthesis protein PhzC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093621.1 protein_id gnl|my_center|LOCUS_65050 1215 1838 gene locus_tag LOCUS_65060 gene phzD 1215 1838 CDS product phenazine biosynthesis protein PhzD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093625.1 protein_id gnl|my_center|LOCUS_65060 1835 3718 gene locus_tag LOCUS_65070 gene phzE 1835 3718 CDS product phenazine biosynthesis protein PhzE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118954.1 protein_id gnl|my_center|LOCUS_65070 3732 4568 gene locus_tag LOCUS_65080 gene phzF 3732 4568 CDS product phenazine biosynthesis protein PhzF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093628.1 protein_id gnl|my_center|LOCUS_65080 4591 5238 gene locus_tag LOCUS_65090 gene phzG 4591 5238 CDS product phenazine biosynthesis FMN-dependent oxidase PhzG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118953.1 protein_id gnl|my_center|LOCUS_65090 >Feature sequence57 <1 4591 gene locus_tag LOCUS_65100 <1 4591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003147038.1:two-partner secretion system putative hemagglutinin TpsA2 4602 4844 gene locus_tag LOCUS_65110 4602 4844 CDS product CPCC family cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877836.1 protein_id gnl|my_center|LOCUS_65110 >Feature sequence58 501 319 gene locus_tag LOCUS_65120 501 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65120 1330 893 gene locus_tag LOCUS_65130 1330 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65130 2345 1920 gene locus_tag LOCUS_65140 2345 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65140 2523 2708 gene locus_tag LOCUS_65150 2523 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65150 2698 3225 gene locus_tag LOCUS_65160 2698 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65160 3222 3479 gene locus_tag LOCUS_65170 3222 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65170 3472 3711 gene locus_tag LOCUS_65180 3472 3711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65180 3704 3937 gene locus_tag LOCUS_65190 3704 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65190 3937 4959 gene locus_tag LOCUS_65200 gene yejK 3937 4959 CDS product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113787.1 protein_id gnl|my_center|LOCUS_65200 >Feature sequence59 >Feature sequence60 438 1019 gene locus_tag LOCUS_65210 438 1019 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267029.1 protein_id gnl|my_center|LOCUS_65210 1355 1516 gene locus_tag LOCUS_65220 1355 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65220 1525 1794 gene locus_tag LOCUS_65230 1525 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65230 1798 4029 gene locus_tag LOCUS_65240 gene traD 1798 4029 CDS product type IV conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895408.1 protein_id gnl|my_center|LOCUS_65240 >Feature sequence61 126 731 gene locus_tag LOCUS_65250 126 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267038.1 protein_id gnl|my_center|LOCUS_65250 761 2206 gene locus_tag LOCUS_65260 761 2206 CDS product DUF6094 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267037.1 protein_id gnl|my_center|LOCUS_65260 2311 4560 gene locus_tag LOCUS_65270 2311 4560 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267036.1 protein_id gnl|my_center|LOCUS_65270 >Feature sequence62 427 1587 gene locus_tag LOCUS_65280 427 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65280 1608 3512 gene locus_tag LOCUS_65290 1608 3512 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031064.1 protein_id gnl|my_center|LOCUS_65290 >Feature sequence63 1133 1318 gene locus_tag LOCUS_65300 1133 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65300 1308 1835 gene locus_tag LOCUS_65310 1308 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65310 1832 2089 gene locus_tag LOCUS_65320 1832 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65320 2082 2321 gene locus_tag LOCUS_65330 2082 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65330 2314 2547 gene locus_tag LOCUS_65340 2314 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65340 2547 3569 gene locus_tag LOCUS_65350 gene yejK 2547 3569 CDS product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113787.1 protein_id gnl|my_center|LOCUS_65350 >Feature sequence64 408 896 gene locus_tag LOCUS_65360 408 896 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895538.1 protein_id gnl|my_center|LOCUS_65360 1743 3518 gene locus_tag LOCUS_65370 1743 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65370 >Feature sequence65 445 942 gene locus_tag LOCUS_65380 445 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124674.1 protein_id gnl|my_center|LOCUS_65380 939 1769 gene locus_tag LOCUS_65390 939 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65390 1766 2452 gene locus_tag LOCUS_65400 1766 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65400 2452 3153 gene locus_tag LOCUS_65410 2452 3153 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267079.1 protein_id gnl|my_center|LOCUS_65410 >Feature sequence66 445 942 gene locus_tag LOCUS_65420 445 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124674.1 protein_id gnl|my_center|LOCUS_65420 939 1694 gene locus_tag LOCUS_65430 939 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65430 1691 2377 gene locus_tag LOCUS_65440 1691 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65440 2377 3078 gene locus_tag LOCUS_65450 2377 3078 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267079.1 protein_id gnl|my_center|LOCUS_65450 >Feature sequence67 <1 936 gene locus_tag LOCUS_65460 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003317502.1:UvrD-helicase domain-containing protein 1814 2482 gene locus_tag LOCUS_65470 1814 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267031.1 protein_id gnl|my_center|LOCUS_65470 >Feature sequence68 >Feature sequence69 1846 1226 gene locus_tag LOCUS_65480 1846 1226 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107436.1 protein_id gnl|my_center|LOCUS_65480 2489 1833 gene locus_tag LOCUS_65490 2489 1833 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023187661.1 protein_id gnl|my_center|LOCUS_65490