>Feature sequence001 <1 675 gene locus_tag LOCUS_00010 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_069332664.1:IS66 family transposase 1194 757 gene locus_tag LOCUS_00020 1194 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2411 1191 gene locus_tag LOCUS_00030 gene waaL-os 2411 1191 CDS product outer core oligosaccharide ligase WaaL-os inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816144.1 protein_id gnl|my_center|LOCUS_00030 3724 2411 gene locus_tag LOCUS_00040 3724 2411 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942891.1 protein_id gnl|my_center|LOCUS_00040 5049 3721 gene locus_tag LOCUS_00050 5049 3721 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224766.1 protein_id gnl|my_center|LOCUS_00050 7046 5046 gene locus_tag LOCUS_00060 7046 5046 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038749.1 protein_id gnl|my_center|LOCUS_00060 7765 7202 gene locus_tag LOCUS_00070 7765 7202 CDS product DUF4390 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188929.1 protein_id gnl|my_center|LOCUS_00070 9056 7743 gene locus_tag LOCUS_00080 gene rsmB 9056 7743 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951361.1 protein_id gnl|my_center|LOCUS_00080 10006 9053 gene locus_tag LOCUS_00090 gene fmt 10006 9053 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958586.1 protein_id gnl|my_center|LOCUS_00090 10509 10006 gene locus_tag LOCUS_00100 gene def 10509 10006 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690288.1 protein_id gnl|my_center|LOCUS_00100 10757 11542 gene locus_tag LOCUS_00110 10757 11542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11611 12093 gene locus_tag LOCUS_00120 11611 12093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 12103 14745 gene locus_tag LOCUS_00130 12103 14745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14745 15584 gene locus_tag LOCUS_00140 14745 15584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 17994 15586 gene locus_tag LOCUS_00150 gene gyrB 17994 15586 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196276.1 protein_id gnl|my_center|LOCUS_00150 19017 18013 gene locus_tag LOCUS_00160 gene dnaN 19017 18013 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223059.1 protein_id gnl|my_center|LOCUS_00160 20724 19321 gene locus_tag LOCUS_00170 gene dnaA 20724 19321 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769932.1 protein_id gnl|my_center|LOCUS_00170 21078 21353 gene locus_tag LOCUS_00180 21078 21353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 21567 23204 gene locus_tag LOCUS_00190 gene yidC 21567 23204 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169144818.1 protein_id gnl|my_center|LOCUS_00190 23188 24549 gene locus_tag LOCUS_00200 gene mnmE 23188 24549 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225859.1 protein_id gnl|my_center|LOCUS_00200 24590 26464 gene locus_tag LOCUS_00210 gene mnmG 24590 26464 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818282.1 protein_id gnl|my_center|LOCUS_00210 26498 27145 gene locus_tag LOCUS_00220 gene rsmG 26498 27145 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690016.1 protein_id gnl|my_center|LOCUS_00220 27142 27957 gene locus_tag LOCUS_00230 gene soj 27142 27957 CDS product chromosome partitioning protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097243.1 protein_id gnl|my_center|LOCUS_00230 27974 28855 gene locus_tag LOCUS_00240 27974 28855 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687145.1 protein_id gnl|my_center|LOCUS_00240 28906 29283 gene locus_tag LOCUS_00250 28906 29283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 29296 30078 gene locus_tag LOCUS_00260 gene atpB 29296 30078 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770029.1 protein_id gnl|my_center|LOCUS_00260 30132 30398 gene locus_tag LOCUS_00270 gene atpE 30132 30398 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555987.1 protein_id gnl|my_center|LOCUS_00270 30435 30905 gene locus_tag LOCUS_00280 30435 30905 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687152.1 protein_id gnl|my_center|LOCUS_00280 30918 31454 gene locus_tag LOCUS_00290 30918 31454 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315956.1 protein_id gnl|my_center|LOCUS_00290 31505 33046 gene locus_tag LOCUS_00300 gene atpA 31505 33046 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524507.1 protein_id gnl|my_center|LOCUS_00300 33069 33944 gene locus_tag LOCUS_00310 gene atpG 33069 33944 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195831.1 protein_id gnl|my_center|LOCUS_00310 33979 35358 gene locus_tag LOCUS_00320 gene atpD 33979 35358 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185243.1 protein_id gnl|my_center|LOCUS_00320 35371 35793 gene locus_tag LOCUS_00330 35371 35793 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195832.1 protein_id gnl|my_center|LOCUS_00330 35850 37172 gene locus_tag LOCUS_00340 gene glmU 35850 37172 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190034.1 protein_id gnl|my_center|LOCUS_00340 37769 37176 gene locus_tag LOCUS_00350 gene dsbA 37769 37176 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096976.1 protein_id gnl|my_center|LOCUS_00350 38526 37852 gene locus_tag LOCUS_00360 38526 37852 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927242.1 protein_id gnl|my_center|LOCUS_00360 40358 38598 gene locus_tag LOCUS_00370 gene argS 40358 38598 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947747.1 protein_id gnl|my_center|LOCUS_00370 40537 40355 gene locus_tag LOCUS_00380 40537 40355 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186709.1 protein_id gnl|my_center|LOCUS_00380 40652 41479 gene locus_tag LOCUS_00390 40652 41479 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186397.1 protein_id gnl|my_center|LOCUS_00390 41577 42101 gene locus_tag LOCUS_00400 gene thiE 41577 42101 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064930.1 protein_id gnl|my_center|LOCUS_00400 42154 43437 gene locus_tag LOCUS_00410 gene hemL 42154 43437 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527562.1 protein_id gnl|my_center|LOCUS_00410 43434 44075 gene locus_tag LOCUS_00420 gene yihA 43434 44075 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521909.1 protein_id gnl|my_center|LOCUS_00420 45076 44072 gene locus_tag LOCUS_00430 gene hemB 45076 44072 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225417.1 protein_id gnl|my_center|LOCUS_00430 47353 45086 gene locus_tag LOCUS_00440 47353 45086 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535017.1 protein_id gnl|my_center|LOCUS_00440 48506 47403 gene locus_tag LOCUS_00450 gene aroB 48506 47403 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403032.1 protein_id gnl|my_center|LOCUS_00450 49281 48481 gene locus_tag LOCUS_00460 49281 48481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 49338 53873 gene locus_tag LOCUS_00470 49338 53873 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196742.1 protein_id gnl|my_center|LOCUS_00470 53875 55308 gene locus_tag LOCUS_00480 53875 55308 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448901.1 protein_id gnl|my_center|LOCUS_00480 55357 56424 gene locus_tag LOCUS_00490 gene hemE 55357 56424 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222724.1 protein_id gnl|my_center|LOCUS_00490 56700 58670 gene locus_tag LOCUS_00500 56700 58670 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815335.1 protein_id gnl|my_center|LOCUS_00500 59498 58680 gene locus_tag LOCUS_00510 59498 58680 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 protein_id gnl|my_center|LOCUS_00510 61405 59501 gene locus_tag LOCUS_00520 gene thiC 61405 59501 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929683.1 protein_id gnl|my_center|LOCUS_00520 62042 61482 gene locus_tag LOCUS_00530 gene greB 62042 61482 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812405.1 protein_id gnl|my_center|LOCUS_00530 62702 62049 gene locus_tag LOCUS_00540 62702 62049 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815097.1 protein_id gnl|my_center|LOCUS_00540 62865 63407 gene locus_tag LOCUS_00550 gene bcp 62865 63407 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_00550 64650 63382 gene locus_tag LOCUS_00560 gene waaA 64650 63382 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185503.1 protein_id gnl|my_center|LOCUS_00560 65597 64647 gene locus_tag LOCUS_00570 gene waaC 65597 64647 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266460.1 protein_id gnl|my_center|LOCUS_00570 65659 66426 gene locus_tag LOCUS_00580 65659 66426 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_00580 68165 66411 gene locus_tag LOCUS_00590 gene msbA 68165 66411 CDS product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211320.1 protein_id gnl|my_center|LOCUS_00590 68951 68196 gene locus_tag LOCUS_00600 68951 68196 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404265.1 protein_id gnl|my_center|LOCUS_00600 69409 68948 gene locus_tag LOCUS_00610 69409 68948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 70551 69502 gene locus_tag LOCUS_00620 gene cobT 70551 69502 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112354.1 protein_id gnl|my_center|LOCUS_00620 71084 70548 gene locus_tag LOCUS_00630 gene cobU 71084 70548 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038175.1 protein_id gnl|my_center|LOCUS_00630 71955 71074 gene locus_tag LOCUS_00640 71955 71074 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812788.1 protein_id gnl|my_center|LOCUS_00640 73492 72011 gene locus_tag LOCUS_00650 gene rmuC 73492 72011 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704261.1 protein_id gnl|my_center|LOCUS_00650 75102 73498 gene locus_tag LOCUS_00660 75102 73498 CDS product glucan biosynthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440221.1 protein_id gnl|my_center|LOCUS_00660 75248 75562 gene locus_tag LOCUS_00670 75248 75562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 75570 75980 gene locus_tag LOCUS_00680 75570 75980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 75990 79652 gene locus_tag LOCUS_00690 75990 79652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 80571 79660 gene locus_tag LOCUS_00700 80571 79660 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090741.1 protein_id gnl|my_center|LOCUS_00700 80732 81847 gene locus_tag LOCUS_00710 gene torT 80732 81847 CDS product TMAO reductase system periplasmic protein TorT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612420.1 protein_id gnl|my_center|LOCUS_00710 81855 84845 gene locus_tag LOCUS_00720 81855 84845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 84842 85318 gene locus_tag LOCUS_00730 84842 85318 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193808.1 protein_id gnl|my_center|LOCUS_00730 88025 85248 gene locus_tag LOCUS_00740 88025 85248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 88595 88029 gene locus_tag LOCUS_00750 88595 88029 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104866.1 protein_id gnl|my_center|LOCUS_00750 88651 90153 gene locus_tag LOCUS_00760 88651 90153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 91050 90172 gene locus_tag LOCUS_00770 91050 90172 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189256.1 protein_id gnl|my_center|LOCUS_00770 92477 91047 gene locus_tag LOCUS_00780 gene pyk 92477 91047 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188973.1 protein_id gnl|my_center|LOCUS_00780 93812 92634 gene locus_tag LOCUS_00790 93812 92634 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064312.1 protein_id gnl|my_center|LOCUS_00790 94922 93906 gene locus_tag LOCUS_00800 gene gap 94922 93906 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194065.1 protein_id gnl|my_center|LOCUS_00800 95040 95948 gene locus_tag LOCUS_00810 95040 95948 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390154.1 protein_id gnl|my_center|LOCUS_00810 96732 95926 gene locus_tag LOCUS_00820 96732 95926 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002234194.1 protein_id gnl|my_center|LOCUS_00820 96747 97553 gene locus_tag LOCUS_00830 96747 97553 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194189.1 protein_id gnl|my_center|LOCUS_00830 97550 98872 gene locus_tag LOCUS_00840 gene argA 97550 98872 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192168.1 protein_id gnl|my_center|LOCUS_00840 98914 99186 gene locus_tag LOCUS_00850 98914 99186 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_00850 99903 99190 gene locus_tag LOCUS_00860 gene phoU 99903 99190 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071865.1 protein_id gnl|my_center|LOCUS_00860 100573 99914 gene locus_tag LOCUS_00870 gene rpiA 100573 99914 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071382.1 protein_id gnl|my_center|LOCUS_00870 100703 102223 gene locus_tag LOCUS_00880 gene ilvA 100703 102223 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064913.1 protein_id gnl|my_center|LOCUS_00880 102220 104361 gene locus_tag LOCUS_00890 102220 104361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 106250 104406 gene locus_tag LOCUS_00900 106250 104406 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891851.1 protein_id gnl|my_center|LOCUS_00900 106979 106254 gene locus_tag LOCUS_00910 gene cheZ 106979 106254 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811909.1 protein_id gnl|my_center|LOCUS_00910 107376 106987 gene locus_tag LOCUS_00920 gene cheY 107376 106987 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164479.1 protein_id gnl|my_center|LOCUS_00920 108351 107404 gene locus_tag LOCUS_00930 108351 107404 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707239.1 protein_id gnl|my_center|LOCUS_00930 109307 108357 gene locus_tag LOCUS_00940 109307 108357 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706646.1 protein_id gnl|my_center|LOCUS_00940 110373 109402 gene locus_tag LOCUS_00950 gene motB 110373 109402 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817154.1 protein_id gnl|my_center|LOCUS_00950 111249 110395 gene locus_tag LOCUS_00960 gene motA 111249 110395 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198197.1 protein_id gnl|my_center|LOCUS_00960 111923 111369 gene locus_tag LOCUS_00970 gene flhC 111923 111369 CDS product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198198.1 protein_id gnl|my_center|LOCUS_00970 112248 111928 gene locus_tag LOCUS_00980 gene flhD 112248 111928 CDS product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198199.1 protein_id gnl|my_center|LOCUS_00980 112645 113835 gene locus_tag LOCUS_00990 gene flhB 112645 113835 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063731.1 protein_id gnl|my_center|LOCUS_00990 113832 114014 gene locus_tag LOCUS_01000 113832 114014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01000 113993 114002 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 114016 115920 gene locus_tag LOCUS_01010 gene flhA 114016 115920 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198639.1 protein_id gnl|my_center|LOCUS_01010 115923 116993 gene locus_tag LOCUS_01020 115923 116993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 116986 117816 gene locus_tag LOCUS_01030 116986 117816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 117838 118560 gene locus_tag LOCUS_01040 117838 118560 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198636.1 protein_id gnl|my_center|LOCUS_01040 118563 119303 gene locus_tag LOCUS_01050 118563 119303 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947507.1 protein_id gnl|my_center|LOCUS_01050 119284 120078 gene locus_tag LOCUS_01060 gene motD 119284 120078 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083090.1 protein_id gnl|my_center|LOCUS_01060 120500 120075 gene locus_tag LOCUS_01070 gene flgN 120500 120075 CDS product flagella biosynthesis chaperone FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197336.1 protein_id gnl|my_center|LOCUS_01070 120833 120510 gene locus_tag LOCUS_01080 120833 120510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 121061 121822 gene locus_tag LOCUS_01090 121061 121822 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229054.1 protein_id gnl|my_center|LOCUS_01090 121822 122547 gene locus_tag LOCUS_01100 121822 122547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 122534 124306 gene locus_tag LOCUS_01110 122534 124306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 124430 126460 gene locus_tag LOCUS_01120 124430 126460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 126541 126912 gene locus_tag LOCUS_01130 126541 126912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 126926 128944 gene locus_tag LOCUS_01140 126926 128944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 128954 129472 gene locus_tag LOCUS_01150 128954 129472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 129469 129804 gene locus_tag LOCUS_01160 129469 129804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 129822 130943 gene locus_tag LOCUS_01170 129822 130943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 130936 131232 gene locus_tag LOCUS_01180 130936 131232 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811829.1 protein_id gnl|my_center|LOCUS_01180 131229 131978 gene locus_tag LOCUS_01190 131229 131978 CDS product flagellar brake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809774.1 protein_id gnl|my_center|LOCUS_01190 132299 131979 gene locus_tag LOCUS_01200 132299 131979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 132462 134255 gene locus_tag LOCUS_01210 gene fliF 132462 134255 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523066.1 protein_id gnl|my_center|LOCUS_01210 134248 135246 gene locus_tag LOCUS_01220 gene fliG 134248 135246 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197167.1 protein_id gnl|my_center|LOCUS_01220 135233 135913 gene locus_tag LOCUS_01230 gene fliH 135233 135913 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556525.1 protein_id gnl|my_center|LOCUS_01230 135910 137307 gene locus_tag LOCUS_01240 gene fliI 135910 137307 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811843.1 protein_id gnl|my_center|LOCUS_01240 137304 137756 gene locus_tag LOCUS_01250 gene fliJ 137304 137756 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037088.1 protein_id gnl|my_center|LOCUS_01250 138432 138112 gene locus_tag LOCUS_01260 138432 138112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 138533 139159 gene locus_tag LOCUS_01270 138533 139159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 139184 139894 gene locus_tag LOCUS_01280 139184 139894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 139901 140899 gene locus_tag LOCUS_01290 gene fliM 139901 140899 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196784.1 protein_id gnl|my_center|LOCUS_01290 140904 141332 gene locus_tag LOCUS_01300 gene fliN 140904 141332 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184995.1 protein_id gnl|my_center|LOCUS_01300 141329 141697 gene locus_tag LOCUS_01310 gene fliO 141329 141697 CDS product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704951.1 protein_id gnl|my_center|LOCUS_01310 141687 142448 gene locus_tag LOCUS_01320 gene fliP 141687 142448 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253411.1 protein_id gnl|my_center|LOCUS_01320 142445 142717 gene locus_tag LOCUS_01330 gene fliQ 142445 142717 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500315.1 protein_id gnl|my_center|LOCUS_01330 142717 143514 gene locus_tag LOCUS_01340 gene fliR 142717 143514 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039843.1 protein_id gnl|my_center|LOCUS_01340 144764 143511 gene locus_tag LOCUS_01350 gene flgL 144764 143511 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200262.1 protein_id gnl|my_center|LOCUS_01350 146695 144779 gene locus_tag LOCUS_01360 gene flgK 146695 144779 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203463.1 protein_id gnl|my_center|LOCUS_01360 147164 146688 gene locus_tag LOCUS_01370 147164 146688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 148281 147166 gene locus_tag LOCUS_01380 gene flgI 148281 147166 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589319.1 protein_id gnl|my_center|LOCUS_01380 148975 148286 gene locus_tag LOCUS_01390 gene flgH 148975 148286 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367324.1 protein_id gnl|my_center|LOCUS_01390 149760 148975 gene locus_tag LOCUS_01400 gene flgG 149760 148975 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625851.1 protein_id gnl|my_center|LOCUS_01400 150537 149776 gene locus_tag LOCUS_01410 gene flgF 150537 149776 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185014.1 protein_id gnl|my_center|LOCUS_01410 151841 150543 gene locus_tag LOCUS_01420 gene flgE 151841 150543 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197255.1 protein_id gnl|my_center|LOCUS_01420 152440 151868 gene locus_tag LOCUS_01430 152440 151868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 152439 152627 gene locus_tag LOCUS_01440 152439 152627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 153017 152610 gene locus_tag LOCUS_01450 gene flgC 153017 152610 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197251.1 protein_id gnl|my_center|LOCUS_01450 153430 153029 gene locus_tag LOCUS_01460 gene flgB 153430 153029 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097139.1 protein_id gnl|my_center|LOCUS_01460 153503 154249 gene locus_tag LOCUS_01470 153503 154249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 154259 155455 gene locus_tag LOCUS_01480 154259 155455 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 protein_id gnl|my_center|LOCUS_01480 155496 156326 gene locus_tag LOCUS_01490 155496 156326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 156387 157820 gene locus_tag LOCUS_01500 156387 157820 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088589.1 protein_id gnl|my_center|LOCUS_01500 157817 159034 gene locus_tag LOCUS_01510 157817 159034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967751.1 protein_id gnl|my_center|LOCUS_01510 159031 160341 gene locus_tag LOCUS_01520 159031 160341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971043.1 protein_id gnl|my_center|LOCUS_01520 160371 161081 gene locus_tag LOCUS_01530 gene queC 160371 161081 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389710.1 protein_id gnl|my_center|LOCUS_01530 161074 162096 gene locus_tag LOCUS_01540 161074 162096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 162098 162745 gene locus_tag LOCUS_01550 gene queE 162098 162745 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085270.1 protein_id gnl|my_center|LOCUS_01550 162788 163273 gene locus_tag LOCUS_01560 162788 163273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 163349 163768 gene locus_tag LOCUS_01570 163349 163768 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_01570 163788 165113 gene locus_tag LOCUS_01580 163788 165113 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_01580 165113 165694 gene locus_tag LOCUS_01590 165113 165694 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_01590 165758 167584 gene locus_tag LOCUS_01600 gene glmS 165758 167584 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815700.1 protein_id gnl|my_center|LOCUS_01600 167581 168639 gene locus_tag LOCUS_01610 gene pyrC 167581 168639 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112889.1 protein_id gnl|my_center|LOCUS_01610 170980 169124 gene locus_tag LOCUS_01620 170980 169124 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037005.1 protein_id gnl|my_center|LOCUS_01620 171249 170977 gene locus_tag LOCUS_01630 171249 170977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 171466 171912 gene locus_tag LOCUS_01640 gene mraZ 171466 171912 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194130.1 protein_id gnl|my_center|LOCUS_01640 171931 172857 gene locus_tag LOCUS_01650 gene rsmH 171931 172857 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697441.1 protein_id gnl|my_center|LOCUS_01650 172854 173135 gene locus_tag LOCUS_01660 172854 173135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 173132 174844 gene locus_tag LOCUS_01670 173132 174844 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532007.1 protein_id gnl|my_center|LOCUS_01670 174841 176355 gene locus_tag LOCUS_01680 174841 176355 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224920.1 protein_id gnl|my_center|LOCUS_01680 176352 177704 gene locus_tag LOCUS_01690 176352 177704 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243999.1 protein_id gnl|my_center|LOCUS_01690 177724 178809 gene locus_tag LOCUS_01700 gene mraY 177724 178809 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_01700 178809 180188 gene locus_tag LOCUS_01710 gene murD 178809 180188 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268846.1 protein_id gnl|my_center|LOCUS_01710 180185 181354 gene locus_tag LOCUS_01720 gene ftsW 180185 181354 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194175.1 protein_id gnl|my_center|LOCUS_01720 181351 182457 gene locus_tag LOCUS_01730 gene murG 181351 182457 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194182.1 protein_id gnl|my_center|LOCUS_01730 182454 183866 gene locus_tag LOCUS_01740 gene murC 182454 183866 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522018.1 protein_id gnl|my_center|LOCUS_01740 183863 184762 gene locus_tag LOCUS_01750 gene murB 183863 184762 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357031.1 protein_id gnl|my_center|LOCUS_01750 184979 185617 gene locus_tag LOCUS_01760 184979 185617 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769491.1 protein_id gnl|my_center|LOCUS_01760 185619 186863 gene locus_tag LOCUS_01770 gene ftsA 185619 186863 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194020.1 protein_id gnl|my_center|LOCUS_01770 186918 188087 gene locus_tag LOCUS_01780 gene ftsZ 186918 188087 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035966.1 protein_id gnl|my_center|LOCUS_01780 188128 189051 gene locus_tag LOCUS_01790 gene lpxC 188128 189051 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522022.1 protein_id gnl|my_center|LOCUS_01790 189479 189042 gene locus_tag LOCUS_01800 189479 189042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 189539 192271 gene locus_tag LOCUS_01810 gene secA 189539 192271 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064961.1 protein_id gnl|my_center|LOCUS_01810 192282 193499 gene locus_tag LOCUS_01820 gene argJ 192282 193499 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202972.1 protein_id gnl|my_center|LOCUS_01820 193509 194474 gene locus_tag LOCUS_01830 193509 194474 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064924.1 protein_id gnl|my_center|LOCUS_01830 195331 194429 gene locus_tag LOCUS_01840 195331 194429 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010356740.1 protein_id gnl|my_center|LOCUS_01840 196233 195340 gene locus_tag LOCUS_01850 196233 195340 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193428.1 protein_id gnl|my_center|LOCUS_01850 196312 196764 gene locus_tag LOCUS_01860 196312 196764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 196810 200688 gene locus_tag LOCUS_01870 gene purL 196810 200688 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100278782.1 protein_id gnl|my_center|LOCUS_01870 201552 200737 gene locus_tag LOCUS_01880 201552 200737 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191958.1 protein_id gnl|my_center|LOCUS_01880 201843 201589 gene locus_tag LOCUS_01890 201843 201589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 202397 201840 gene locus_tag LOCUS_01900 202397 201840 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813872.1 protein_id gnl|my_center|LOCUS_01900 202524 203393 gene locus_tag LOCUS_01910 202524 203393 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816844.1 protein_id gnl|my_center|LOCUS_01910 203396 204598 gene locus_tag LOCUS_01920 203396 204598 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191887.1 protein_id gnl|my_center|LOCUS_01920 204638 205495 gene locus_tag LOCUS_01930 204638 205495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 206330 205422 gene locus_tag LOCUS_01940 gene prmB 206330 205422 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926401.1 protein_id gnl|my_center|LOCUS_01940 207463 206327 gene locus_tag LOCUS_01950 gene dapE 207463 206327 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688278.1 protein_id gnl|my_center|LOCUS_01950 208287 207463 gene locus_tag LOCUS_01960 gene dapD 208287 207463 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368172.1 protein_id gnl|my_center|LOCUS_01960 209500 208274 gene locus_tag LOCUS_01970 gene dapC 209500 208274 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448163.1 protein_id gnl|my_center|LOCUS_01970 209925 209497 gene locus_tag LOCUS_01980 209925 209497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 210075 211094 gene locus_tag LOCUS_01990 210075 211094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 211091 213124 gene locus_tag LOCUS_02000 gene ligA 211091 213124 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192539.1 protein_id gnl|my_center|LOCUS_02000 213121 213990 gene locus_tag LOCUS_02010 gene galU 213121 213990 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225519.1 protein_id gnl|my_center|LOCUS_02010 213992 214531 gene locus_tag LOCUS_02020 gene def 213992 214531 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064978.1 protein_id gnl|my_center|LOCUS_02020 217090 214523 gene locus_tag LOCUS_02030 217090 214523 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544413.1 protein_id gnl|my_center|LOCUS_02030 217901 217104 gene locus_tag LOCUS_02040 gene map 217901 217104 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193235.1 protein_id gnl|my_center|LOCUS_02040 218055 218801 gene locus_tag LOCUS_02050 gene rpsB 218055 218801 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686861.1 protein_id gnl|my_center|LOCUS_02050 218887 219771 gene locus_tag LOCUS_02060 gene tsf 218887 219771 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197087.1 protein_id gnl|my_center|LOCUS_02060 219774 220496 gene locus_tag LOCUS_02070 gene pyrH 219774 220496 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926571.1 protein_id gnl|my_center|LOCUS_02070 220513 221070 gene locus_tag LOCUS_02080 gene frr 220513 221070 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811796.1 protein_id gnl|my_center|LOCUS_02080 221084 221845 gene locus_tag LOCUS_02090 gene uppS 221084 221845 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930350.1 protein_id gnl|my_center|LOCUS_02090 221824 222630 gene locus_tag LOCUS_02100 221824 222630 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002239446.1 protein_id gnl|my_center|LOCUS_02100 222639 223811 gene locus_tag LOCUS_02110 gene ispC 222639 223811 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765988.1 protein_id gnl|my_center|LOCUS_02110 223808 225175 gene locus_tag LOCUS_02120 gene rseP 223808 225175 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930352.1 protein_id gnl|my_center|LOCUS_02120 225187 227484 gene locus_tag LOCUS_02130 gene bamA 225187 227484 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535505.1 protein_id gnl|my_center|LOCUS_02130 227500 228018 gene locus_tag LOCUS_02140 227500 228018 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930951.1 protein_id gnl|my_center|LOCUS_02140 228034 229059 gene locus_tag LOCUS_02150 gene lpxD 228034 229059 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771660.1 protein_id gnl|my_center|LOCUS_02150 229094 229549 gene locus_tag LOCUS_02160 gene fabZ 229094 229549 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811776.1 protein_id gnl|my_center|LOCUS_02160 229554 230330 gene locus_tag LOCUS_02170 gene lpxA 229554 230330 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811774.1 protein_id gnl|my_center|LOCUS_02170 230334 231461 gene locus_tag LOCUS_02180 gene lpxB 230334 231461 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705104.1 protein_id gnl|my_center|LOCUS_02180 231484 232059 gene locus_tag LOCUS_02190 gene rnhB 231484 232059 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947103.1 protein_id gnl|my_center|LOCUS_02190 232056 232856 gene locus_tag LOCUS_02200 232056 232856 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222468.1 protein_id gnl|my_center|LOCUS_02200 232853 233722 gene locus_tag LOCUS_02210 232853 233722 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967128.1 protein_id gnl|my_center|LOCUS_02210 >Feature sequence002 1630 188 gene locus_tag LOCUS_02220 1630 188 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814201.1 protein_id gnl|my_center|LOCUS_02220 1764 3296 gene locus_tag LOCUS_02230 1764 3296 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522572.1 protein_id gnl|my_center|LOCUS_02230 3293 3721 gene locus_tag LOCUS_02240 3293 3721 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193228.1 protein_id gnl|my_center|LOCUS_02240 3727 6450 gene locus_tag LOCUS_02250 3727 6450 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521705.1 protein_id gnl|my_center|LOCUS_02250 6784 6464 gene locus_tag LOCUS_02260 6784 6464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 8005 6821 gene locus_tag LOCUS_02270 gene neuC 8005 6821 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289362.1 protein_id gnl|my_center|LOCUS_02270 9035 7995 gene locus_tag LOCUS_02280 gene siaC 9035 7995 CDS product polysialic acid capsule biosynthesis protein SiaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215299.1 protein_id gnl|my_center|LOCUS_02280 9310 10125 gene locus_tag LOCUS_02290 9310 10125 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813139.1 protein_id gnl|my_center|LOCUS_02290 11142 10102 gene locus_tag LOCUS_02300 11142 10102 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057042.1 protein_id gnl|my_center|LOCUS_02300 11720 11163 gene locus_tag LOCUS_02310 11720 11163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 14333 11733 gene locus_tag LOCUS_02320 14333 11733 CDS product DUF2309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257648.1 protein_id gnl|my_center|LOCUS_02320 15982 14336 gene locus_tag LOCUS_02330 15982 14336 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257649.1 protein_id gnl|my_center|LOCUS_02330 18582 16198 gene locus_tag LOCUS_02340 18582 16198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 19428 18625 gene locus_tag LOCUS_02350 19428 18625 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731550.1 protein_id gnl|my_center|LOCUS_02350 19652 19443 gene locus_tag LOCUS_02360 19652 19443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 20287 19643 gene locus_tag LOCUS_02370 gene parA 20287 19643 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194446.1 protein_id gnl|my_center|LOCUS_02370 20572 20294 gene locus_tag LOCUS_02380 20572 20294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 21018 20569 gene locus_tag LOCUS_02390 21018 20569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 21367 21029 gene locus_tag LOCUS_02400 21367 21029 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006169870.1 protein_id gnl|my_center|LOCUS_02400 21790 21536 gene locus_tag LOCUS_02410 21790 21536 CDS product carboxysome peptide B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124709.1 protein_id gnl|my_center|LOCUS_02410 22040 21792 gene locus_tag LOCUS_02420 22040 21792 CDS product carboxysome peptide A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124708.1 protein_id gnl|my_center|LOCUS_02420 23509 22037 gene locus_tag LOCUS_02430 23509 22037 CDS product carboxysome shell carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124707.1 protein_id gnl|my_center|LOCUS_02430 25908 23650 gene locus_tag LOCUS_02440 25908 23650 CDS product CsoS2 family carboxysome shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124706.1 protein_id gnl|my_center|LOCUS_02440 26334 26002 gene locus_tag LOCUS_02450 26334 26002 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124705.1 protein_id gnl|my_center|LOCUS_02450 27838 26417 gene locus_tag LOCUS_02460 27838 26417 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124704.1 protein_id gnl|my_center|LOCUS_02460 28031 28963 gene locus_tag LOCUS_02470 28031 28963 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920971.1 protein_id gnl|my_center|LOCUS_02470 29286 29199 gene locus_tag LOCUS_t00010 29286 29199 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 29451 30140 gene locus_tag LOCUS_02480 29451 30140 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191933.1 protein_id gnl|my_center|LOCUS_02480 31497 30193 gene locus_tag LOCUS_02490 gene rlmD 31497 30193 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192701.1 protein_id gnl|my_center|LOCUS_02490 31836 31534 gene locus_tag LOCUS_02500 31836 31534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 32228 33187 gene locus_tag LOCUS_02510 32228 33187 CDS product beta-propeller fold lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192001.1 protein_id gnl|my_center|LOCUS_02510 33209 33964 gene locus_tag LOCUS_02520 33209 33964 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448285.1 protein_id gnl|my_center|LOCUS_02520 33961 34923 gene locus_tag LOCUS_02530 33961 34923 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524705.1 protein_id gnl|my_center|LOCUS_02530 36871 34979 gene locus_tag LOCUS_02540 gene htpG 36871 34979 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185742.1 protein_id gnl|my_center|LOCUS_02540 37511 36924 gene locus_tag LOCUS_02550 37511 36924 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063992.1 protein_id gnl|my_center|LOCUS_02550 38965 37514 gene locus_tag LOCUS_02560 gene nuoN 38965 37514 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186468.1 protein_id gnl|my_center|LOCUS_02560 40457 38976 gene locus_tag LOCUS_02570 40457 38976 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247436.1 protein_id gnl|my_center|LOCUS_02570 42429 40471 gene locus_tag LOCUS_02580 gene nuoL 42429 40471 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526462.1 protein_id gnl|my_center|LOCUS_02580 42739 42434 gene locus_tag LOCUS_02590 gene nuoK 42739 42434 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 protein_id gnl|my_center|LOCUS_02590 43335 42739 gene locus_tag LOCUS_02600 43335 42739 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185672.1 protein_id gnl|my_center|LOCUS_02600 43827 43348 gene locus_tag LOCUS_02610 gene nuoI 43827 43348 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813924.1 protein_id gnl|my_center|LOCUS_02610 44883 43843 gene locus_tag LOCUS_02620 gene nuoH 44883 43843 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813926.1 protein_id gnl|my_center|LOCUS_02620 47261 44883 gene locus_tag LOCUS_02630 gene nuoG 47261 44883 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543813.1 protein_id gnl|my_center|LOCUS_02630 48562 47264 gene locus_tag LOCUS_02640 gene nuoF 48562 47264 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813930.1 protein_id gnl|my_center|LOCUS_02640 49035 48559 gene locus_tag LOCUS_02650 gene nuoE 49035 48559 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185492.1 protein_id gnl|my_center|LOCUS_02650 50303 49038 gene locus_tag LOCUS_02660 50303 49038 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185833.1 protein_id gnl|my_center|LOCUS_02660 50896 50303 gene locus_tag LOCUS_02670 50896 50303 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186121.1 protein_id gnl|my_center|LOCUS_02670 51378 50896 gene locus_tag LOCUS_02680 51378 50896 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 protein_id gnl|my_center|LOCUS_02680 51774 51418 gene locus_tag LOCUS_02690 51774 51418 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958235.1 protein_id gnl|my_center|LOCUS_02690 54380 52098 gene locus_tag LOCUS_02700 54380 52098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 54645 54561 gene locus_tag LOCUS_t00020 54645 54561 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 55027 54683 gene locus_tag LOCUS_02710 55027 54683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 55796 55038 gene locus_tag LOCUS_02720 gene tpiA 55796 55038 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037661.1 protein_id gnl|my_center|LOCUS_02720 56673 55879 gene locus_tag LOCUS_02730 gene pstB 56673 55879 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448479.1 protein_id gnl|my_center|LOCUS_02730 57546 56686 gene locus_tag LOCUS_02740 gene pstA 57546 56686 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809638.1 protein_id gnl|my_center|LOCUS_02740 58460 57549 gene locus_tag LOCUS_02750 gene pstC 58460 57549 CDS product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193912.1 protein_id gnl|my_center|LOCUS_02750 59746 58703 gene locus_tag LOCUS_02760 gene pstS 59746 58703 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930170.1 protein_id gnl|my_center|LOCUS_02760 61313 59829 gene locus_tag LOCUS_02770 gene ppx 61313 59829 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192703.1 protein_id gnl|my_center|LOCUS_02770 62164 61382 gene locus_tag LOCUS_02780 62164 61382 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266561.1 protein_id gnl|my_center|LOCUS_02780 62295 64421 gene locus_tag LOCUS_02790 gene ppk1 62295 64421 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950968.1 protein_id gnl|my_center|LOCUS_02790 66259 64904 gene locus_tag LOCUS_02800 gene glmM 66259 64904 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266863.1 protein_id gnl|my_center|LOCUS_02800 67142 66273 gene locus_tag LOCUS_02810 gene folP 67142 66273 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113907.1 protein_id gnl|my_center|LOCUS_02810 69049 67160 gene locus_tag LOCUS_02820 gene ftsH 69049 67160 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039235.1 protein_id gnl|my_center|LOCUS_02820 69738 69133 gene locus_tag LOCUS_02830 gene rlmE 69738 69133 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235573.1 protein_id gnl|my_center|LOCUS_02830 70250 69765 gene locus_tag LOCUS_02840 70250 69765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 70719 70243 gene locus_tag LOCUS_02850 gene greA 70719 70243 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809615.1 protein_id gnl|my_center|LOCUS_02850 73996 70760 gene locus_tag LOCUS_02860 gene carB 73996 70760 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193866.1 protein_id gnl|my_center|LOCUS_02860 75151 74000 gene locus_tag LOCUS_02870 gene carA 75151 74000 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198695.1 protein_id gnl|my_center|LOCUS_02870 76128 75316 gene locus_tag LOCUS_02880 gene dapB 76128 75316 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766439.1 protein_id gnl|my_center|LOCUS_02880 76643 76128 gene locus_tag LOCUS_02890 76643 76128 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113904.1 protein_id gnl|my_center|LOCUS_02890 76706 77143 gene locus_tag LOCUS_02900 gene fur 76706 77143 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194273.1 protein_id gnl|my_center|LOCUS_02900 78015 77140 gene locus_tag LOCUS_02910 gene sucD 78015 77140 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550822.1 protein_id gnl|my_center|LOCUS_02910 79181 78018 gene locus_tag LOCUS_02920 gene sucC 79181 78018 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189251.1 protein_id gnl|my_center|LOCUS_02920 79779 79240 gene locus_tag LOCUS_02930 79779 79240 CDS product DUF2889 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930988.1 protein_id gnl|my_center|LOCUS_02930 79808 81808 gene locus_tag LOCUS_02940 79808 81808 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023995440.1 protein_id gnl|my_center|LOCUS_02940 81805 82932 gene locus_tag LOCUS_02950 81805 82932 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708457.1 protein_id gnl|my_center|LOCUS_02950 84225 83062 gene locus_tag LOCUS_02960 84225 83062 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064710.1 protein_id gnl|my_center|LOCUS_02960 84371 85273 gene locus_tag LOCUS_02970 gene ttcA 84371 85273 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816357.1 protein_id gnl|my_center|LOCUS_02970 85270 86511 gene locus_tag LOCUS_02980 85270 86511 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261142.1 protein_id gnl|my_center|LOCUS_02980 87424 86561 gene locus_tag LOCUS_02990 gene metF 87424 86561 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198631.1 protein_id gnl|my_center|LOCUS_02990 88741 87431 gene locus_tag LOCUS_03000 gene ahcY 88741 87431 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947737.1 protein_id gnl|my_center|LOCUS_03000 89930 88773 gene locus_tag LOCUS_03010 gene metK 89930 88773 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199069.1 protein_id gnl|my_center|LOCUS_03010 90071 90877 gene locus_tag LOCUS_03020 90071 90877 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010356740.1 protein_id gnl|my_center|LOCUS_03020 91002 91868 gene locus_tag LOCUS_03030 gene dapF 91002 91868 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545660.1 protein_id gnl|my_center|LOCUS_03030 91855 92511 gene locus_tag LOCUS_03040 91855 92511 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944790.1 protein_id gnl|my_center|LOCUS_03040 92498 93409 gene locus_tag LOCUS_03050 gene xerC 92498 93409 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064714.1 protein_id gnl|my_center|LOCUS_03050 94586 93438 gene locus_tag LOCUS_03060 94586 93438 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113168.1 protein_id gnl|my_center|LOCUS_03060 95781 94549 gene locus_tag LOCUS_03070 95781 94549 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931221.1 protein_id gnl|my_center|LOCUS_03070 95965 97158 gene locus_tag LOCUS_03080 gene tyrS 95965 97158 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071526.1 protein_id gnl|my_center|LOCUS_03080 97149 98585 gene locus_tag LOCUS_03090 97149 98585 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338470.1 protein_id gnl|my_center|LOCUS_03090 99280 98573 gene locus_tag LOCUS_03100 gene coq7 99280 98573 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011214319.1 protein_id gnl|my_center|LOCUS_03100 100236 99331 gene locus_tag LOCUS_03110 gene argB 100236 99331 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551508.1 protein_id gnl|my_center|LOCUS_03110 100482 101627 gene locus_tag LOCUS_03120 100482 101627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 101727 102170 gene locus_tag LOCUS_03130 101727 102170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 105476 102228 gene locus_tag LOCUS_03140 105476 102228 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085718.1 protein_id gnl|my_center|LOCUS_03140 106987 105569 gene locus_tag LOCUS_03150 106987 105569 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927123.1 protein_id gnl|my_center|LOCUS_03150 108228 107038 gene locus_tag LOCUS_03160 108228 107038 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085719.1 protein_id gnl|my_center|LOCUS_03160 111341 108282 gene locus_tag LOCUS_03170 111341 108282 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085718.1 protein_id gnl|my_center|LOCUS_03170 108419 108517 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 112099 111548 gene locus_tag LOCUS_03180 112099 111548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 112196 112002 gene locus_tag LOCUS_03190 112196 112002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 113097 112309 gene locus_tag LOCUS_03200 gene trpC 113097 112309 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522001.1 protein_id gnl|my_center|LOCUS_03200 114113 113094 gene locus_tag LOCUS_03210 gene trpD 114113 113094 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217365.1 protein_id gnl|my_center|LOCUS_03210 114531 114100 gene locus_tag LOCUS_03220 114531 114100 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767887.1 protein_id gnl|my_center|LOCUS_03220 115679 114645 gene locus_tag LOCUS_03230 115679 114645 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941134.1 protein_id gnl|my_center|LOCUS_03230 116126 115776 gene locus_tag LOCUS_03240 gene erpA 116126 115776 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194247.1 protein_id gnl|my_center|LOCUS_03240 117223 116192 gene locus_tag LOCUS_03250 gene argC 117223 116192 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113169.1 protein_id gnl|my_center|LOCUS_03250 117715 117269 gene locus_tag LOCUS_03260 117715 117269 CDS product pseudoazurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314643.1 protein_id gnl|my_center|LOCUS_03260 118272 117880 gene locus_tag LOCUS_03270 gene rpsI 118272 117880 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814889.1 protein_id gnl|my_center|LOCUS_03270 118712 118284 gene locus_tag LOCUS_03280 gene rplM 118712 118284 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522094.1 protein_id gnl|my_center|LOCUS_03280 119235 118771 gene locus_tag LOCUS_03290 gene nudB 119235 118771 CDS product dihydroneopterin triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189197.1 protein_id gnl|my_center|LOCUS_03290 121970 119232 gene locus_tag LOCUS_03300 121970 119232 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814074.1 protein_id gnl|my_center|LOCUS_03300 122177 122440 gene locus_tag LOCUS_03310 122177 122440 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929971.1 protein_id gnl|my_center|LOCUS_03310 >Feature sequence003 <1 1072 gene locus_tag LOCUS_03320 <1 1072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003084250.1:EAL domain-containing protein 1114 1500 gene locus_tag LOCUS_03330 1114 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 1510 2550 gene locus_tag LOCUS_03340 1510 2550 CDS product pepsin-like aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066614.1 protein_id gnl|my_center|LOCUS_03340 3010 5850 gene locus_tag LOCUS_03350 3010 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 5867 8977 gene locus_tag LOCUS_03360 5867 8977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 9617 9186 gene locus_tag LOCUS_03370 9617 9186 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940924.1 protein_id gnl|my_center|LOCUS_03370 9776 10144 gene locus_tag LOCUS_03380 gene gloA 9776 10144 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814410.1 protein_id gnl|my_center|LOCUS_03380 10155 10817 gene locus_tag LOCUS_03390 10155 10817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477695.1 protein_id gnl|my_center|LOCUS_03390 10918 11526 gene locus_tag LOCUS_03400 10918 11526 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067204.1 protein_id gnl|my_center|LOCUS_03400 12214 11993 gene locus_tag LOCUS_03410 12214 11993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 12761 12111 gene locus_tag LOCUS_03420 12761 12111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 14959 12842 gene locus_tag LOCUS_03430 14959 12842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 15255 14956 gene locus_tag LOCUS_03440 15255 14956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 15668 15252 gene locus_tag LOCUS_03450 15668 15252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 15916 15665 gene locus_tag LOCUS_03460 15916 15665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 17017 16088 gene locus_tag LOCUS_03470 17017 16088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 18092 17028 gene locus_tag LOCUS_03480 18092 17028 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073356551.1 protein_id gnl|my_center|LOCUS_03480 18492 18417 gene locus_tag LOCUS_t00030 18492 18417 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 18951 18511 gene locus_tag LOCUS_03490 18951 18511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 19560 18955 gene locus_tag LOCUS_03500 19560 18955 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185176.1 protein_id gnl|my_center|LOCUS_03500 20328 19594 gene locus_tag LOCUS_03510 20328 19594 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199892.1 protein_id gnl|my_center|LOCUS_03510 19997 20006 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21536 20325 gene locus_tag LOCUS_03520 21536 20325 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094159.1 protein_id gnl|my_center|LOCUS_03520 22141 21539 gene locus_tag LOCUS_03530 gene petA 22141 21539 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215005.1 protein_id gnl|my_center|LOCUS_03530 22322 23497 gene locus_tag LOCUS_03540 22322 23497 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204991.1 protein_id gnl|my_center|LOCUS_03540 24302 23529 gene locus_tag LOCUS_03550 gene tatC 24302 23529 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765541.1 protein_id gnl|my_center|LOCUS_03550 24829 24299 gene locus_tag LOCUS_03560 24829 24299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 25087 24845 gene locus_tag LOCUS_03570 25087 24845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 25534 25181 gene locus_tag LOCUS_03580 25534 25181 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687490.1 protein_id gnl|my_center|LOCUS_03580 25885 25571 gene locus_tag LOCUS_03590 25885 25571 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103458.1 protein_id gnl|my_center|LOCUS_03590 26274 25885 gene locus_tag LOCUS_03600 gene hisI 26274 25885 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105339.1 protein_id gnl|my_center|LOCUS_03600 27038 26271 gene locus_tag LOCUS_03610 gene hisF 27038 26271 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 protein_id gnl|my_center|LOCUS_03610 27792 27040 gene locus_tag LOCUS_03620 gene hisA 27792 27040 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199906.1 protein_id gnl|my_center|LOCUS_03620 28453 27818 gene locus_tag LOCUS_03630 gene hisH 28453 27818 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199907.1 protein_id gnl|my_center|LOCUS_03630 29078 28473 gene locus_tag LOCUS_03640 gene hisB 29078 28473 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199911.1 protein_id gnl|my_center|LOCUS_03640 30154 29075 gene locus_tag LOCUS_03650 gene hisC 30154 29075 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199913.1 protein_id gnl|my_center|LOCUS_03650 31460 30156 gene locus_tag LOCUS_03660 gene hisD 31460 30156 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527888.1 protein_id gnl|my_center|LOCUS_03660 32152 31457 gene locus_tag LOCUS_03670 gene hisG 32152 31457 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199915.1 protein_id gnl|my_center|LOCUS_03670 33428 32163 gene locus_tag LOCUS_03680 gene murA 33428 32163 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185050.1 protein_id gnl|my_center|LOCUS_03680 33683 33438 gene locus_tag LOCUS_03690 33683 33438 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199917.1 protein_id gnl|my_center|LOCUS_03690 34475 33717 gene locus_tag LOCUS_03700 34475 33717 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815783.1 protein_id gnl|my_center|LOCUS_03700 35214 34477 gene locus_tag LOCUS_03710 35214 34477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 35510 35211 gene locus_tag LOCUS_03720 35510 35211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 36139 35507 gene locus_tag LOCUS_03730 36139 35507 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199924.1 protein_id gnl|my_center|LOCUS_03730 36630 36136 gene locus_tag LOCUS_03740 gene mlaD 36630 36136 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199927.1 protein_id gnl|my_center|LOCUS_03740 37427 36630 gene locus_tag LOCUS_03750 gene mlaE 37427 36630 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931637.1 protein_id gnl|my_center|LOCUS_03750 38227 37424 gene locus_tag LOCUS_03760 38227 37424 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199931.1 protein_id gnl|my_center|LOCUS_03760 38917 38243 gene locus_tag LOCUS_03770 gene trmB 38917 38243 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222361.1 protein_id gnl|my_center|LOCUS_03770 39771 38962 gene locus_tag LOCUS_03780 39771 38962 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931559.1 protein_id gnl|my_center|LOCUS_03780 39976 39773 gene locus_tag LOCUS_03790 gene thiS 39976 39773 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807812.1 protein_id gnl|my_center|LOCUS_03790 40526 39936 gene locus_tag LOCUS_03800 40526 39936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 41674 40535 gene locus_tag LOCUS_03810 gene hemW 41674 40535 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114885.1 protein_id gnl|my_center|LOCUS_03810 42258 41671 gene locus_tag LOCUS_03820 gene rdgB 42258 41671 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186211.1 protein_id gnl|my_center|LOCUS_03820 42983 42255 gene locus_tag LOCUS_03830 gene rph 42983 42255 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186400.1 protein_id gnl|my_center|LOCUS_03830 43036 43965 gene locus_tag LOCUS_03840 43036 43965 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687657.1 protein_id gnl|my_center|LOCUS_03840 43966 44568 gene locus_tag LOCUS_03850 gene gmk 43966 44568 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515790.1 protein_id gnl|my_center|LOCUS_03850 44594 44800 gene locus_tag LOCUS_03860 gene rpoZ 44594 44800 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185855.1 protein_id gnl|my_center|LOCUS_03860 44818 46959 gene locus_tag LOCUS_03870 44818 46959 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811115.1 protein_id gnl|my_center|LOCUS_03870 46971 47363 gene locus_tag LOCUS_03880 46971 47363 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116996.1 protein_id gnl|my_center|LOCUS_03880 47453 47380 gene locus_tag LOCUS_t00040 47453 47380 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 47676 48611 gene locus_tag LOCUS_03890 gene mutY 47676 48611 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957904.1 protein_id gnl|my_center|LOCUS_03890 49431 48580 gene locus_tag LOCUS_03900 gene rapZ 49431 48580 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195227.1 protein_id gnl|my_center|LOCUS_03900 50396 49428 gene locus_tag LOCUS_03910 gene hprK 50396 49428 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225452.1 protein_id gnl|my_center|LOCUS_03910 50862 50383 gene locus_tag LOCUS_03920 50862 50383 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929966.1 protein_id gnl|my_center|LOCUS_03920 51194 50868 gene locus_tag LOCUS_03930 gene hpf 51194 50868 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_03930 52616 51222 gene locus_tag LOCUS_03940 52616 51222 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195216.1 protein_id gnl|my_center|LOCUS_03940 53348 52620 gene locus_tag LOCUS_03950 gene lptB 53348 52620 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195214.1 protein_id gnl|my_center|LOCUS_03950 53968 53345 gene locus_tag LOCUS_03960 gene lptA 53968 53345 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936242.1 protein_id gnl|my_center|LOCUS_03960 54512 53928 gene locus_tag LOCUS_03970 54512 53928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 55042 54500 gene locus_tag LOCUS_03980 55042 54500 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815172.1 protein_id gnl|my_center|LOCUS_03980 56016 55039 gene locus_tag LOCUS_03990 56016 55039 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_03990 56112 58130 gene locus_tag LOCUS_04000 56112 58130 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195204.1 protein_id gnl|my_center|LOCUS_04000 58135 60177 gene locus_tag LOCUS_04010 gene recG 58135 60177 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446218.1 protein_id gnl|my_center|LOCUS_04010 60183 61028 gene locus_tag LOCUS_04020 gene ubiA 60183 61028 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194359.1 protein_id gnl|my_center|LOCUS_04020 61526 61035 gene locus_tag LOCUS_04030 61526 61035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 63032 61611 gene locus_tag LOCUS_04040 gene dacB 63032 61611 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064320.1 protein_id gnl|my_center|LOCUS_04040 63260 63550 gene locus_tag LOCUS_04050 gene groES 63260 63550 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186661.1 protein_id gnl|my_center|LOCUS_04050 63615 65258 gene locus_tag LOCUS_04060 gene groL 63615 65258 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538665.1 protein_id gnl|my_center|LOCUS_04060 65372 66799 gene locus_tag LOCUS_04070 gene argH 65372 66799 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704829.1 protein_id gnl|my_center|LOCUS_04070 66959 68233 gene locus_tag LOCUS_04080 gene lysA 66959 68233 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704446.1 protein_id gnl|my_center|LOCUS_04080 68366 68917 gene locus_tag LOCUS_04090 68366 68917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 69755 68901 gene locus_tag LOCUS_04100 gene aroE 69755 68901 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931247.1 protein_id gnl|my_center|LOCUS_04100 70135 69740 gene locus_tag LOCUS_04110 70135 69740 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191860.1 protein_id gnl|my_center|LOCUS_04110 70494 71906 gene locus_tag LOCUS_04120 gene glnA 70494 71906 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811164.1 protein_id gnl|my_center|LOCUS_04120 71995 72750 gene locus_tag LOCUS_04130 71995 72750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 74356 73190 gene locus_tag LOCUS_04140 74356 73190 CDS product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214676.1 protein_id gnl|my_center|LOCUS_04140 75184 74378 gene locus_tag LOCUS_04150 75184 74378 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620333.1 protein_id gnl|my_center|LOCUS_04150 75349 79482 gene locus_tag LOCUS_04160 75349 79482 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122252.1 protein_id gnl|my_center|LOCUS_04160 81128 79461 gene locus_tag LOCUS_04170 gene ettA 81128 79461 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186903.1 protein_id gnl|my_center|LOCUS_04170 81366 81917 gene locus_tag LOCUS_04180 81366 81917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 82686 81985 gene locus_tag LOCUS_04190 82686 81985 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693189.1 protein_id gnl|my_center|LOCUS_04190 82832 84427 gene locus_tag LOCUS_04200 gene nadB 82832 84427 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186553.1 protein_id gnl|my_center|LOCUS_04200 84466 85338 gene locus_tag LOCUS_04210 gene nadC 84466 85338 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406592.1 protein_id gnl|my_center|LOCUS_04210 85331 86428 gene locus_tag LOCUS_04220 gene nadA 85331 86428 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185886.1 protein_id gnl|my_center|LOCUS_04220 86497 86877 gene locus_tag LOCUS_04230 86497 86877 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191357.1 protein_id gnl|my_center|LOCUS_04230 87903 86947 gene locus_tag LOCUS_04240 87903 86947 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813337.1 protein_id gnl|my_center|LOCUS_04240 88657 87905 gene locus_tag LOCUS_04250 88657 87905 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064586.1 protein_id gnl|my_center|LOCUS_04250 89876 88692 gene locus_tag LOCUS_04260 89876 88692 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810108.1 protein_id gnl|my_center|LOCUS_04260 92256 89890 gene locus_tag LOCUS_04270 92256 89890 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189629.1 protein_id gnl|my_center|LOCUS_04270 92401 94128 gene locus_tag LOCUS_04280 gene pabB 92401 94128 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722110.1 protein_id gnl|my_center|LOCUS_04280 95014 94106 gene locus_tag LOCUS_04290 95014 94106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 >Feature sequence004 1319 513 gene locus_tag LOCUS_04300 1319 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 3775 1316 gene locus_tag LOCUS_04310 gene trbE 3775 1316 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090993.1 protein_id gnl|my_center|LOCUS_04310 4098 3772 gene locus_tag LOCUS_04320 4098 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 4331 4089 gene locus_tag LOCUS_04330 4331 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 5376 4411 gene locus_tag LOCUS_04340 5376 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 5551 5330 gene locus_tag LOCUS_04350 5551 5330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 5980 5558 gene locus_tag LOCUS_04360 5980 5558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 5942 6550 gene locus_tag LOCUS_04370 5942 6550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 6543 7568 gene locus_tag LOCUS_04380 6543 7568 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189905.1 protein_id gnl|my_center|LOCUS_04380 7565 8971 gene locus_tag LOCUS_04390 7565 8971 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204094.1 protein_id gnl|my_center|LOCUS_04390 9285 9716 gene locus_tag LOCUS_04400 9285 9716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 9718 11295 gene locus_tag LOCUS_04410 9718 11295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 11292 11615 gene locus_tag LOCUS_04420 11292 11615 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192342.1 protein_id gnl|my_center|LOCUS_04420 11626 12228 gene locus_tag LOCUS_04430 gene recR 11626 12228 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521324.1 protein_id gnl|my_center|LOCUS_04430 12246 13523 gene locus_tag LOCUS_04440 gene serS 12246 13523 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224981.1 protein_id gnl|my_center|LOCUS_04440 13516 14229 gene locus_tag LOCUS_04450 gene ispD 13516 14229 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051360364.1 protein_id gnl|my_center|LOCUS_04450 14207 14680 gene locus_tag LOCUS_04460 gene ispF 14207 14680 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_04460 15293 14691 gene locus_tag LOCUS_04470 15293 14691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 16027 15362 gene locus_tag LOCUS_04480 16027 15362 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064061.1 protein_id gnl|my_center|LOCUS_04480 17040 16036 gene locus_tag LOCUS_04490 17040 16036 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388811.1 protein_id gnl|my_center|LOCUS_04490 17094 17684 gene locus_tag LOCUS_04500 17094 17684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 17777 18418 gene locus_tag LOCUS_04510 gene rqpR 17777 18418 CDS product response regulator transcription factor RqpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197176.1 protein_id gnl|my_center|LOCUS_04510 21360 18421 gene locus_tag LOCUS_04520 21360 18421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 21815 21363 gene locus_tag LOCUS_04530 21815 21363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 22324 21815 gene locus_tag LOCUS_04540 22324 21815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 22865 22683 gene locus_tag LOCUS_04550 22865 22683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 24096 24021 gene locus_tag LOCUS_t00050 24096 24021 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 24298 25563 gene locus_tag LOCUS_04560 24298 25563 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 protein_id gnl|my_center|LOCUS_04560 25560 26213 gene locus_tag LOCUS_04570 gene nadD 25560 26213 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161458274.1 protein_id gnl|my_center|LOCUS_04570 26210 26611 gene locus_tag LOCUS_04580 26210 26611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 26641 27078 gene locus_tag LOCUS_04590 gene rlmH 26641 27078 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186098.1 protein_id gnl|my_center|LOCUS_04590 27088 28542 gene locus_tag LOCUS_04600 gene rng 27088 28542 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522445.1 protein_id gnl|my_center|LOCUS_04600 29104 28535 gene locus_tag LOCUS_04610 29104 28535 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194943.1 protein_id gnl|my_center|LOCUS_04610 29919 29101 gene locus_tag LOCUS_04620 gene proC 29919 29101 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522133.1 protein_id gnl|my_center|LOCUS_04620 30596 29919 gene locus_tag LOCUS_04630 30596 29919 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084549.1 protein_id gnl|my_center|LOCUS_04630 30656 31033 gene locus_tag LOCUS_04640 30656 31033 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_04640 31039 31770 gene locus_tag LOCUS_04650 gene ubiE 31039 31770 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815111.1 protein_id gnl|my_center|LOCUS_04650 31764 32351 gene locus_tag LOCUS_04660 31764 32351 CDS product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260924.1 protein_id gnl|my_center|LOCUS_04660 32351 33901 gene locus_tag LOCUS_04670 gene ubiB 32351 33901 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189815.1 protein_id gnl|my_center|LOCUS_04670 33929 34465 gene locus_tag LOCUS_04680 33929 34465 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524734.1 protein_id gnl|my_center|LOCUS_04680 34462 35076 gene locus_tag LOCUS_04690 34462 35076 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188999.1 protein_id gnl|my_center|LOCUS_04690 35085 35510 gene locus_tag LOCUS_04700 gene hemJ 35085 35510 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377457.1 protein_id gnl|my_center|LOCUS_04700 35521 36687 gene locus_tag LOCUS_04710 35521 36687 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194083.1 protein_id gnl|my_center|LOCUS_04710 36707 37459 gene locus_tag LOCUS_04720 gene phoB 36707 37459 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815113.1 protein_id gnl|my_center|LOCUS_04720 37525 38826 gene locus_tag LOCUS_04730 gene phoR 37525 38826 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197666.1 protein_id gnl|my_center|LOCUS_04730 38831 39127 gene locus_tag LOCUS_04740 38831 39127 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686964.1 protein_id gnl|my_center|LOCUS_04740 39127 40854 gene locus_tag LOCUS_04750 gene ptsP 39127 40854 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522912.1 protein_id gnl|my_center|LOCUS_04750 41786 40878 gene locus_tag LOCUS_04760 41786 40878 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930443.1 protein_id gnl|my_center|LOCUS_04760 42595 41942 gene locus_tag LOCUS_04770 gene pyrE 42595 41942 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217982.1 protein_id gnl|my_center|LOCUS_04770 43870 42665 gene locus_tag LOCUS_04780 43870 42665 CDS product muropeptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040617.1 protein_id gnl|my_center|LOCUS_04780 44501 43914 gene locus_tag LOCUS_04790 gene metW 44501 43914 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688371.1 protein_id gnl|my_center|LOCUS_04790 45649 44498 gene locus_tag LOCUS_04800 45649 44498 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198305.1 protein_id gnl|my_center|LOCUS_04800 47089 45650 gene locus_tag LOCUS_04810 gene gatB 47089 45650 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552444.1 protein_id gnl|my_center|LOCUS_04810 48561 47086 gene locus_tag LOCUS_04820 gene gatA 48561 47086 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525859.1 protein_id gnl|my_center|LOCUS_04820 48862 48569 gene locus_tag LOCUS_04830 gene gatC 48862 48569 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555109.1 protein_id gnl|my_center|LOCUS_04830 48937 49980 gene locus_tag LOCUS_04840 48937 49980 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189550.1 protein_id gnl|my_center|LOCUS_04840 50011 50868 gene locus_tag LOCUS_04850 gene mreC 50011 50868 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369462.1 protein_id gnl|my_center|LOCUS_04850 50873 51391 gene locus_tag LOCUS_04860 50873 51391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 51401 53272 gene locus_tag LOCUS_04870 gene mrdA 51401 53272 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204769.1 protein_id gnl|my_center|LOCUS_04870 53269 54375 gene locus_tag LOCUS_04880 gene rodA 53269 54375 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957655.1 protein_id gnl|my_center|LOCUS_04880 54400 54933 gene locus_tag LOCUS_04890 54400 54933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 55865 54891 gene locus_tag LOCUS_04900 gene lipA 55865 54891 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807146.1 protein_id gnl|my_center|LOCUS_04900 56533 55862 gene locus_tag LOCUS_04910 gene lipB 56533 55862 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488805.1 protein_id gnl|my_center|LOCUS_04910 56830 56546 gene locus_tag LOCUS_04920 56830 56546 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021138.1 protein_id gnl|my_center|LOCUS_04920 57660 56827 gene locus_tag LOCUS_04930 57660 56827 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189800.1 protein_id gnl|my_center|LOCUS_04930 58805 57657 gene locus_tag LOCUS_04940 58805 57657 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064727.1 protein_id gnl|my_center|LOCUS_04940 60051 58822 gene locus_tag LOCUS_04950 60051 58822 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387806.1 protein_id gnl|my_center|LOCUS_04950 60347 60090 gene locus_tag LOCUS_04960 60347 60090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 61189 60356 gene locus_tag LOCUS_04970 61189 60356 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527983.1 protein_id gnl|my_center|LOCUS_04970 62408 61317 gene locus_tag LOCUS_04980 gene ychF 62408 61317 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186874.1 protein_id gnl|my_center|LOCUS_04980 63002 62418 gene locus_tag LOCUS_04990 gene pth 63002 62418 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687802.1 protein_id gnl|my_center|LOCUS_04990 63713 63045 gene locus_tag LOCUS_05000 63713 63045 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200150.1 protein_id gnl|my_center|LOCUS_05000 64725 63775 gene locus_tag LOCUS_05010 64725 63775 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931310.1 protein_id gnl|my_center|LOCUS_05010 64833 64759 gene locus_tag LOCUS_t00060 64833 64759 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 <65411 64840 gene locus_tag LOCUS_05020 <65411 64840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_133845424.1:4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase >Feature sequence005 922 653 gene locus_tag LOCUS_05030 gene rpsO 922 653 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217790.1 protein_id gnl|my_center|LOCUS_05030 1321 1022 gene locus_tag LOCUS_05040 1321 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 3658 1334 gene locus_tag LOCUS_05050 3658 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 4474 3671 gene locus_tag LOCUS_05060 4474 3671 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_05060 4959 4603 gene locus_tag LOCUS_05070 4959 4603 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124705.1 protein_id gnl|my_center|LOCUS_05070 6447 5026 gene locus_tag LOCUS_05080 6447 5026 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124704.1 protein_id gnl|my_center|LOCUS_05080 8429 6576 gene locus_tag LOCUS_05090 8429 6576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 8638 9108 gene locus_tag LOCUS_05100 8638 9108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 9594 9118 gene locus_tag LOCUS_05110 9594 9118 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524740.1 protein_id gnl|my_center|LOCUS_05110 10064 9591 gene locus_tag LOCUS_05120 gene bcp 10064 9591 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975630.1 protein_id gnl|my_center|LOCUS_05120 12700 10121 gene locus_tag LOCUS_05130 gene mutS 12700 10121 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193335.1 protein_id gnl|my_center|LOCUS_05130 12918 14084 gene locus_tag LOCUS_05140 12918 14084 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185515.1 protein_id gnl|my_center|LOCUS_05140 14354 14067 gene locus_tag LOCUS_05150 14354 14067 CDS product H-NS histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532451.1 protein_id gnl|my_center|LOCUS_05150 14575 14650 gene locus_tag LOCUS_t00070 14575 14650 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 14848 16053 gene locus_tag LOCUS_05160 14848 16053 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938819.1 protein_id gnl|my_center|LOCUS_05160 16586 16912 gene locus_tag LOCUS_05170 16586 16912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 16909 18456 gene locus_tag LOCUS_05180 16909 18456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 18453 19001 gene locus_tag LOCUS_05190 18453 19001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 19116 19496 gene locus_tag LOCUS_05200 19116 19496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 19512 19649 gene locus_tag LOCUS_05210 19512 19649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 19652 20311 gene locus_tag LOCUS_05220 19652 20311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 20327 20587 gene locus_tag LOCUS_05230 20327 20587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 21249 21644 gene locus_tag LOCUS_05240 21249 21644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 21677 23401 gene locus_tag LOCUS_05250 21677 23401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 24183 24416 gene locus_tag LOCUS_05260 24183 24416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 24416 24850 gene locus_tag LOCUS_05270 24416 24850 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529815.1 protein_id gnl|my_center|LOCUS_05270 25380 29120 gene locus_tag LOCUS_05280 25380 29120 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975826.1 protein_id gnl|my_center|LOCUS_05280 30274 29159 gene locus_tag LOCUS_05290 30274 29159 CDS product YbdK family carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195787.1 protein_id gnl|my_center|LOCUS_05290 31454 30279 gene locus_tag LOCUS_05300 31454 30279 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195784.1 protein_id gnl|my_center|LOCUS_05300 31549 32430 gene locus_tag LOCUS_05310 31549 32430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 32439 33182 gene locus_tag LOCUS_05320 32439 33182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 34381 33185 gene locus_tag LOCUS_05330 gene fucP 34381 33185 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036694.1 protein_id gnl|my_center|LOCUS_05330 35720 34386 gene locus_tag LOCUS_05340 35720 34386 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256266.1 protein_id gnl|my_center|LOCUS_05340 35912 36820 gene locus_tag LOCUS_05350 35912 36820 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895705.1 protein_id gnl|my_center|LOCUS_05350 36843 38510 gene locus_tag LOCUS_05360 gene pgm 36843 38510 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268077.1 protein_id gnl|my_center|LOCUS_05360 38609 40867 gene locus_tag LOCUS_05370 38609 40867 CDS product arginine/lysine/ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191939.1 protein_id gnl|my_center|LOCUS_05370 40956 43742 gene locus_tag LOCUS_05380 40956 43742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 43771 44355 gene locus_tag LOCUS_05390 43771 44355 CDS product DUF2867 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208083.1 protein_id gnl|my_center|LOCUS_05390 44654 45025 gene locus_tag LOCUS_05400 44654 45025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 44952 45248 gene locus_tag LOCUS_05410 44952 45248 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057517.1 protein_id gnl|my_center|LOCUS_05410 45852 45421 gene locus_tag LOCUS_05420 45852 45421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 47959 45980 gene locus_tag LOCUS_05430 47959 45980 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958448.1 protein_id gnl|my_center|LOCUS_05430 50656 47963 gene locus_tag LOCUS_05440 gene aceE 50656 47963 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444499.1 protein_id gnl|my_center|LOCUS_05440 51833 50712 gene locus_tag LOCUS_05450 gene lptF 51833 50712 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040214.1 protein_id gnl|my_center|LOCUS_05450 52182 52256 gene locus_tag LOCUS_t00080 52182 52256 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 53056 52499 gene locus_tag LOCUS_05460 53056 52499 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197759.1 protein_id gnl|my_center|LOCUS_05460 54131 53223 gene locus_tag LOCUS_05470 54131 53223 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920971.1 protein_id gnl|my_center|LOCUS_05470 54265 55866 gene locus_tag LOCUS_05480 54265 55866 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257649.1 protein_id gnl|my_center|LOCUS_05480 >Feature sequence006 3 923 gene locus_tag LOCUS_05490 3 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 1292 1217 gene locus_tag LOCUS_t00090 1292 1217 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1370 2899 gene locus_tag LOCUS_05500 gene murJ 1370 2899 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816533.1 protein_id gnl|my_center|LOCUS_05500 3616 2864 gene locus_tag LOCUS_05510 3616 2864 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194827.1 protein_id gnl|my_center|LOCUS_05510 3738 4676 gene locus_tag LOCUS_05520 gene cysB 3738 4676 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382487.1 protein_id gnl|my_center|LOCUS_05520 4782 5705 gene locus_tag LOCUS_05530 4782 5705 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535897.1 protein_id gnl|my_center|LOCUS_05530 5720 8566 gene locus_tag LOCUS_05540 gene ileS 5720 8566 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699451.1 protein_id gnl|my_center|LOCUS_05540 8559 9041 gene locus_tag LOCUS_05550 gene lspA 8559 9041 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186086.1 protein_id gnl|my_center|LOCUS_05550 9038 9985 gene locus_tag LOCUS_05560 gene ispH 9038 9985 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930264.1 protein_id gnl|my_center|LOCUS_05560 10452 9994 gene locus_tag LOCUS_05570 10452 9994 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391535.1 protein_id gnl|my_center|LOCUS_05570 10609 10875 gene locus_tag LOCUS_05580 gene rpsT 10609 10875 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189743.1 protein_id gnl|my_center|LOCUS_05580 10992 12167 gene locus_tag LOCUS_05590 10992 12167 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039570.1 protein_id gnl|my_center|LOCUS_05590 12164 13072 gene locus_tag LOCUS_05600 gene argF 12164 13072 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190177.1 protein_id gnl|my_center|LOCUS_05600 13108 14328 gene locus_tag LOCUS_05610 13108 14328 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_05610 14344 14829 gene locus_tag LOCUS_05620 14344 14829 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189237.1 protein_id gnl|my_center|LOCUS_05620 15175 14810 gene locus_tag LOCUS_05630 15175 14810 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707590.1 protein_id gnl|my_center|LOCUS_05630 15174 16058 gene locus_tag LOCUS_05640 gene rsmI 15174 16058 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525682.1 protein_id gnl|my_center|LOCUS_05640 16066 16683 gene locus_tag LOCUS_05650 16066 16683 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070670.1 protein_id gnl|my_center|LOCUS_05650 16676 17374 gene locus_tag LOCUS_05660 16676 17374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 17379 17876 gene locus_tag LOCUS_05670 gene rfaE2 17379 17876 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686901.1 protein_id gnl|my_center|LOCUS_05670 18283 17861 gene locus_tag LOCUS_05680 18283 17861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 18320 18580 gene locus_tag LOCUS_05690 18320 18580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 19412 18591 gene locus_tag LOCUS_05700 19412 18591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 19524 21182 gene locus_tag LOCUS_05710 19524 21182 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943977.1 protein_id gnl|my_center|LOCUS_05710 21972 21151 gene locus_tag LOCUS_05720 gene folE2 21972 21151 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195713.1 protein_id gnl|my_center|LOCUS_05720 23920 22034 gene locus_tag LOCUS_05730 gene dxs 23920 22034 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266656.1 protein_id gnl|my_center|LOCUS_05730 24831 23926 gene locus_tag LOCUS_05740 24831 23926 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697633.1 protein_id gnl|my_center|LOCUS_05740 25046 24831 gene locus_tag LOCUS_05750 gene xseB 25046 24831 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157114.1 protein_id gnl|my_center|LOCUS_05750 25213 26310 gene locus_tag LOCUS_05760 25213 26310 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190814.1 protein_id gnl|my_center|LOCUS_05760 26314 26676 gene locus_tag LOCUS_05770 26314 26676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 26648 27172 gene locus_tag LOCUS_05780 gene rimM 26648 27172 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957579.1 protein_id gnl|my_center|LOCUS_05780 27172 27945 gene locus_tag LOCUS_05790 gene trmD 27172 27945 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189914.1 protein_id gnl|my_center|LOCUS_05790 27942 28322 gene locus_tag LOCUS_05800 gene rplS 27942 28322 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189360.1 protein_id gnl|my_center|LOCUS_05800 28332 29261 gene locus_tag LOCUS_05810 gene xerD 28332 29261 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203577.1 protein_id gnl|my_center|LOCUS_05810 29265 29885 gene locus_tag LOCUS_05820 gene plsY 29265 29885 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522633.1 protein_id gnl|my_center|LOCUS_05820 30804 29890 gene locus_tag LOCUS_05830 30804 29890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 31401 30808 gene locus_tag LOCUS_05840 31401 30808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 31517 33751 gene locus_tag LOCUS_05850 31517 33751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 33847 34527 gene locus_tag LOCUS_05860 33847 34527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 34535 34939 gene locus_tag LOCUS_05870 34535 34939 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380333.1 protein_id gnl|my_center|LOCUS_05870 34936 35616 gene locus_tag LOCUS_05880 34936 35616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 35613 36164 gene locus_tag LOCUS_05890 35613 36164 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112597.1 protein_id gnl|my_center|LOCUS_05890 36182 36481 gene locus_tag LOCUS_05900 36182 36481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 36700 38799 gene locus_tag LOCUS_05910 36700 38799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 40151 38796 gene locus_tag LOCUS_05920 gene ffh 40151 38796 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215706.1 protein_id gnl|my_center|LOCUS_05920 40199 41029 gene locus_tag LOCUS_05930 gene ccsA 40199 41029 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194227.1 protein_id gnl|my_center|LOCUS_05930 41022 42302 gene locus_tag LOCUS_05940 41022 42302 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704627.1 protein_id gnl|my_center|LOCUS_05940 42380 42976 gene locus_tag LOCUS_05950 42380 42976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 42973 43605 gene locus_tag LOCUS_05960 gene coaE 42973 43605 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540596.1 protein_id gnl|my_center|LOCUS_05960 43687 44442 gene locus_tag LOCUS_05970 gene zapD 43687 44442 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195118.1 protein_id gnl|my_center|LOCUS_05970 45352 44459 gene locus_tag LOCUS_05980 gene rpoH 45352 44459 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040728.1 protein_id gnl|my_center|LOCUS_05980 46252 45377 gene locus_tag LOCUS_05990 46252 45377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 46899 46249 gene locus_tag LOCUS_06000 gene ftsE 46899 46249 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216539.1 protein_id gnl|my_center|LOCUS_06000 47843 46896 gene locus_tag LOCUS_06010 47843 46896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 47897 48460 gene locus_tag LOCUS_06020 gene rsmD 47897 48460 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455148.1 protein_id gnl|my_center|LOCUS_06020 48485 48979 gene locus_tag LOCUS_06030 gene coaD 48485 48979 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195249.1 protein_id gnl|my_center|LOCUS_06030 48996 49250 gene locus_tag LOCUS_06040 48996 49250 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195247.1 protein_id gnl|my_center|LOCUS_06040 49259 50992 gene locus_tag LOCUS_06050 49259 50992 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195237.1 protein_id gnl|my_center|LOCUS_06050 51007 51588 gene locus_tag LOCUS_06060 51007 51588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 >Feature sequence007 426 1202 gene locus_tag LOCUS_06070 426 1202 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811187.1 protein_id gnl|my_center|LOCUS_06070 4240 1199 gene locus_tag LOCUS_06080 4240 1199 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921619.1 protein_id gnl|my_center|LOCUS_06080 5331 4249 gene locus_tag LOCUS_06090 5331 4249 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171251.1 protein_id gnl|my_center|LOCUS_06090 6877 5426 gene locus_tag LOCUS_06100 6877 5426 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087094.1 protein_id gnl|my_center|LOCUS_06100 8770 6959 gene locus_tag LOCUS_06110 gene typA 8770 6959 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193111.1 protein_id gnl|my_center|LOCUS_06110 8794 9780 gene locus_tag LOCUS_06120 8794 9780 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539670.1 protein_id gnl|my_center|LOCUS_06120 9817 10278 gene locus_tag LOCUS_06130 9817 10278 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521302.1 protein_id gnl|my_center|LOCUS_06130 10308 11711 gene locus_tag LOCUS_06140 10308 11711 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813082.1 protein_id gnl|my_center|LOCUS_06140 11724 13031 gene locus_tag LOCUS_06150 gene lplT 11724 13031 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266648.1 protein_id gnl|my_center|LOCUS_06150 13028 13711 gene locus_tag LOCUS_06160 gene tsaB 13028 13711 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266959.1 protein_id gnl|my_center|LOCUS_06160 13708 14178 gene locus_tag LOCUS_06170 gene rimI 13708 14178 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439259.1 protein_id gnl|my_center|LOCUS_06170 14252 14926 gene locus_tag LOCUS_06180 14252 14926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 14949 15683 gene locus_tag LOCUS_06190 gene ompR 14949 15683 CDS product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199523.1 protein_id gnl|my_center|LOCUS_06190 15680 16984 gene locus_tag LOCUS_06200 15680 16984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 17071 17604 gene locus_tag LOCUS_06210 17071 17604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 19532 17598 gene locus_tag LOCUS_06220 19532 17598 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192700.1 protein_id gnl|my_center|LOCUS_06220 22248 19552 gene locus_tag LOCUS_06230 gene mgtA 22248 19552 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817269.1 protein_id gnl|my_center|LOCUS_06230 22518 25097 gene locus_tag LOCUS_06240 gene clpB 22518 25097 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521310.1 protein_id gnl|my_center|LOCUS_06240 25818 25105 gene locus_tag LOCUS_06250 25818 25105 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 protein_id gnl|my_center|LOCUS_06250 27025 25901 gene locus_tag LOCUS_06260 gene thrC 27025 25901 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002048893.1 protein_id gnl|my_center|LOCUS_06260 28379 27060 gene locus_tag LOCUS_06270 28379 27060 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813074.1 protein_id gnl|my_center|LOCUS_06270 29560 28376 gene locus_tag LOCUS_06280 gene alaC 29560 28376 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931132.1 protein_id gnl|my_center|LOCUS_06280 29633 30016 gene locus_tag LOCUS_06290 29633 30016 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198835.1 protein_id gnl|my_center|LOCUS_06290 30587 30009 gene locus_tag LOCUS_06300 30587 30009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 31263 30607 gene locus_tag LOCUS_06310 31263 30607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 32024 31263 gene locus_tag LOCUS_06320 gene surE 32024 31263 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930526.1 protein_id gnl|my_center|LOCUS_06320 33442 32021 gene locus_tag LOCUS_06330 gene lpdA 33442 32021 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930129.1 protein_id gnl|my_center|LOCUS_06330 34744 33452 gene locus_tag LOCUS_06340 gene aceF 34744 33452 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205154.1 protein_id gnl|my_center|LOCUS_06340 34859 35389 gene locus_tag LOCUS_06350 34859 35389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 35967 35398 gene locus_tag LOCUS_06360 gene radC 35967 35398 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482037.1 protein_id gnl|my_center|LOCUS_06360 36806 36063 gene locus_tag LOCUS_06370 36806 36063 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689299.1 protein_id gnl|my_center|LOCUS_06370 37995 36826 gene locus_tag LOCUS_06380 37995 36826 CDS product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527797.1 protein_id gnl|my_center|LOCUS_06380 39171 38011 gene locus_tag LOCUS_06390 gene ubiH 39171 38011 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209951.1 protein_id gnl|my_center|LOCUS_06390 40469 39144 gene locus_tag LOCUS_06400 40469 39144 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065042.1 protein_id gnl|my_center|LOCUS_06400 41175 40477 gene locus_tag LOCUS_06410 41175 40477 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190139.1 protein_id gnl|my_center|LOCUS_06410 42182 41175 gene locus_tag LOCUS_06420 42182 41175 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931410.1 protein_id gnl|my_center|LOCUS_06420 42301 44814 gene locus_tag LOCUS_06430 42301 44814 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814429.1 protein_id gnl|my_center|LOCUS_06430 44811 46247 gene locus_tag LOCUS_06440 44811 46247 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550859.1 protein_id gnl|my_center|LOCUS_06440 46237 47226 gene locus_tag LOCUS_06450 gene pdxA 46237 47226 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095541.1 protein_id gnl|my_center|LOCUS_06450 47226 48011 gene locus_tag LOCUS_06460 gene rsmA 47226 48011 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064975.1 protein_id gnl|my_center|LOCUS_06460 48636 48088 gene locus_tag LOCUS_06470 48636 48088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 49393 49468 gene locus_tag LOCUS_t00100 49393 49468 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 50252 49746 gene locus_tag LOCUS_06480 50252 49746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 50638 50351 gene locus_tag LOCUS_06490 50638 50351 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391158.1 protein_id gnl|my_center|LOCUS_06490 50961 50635 gene locus_tag LOCUS_06500 50961 50635 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068497212.1 protein_id gnl|my_center|LOCUS_06500 >Feature sequence008 <1 753 gene locus_tag LOCUS_06510 <1 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_065340943.1:methyltransferase domain-containing protein 1308 760 gene locus_tag LOCUS_06520 gene ppa 1308 760 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930982.1 protein_id gnl|my_center|LOCUS_06520 1424 2689 gene locus_tag LOCUS_06530 1424 2689 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063961.1 protein_id gnl|my_center|LOCUS_06530 3673 2678 gene locus_tag LOCUS_06540 3673 2678 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932879.1 protein_id gnl|my_center|LOCUS_06540 4338 3778 gene locus_tag LOCUS_06550 gene efp 4338 3778 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810194.1 protein_id gnl|my_center|LOCUS_06550 5481 4375 gene locus_tag LOCUS_06560 gene earP 5481 4375 CDS product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114754.1 protein_id gnl|my_center|LOCUS_06560 5911 5492 gene locus_tag LOCUS_06570 5911 5492 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765145.1 protein_id gnl|my_center|LOCUS_06570 7257 5956 gene locus_tag LOCUS_06580 7257 5956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 8194 7373 gene locus_tag LOCUS_06590 8194 7373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 9672 8275 gene locus_tag LOCUS_06600 gene pntB 9672 8275 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705257.1 protein_id gnl|my_center|LOCUS_06600 11254 9683 gene locus_tag LOCUS_06610 gene pntA 11254 9683 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816338.1 protein_id gnl|my_center|LOCUS_06610 11896 11312 gene locus_tag LOCUS_06620 gene ampD 11896 11312 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194313.1 protein_id gnl|my_center|LOCUS_06620 12174 11896 gene locus_tag LOCUS_06630 12174 11896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 13384 12338 gene locus_tag LOCUS_06640 13384 12338 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185574.1 protein_id gnl|my_center|LOCUS_06640 14196 13381 gene locus_tag LOCUS_06650 14196 13381 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196438.1 protein_id gnl|my_center|LOCUS_06650 14762 14364 gene locus_tag LOCUS_06660 14762 14364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 14962 16290 gene locus_tag LOCUS_06670 14962 16290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 17483 17190 gene locus_tag LOCUS_06680 17483 17190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 17899 18822 gene locus_tag LOCUS_06690 17899 18822 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039079.1 protein_id gnl|my_center|LOCUS_06690 18809 19393 gene locus_tag LOCUS_06700 18809 19393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 19492 21723 gene locus_tag LOCUS_06710 19492 21723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 22428 22108 gene locus_tag LOCUS_06720 22428 22108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 22587 22994 gene locus_tag LOCUS_06730 22587 22994 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039075.1 protein_id gnl|my_center|LOCUS_06730 22991 23710 gene locus_tag LOCUS_06740 gene fabG 22991 23710 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039074.1 protein_id gnl|my_center|LOCUS_06740 24536 23775 gene locus_tag LOCUS_06750 gene ubiE 24536 23775 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456853.1 protein_id gnl|my_center|LOCUS_06750 24803 25990 gene locus_tag LOCUS_06760 24803 25990 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039069.1 protein_id gnl|my_center|LOCUS_06760 25987 26760 gene locus_tag LOCUS_06770 25987 26760 CDS product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039070.1 protein_id gnl|my_center|LOCUS_06770 27505 26744 gene locus_tag LOCUS_06780 27505 26744 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266398.1 protein_id gnl|my_center|LOCUS_06780 28278 27505 gene locus_tag LOCUS_06790 28278 27505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 29320 28292 gene locus_tag LOCUS_06800 29320 28292 CDS product pteridine-dependent deoxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275502.1 protein_id gnl|my_center|LOCUS_06800 29973 29320 gene locus_tag LOCUS_06810 29973 29320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 30281 29988 gene locus_tag LOCUS_06820 gene xanC 30281 29988 CDS product xanthomonadin biosynthesis acyl carrier protein XanC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039083.1 protein_id gnl|my_center|LOCUS_06820 30708 30632 gene locus_tag LOCUS_t00110 30708 30632 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 31606 30734 gene locus_tag LOCUS_06830 31606 30734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 31707 32954 gene locus_tag LOCUS_06840 31707 32954 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005731386.1 protein_id gnl|my_center|LOCUS_06840 32971 33063 gene locus_tag LOCUS_t00120 32971 33063 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 33632 35155 gene locus_tag LOCUS_06850 33632 35155 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109635.1 protein_id gnl|my_center|LOCUS_06850 36306 35737 gene locus_tag LOCUS_06860 36306 35737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 36611 36303 gene locus_tag LOCUS_06870 36611 36303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 38925 36799 gene locus_tag LOCUS_06880 38925 36799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 39224 38922 gene locus_tag LOCUS_06890 39224 38922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 39634 39221 gene locus_tag LOCUS_06900 39634 39221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 39873 39631 gene locus_tag LOCUS_06910 39873 39631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 40969 40004 gene locus_tag LOCUS_06920 40969 40004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 42014 40950 gene locus_tag LOCUS_06930 42014 40950 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083692.1 protein_id gnl|my_center|LOCUS_06930 42517 42430 gene locus_tag LOCUS_t00130 42517 42430 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 42539 43897 gene locus_tag LOCUS_06940 42539 43897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 46341 43894 gene locus_tag LOCUS_06950 46341 43894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 46607 46401 gene locus_tag LOCUS_06960 46607 46401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 <47626 46676 gene locus_tag LOCUS_06970 <47626 46676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522575.1:GTP-binding protein >Feature sequence009 839 324 gene locus_tag LOCUS_06980 839 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 1420 839 gene locus_tag LOCUS_06990 1420 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 2243 1509 gene locus_tag LOCUS_07000 2243 1509 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113296.1 protein_id gnl|my_center|LOCUS_07000 2667 2966 gene locus_tag LOCUS_07010 2667 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 3201 3815 gene locus_tag LOCUS_07020 3201 3815 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064927.1 protein_id gnl|my_center|LOCUS_07020 3837 6044 gene locus_tag LOCUS_07030 3837 6044 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937997.1 protein_id gnl|my_center|LOCUS_07030 6047 6895 gene locus_tag LOCUS_07040 6047 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 6949 8412 gene locus_tag LOCUS_07050 gene nrfD 6949 8412 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328378.1 protein_id gnl|my_center|LOCUS_07050 8409 8939 gene locus_tag LOCUS_07060 8409 8939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 8936 9484 gene locus_tag LOCUS_07070 8936 9484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 9500 10504 gene locus_tag LOCUS_07080 9500 10504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 10674 10949 gene locus_tag LOCUS_07090 10674 10949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 11158 12564 gene locus_tag LOCUS_07100 11158 12564 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403101.1 protein_id gnl|my_center|LOCUS_07100 12598 13554 gene locus_tag LOCUS_07110 12598 13554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 13612 14232 gene locus_tag LOCUS_07120 13612 14232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 14443 14724 gene locus_tag LOCUS_07130 14443 14724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 14846 15124 gene locus_tag LOCUS_07140 14846 15124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 15124 15621 gene locus_tag LOCUS_07150 15124 15621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 15618 16133 gene locus_tag LOCUS_07160 15618 16133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 16136 17203 gene locus_tag LOCUS_07170 16136 17203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 17211 17459 gene locus_tag LOCUS_07180 17211 17459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 17456 17854 gene locus_tag LOCUS_07190 17456 17854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 17851 20457 gene locus_tag LOCUS_07200 17851 20457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 20476 21771 gene locus_tag LOCUS_07210 20476 21771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 21768 22199 gene locus_tag LOCUS_07220 21768 22199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 22196 22606 gene locus_tag LOCUS_07230 22196 22606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 23164 22640 gene locus_tag LOCUS_07240 23164 22640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 23464 23333 gene locus_tag LOCUS_07250 23464 23333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 24225 23593 gene locus_tag LOCUS_07260 24225 23593 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197988.1 protein_id gnl|my_center|LOCUS_07260 24995 24222 gene locus_tag LOCUS_07270 24995 24222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 25870 25100 gene locus_tag LOCUS_07280 25870 25100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 26796 25858 gene locus_tag LOCUS_07290 26796 25858 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190439.1 protein_id gnl|my_center|LOCUS_07290 27235 26810 gene locus_tag LOCUS_07300 27235 26810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 27353 27868 gene locus_tag LOCUS_07310 gene tsaC 27353 27868 CDS product L-threonylcarbamoyladenylate synthase type 1 TsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174593.1 protein_id gnl|my_center|LOCUS_07310 29139 27859 gene locus_tag LOCUS_07320 gene purD 29139 27859 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930862.1 protein_id gnl|my_center|LOCUS_07320 30713 29154 gene locus_tag LOCUS_07330 gene purH 30713 29154 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980881.1 protein_id gnl|my_center|LOCUS_07330 30949 30710 gene locus_tag LOCUS_07340 30949 30710 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194052.1 protein_id gnl|my_center|LOCUS_07340 31965 30946 gene locus_tag LOCUS_07350 gene dusB 31965 30946 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194278.1 protein_id gnl|my_center|LOCUS_07350 34709 32010 gene locus_tag LOCUS_07360 gene polA 34709 32010 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540200.1 protein_id gnl|my_center|LOCUS_07360 34711 35637 gene locus_tag LOCUS_07370 gene hemF 34711 35637 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813191.1 protein_id gnl|my_center|LOCUS_07370 35651 36574 gene locus_tag LOCUS_07380 35651 36574 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064074.1 protein_id gnl|my_center|LOCUS_07380 36571 37605 gene locus_tag LOCUS_07390 36571 37605 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064073.1 protein_id gnl|my_center|LOCUS_07390 37602 38369 gene locus_tag LOCUS_07400 37602 38369 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064072.1 protein_id gnl|my_center|LOCUS_07400 38366 39085 gene locus_tag LOCUS_07410 38366 39085 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064071.1 protein_id gnl|my_center|LOCUS_07410 39069 40502 gene locus_tag LOCUS_07420 39069 40502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 40493 41389 gene locus_tag LOCUS_07430 40493 41389 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958093.1 protein_id gnl|my_center|LOCUS_07430 >Feature sequence010 1044 424 gene locus_tag LOCUS_07440 1044 424 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314066.1 protein_id gnl|my_center|LOCUS_07440 2638 1130 gene locus_tag LOCUS_07450 2638 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 3561 2635 gene locus_tag LOCUS_07460 3561 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 4016 3558 gene locus_tag LOCUS_07470 4016 3558 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070884.1 protein_id gnl|my_center|LOCUS_07470 4171 5427 gene locus_tag LOCUS_07480 4171 5427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 5659 5459 gene locus_tag LOCUS_07490 5659 5459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 6254 5670 gene locus_tag LOCUS_07500 6254 5670 CDS product RNA polymerase factor sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206317.1 protein_id gnl|my_center|LOCUS_07500 6369 6860 gene locus_tag LOCUS_07510 6369 6860 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458568.1 protein_id gnl|my_center|LOCUS_07510 8602 6857 gene locus_tag LOCUS_07520 8602 6857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 8877 8602 gene locus_tag LOCUS_07530 8877 8602 CDS product DUF2282 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946406.1 protein_id gnl|my_center|LOCUS_07530 9423 9079 gene locus_tag LOCUS_07540 9423 9079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 10280 9540 gene locus_tag LOCUS_07550 10280 9540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 11540 10359 gene locus_tag LOCUS_07560 11540 10359 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525689.1 protein_id gnl|my_center|LOCUS_07560 11840 11562 gene locus_tag LOCUS_07570 11840 11562 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551036.1 protein_id gnl|my_center|LOCUS_07570 12777 11932 gene locus_tag LOCUS_07580 gene lgt 12777 11932 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191241.1 protein_id gnl|my_center|LOCUS_07580 13987 12965 gene locus_tag LOCUS_07590 13987 12965 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538099.1 protein_id gnl|my_center|LOCUS_07590 13991 14066 gene locus_tag LOCUS_t00140 13991 14066 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 14223 14684 gene locus_tag LOCUS_07600 14223 14684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 14567 15100 gene locus_tag LOCUS_07610 14567 15100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 15120 15347 gene locus_tag LOCUS_07620 15120 15347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 15577 16725 gene locus_tag LOCUS_07630 15577 16725 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035313.1 protein_id gnl|my_center|LOCUS_07630 17862 16996 gene locus_tag LOCUS_07640 17862 16996 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114805.1 protein_id gnl|my_center|LOCUS_07640 18272 17859 gene locus_tag LOCUS_07650 18272 17859 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016352231.1 protein_id gnl|my_center|LOCUS_07650 18902 18300 gene locus_tag LOCUS_07660 18902 18300 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549943.1 protein_id gnl|my_center|LOCUS_07660 19021 19953 gene locus_tag LOCUS_07670 19021 19953 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091534.1 protein_id gnl|my_center|LOCUS_07670 20370 23381 gene locus_tag LOCUS_07680 20370 23381 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526171.1 protein_id gnl|my_center|LOCUS_07680 24480 23392 gene locus_tag LOCUS_07690 24480 23392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 25300 24482 gene locus_tag LOCUS_07700 gene ygiD 25300 24482 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174107.1 protein_id gnl|my_center|LOCUS_07700 25366 26547 gene locus_tag LOCUS_07710 25366 26547 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056461.1 protein_id gnl|my_center|LOCUS_07710 26620 27411 gene locus_tag LOCUS_07720 26620 27411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 27455 28189 gene locus_tag LOCUS_07730 27455 28189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 28319 28936 gene locus_tag LOCUS_07740 28319 28936 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_07740 29034 30050 gene locus_tag LOCUS_07750 29034 30050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 30288 30833 gene locus_tag LOCUS_07760 30288 30833 CDS product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036208.1 protein_id gnl|my_center|LOCUS_07760 31215 30862 gene locus_tag LOCUS_07770 31215 30862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 31459 32073 gene locus_tag LOCUS_07780 gene lexA 31459 32073 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704040.1 protein_id gnl|my_center|LOCUS_07780 32137 33138 gene locus_tag LOCUS_07790 gene ispB 32137 33138 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929988.1 protein_id gnl|my_center|LOCUS_07790 33339 33998 gene locus_tag LOCUS_07800 gene pmrA 33339 33998 CDS product two-component system response regulator PrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102236.1 protein_id gnl|my_center|LOCUS_07800 34005 35375 gene locus_tag LOCUS_07810 34005 35375 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770760.1 protein_id gnl|my_center|LOCUS_07810 35798 35352 gene locus_tag LOCUS_07820 35798 35352 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940823.1 protein_id gnl|my_center|LOCUS_07820 <36648 35795 gene locus_tag LOCUS_07830 <36648 35795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947527.1:recombinase RecA >Feature sequence011 689 438 gene locus_tag LOCUS_07840 689 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 1384 689 gene locus_tag LOCUS_07850 1384 689 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065157.1 protein_id gnl|my_center|LOCUS_07850 3156 1393 gene locus_tag LOCUS_07860 gene sdhA 3156 1393 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188402.1 protein_id gnl|my_center|LOCUS_07860 3505 3161 gene locus_tag LOCUS_07870 gene sdhD 3505 3161 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187439.1 protein_id gnl|my_center|LOCUS_07870 3873 3499 gene locus_tag LOCUS_07880 gene sdhC 3873 3499 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688393.1 protein_id gnl|my_center|LOCUS_07880 4034 6688 gene locus_tag LOCUS_07890 gene acnA 4034 6688 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187807.1 protein_id gnl|my_center|LOCUS_07890 6714 7697 gene locus_tag LOCUS_07900 6714 7697 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065155.1 protein_id gnl|my_center|LOCUS_07900 8660 7770 gene locus_tag LOCUS_07910 gene cysM 8660 7770 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554618.1 protein_id gnl|my_center|LOCUS_07910 9040 8720 gene locus_tag LOCUS_07920 9040 8720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 10071 9070 gene locus_tag LOCUS_07930 gene rfaD 10071 9070 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225405.1 protein_id gnl|my_center|LOCUS_07930 11012 10065 gene locus_tag LOCUS_07940 gene rfaE1 11012 10065 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189069.1 protein_id gnl|my_center|LOCUS_07940 12331 11009 gene locus_tag LOCUS_07950 12331 11009 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064823.1 protein_id gnl|my_center|LOCUS_07950 13041 12343 gene locus_tag LOCUS_07960 gene pyrF 13041 12343 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687835.1 protein_id gnl|my_center|LOCUS_07960 14232 13048 gene locus_tag LOCUS_07970 gene lapB 14232 13048 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188993.1 protein_id gnl|my_center|LOCUS_07970 14699 14400 gene locus_tag LOCUS_07980 14699 14400 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189865.1 protein_id gnl|my_center|LOCUS_07980 16424 14709 gene locus_tag LOCUS_07990 gene rpsA 16424 14709 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189285.1 protein_id gnl|my_center|LOCUS_07990 17207 16536 gene locus_tag LOCUS_08000 gene cmk 17207 16536 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688932.1 protein_id gnl|my_center|LOCUS_08000 18525 17209 gene locus_tag LOCUS_08010 18525 17209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08010 19423 18542 gene locus_tag LOCUS_08020 19423 18542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08020 20591 19494 gene locus_tag LOCUS_08030 gene hisC 20591 19494 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_08030 21673 20588 gene locus_tag LOCUS_08040 gene pheA 21673 20588 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689394.1 protein_id gnl|my_center|LOCUS_08040 22745 21666 gene locus_tag LOCUS_08050 gene serC 22745 21666 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106701.1 protein_id gnl|my_center|LOCUS_08050 25301 22749 gene locus_tag LOCUS_08060 gene gyrA 25301 22749 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527513.1 protein_id gnl|my_center|LOCUS_08060 25462 26175 gene locus_tag LOCUS_08070 25462 26175 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532296.1 protein_id gnl|my_center|LOCUS_08070 26154 26843 gene locus_tag LOCUS_08080 gene gph 26154 26843 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550108.1 protein_id gnl|my_center|LOCUS_08080 26840 28108 gene locus_tag LOCUS_08090 gene yegQ 26840 28108 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222142.1 protein_id gnl|my_center|LOCUS_08090 28475 28137 gene locus_tag LOCUS_08100 28475 28137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 29776 28490 gene locus_tag LOCUS_08110 29776 28490 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724487.1 protein_id gnl|my_center|LOCUS_08110 31232 29790 gene locus_tag LOCUS_08120 31232 29790 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 protein_id gnl|my_center|LOCUS_08120 31458 31249 gene locus_tag LOCUS_08130 31458 31249 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963915.1 protein_id gnl|my_center|LOCUS_08130 34694 31461 gene locus_tag LOCUS_08140 34694 31461 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711674.1 protein_id gnl|my_center|LOCUS_08140 35721 34702 gene locus_tag LOCUS_08150 35721 34702 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646058.1 protein_id gnl|my_center|LOCUS_08150 >Feature sequence012 1181 897 gene locus_tag LOCUS_08160 1181 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 1271 2005 gene locus_tag LOCUS_08170 1271 2005 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688574.1 protein_id gnl|my_center|LOCUS_08170 3345 1981 gene locus_tag LOCUS_08180 gene radA 3345 1981 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928233.1 protein_id gnl|my_center|LOCUS_08180 4716 3349 gene locus_tag LOCUS_08190 4716 3349 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813089.1 protein_id gnl|my_center|LOCUS_08190 5189 4743 gene locus_tag LOCUS_08200 gene rplI 5189 4743 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232586.1 protein_id gnl|my_center|LOCUS_08200 5475 5203 gene locus_tag LOCUS_08210 gene rpsR 5475 5203 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213306.1 protein_id gnl|my_center|LOCUS_08210 5783 5472 gene locus_tag LOCUS_08220 5783 5472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 6166 5783 gene locus_tag LOCUS_08230 gene rpsF 6166 5783 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980921.1 protein_id gnl|my_center|LOCUS_08230 6340 6254 gene locus_tag LOCUS_t00150 6340 6254 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6378 8585 gene locus_tag LOCUS_08240 gene rnr 6378 8585 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225208.1 protein_id gnl|my_center|LOCUS_08240 8595 9338 gene locus_tag LOCUS_08250 gene rlmB 8595 9338 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064116.1 protein_id gnl|my_center|LOCUS_08250 9549 10577 gene locus_tag LOCUS_08260 9549 10577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 12139 10562 gene locus_tag LOCUS_08270 12139 10562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 12655 12188 gene locus_tag LOCUS_08280 12655 12188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 14223 12649 gene locus_tag LOCUS_08290 14223 12649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 14381 15121 gene locus_tag LOCUS_08300 14381 15121 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531608.1 protein_id gnl|my_center|LOCUS_08300 15118 15504 gene locus_tag LOCUS_08310 15118 15504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 15542 15618 gene locus_tag LOCUS_t00160 15542 15618 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 15939 15676 gene locus_tag LOCUS_08320 15939 15676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 17812 16085 gene locus_tag LOCUS_08330 17812 16085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 16094 16193 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18219 17809 gene locus_tag LOCUS_08340 18219 17809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 19295 18306 gene locus_tag LOCUS_08350 19295 18306 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_08350 19501 19304 gene locus_tag LOCUS_08360 19501 19304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 20200 19601 gene locus_tag LOCUS_08370 gene wrbA 20200 19601 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918676.1 protein_id gnl|my_center|LOCUS_08370 20199 20387 gene locus_tag LOCUS_08380 20199 20387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 20963 20517 gene locus_tag LOCUS_08390 20963 20517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 22103 20967 gene locus_tag LOCUS_08400 22103 20967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 22342 22418 gene locus_tag LOCUS_t00170 22342 22418 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 23047 22424 gene locus_tag LOCUS_08410 gene lolA 23047 22424 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185701.1 protein_id gnl|my_center|LOCUS_08410 25374 23044 gene locus_tag LOCUS_08420 25374 23044 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814032.1 protein_id gnl|my_center|LOCUS_08420 25464 26423 gene locus_tag LOCUS_08430 gene trxB 25464 26423 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065064.1 protein_id gnl|my_center|LOCUS_08430 26420 28057 gene locus_tag LOCUS_08440 26420 28057 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193449.1 protein_id gnl|my_center|LOCUS_08440 28054 28425 gene locus_tag LOCUS_08450 28054 28425 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192320.1 protein_id gnl|my_center|LOCUS_08450 28412 29548 gene locus_tag LOCUS_08460 28412 29548 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527179.1 protein_id gnl|my_center|LOCUS_08460 29548 30516 gene locus_tag LOCUS_08470 29548 30516 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191549.1 protein_id gnl|my_center|LOCUS_08470 30506 31432 gene locus_tag LOCUS_08480 30506 31432 CDS product formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192441.1 protein_id gnl|my_center|LOCUS_08480 31545 32588 gene locus_tag LOCUS_08490 31545 32588 CDS product bifunctional UDP-4-keto-pentose/UDP-xylose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193921.1 protein_id gnl|my_center|LOCUS_08490 32594 33088 gene locus_tag LOCUS_08500 gene purE 32594 33088 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688684.1 protein_id gnl|my_center|LOCUS_08500 33085 34266 gene locus_tag LOCUS_08510 33085 34266 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002230480.1 protein_id gnl|my_center|LOCUS_08510 34338 34676 gene locus_tag LOCUS_08520 34338 34676 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812004.1 protein_id gnl|my_center|LOCUS_08520 <35813 34737 gene locus_tag LOCUS_08530 <35813 34737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064046.1:oxygen-independent coproporphyrinogen III oxidase >Feature sequence013 2733 379 gene locus_tag LOCUS_08540 gene parC 2733 379 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522490.1 protein_id gnl|my_center|LOCUS_08540 4706 2730 gene locus_tag LOCUS_08550 gene parE 4706 2730 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224983.1 protein_id gnl|my_center|LOCUS_08550 4855 6273 gene locus_tag LOCUS_08560 4855 6273 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229439.1 protein_id gnl|my_center|LOCUS_08560 6266 7396 gene locus_tag LOCUS_08570 6266 7396 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096126.1 protein_id gnl|my_center|LOCUS_08570 7515 8159 gene locus_tag LOCUS_08580 7515 8159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 8209 8616 gene locus_tag LOCUS_08590 8209 8616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 8609 9544 gene locus_tag LOCUS_08600 8609 9544 CDS product PA2778 family cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895637.1 protein_id gnl|my_center|LOCUS_08600 9623 9550 gene locus_tag LOCUS_t00180 9623 9550 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 9704 9629 gene locus_tag LOCUS_t00190 9704 9629 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9890 10975 gene locus_tag LOCUS_08610 9890 10975 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261540.1 protein_id gnl|my_center|LOCUS_08610 11579 11010 gene locus_tag LOCUS_08620 gene pgsA 11579 11010 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810356.1 protein_id gnl|my_center|LOCUS_08620 13394 11589 gene locus_tag LOCUS_08630 gene uvrC 13394 11589 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930726.1 protein_id gnl|my_center|LOCUS_08630 14341 13391 gene locus_tag LOCUS_08640 14341 13391 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957524.1 protein_id gnl|my_center|LOCUS_08640 15365 14343 gene locus_tag LOCUS_08650 gene nagZ 15365 14343 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193430.1 protein_id gnl|my_center|LOCUS_08650 15742 15362 gene locus_tag LOCUS_08660 gene acpS 15742 15362 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212541.1 protein_id gnl|my_center|LOCUS_08660 16464 15739 gene locus_tag LOCUS_08670 gene pdxJ 16464 15739 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192885.1 protein_id gnl|my_center|LOCUS_08670 17189 16461 gene locus_tag LOCUS_08680 gene recO 17189 16461 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704751.1 protein_id gnl|my_center|LOCUS_08680 18072 17179 gene locus_tag LOCUS_08690 gene era 18072 17179 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191678.1 protein_id gnl|my_center|LOCUS_08690 18776 18069 gene locus_tag LOCUS_08700 gene rnc 18776 18069 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036467.1 protein_id gnl|my_center|LOCUS_08700 19731 18757 gene locus_tag LOCUS_08710 19731 18757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 21530 19728 gene locus_tag LOCUS_08720 gene lepA 21530 19728 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193305.1 protein_id gnl|my_center|LOCUS_08720 23001 21628 gene locus_tag LOCUS_08730 23001 21628 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363717.1 protein_id gnl|my_center|LOCUS_08730 23966 22998 gene locus_tag LOCUS_08740 23966 22998 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764762.1 protein_id gnl|my_center|LOCUS_08740 24502 23999 gene locus_tag LOCUS_08750 24502 23999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 25191 24496 gene locus_tag LOCUS_08760 gene rpoE 25191 24496 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_08760 25302 26939 gene locus_tag LOCUS_08770 25302 26939 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689235.1 protein_id gnl|my_center|LOCUS_08770 27559 26936 gene locus_tag LOCUS_08780 27559 26936 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932402.1 protein_id gnl|my_center|LOCUS_08780 28461 27595 gene locus_tag LOCUS_08790 28461 27595 CDS product NADP-dependent methylenetetrahydromethanopterin/methylenetetrahydrofolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122705.1 protein_id gnl|my_center|LOCUS_08790 30263 28470 gene locus_tag LOCUS_08800 30263 28470 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_08800 31019 30285 gene locus_tag LOCUS_08810 31019 30285 CDS product rRNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811964.1 protein_id gnl|my_center|LOCUS_08810 31690 31016 gene locus_tag LOCUS_08820 31690 31016 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817342.1 protein_id gnl|my_center|LOCUS_08820 31657 32094 gene locus_tag LOCUS_08830 31657 32094 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_08830 33195 32101 gene locus_tag LOCUS_08840 gene zapE 33195 32101 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447983.1 protein_id gnl|my_center|LOCUS_08840 <34571 33188 gene locus_tag LOCUS_08850 <34571 33188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813626.1:dihydrolipoyl dehydrogenase >Feature sequence014 252 67 gene locus_tag LOCUS_08860 252 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 345 1556 gene locus_tag LOCUS_08870 345 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 1553 3376 gene locus_tag LOCUS_08880 1553 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 4542 3382 gene locus_tag LOCUS_08890 gene emrA 4542 3382 CDS product multidrug efflux MFS transporter periplasmic adaptor subunit EmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208745.1 protein_id gnl|my_center|LOCUS_08890 5939 4530 gene locus_tag LOCUS_08900 5939 4530 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105655.1 protein_id gnl|my_center|LOCUS_08900 7501 5936 gene locus_tag LOCUS_08910 gene farB 7501 5936 CDS product fatty acid resistance MFS efflux transporter permease subunit FarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951322.1 protein_id gnl|my_center|LOCUS_08910 8168 7512 gene locus_tag LOCUS_08920 gene narL 8168 7512 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070487.1 protein_id gnl|my_center|LOCUS_08920 9948 8176 gene locus_tag LOCUS_08930 gene narX 9948 8176 CDS product two-component system sensor histidine kinase NarX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105296.1 protein_id gnl|my_center|LOCUS_08930 10255 10617 gene locus_tag LOCUS_08940 10255 10617 CDS product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947457.1 protein_id gnl|my_center|LOCUS_08940 10707 11690 gene locus_tag LOCUS_08950 10707 11690 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948238.1 protein_id gnl|my_center|LOCUS_08950 11715 12353 gene locus_tag LOCUS_08960 11715 12353 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926772.1 protein_id gnl|my_center|LOCUS_08960 14107 12404 gene locus_tag LOCUS_08970 14107 12404 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194217.1 protein_id gnl|my_center|LOCUS_08970 14205 14990 gene locus_tag LOCUS_08980 14205 14990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 15267 16802 gene locus_tag LOCUS_08990 15267 16802 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980887.1 protein_id gnl|my_center|LOCUS_08990 16799 17656 gene locus_tag LOCUS_09000 16799 17656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 18138 19205 gene locus_tag LOCUS_09010 18138 19205 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035354.1 protein_id gnl|my_center|LOCUS_09010 19235 20110 gene locus_tag LOCUS_09020 19235 20110 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390157.1 protein_id gnl|my_center|LOCUS_09020 20110 20820 gene locus_tag LOCUS_09030 20110 20820 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113205.1 protein_id gnl|my_center|LOCUS_09030 20853 21917 gene locus_tag LOCUS_09040 gene fba 20853 21917 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022162.1 protein_id gnl|my_center|LOCUS_09040 21959 23944 gene locus_tag LOCUS_09050 gene tkt 21959 23944 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477253.1 protein_id gnl|my_center|LOCUS_09050 24154 25623 gene locus_tag LOCUS_09060 24154 25623 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036845.1 protein_id gnl|my_center|LOCUS_09060 25630 26337 gene locus_tag LOCUS_09070 25630 26337 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_09070 26906 26433 gene locus_tag LOCUS_09080 26906 26433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 27655 26993 gene locus_tag LOCUS_09090 27655 26993 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228227.1 protein_id gnl|my_center|LOCUS_09090 27794 28651 gene locus_tag LOCUS_09100 27794 28651 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546070.1 protein_id gnl|my_center|LOCUS_09100 28664 30109 gene locus_tag LOCUS_09110 28664 30109 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035868.1 protein_id gnl|my_center|LOCUS_09110 30672 30103 gene locus_tag LOCUS_09120 30672 30103 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919360.1 protein_id gnl|my_center|LOCUS_09120 31477 30665 gene locus_tag LOCUS_09130 31477 30665 CDS product hydroxypyruvate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113230.1 protein_id gnl|my_center|LOCUS_09130 31861 31481 gene locus_tag LOCUS_09140 31861 31481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 32775 31858 gene locus_tag LOCUS_09150 gene trpI 32775 31858 CDS product trpBA operon transcriptional activator TrpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114633.1 protein_id gnl|my_center|LOCUS_09150 >Feature sequence015 1118 1852 gene locus_tag LOCUS_09160 1118 1852 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820991.1 protein_id gnl|my_center|LOCUS_09160 1873 2889 gene locus_tag LOCUS_09170 1873 2889 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814170.1 protein_id gnl|my_center|LOCUS_09170 2886 3125 gene locus_tag LOCUS_09180 2886 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 3112 3744 gene locus_tag LOCUS_09190 gene nth 3112 3744 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948566.1 protein_id gnl|my_center|LOCUS_09190 3710 4174 gene locus_tag LOCUS_09200 3710 4174 CDS product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814061.1 protein_id gnl|my_center|LOCUS_09200 4736 4158 gene locus_tag LOCUS_09210 4736 4158 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932386.1 protein_id gnl|my_center|LOCUS_09210 5485 4748 gene locus_tag LOCUS_09220 gene dnaQ 5485 4748 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531112.1 protein_id gnl|my_center|LOCUS_09220 5922 5482 gene locus_tag LOCUS_09230 gene rnhA 5922 5482 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084134.1 protein_id gnl|my_center|LOCUS_09230 6731 5919 gene locus_tag LOCUS_09240 6731 5919 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931355.1 protein_id gnl|my_center|LOCUS_09240 6751 7527 gene locus_tag LOCUS_09250 gene gloB 6751 7527 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939287.1 protein_id gnl|my_center|LOCUS_09250 7527 8951 gene locus_tag LOCUS_09260 7527 8951 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814738.1 protein_id gnl|my_center|LOCUS_09260 10613 8952 gene locus_tag LOCUS_09270 10613 8952 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206616.1 protein_id gnl|my_center|LOCUS_09270 11635 10610 gene locus_tag LOCUS_09280 11635 10610 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206615.1 protein_id gnl|my_center|LOCUS_09280 12587 11643 gene locus_tag LOCUS_09290 12587 11643 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069490.1 protein_id gnl|my_center|LOCUS_09290 14359 12584 gene locus_tag LOCUS_09300 14359 12584 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206613.1 protein_id gnl|my_center|LOCUS_09300 14501 15289 gene locus_tag LOCUS_09310 gene fabI 14501 15289 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814739.1 protein_id gnl|my_center|LOCUS_09310 17214 15286 gene locus_tag LOCUS_09320 17214 15286 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098131.1 protein_id gnl|my_center|LOCUS_09320 17387 17311 gene locus_tag LOCUS_t00200 17387 17311 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 17494 17419 gene locus_tag LOCUS_t00210 17494 17419 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 17778 17506 gene locus_tag LOCUS_09330 gene hupB 17778 17506 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081127.1 protein_id gnl|my_center|LOCUS_09330 20300 17898 gene locus_tag LOCUS_09340 gene lon 20300 17898 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193454.1 protein_id gnl|my_center|LOCUS_09340 21633 20377 gene locus_tag LOCUS_09350 gene clpX 21633 20377 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087924.1 protein_id gnl|my_center|LOCUS_09350 22280 21663 gene locus_tag LOCUS_09360 gene clpP 22280 21663 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193408.1 protein_id gnl|my_center|LOCUS_09360 23631 22318 gene locus_tag LOCUS_09370 gene tig 23631 22318 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020997321.1 protein_id gnl|my_center|LOCUS_09370 25330 23732 gene locus_tag LOCUS_09380 gene ggt 25330 23732 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231470.1 protein_id gnl|my_center|LOCUS_09380 26213 25404 gene locus_tag LOCUS_09390 gene pssA 26213 25404 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_09390 26871 26227 gene locus_tag LOCUS_09400 26871 26227 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196436.1 protein_id gnl|my_center|LOCUS_09400 27890 26874 gene locus_tag LOCUS_09410 gene ilvC 27890 26874 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185539.1 protein_id gnl|my_center|LOCUS_09410 28422 27931 gene locus_tag LOCUS_09420 gene ilvN 28422 27931 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814006.1 protein_id gnl|my_center|LOCUS_09420 30148 28439 gene locus_tag LOCUS_09430 30148 28439 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814007.1 protein_id gnl|my_center|LOCUS_09430 31460 30243 gene locus_tag LOCUS_09440 gene gspF 31460 30243 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112721.1 protein_id gnl|my_center|LOCUS_09440 32899 31457 gene locus_tag LOCUS_09450 gene gspE 32899 31457 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196824.1 protein_id gnl|my_center|LOCUS_09450 >Feature sequence016 2972 3484 gene locus_tag LOCUS_09460 2972 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064477.1 protein_id gnl|my_center|LOCUS_09460 3498 4634 gene locus_tag LOCUS_09470 3498 4634 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909134.1 protein_id gnl|my_center|LOCUS_09470 4631 5287 gene locus_tag LOCUS_09480 4631 5287 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141840.1 protein_id gnl|my_center|LOCUS_09480 5287 8067 gene locus_tag LOCUS_09490 5287 8067 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064478.1 protein_id gnl|my_center|LOCUS_09490 8304 8214 gene locus_tag LOCUS_t00220 8304 8214 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8467 8312 gene locus_tag LOCUS_09500 gene rpmG 8467 8312 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212306.1 protein_id gnl|my_center|LOCUS_09500 8766 8485 gene locus_tag LOCUS_09510 gene rpmB 8766 8485 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186391.1 protein_id gnl|my_center|LOCUS_09510 9172 8750 gene locus_tag LOCUS_09520 9172 8750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 9621 9172 gene locus_tag LOCUS_09530 gene dut 9621 9172 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812576.1 protein_id gnl|my_center|LOCUS_09530 10858 9632 gene locus_tag LOCUS_09540 gene coaBC 10858 9632 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928305.1 protein_id gnl|my_center|LOCUS_09540 11855 10878 gene locus_tag LOCUS_09550 11855 10878 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387970.1 protein_id gnl|my_center|LOCUS_09550 12760 11873 gene locus_tag LOCUS_09560 gene sucD 12760 11873 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329405.1 protein_id gnl|my_center|LOCUS_09560 13954 12785 gene locus_tag LOCUS_09570 13954 12785 CDS product malate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329404.1 protein_id gnl|my_center|LOCUS_09570 14999 14049 gene locus_tag LOCUS_09580 14999 14049 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974587.1 protein_id gnl|my_center|LOCUS_09580 16192 14996 gene locus_tag LOCUS_09590 16192 14996 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243814.1 protein_id gnl|my_center|LOCUS_09590 17460 16213 gene locus_tag LOCUS_09600 17460 16213 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186490.1 protein_id gnl|my_center|LOCUS_09600 17552 18829 gene locus_tag LOCUS_09610 17552 18829 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390217.1 protein_id gnl|my_center|LOCUS_09610 18873 20597 gene locus_tag LOCUS_09620 18873 20597 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720843.1 protein_id gnl|my_center|LOCUS_09620 20597 21928 gene locus_tag LOCUS_09630 gene folC 20597 21928 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811819.1 protein_id gnl|my_center|LOCUS_09630 21990 22376 gene locus_tag LOCUS_09640 21990 22376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 22431 22661 gene locus_tag LOCUS_09650 22431 22661 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878063.1 protein_id gnl|my_center|LOCUS_09650 22729 23862 gene locus_tag LOCUS_09660 22729 23862 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878064.1 protein_id gnl|my_center|LOCUS_09660 23875 24486 gene locus_tag LOCUS_09670 23875 24486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 24503 25405 gene locus_tag LOCUS_09680 24503 25405 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368920.1 protein_id gnl|my_center|LOCUS_09680 26154 25456 gene locus_tag LOCUS_09690 26154 25456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 26593 26132 gene locus_tag LOCUS_09700 26593 26132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 26747 27178 gene locus_tag LOCUS_09710 gene gspG 26747 27178 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196811.1 protein_id gnl|my_center|LOCUS_09710 27147 27545 gene locus_tag LOCUS_09720 gene gspI 27147 27545 CDS product type II secretion system minor pseudopilin GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204729.1 protein_id gnl|my_center|LOCUS_09720 27546 28118 gene locus_tag LOCUS_09730 27546 28118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 28118 29158 gene locus_tag LOCUS_09740 gene gspK 28118 29158 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551121.1 protein_id gnl|my_center|LOCUS_09740 29163 30296 gene locus_tag LOCUS_09750 29163 30296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 30293 30748 gene locus_tag LOCUS_09760 30293 30748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 30727 31476 gene locus_tag LOCUS_09770 30727 31476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 >Feature sequence017 1665 733 gene locus_tag LOCUS_09780 1665 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 2296 1748 gene locus_tag LOCUS_09790 2296 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 2752 2303 gene locus_tag LOCUS_09800 2752 2303 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_09800 3973 2753 gene locus_tag LOCUS_09810 3973 2753 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_09810 5256 3976 gene locus_tag LOCUS_09820 gene sufD 5256 3976 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946340.1 protein_id gnl|my_center|LOCUS_09820 6020 5256 gene locus_tag LOCUS_09830 gene sufC 6020 5256 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_09830 7517 6069 gene locus_tag LOCUS_09840 gene sufB 7517 6069 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_09840 7981 7514 gene locus_tag LOCUS_09850 7981 7514 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141369.1 protein_id gnl|my_center|LOCUS_09850 8137 9417 gene locus_tag LOCUS_09860 gene gshA 8137 9417 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522914.1 protein_id gnl|my_center|LOCUS_09860 9410 10369 gene locus_tag LOCUS_09870 gene gshB 9410 10369 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316740.1 protein_id gnl|my_center|LOCUS_09870 11340 10303 gene locus_tag LOCUS_09880 11340 10303 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114722.1 protein_id gnl|my_center|LOCUS_09880 14116 11354 gene locus_tag LOCUS_09890 gene ppc 14116 11354 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085739.1 protein_id gnl|my_center|LOCUS_09890 14179 15117 gene locus_tag LOCUS_09900 gene hemC 14179 15117 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812742.1 protein_id gnl|my_center|LOCUS_09900 15122 15868 gene locus_tag LOCUS_09910 15122 15868 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687770.1 protein_id gnl|my_center|LOCUS_09910 15861 16859 gene locus_tag LOCUS_09920 15861 16859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 16856 17389 gene locus_tag LOCUS_09930 16856 17389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 18372 17356 gene locus_tag LOCUS_09940 18372 17356 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_09940 18389 19285 gene locus_tag LOCUS_09950 18389 19285 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204919.1 protein_id gnl|my_center|LOCUS_09950 19327 19761 gene locus_tag LOCUS_09960 gene aroQ 19327 19761 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068810.1 protein_id gnl|my_center|LOCUS_09960 19765 20223 gene locus_tag LOCUS_09970 gene accB 19765 20223 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814952.1 protein_id gnl|my_center|LOCUS_09970 20245 21597 gene locus_tag LOCUS_09980 gene accC 20245 21597 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814951.1 protein_id gnl|my_center|LOCUS_09980 21601 22506 gene locus_tag LOCUS_09990 gene prmA 21601 22506 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194259.1 protein_id gnl|my_center|LOCUS_09990 22533 22910 gene locus_tag LOCUS_10000 gene gcvH 22533 22910 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723327.1 protein_id gnl|my_center|LOCUS_10000 22967 23467 gene locus_tag LOCUS_10010 gene tpx 22967 23467 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693150.1 protein_id gnl|my_center|LOCUS_10010 23485 24417 gene locus_tag LOCUS_10020 23485 24417 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_10020 24426 25175 gene locus_tag LOCUS_10030 24426 25175 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186297.1 protein_id gnl|my_center|LOCUS_10030 25973 25164 gene locus_tag LOCUS_10040 25973 25164 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186146.1 protein_id gnl|my_center|LOCUS_10040 26182 25970 gene locus_tag LOCUS_10050 26182 25970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 26286 27632 gene locus_tag LOCUS_10060 26286 27632 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189788.1 protein_id gnl|my_center|LOCUS_10060 27703 28887 gene locus_tag LOCUS_10070 27703 28887 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814920.1 protein_id gnl|my_center|LOCUS_10070 29801 28881 gene locus_tag LOCUS_10080 29801 28881 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143748.1 protein_id gnl|my_center|LOCUS_10080 29952 31553 gene locus_tag LOCUS_10090 29952 31553 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537669.1 protein_id gnl|my_center|LOCUS_10090 31550 32653 gene locus_tag LOCUS_10100 31550 32653 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531909.1 protein_id gnl|my_center|LOCUS_10100 33101 32586 gene locus_tag LOCUS_10110 33101 32586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 >Feature sequence018 867 226 gene locus_tag LOCUS_10120 867 226 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619689.1 protein_id gnl|my_center|LOCUS_10120 1997 864 gene locus_tag LOCUS_10130 gene asd 1997 864 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209507.1 protein_id gnl|my_center|LOCUS_10130 3073 2000 gene locus_tag LOCUS_10140 gene leuB 3073 2000 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812648.1 protein_id gnl|my_center|LOCUS_10140 5845 3167 gene locus_tag LOCUS_10150 5845 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 6774 6010 gene locus_tag LOCUS_10160 gene truA 6774 6010 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244344.1 protein_id gnl|my_center|LOCUS_10160 7549 6797 gene locus_tag LOCUS_10170 7549 6797 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932977.1 protein_id gnl|my_center|LOCUS_10170 7696 8652 gene locus_tag LOCUS_10180 gene tal 7696 8652 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351598.1 protein_id gnl|my_center|LOCUS_10180 8790 9572 gene locus_tag LOCUS_10190 gene cyoA 8790 9572 CDS product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536354.1 protein_id gnl|my_center|LOCUS_10190 9576 11582 gene locus_tag LOCUS_10200 gene cyoB 9576 11582 CDS product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112371.1 protein_id gnl|my_center|LOCUS_10200 11579 12196 gene locus_tag LOCUS_10210 11579 12196 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704586.1 protein_id gnl|my_center|LOCUS_10210 12193 12516 gene locus_tag LOCUS_10220 gene cyoD 12193 12516 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190895.1 protein_id gnl|my_center|LOCUS_10220 12462 13400 gene locus_tag LOCUS_10230 gene cyoE 12462 13400 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195157148.1 protein_id gnl|my_center|LOCUS_10230 13494 15980 gene locus_tag LOCUS_10240 13494 15980 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_10240 16026 16940 gene locus_tag LOCUS_10250 gene gnd 16026 16940 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350162.1 protein_id gnl|my_center|LOCUS_10250 16950 18440 gene locus_tag LOCUS_10260 gene zwf 16950 18440 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056390.1 protein_id gnl|my_center|LOCUS_10260 18452 19168 gene locus_tag LOCUS_10270 gene pgl 18452 19168 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764047.1 protein_id gnl|my_center|LOCUS_10270 19245 20672 gene locus_tag LOCUS_10280 19245 20672 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199502.1 protein_id gnl|my_center|LOCUS_10280 20707 21720 gene locus_tag LOCUS_10290 20707 21720 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974005.1 protein_id gnl|my_center|LOCUS_10290 22089 22014 gene locus_tag LOCUS_t00230 22089 22014 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 22681 22184 gene locus_tag LOCUS_10300 22681 22184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 22831 23871 gene locus_tag LOCUS_10310 gene tsaD 22831 23871 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811013.1 protein_id gnl|my_center|LOCUS_10310 24623 23844 gene locus_tag LOCUS_10320 gene moeB 24623 23844 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198009.1 protein_id gnl|my_center|LOCUS_10320 26092 24641 gene locus_tag LOCUS_10330 gene cptA 26092 24641 CDS product protease CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929911.1 protein_id gnl|my_center|LOCUS_10330 27399 26137 gene locus_tag LOCUS_10340 gene envC 27399 26137 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704298.1 protein_id gnl|my_center|LOCUS_10340 28154 27405 gene locus_tag LOCUS_10350 gene gpmA 28154 27405 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295305.1 protein_id gnl|my_center|LOCUS_10350 28270 28689 gene locus_tag LOCUS_10360 28270 28689 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198006.1 protein_id gnl|my_center|LOCUS_10360 28695 28964 gene locus_tag LOCUS_10370 gene grxC 28695 28964 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200200.1 protein_id gnl|my_center|LOCUS_10370 29029 29499 gene locus_tag LOCUS_10380 gene secB 29029 29499 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225639.1 protein_id gnl|my_center|LOCUS_10380 29502 30485 gene locus_tag LOCUS_10390 29502 30485 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536061.1 protein_id gnl|my_center|LOCUS_10390 30955 30491 gene locus_tag LOCUS_10400 30955 30491 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035465.1 protein_id gnl|my_center|LOCUS_10400 31472 30990 gene locus_tag LOCUS_10410 31472 30990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 31669 32664 gene locus_tag LOCUS_10420 gene bioB 31669 32664 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035642.1 protein_id gnl|my_center|LOCUS_10420 >Feature sequence019 522 154 gene locus_tag LOCUS_10430 gene rbfA 522 154 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268880.1 protein_id gnl|my_center|LOCUS_10430 3357 526 gene locus_tag LOCUS_10440 gene infB 3357 526 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025871401.1 protein_id gnl|my_center|LOCUS_10440 4846 3371 gene locus_tag LOCUS_10450 gene nusA 4846 3371 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193517.1 protein_id gnl|my_center|LOCUS_10450 5285 4860 gene locus_tag LOCUS_10460 gene rimP 5285 4860 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216731.1 protein_id gnl|my_center|LOCUS_10460 6914 5391 gene locus_tag LOCUS_10470 6914 5391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 7016 8008 gene locus_tag LOCUS_10480 7016 8008 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064486.1 protein_id gnl|my_center|LOCUS_10480 8033 8758 gene locus_tag LOCUS_10490 8033 8758 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039897.1 protein_id gnl|my_center|LOCUS_10490 8872 10617 gene locus_tag LOCUS_10500 8872 10617 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084153.1 protein_id gnl|my_center|LOCUS_10500 10736 11071 gene locus_tag LOCUS_10510 10736 11071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 11068 11811 gene locus_tag LOCUS_10520 11068 11811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 12678 11830 gene locus_tag LOCUS_10530 12678 11830 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705198.1 protein_id gnl|my_center|LOCUS_10530 12885 13796 gene locus_tag LOCUS_10540 12885 13796 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087258.1 protein_id gnl|my_center|LOCUS_10540 15666 13828 gene locus_tag LOCUS_10550 gene ilvD 15666 13828 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084436.1 protein_id gnl|my_center|LOCUS_10550 16046 17854 gene locus_tag LOCUS_10560 gene kdpA 16046 17854 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185359.1 protein_id gnl|my_center|LOCUS_10560 17865 19937 gene locus_tag LOCUS_10570 gene kdpB 17865 19937 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522436.1 protein_id gnl|my_center|LOCUS_10570 19951 20532 gene locus_tag LOCUS_10580 gene kdpC 19951 20532 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814050.1 protein_id gnl|my_center|LOCUS_10580 20558 23245 gene locus_tag LOCUS_10590 20558 23245 CDS product DUF4118 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526440.1 protein_id gnl|my_center|LOCUS_10590 23242 23931 gene locus_tag LOCUS_10600 gene kdpE 23242 23931 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039223.1 protein_id gnl|my_center|LOCUS_10600 25607 23934 gene locus_tag LOCUS_10610 25607 23934 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065280.1 protein_id gnl|my_center|LOCUS_10610 25997 25617 gene locus_tag LOCUS_10620 25997 25617 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143803.1 protein_id gnl|my_center|LOCUS_10620 27369 25987 gene locus_tag LOCUS_10630 27369 25987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 27770 27366 gene locus_tag LOCUS_10640 27770 27366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10640 28516 27767 gene locus_tag LOCUS_10650 28516 27767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10650 29305 28526 gene locus_tag LOCUS_10660 gene cobI 29305 28526 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914028.1 protein_id gnl|my_center|LOCUS_10660 30597 29302 gene locus_tag LOCUS_10670 30597 29302 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631406.1 protein_id gnl|my_center|LOCUS_10670 <31083 30584 gene locus_tag LOCUS_10680 <31083 30584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000145958.1:cobalt-precorrin-5B (C(1))-methyltransferase >Feature sequence020 91 199 gene locus_tag LOCUS_r00010 91 199 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 344 688 gene locus_tag LOCUS_10690 344 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 705 1052 gene locus_tag LOCUS_10700 705 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 1307 1885 gene locus_tag LOCUS_10710 1307 1885 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186304.1 protein_id gnl|my_center|LOCUS_10710 1891 2265 gene locus_tag LOCUS_10720 1891 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 2244 2702 gene locus_tag LOCUS_10730 2244 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 2699 3160 gene locus_tag LOCUS_10740 2699 3160 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065147.1 protein_id gnl|my_center|LOCUS_10740 4199 3105 gene locus_tag LOCUS_10750 gene lptG 4199 3105 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552347.1 protein_id gnl|my_center|LOCUS_10750 6166 4196 gene locus_tag LOCUS_10760 gene acs 6166 4196 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188376.1 protein_id gnl|my_center|LOCUS_10760 6301 7824 gene locus_tag LOCUS_10770 6301 7824 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036607.1 protein_id gnl|my_center|LOCUS_10770 11185 7844 gene locus_tag LOCUS_10780 gene mfd 11185 7844 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193121.1 protein_id gnl|my_center|LOCUS_10780 11536 11201 gene locus_tag LOCUS_10790 gene iscA 11536 11201 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191333.1 protein_id gnl|my_center|LOCUS_10790 12232 11549 gene locus_tag LOCUS_10800 gene cysE 12232 11549 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_10800 12986 12225 gene locus_tag LOCUS_10810 gene trmJ 12986 12225 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406500.1 protein_id gnl|my_center|LOCUS_10810 13769 12993 gene locus_tag LOCUS_10820 13769 12993 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191664.1 protein_id gnl|my_center|LOCUS_10820 13918 14214 gene locus_tag LOCUS_10830 13918 14214 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807672.1 protein_id gnl|my_center|LOCUS_10830 15656 14211 gene locus_tag LOCUS_10840 gene gltX 15656 14211 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197094.1 protein_id gnl|my_center|LOCUS_10840 15655 16776 gene locus_tag LOCUS_10850 15655 16776 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535743.1 protein_id gnl|my_center|LOCUS_10850 16975 17214 gene locus_tag LOCUS_10860 16975 17214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 17995 17237 gene locus_tag LOCUS_10870 17995 17237 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112544.1 protein_id gnl|my_center|LOCUS_10870 19213 18005 gene locus_tag LOCUS_10880 gene bamC 19213 18005 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809956.1 protein_id gnl|my_center|LOCUS_10880 20101 19214 gene locus_tag LOCUS_10890 gene dapA 20101 19214 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809954.1 protein_id gnl|my_center|LOCUS_10890 20248 21240 gene locus_tag LOCUS_10900 gene glk 20248 21240 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141169.1 protein_id gnl|my_center|LOCUS_10900 21881 21198 gene locus_tag LOCUS_10910 21881 21198 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256419.1 protein_id gnl|my_center|LOCUS_10910 22045 24108 gene locus_tag LOCUS_10920 22045 24108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 24160 25812 gene locus_tag LOCUS_10930 24160 25812 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813705.1 protein_id gnl|my_center|LOCUS_10930 25819 26655 gene locus_tag LOCUS_10940 gene kdsA 25819 26655 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813703.1 protein_id gnl|my_center|LOCUS_10940 26701 27987 gene locus_tag LOCUS_10950 gene eno 26701 27987 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065136.1 protein_id gnl|my_center|LOCUS_10950 28014 28334 gene locus_tag LOCUS_10960 gene ftsB 28014 28334 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065137.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10960 29168 28353 gene locus_tag LOCUS_10970 29168 28353 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193722.1 protein_id gnl|my_center|LOCUS_10970 29134 30147 gene locus_tag LOCUS_10980 29134 30147 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203970.1 protein_id gnl|my_center|LOCUS_10980 >Feature sequence021 1426 338 gene locus_tag LOCUS_10990 gene apbC 1426 338 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193796.1 protein_id gnl|my_center|LOCUS_10990 1590 3236 gene locus_tag LOCUS_11000 gene metG 1590 3236 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225763.1 protein_id gnl|my_center|LOCUS_11000 3262 3696 gene locus_tag LOCUS_11010 3262 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 3693 7130 gene locus_tag LOCUS_11020 gene dnaE 3693 7130 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522462.1 protein_id gnl|my_center|LOCUS_11020 8402 7137 gene locus_tag LOCUS_11030 8402 7137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 8503 9075 gene locus_tag LOCUS_11040 8503 9075 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_11040 10949 9072 gene locus_tag LOCUS_11050 10949 9072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 12448 10946 gene locus_tag LOCUS_11060 12448 10946 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265670.1 protein_id gnl|my_center|LOCUS_11060 13611 12445 gene locus_tag LOCUS_11070 13611 12445 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926862.1 protein_id gnl|my_center|LOCUS_11070 14776 13637 gene locus_tag LOCUS_11080 14776 13637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 15774 14833 gene locus_tag LOCUS_11090 15774 14833 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523363.1 protein_id gnl|my_center|LOCUS_11090 16795 15806 gene locus_tag LOCUS_11100 16795 15806 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537325.1 protein_id gnl|my_center|LOCUS_11100 18153 16792 gene locus_tag LOCUS_11110 18153 16792 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932125.1 protein_id gnl|my_center|LOCUS_11110 19391 18198 gene locus_tag LOCUS_11120 19391 18198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 19727 19410 gene locus_tag LOCUS_11130 19727 19410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 21145 19724 gene locus_tag LOCUS_11140 21145 19724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 21947 21162 gene locus_tag LOCUS_11150 gene cpaB 21947 21162 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523372.1 protein_id gnl|my_center|LOCUS_11150 22501 22073 gene locus_tag LOCUS_11160 22501 22073 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523374.1 protein_id gnl|my_center|LOCUS_11160 22697 22527 gene locus_tag LOCUS_11170 22697 22527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 23154 23639 gene locus_tag LOCUS_11180 23154 23639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 23632 25476 gene locus_tag LOCUS_11190 23632 25476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 26956 25526 gene locus_tag LOCUS_11200 26956 25526 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_11200 27663 26962 gene locus_tag LOCUS_11210 gene bioD 27663 26962 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203536601.1 protein_id gnl|my_center|LOCUS_11210 28958 27660 gene locus_tag LOCUS_11220 gene bioA 28958 27660 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525973.1 protein_id gnl|my_center|LOCUS_11220 <29861 28958 gene locus_tag LOCUS_11230 <29861 28958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189736.1:8-amino-7-oxononanoate synthase >Feature sequence022 64 336 gene locus_tag LOCUS_11240 64 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 1324 314 gene locus_tag LOCUS_11250 gene waaF 1324 314 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109905.1 protein_id gnl|my_center|LOCUS_11250 1515 1321 gene locus_tag LOCUS_11260 1515 1321 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814195.1 protein_id gnl|my_center|LOCUS_11260 2445 1525 gene locus_tag LOCUS_11270 2445 1525 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188924.1 protein_id gnl|my_center|LOCUS_11270 2529 6755 gene locus_tag LOCUS_11280 2529 6755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 6793 7689 gene locus_tag LOCUS_11290 6793 7689 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039539.1 protein_id gnl|my_center|LOCUS_11290 7695 9149 gene locus_tag LOCUS_11300 gene tldD 7695 9149 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194084.1 protein_id gnl|my_center|LOCUS_11300 9194 10273 gene locus_tag LOCUS_11310 gene aroG 9194 10273 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813056.1 protein_id gnl|my_center|LOCUS_11310 10273 10848 gene locus_tag LOCUS_11320 10273 10848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 10858 11820 gene locus_tag LOCUS_11330 10858 11820 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193249.1 protein_id gnl|my_center|LOCUS_11330 11795 12811 gene locus_tag LOCUS_11340 11795 12811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 12853 13278 gene locus_tag LOCUS_11350 gene ndk 12853 13278 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810689.1 protein_id gnl|my_center|LOCUS_11350 13291 14388 gene locus_tag LOCUS_11360 gene rlmN 13291 14388 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219171.1 protein_id gnl|my_center|LOCUS_11360 14385 15623 gene locus_tag LOCUS_11370 gene ispG 14385 15623 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810695.1 protein_id gnl|my_center|LOCUS_11370 15620 16882 gene locus_tag LOCUS_11380 gene hisS 15620 16882 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140461.1 protein_id gnl|my_center|LOCUS_11380 16891 17523 gene locus_tag LOCUS_11390 16891 17523 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810700.1 protein_id gnl|my_center|LOCUS_11390 17520 18662 gene locus_tag LOCUS_11400 gene bamB 17520 18662 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177052.1 protein_id gnl|my_center|LOCUS_11400 18649 20085 gene locus_tag LOCUS_11410 gene der 18649 20085 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810703.1 protein_id gnl|my_center|LOCUS_11410 20098 22005 gene locus_tag LOCUS_11420 gene thrS 20098 22005 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812608.1 protein_id gnl|my_center|LOCUS_11420 22029 22655 gene locus_tag LOCUS_11430 gene infC 22029 22655 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071810680.1 protein_id gnl|my_center|LOCUS_11430 22753 22950 gene locus_tag LOCUS_11440 gene rpmI 22753 22950 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812834.1 protein_id gnl|my_center|LOCUS_11440 22960 23319 gene locus_tag LOCUS_11450 gene rplT 22960 23319 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214103.1 protein_id gnl|my_center|LOCUS_11450 23372 24397 gene locus_tag LOCUS_11460 gene pheS 23372 24397 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114409.1 protein_id gnl|my_center|LOCUS_11460 24407 26788 gene locus_tag LOCUS_11470 gene pheT 24407 26788 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225459.1 protein_id gnl|my_center|LOCUS_11470 26798 27103 gene locus_tag LOCUS_11480 26798 27103 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812826.1 protein_id gnl|my_center|LOCUS_11480 27081 27521 gene locus_tag LOCUS_11490 27081 27521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 27542 27618 gene locus_tag LOCUS_t00240 27542 27618 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 29007 27757 gene locus_tag LOCUS_11500 29007 27757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 29539 29066 gene locus_tag LOCUS_11510 gene creA 29539 29066 CDS product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815531.1 protein_id gnl|my_center|LOCUS_11510 29695 29771 gene locus_tag LOCUS_t00250 29695 29771 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence023 574 2586 gene locus_tag LOCUS_11520 574 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 2958 3869 gene locus_tag LOCUS_11530 2958 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 4758 4276 gene locus_tag LOCUS_11540 4758 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 5893 4745 gene locus_tag LOCUS_11550 5893 4745 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705890.1 protein_id gnl|my_center|LOCUS_11550 6025 6600 gene locus_tag LOCUS_11560 6025 6600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 6848 6603 gene locus_tag LOCUS_11570 6848 6603 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931105.1 protein_id gnl|my_center|LOCUS_11570 7247 6963 gene locus_tag LOCUS_11580 7247 6963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 7688 8950 gene locus_tag LOCUS_11590 7688 8950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 8965 9303 gene locus_tag LOCUS_11600 8965 9303 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198020.1 protein_id gnl|my_center|LOCUS_11600 9315 10757 gene locus_tag LOCUS_11610 9315 10757 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526016.1 protein_id gnl|my_center|LOCUS_11610 10930 12216 gene locus_tag LOCUS_11620 10930 12216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 12340 16041 gene locus_tag LOCUS_11630 gene metH 12340 16041 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113602.1 protein_id gnl|my_center|LOCUS_11630 16050 17471 gene locus_tag LOCUS_11640 gene mpl 16050 17471 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527766.1 protein_id gnl|my_center|LOCUS_11640 17443 19278 gene locus_tag LOCUS_11650 17443 19278 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194277.1 protein_id gnl|my_center|LOCUS_11650 19647 20042 gene locus_tag LOCUS_11660 19647 20042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 22139 20046 gene locus_tag LOCUS_11670 22139 20046 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035825.1 protein_id gnl|my_center|LOCUS_11670 23409 22126 gene locus_tag LOCUS_11680 23409 22126 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011381770.1 protein_id gnl|my_center|LOCUS_11680 24390 23422 gene locus_tag LOCUS_11690 24390 23422 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 protein_id gnl|my_center|LOCUS_11690 24880 24401 gene locus_tag LOCUS_11700 gene ruvX 24880 24401 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091869.1 protein_id gnl|my_center|LOCUS_11700 25433 24873 gene locus_tag LOCUS_11710 25433 24873 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185441.1 protein_id gnl|my_center|LOCUS_11710 25559 26329 gene locus_tag LOCUS_11720 gene xth 25559 26329 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926539.1 protein_id gnl|my_center|LOCUS_11720 27760 26324 gene locus_tag LOCUS_11730 gene glnG 27760 26324 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074101.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence024 137 1096 gene locus_tag LOCUS_11740 137 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 1100 1396 gene locus_tag LOCUS_11750 1100 1396 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530048.1 protein_id gnl|my_center|LOCUS_11750 1416 2990 gene locus_tag LOCUS_11760 gene glcD 1416 2990 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765139.1 protein_id gnl|my_center|LOCUS_11760 2993 4054 gene locus_tag LOCUS_11770 gene glcE 2993 4054 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943081.1 protein_id gnl|my_center|LOCUS_11770 4057 5340 gene locus_tag LOCUS_11780 gene glcF 4057 5340 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194146.1 protein_id gnl|my_center|LOCUS_11780 5376 6080 gene locus_tag LOCUS_11790 gene sfsA 5376 6080 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071164.1 protein_id gnl|my_center|LOCUS_11790 6148 7014 gene locus_tag LOCUS_11800 6148 7014 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143980.1 protein_id gnl|my_center|LOCUS_11800 7290 7042 gene locus_tag LOCUS_11810 7290 7042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 7506 7733 gene locus_tag LOCUS_11820 gene tusA 7506 7733 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015099.1 protein_id gnl|my_center|LOCUS_11820 8627 7776 gene locus_tag LOCUS_11830 8627 7776 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929150.1 protein_id gnl|my_center|LOCUS_11830 9184 8624 gene locus_tag LOCUS_11840 gene rfbC 9184 8624 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771397.1 protein_id gnl|my_center|LOCUS_11840 10127 9234 gene locus_tag LOCUS_11850 gene rfbD 10127 9234 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807150.1 protein_id gnl|my_center|LOCUS_11850 10345 10818 gene locus_tag LOCUS_11860 10345 10818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11860 11062 11379 gene locus_tag LOCUS_11870 11062 11379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 11469 12659 gene locus_tag LOCUS_11880 11469 12659 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037434.1 protein_id gnl|my_center|LOCUS_11880 12852 13889 gene locus_tag LOCUS_11890 12852 13889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 14047 14724 gene locus_tag LOCUS_11900 14047 14724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 16092 14782 gene locus_tag LOCUS_11910 16092 14782 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198124.1 protein_id gnl|my_center|LOCUS_11910 16091 18106 gene locus_tag LOCUS_11920 gene uvrB 16091 18106 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812466.1 protein_id gnl|my_center|LOCUS_11920 19518 18103 gene locus_tag LOCUS_11930 19518 18103 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 protein_id gnl|my_center|LOCUS_11930 21560 19515 gene locus_tag LOCUS_11940 21560 19515 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257258.1 protein_id gnl|my_center|LOCUS_11940 22980 21565 gene locus_tag LOCUS_11950 22980 21565 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204730.1 protein_id gnl|my_center|LOCUS_11950 26117 22995 gene locus_tag LOCUS_11960 gene mdtC 26117 22995 CDS product multidrug efflux RND transporter permease subunit MdtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667515.1 protein_id gnl|my_center|LOCUS_11960 <27043 26114 gene locus_tag LOCUS_11970 <27043 26114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204974.1:MdtB/MuxB family multidrug efflux RND transporter permease subunit >Feature sequence025 383 703 gene locus_tag LOCUS_11980 gene rpsJ 383 703 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199280.1 protein_id gnl|my_center|LOCUS_11980 797 1441 gene locus_tag LOCUS_11990 gene rplC 797 1441 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521904.1 protein_id gnl|my_center|LOCUS_11990 1443 2063 gene locus_tag LOCUS_12000 gene rplD 1443 2063 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199276.1 protein_id gnl|my_center|LOCUS_12000 2060 2368 gene locus_tag LOCUS_12010 gene rplW 2060 2368 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307955.1 protein_id gnl|my_center|LOCUS_12010 2371 3198 gene locus_tag LOCUS_12020 gene rplB 2371 3198 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199274.1 protein_id gnl|my_center|LOCUS_12020 3210 3494 gene locus_tag LOCUS_12030 gene rpsS 3210 3494 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199273.1 protein_id gnl|my_center|LOCUS_12030 3507 3842 gene locus_tag LOCUS_12040 gene rplV 3507 3842 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215424.1 protein_id gnl|my_center|LOCUS_12040 3845 4555 gene locus_tag LOCUS_12050 gene rpsC 3845 4555 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185240.1 protein_id gnl|my_center|LOCUS_12050 4539 4952 gene locus_tag LOCUS_12060 gene rplP 4539 4952 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199857.1 protein_id gnl|my_center|LOCUS_12060 4958 5152 gene locus_tag LOCUS_12070 gene rpmC 4958 5152 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199856.1 protein_id gnl|my_center|LOCUS_12070 5149 5427 gene locus_tag LOCUS_12080 gene rpsQ 5149 5427 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555480.1 protein_id gnl|my_center|LOCUS_12080 5574 5942 gene locus_tag LOCUS_12090 gene rplN 5574 5942 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806916.1 protein_id gnl|my_center|LOCUS_12090 5951 6268 gene locus_tag LOCUS_12100 gene rplX 5951 6268 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771523.1 protein_id gnl|my_center|LOCUS_12100 6280 6819 gene locus_tag LOCUS_12110 gene rplE 6280 6819 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215436.1 protein_id gnl|my_center|LOCUS_12110 6828 7133 gene locus_tag LOCUS_12120 gene rpsN 6828 7133 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216244.1 protein_id gnl|my_center|LOCUS_12120 7151 7543 gene locus_tag LOCUS_12130 gene rpsH 7151 7543 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806920.1 protein_id gnl|my_center|LOCUS_12130 7556 8089 gene locus_tag LOCUS_12140 gene rplF 7556 8089 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064757.1 protein_id gnl|my_center|LOCUS_12140 8102 8455 gene locus_tag LOCUS_12150 gene rplR 8102 8455 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197946.1 protein_id gnl|my_center|LOCUS_12150 8478 8984 gene locus_tag LOCUS_12160 gene rpsE 8478 8984 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215445.1 protein_id gnl|my_center|LOCUS_12160 8987 9175 gene locus_tag LOCUS_12170 gene rpmD 8987 9175 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215447.1 protein_id gnl|my_center|LOCUS_12170 9185 9631 gene locus_tag LOCUS_12180 gene rplO 9185 9631 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197941.1 protein_id gnl|my_center|LOCUS_12180 9636 10952 gene locus_tag LOCUS_12190 gene secY 9636 10952 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806926.1 protein_id gnl|my_center|LOCUS_12190 10956 11174 gene locus_tag LOCUS_12200 gene infA 10956 11174 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215452.1 protein_id gnl|my_center|LOCUS_12200 11344 11706 gene locus_tag LOCUS_12210 gene rpsM 11344 11706 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197938.1 protein_id gnl|my_center|LOCUS_12210 11727 12122 gene locus_tag LOCUS_12220 gene rpsK 11727 12122 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216249.1 protein_id gnl|my_center|LOCUS_12220 12141 12767 gene locus_tag LOCUS_12230 gene rpsD 12141 12767 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938623.1 protein_id gnl|my_center|LOCUS_12230 12806 13801 gene locus_tag LOCUS_12240 gene rpoA 12806 13801 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197925.1 protein_id gnl|my_center|LOCUS_12240 13868 14257 gene locus_tag LOCUS_12250 gene rplQ 13868 14257 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224774.1 protein_id gnl|my_center|LOCUS_12250 15096 14323 gene locus_tag LOCUS_12260 15096 14323 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056646.1 protein_id gnl|my_center|LOCUS_12260 15554 15123 gene locus_tag LOCUS_12270 15554 15123 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114104.1 protein_id gnl|my_center|LOCUS_12270 15865 15551 gene locus_tag LOCUS_12280 15865 15551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 16271 15885 gene locus_tag LOCUS_12290 gene crcB 16271 15885 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094051.1 protein_id gnl|my_center|LOCUS_12290 19153 16322 gene locus_tag LOCUS_12300 gene uvrA 19153 16322 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526066.1 protein_id gnl|my_center|LOCUS_12300 19303 20457 gene locus_tag LOCUS_12310 19303 20457 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002251980.1 protein_id gnl|my_center|LOCUS_12310 20473 20940 gene locus_tag LOCUS_12320 gene ssb 20473 20940 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806953.1 protein_id gnl|my_center|LOCUS_12320 22658 21069 gene locus_tag LOCUS_12330 22658 21069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 24422 22659 gene locus_tag LOCUS_12340 gene aspS 24422 22659 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189849.1 protein_id gnl|my_center|LOCUS_12340 <25076 24458 gene locus_tag LOCUS_12350 <25076 24458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189093.1:DUF502 domain-containing protein >Feature sequence026 <1 755 gene locus_tag LOCUS_12360 <1 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203915.1:tRNA pseudouridine(55) synthase TruB 736 2544 gene locus_tag LOCUS_12370 736 2544 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 protein_id gnl|my_center|LOCUS_12370 3161 2532 gene locus_tag LOCUS_12380 3161 2532 CDS product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192015.1 protein_id gnl|my_center|LOCUS_12380 4564 3161 gene locus_tag LOCUS_12390 4564 3161 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191338.1 protein_id gnl|my_center|LOCUS_12390 5294 4566 gene locus_tag LOCUS_12400 5294 4566 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193278.1 protein_id gnl|my_center|LOCUS_12400 6234 5302 gene locus_tag LOCUS_12410 6234 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 10033 6299 gene locus_tag LOCUS_12420 gene hrpA 10033 6299 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039506.1 protein_id gnl|my_center|LOCUS_12420 11694 10030 gene locus_tag LOCUS_12430 11694 10030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191882.1 protein_id gnl|my_center|LOCUS_12430 11955 11749 gene locus_tag LOCUS_12440 gene rpmE 11955 11749 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003027123.1 protein_id gnl|my_center|LOCUS_12440 13304 12045 gene locus_tag LOCUS_12450 gene rho 13304 12045 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521321.1 protein_id gnl|my_center|LOCUS_12450 13800 13477 gene locus_tag LOCUS_12460 gene trxA 13800 13477 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191795.1 protein_id gnl|my_center|LOCUS_12460 13982 14311 gene locus_tag LOCUS_12470 13982 14311 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205776.1 protein_id gnl|my_center|LOCUS_12470 15450 14353 gene locus_tag LOCUS_12480 15450 14353 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_12480 16014 15643 gene locus_tag LOCUS_12490 16014 15643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12490 16724 15978 gene locus_tag LOCUS_12500 16724 15978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12500 18345 16741 gene locus_tag LOCUS_12510 18345 16741 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088888.1 protein_id gnl|my_center|LOCUS_12510 18501 19103 gene locus_tag LOCUS_12520 18501 19103 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328727.1 protein_id gnl|my_center|LOCUS_12520 19120 22617 gene locus_tag LOCUS_12530 19120 22617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 22614 23012 gene locus_tag LOCUS_12540 22614 23012 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626534.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence027 1356 277 gene locus_tag LOCUS_12550 gene arsB 1356 277 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272375.1 protein_id gnl|my_center|LOCUS_12550 1726 1370 gene locus_tag LOCUS_12560 1726 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 3605 2235 gene locus_tag LOCUS_12570 3605 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 3860 4360 gene locus_tag LOCUS_12580 3860 4360 CDS product MEKHLA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192119.1 protein_id gnl|my_center|LOCUS_12580 4388 5308 gene locus_tag LOCUS_12590 4388 5308 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065041.1 protein_id gnl|my_center|LOCUS_12590 5823 5392 gene locus_tag LOCUS_12600 5823 5392 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195832.1 protein_id gnl|my_center|LOCUS_12600 6692 5820 gene locus_tag LOCUS_12610 gene atpG 6692 5820 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195831.1 protein_id gnl|my_center|LOCUS_12610 7787 6705 gene locus_tag LOCUS_12620 7787 6705 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389221.1 protein_id gnl|my_center|LOCUS_12620 10123 7769 gene locus_tag LOCUS_12630 10123 7769 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140999.1 protein_id gnl|my_center|LOCUS_12630 10242 10901 gene locus_tag LOCUS_12640 10242 10901 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338471.1 protein_id gnl|my_center|LOCUS_12640 13752 11098 gene locus_tag LOCUS_12650 13752 11098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 13884 14129 gene locus_tag LOCUS_12660 13884 14129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 14515 14138 gene locus_tag LOCUS_12670 14515 14138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 14931 14512 gene locus_tag LOCUS_12680 14931 14512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 15300 15211 gene locus_tag LOCUS_t00260 15300 15211 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 17116 15311 gene locus_tag LOCUS_12690 17116 15311 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814586.1 protein_id gnl|my_center|LOCUS_12690 18482 17241 gene locus_tag LOCUS_12700 18482 17241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 18701 18775 gene locus_tag LOCUS_t00270 18701 18775 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 19605 18877 gene locus_tag LOCUS_12710 gene lpxH 19605 18877 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095922.1 protein_id gnl|my_center|LOCUS_12710 20102 19611 gene locus_tag LOCUS_12720 20102 19611 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248574.1 protein_id gnl|my_center|LOCUS_12720 20736 20089 gene locus_tag LOCUS_12730 20736 20089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 20849 22240 gene locus_tag LOCUS_12740 gene cysS 20849 22240 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010355798.1 protein_id gnl|my_center|LOCUS_12740 23377 22247 gene locus_tag LOCUS_12750 gene dnaJ 23377 22247 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522147.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence028 2050 830 gene locus_tag LOCUS_12760 gene hflK 2050 830 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928767.1 protein_id gnl|my_center|LOCUS_12760 3263 2040 gene locus_tag LOCUS_12770 gene hflX 3263 2040 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191816.1 protein_id gnl|my_center|LOCUS_12770 3512 3267 gene locus_tag LOCUS_12780 gene hfq 3512 3267 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192796.1 protein_id gnl|my_center|LOCUS_12780 3708 3784 gene locus_tag LOCUS_t00280 3708 3784 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4626 3787 gene locus_tag LOCUS_12790 4626 3787 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811915.1 protein_id gnl|my_center|LOCUS_12790 4772 6124 gene locus_tag LOCUS_12800 4772 6124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 6124 9648 gene locus_tag LOCUS_12810 gene recC 6124 9648 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010793829.1 protein_id gnl|my_center|LOCUS_12810 9664 12459 gene locus_tag LOCUS_12820 9664 12459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12820 12348 13298 gene locus_tag LOCUS_12830 12348 13298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 13295 15346 gene locus_tag LOCUS_12840 gene recD 13295 15346 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114993.1 protein_id gnl|my_center|LOCUS_12840 16628 15309 gene locus_tag LOCUS_12850 16628 15309 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931889.1 protein_id gnl|my_center|LOCUS_12850 17236 16607 gene locus_tag LOCUS_12860 17236 16607 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931888.1 protein_id gnl|my_center|LOCUS_12860 20311 17270 gene locus_tag LOCUS_12870 20311 17270 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_12870 21330 20308 gene locus_tag LOCUS_12880 21330 20308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 22682 21327 gene locus_tag LOCUS_12890 22682 21327 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146571912.1 protein_id gnl|my_center|LOCUS_12890 >Feature sequence029 1476 2684 gene locus_tag LOCUS_12900 1476 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 2810 4141 gene locus_tag LOCUS_12910 2810 4141 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216114.1 protein_id gnl|my_center|LOCUS_12910 4245 4817 gene locus_tag LOCUS_12920 4245 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 6493 4823 gene locus_tag LOCUS_12930 gene asnB 6493 4823 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_12930 7713 6490 gene locus_tag LOCUS_12940 7713 6490 CDS product pyridoxal-dependent decarboxylase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390883.1 protein_id gnl|my_center|LOCUS_12940 8750 7710 gene locus_tag LOCUS_12950 gene tviC 8750 7710 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosaminuronic acid C-4 epimerase TviC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127915.1 protein_id gnl|my_center|LOCUS_12950 10048 8753 gene locus_tag LOCUS_12960 10048 8753 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_12960 10182 11762 gene locus_tag LOCUS_12970 10182 11762 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827567.1 protein_id gnl|my_center|LOCUS_12970 12728 11775 gene locus_tag LOCUS_12980 12728 11775 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532216.1 protein_id gnl|my_center|LOCUS_12980 14650 12725 gene locus_tag LOCUS_12990 14650 12725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 17727 14941 gene locus_tag LOCUS_13000 gene prsT 17727 14941 CDS product PEP-CTERM system TPR-repeat protein PrsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942631.1 protein_id gnl|my_center|LOCUS_13000 17964 18125 gene locus_tag LOCUS_13010 17964 18125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 18592 18891 gene locus_tag LOCUS_13020 18592 18891 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042397.1 protein_id gnl|my_center|LOCUS_13020 19017 19436 gene locus_tag LOCUS_13030 19017 19436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 20078 19746 gene locus_tag LOCUS_13040 gene pemK 20078 19746 CDS product type II toxin-antitoxin system toxin endoribonuclease PemK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001398199.1 protein_id gnl|my_center|LOCUS_13040 20335 20078 gene locus_tag LOCUS_13050 20335 20078 CDS product MazE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042074.1 protein_id gnl|my_center|LOCUS_13050 20775 20518 gene locus_tag LOCUS_13060 20775 20518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 21666 20812 gene locus_tag LOCUS_13070 21666 20812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142083.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence030 1388 465 gene locus_tag LOCUS_13080 gene cysD 1388 465 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039486.1 protein_id gnl|my_center|LOCUS_13080 2098 1385 gene locus_tag LOCUS_13090 2098 1385 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004565842.1 protein_id gnl|my_center|LOCUS_13090 2599 2102 gene locus_tag LOCUS_13100 2599 2102 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191986.1 protein_id gnl|my_center|LOCUS_13100 4268 2592 gene locus_tag LOCUS_13110 4268 2592 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064644.1 protein_id gnl|my_center|LOCUS_13110 5577 4402 gene locus_tag LOCUS_13120 5577 4402 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186237.1 protein_id gnl|my_center|LOCUS_13120 6897 5635 gene locus_tag LOCUS_13130 6897 5635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 8281 6911 gene locus_tag LOCUS_13140 8281 6911 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186079.1 protein_id gnl|my_center|LOCUS_13140 8928 8278 gene locus_tag LOCUS_13150 gene purN 8928 8278 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812554.1 protein_id gnl|my_center|LOCUS_13150 9108 8932 gene locus_tag LOCUS_13160 9108 8932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 10089 9115 gene locus_tag LOCUS_13170 gene purM 10089 9115 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194386.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13170 10159 11160 gene locus_tag LOCUS_13180 10159 11160 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404282.1 protein_id gnl|my_center|LOCUS_13180 11160 11816 gene locus_tag LOCUS_13190 gene hda 11160 11816 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039150.1 protein_id gnl|my_center|LOCUS_13190 11806 12498 gene locus_tag LOCUS_13200 11806 12498 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194213.1 protein_id gnl|my_center|LOCUS_13200 12495 13817 gene locus_tag LOCUS_13210 gene pcnB 12495 13817 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065010.1 protein_id gnl|my_center|LOCUS_13210 13817 14311 gene locus_tag LOCUS_13220 gene folK 13817 14311 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707280.1 protein_id gnl|my_center|LOCUS_13220 14317 15141 gene locus_tag LOCUS_13230 gene panC 14317 15141 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064922.1 protein_id gnl|my_center|LOCUS_13230 17732 15138 gene locus_tag LOCUS_13240 gene alaS 17732 15138 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204967.1 protein_id gnl|my_center|LOCUS_13240 20064 17797 gene locus_tag LOCUS_13250 gene clpA 20064 17797 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447476.1 protein_id gnl|my_center|LOCUS_13250 20369 20061 gene locus_tag LOCUS_13260 gene clpS 20369 20061 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820400.1 protein_id gnl|my_center|LOCUS_13260 20627 20830 gene locus_tag LOCUS_13270 20627 20830 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196460.1 protein_id gnl|my_center|LOCUS_13270 <21534 20899 gene locus_tag LOCUS_13280 <21534 20899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005110588.1:fatty acid--CoA ligase >Feature sequence031 2954 1293 gene locus_tag LOCUS_13290 2954 1293 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039376.1 protein_id gnl|my_center|LOCUS_13290 3725 2982 gene locus_tag LOCUS_13300 3725 2982 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190040.1 protein_id gnl|my_center|LOCUS_13300 4268 3729 gene locus_tag LOCUS_13310 gene gmhB 4268 3729 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522791.1 protein_id gnl|my_center|LOCUS_13310 6359 4290 gene locus_tag LOCUS_13320 gene glyS 6359 4290 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951416.1 protein_id gnl|my_center|LOCUS_13320 7246 6356 gene locus_tag LOCUS_13330 gene glyQ 7246 6356 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189444.1 protein_id gnl|my_center|LOCUS_13330 7750 7253 gene locus_tag LOCUS_13340 7750 7253 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207954.1 protein_id gnl|my_center|LOCUS_13340 9228 7747 gene locus_tag LOCUS_13350 gene lnt 9228 7747 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261462.1 protein_id gnl|my_center|LOCUS_13350 10076 9228 gene locus_tag LOCUS_13360 10076 9228 CDS product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189366.1 protein_id gnl|my_center|LOCUS_13360 10542 10069 gene locus_tag LOCUS_13370 10542 10069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 11513 10539 gene locus_tag LOCUS_13380 11513 10539 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093159.1 protein_id gnl|my_center|LOCUS_13380 12869 11514 gene locus_tag LOCUS_13390 gene miaB 12869 11514 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927876.1 protein_id gnl|my_center|LOCUS_13390 13032 13108 gene locus_tag LOCUS_t00290 13032 13108 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 14027 13311 gene locus_tag LOCUS_13400 14027 13311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 14434 14039 gene locus_tag LOCUS_13410 14434 14039 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140046606.1 protein_id gnl|my_center|LOCUS_13410 14671 14892 gene locus_tag LOCUS_13420 14671 14892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 14961 15503 gene locus_tag LOCUS_13430 14961 15503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 15314 15323 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 16779 15547 gene locus_tag LOCUS_13440 16779 15547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 17500 16772 gene locus_tag LOCUS_13450 17500 16772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 18203 17505 gene locus_tag LOCUS_13460 18203 17505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 18410 18997 gene locus_tag LOCUS_13470 18410 18997 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919854.1 protein_id gnl|my_center|LOCUS_13470 20100 19012 gene locus_tag LOCUS_13480 gene aroC 20100 19012 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266572.1 protein_id gnl|my_center|LOCUS_13480 >Feature sequence032 1313 195 gene locus_tag LOCUS_13490 gene queG 1313 195 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037446.1 protein_id gnl|my_center|LOCUS_13490 1335 1844 gene locus_tag LOCUS_13500 1335 1844 CDS product bifunctional alanine racemase/tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065018.1 protein_id gnl|my_center|LOCUS_13500 1850 3166 gene locus_tag LOCUS_13510 1850 3166 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247543.1 protein_id gnl|my_center|LOCUS_13510 3163 4995 gene locus_tag LOCUS_13520 gene mutL 3163 4995 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039151.1 protein_id gnl|my_center|LOCUS_13520 4985 5929 gene locus_tag LOCUS_13530 gene miaA 4985 5929 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113929.1 protein_id gnl|my_center|LOCUS_13530 7305 5917 gene locus_tag LOCUS_13540 gene xseA 7305 5917 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522628.1 protein_id gnl|my_center|LOCUS_13540 7589 8191 gene locus_tag LOCUS_13550 7589 8191 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064089.1 protein_id gnl|my_center|LOCUS_13550 8188 8592 gene locus_tag LOCUS_13560 8188 8592 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064090.1 protein_id gnl|my_center|LOCUS_13560 8593 9609 gene locus_tag LOCUS_13570 gene lpxK 8593 9609 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072734.1 protein_id gnl|my_center|LOCUS_13570 9602 9781 gene locus_tag LOCUS_13580 9602 9781 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947637.1 protein_id gnl|my_center|LOCUS_13580 9778 10581 gene locus_tag LOCUS_13590 gene kdsB 9778 10581 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185994.1 protein_id gnl|my_center|LOCUS_13590 10607 11272 gene locus_tag LOCUS_13600 gene adk 10607 11272 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064094.1 protein_id gnl|my_center|LOCUS_13600 11308 12567 gene locus_tag LOCUS_13610 11308 12567 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 protein_id gnl|my_center|LOCUS_13610 13306 12725 gene locus_tag LOCUS_13620 13306 12725 CDS product DUF4865 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027533.1 protein_id gnl|my_center|LOCUS_13620 13512 14441 gene locus_tag LOCUS_13630 13512 14441 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532847.1 protein_id gnl|my_center|LOCUS_13630 15537 14884 gene locus_tag LOCUS_13640 15537 14884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 16005 16619 gene locus_tag LOCUS_13650 16005 16619 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552423.1 protein_id gnl|my_center|LOCUS_13650 17097 17246 gene locus_tag LOCUS_13660 17097 17246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 17243 17452 gene locus_tag LOCUS_13670 17243 17452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13670 17463 17720 gene locus_tag LOCUS_13680 17463 17720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 17897 18181 gene locus_tag LOCUS_13690 17897 18181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 18187 19497 gene locus_tag LOCUS_13700 18187 19497 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence033 1892 1437 gene locus_tag LOCUS_13710 1892 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 2717 2082 gene locus_tag LOCUS_13720 2717 2082 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532164.1 protein_id gnl|my_center|LOCUS_13720 3346 2741 gene locus_tag LOCUS_13730 3346 2741 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942196.1 protein_id gnl|my_center|LOCUS_13730 3795 3343 gene locus_tag LOCUS_13740 3795 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13740 4961 4539 gene locus_tag LOCUS_13750 4961 4539 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943110.1 protein_id gnl|my_center|LOCUS_13750 5209 4973 gene locus_tag LOCUS_13760 5209 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 6927 6133 gene locus_tag LOCUS_13770 6927 6133 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368130.1 protein_id gnl|my_center|LOCUS_13770 7107 7799 gene locus_tag LOCUS_13780 7107 7799 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192784.1 protein_id gnl|my_center|LOCUS_13780 8981 8622 gene locus_tag LOCUS_13790 8981 8622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 9212 11650 gene locus_tag LOCUS_13800 gene copA 9212 11650 CDS product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242925.1 protein_id gnl|my_center|LOCUS_13800 11665 11874 gene locus_tag LOCUS_13810 11665 11874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 11858 12175 gene locus_tag LOCUS_13820 gene csoR 11858 12175 CDS product copper-sensing transcriptional repressor CsoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228404.1 protein_id gnl|my_center|LOCUS_13820 13237 12317 gene locus_tag LOCUS_13830 13237 12317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 16692 13510 gene locus_tag LOCUS_13840 16692 13510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 18180 16882 gene locus_tag LOCUS_13850 18180 16882 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023852902.1 protein_id gnl|my_center|LOCUS_13850 19173 18196 gene locus_tag LOCUS_13860 19173 18196 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402926.1 protein_id gnl|my_center|LOCUS_13860 19468 19190 gene locus_tag LOCUS_13870 19468 19190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 >Feature sequence034 1053 2003 gene locus_tag LOCUS_13880 1053 2003 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193798.1 protein_id gnl|my_center|LOCUS_13880 2749 1934 gene locus_tag LOCUS_13890 2749 1934 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821344.1 protein_id gnl|my_center|LOCUS_13890 3335 2739 gene locus_tag LOCUS_13900 3335 2739 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192535.1 protein_id gnl|my_center|LOCUS_13900 3432 3932 gene locus_tag LOCUS_13910 gene yceD 3432 3932 CDS product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174482.1 protein_id gnl|my_center|LOCUS_13910 3997 4176 gene locus_tag LOCUS_13920 gene rpmF 3997 4176 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192741.1 protein_id gnl|my_center|LOCUS_13920 4180 5238 gene locus_tag LOCUS_13930 gene plsX 4180 5238 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192749.1 protein_id gnl|my_center|LOCUS_13930 5235 6197 gene locus_tag LOCUS_13940 5235 6197 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687179.1 protein_id gnl|my_center|LOCUS_13940 6244 7173 gene locus_tag LOCUS_13950 gene fabD 6244 7173 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813821.1 protein_id gnl|my_center|LOCUS_13950 7188 7934 gene locus_tag LOCUS_13960 gene fabG 7188 7934 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197597.1 protein_id gnl|my_center|LOCUS_13960 8022 8261 gene locus_tag LOCUS_13970 gene acpP 8022 8261 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381096.1 protein_id gnl|my_center|LOCUS_13970 8326 9567 gene locus_tag LOCUS_13980 gene fabF 8326 9567 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193086.1 protein_id gnl|my_center|LOCUS_13980 9580 10569 gene locus_tag LOCUS_13990 gene mltG 9580 10569 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930596.1 protein_id gnl|my_center|LOCUS_13990 10490 11197 gene locus_tag LOCUS_14000 gene tmk 10490 11197 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811733.1 protein_id gnl|my_center|LOCUS_14000 11185 12153 gene locus_tag LOCUS_14010 11185 12153 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192693.1 protein_id gnl|my_center|LOCUS_14010 12161 12931 gene locus_tag LOCUS_14020 12161 12931 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192025.1 protein_id gnl|my_center|LOCUS_14020 13005 13553 gene locus_tag LOCUS_14030 13005 13553 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194252.1 protein_id gnl|my_center|LOCUS_14030 13630 14112 gene locus_tag LOCUS_14040 13630 14112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 14126 14923 gene locus_tag LOCUS_14050 gene panB 14126 14923 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194137.1 protein_id gnl|my_center|LOCUS_14050 14913 16274 gene locus_tag LOCUS_14060 14913 16274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 16271 17458 gene locus_tag LOCUS_14070 16271 17458 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097455.1 protein_id gnl|my_center|LOCUS_14070 17547 18428 gene locus_tag LOCUS_14080 17547 18428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 >Feature sequence035 1573 668 gene locus_tag LOCUS_14090 gene cysD 1573 668 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640249.1 protein_id gnl|my_center|LOCUS_14090 1690 2457 gene locus_tag LOCUS_14100 gene cysQ 1690 2457 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818748.1 protein_id gnl|my_center|LOCUS_14100 2466 3254 gene locus_tag LOCUS_14110 2466 3254 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194827.1 protein_id gnl|my_center|LOCUS_14110 3314 4312 gene locus_tag LOCUS_14120 3314 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 4291 5238 gene locus_tag LOCUS_14130 4291 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 5220 6203 gene locus_tag LOCUS_14140 5220 6203 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061860.1 protein_id gnl|my_center|LOCUS_14140 6200 7186 gene locus_tag LOCUS_14150 6200 7186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 7588 8658 gene locus_tag LOCUS_14160 7588 8658 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690973.1 protein_id gnl|my_center|LOCUS_14160 8932 9282 gene locus_tag LOCUS_14170 8932 9282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 9472 9726 gene locus_tag LOCUS_14180 9472 9726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 11446 10001 gene locus_tag LOCUS_14190 11446 10001 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626578.1 protein_id gnl|my_center|LOCUS_14190 11689 11495 gene locus_tag LOCUS_14200 11689 11495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 12884 11706 gene locus_tag LOCUS_14210 12884 11706 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390844.1 protein_id gnl|my_center|LOCUS_14210 14114 12891 gene locus_tag LOCUS_14220 14114 12891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 15994 14111 gene locus_tag LOCUS_14230 15994 14111 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_14230 16579 17301 gene locus_tag LOCUS_14240 16579 17301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 <19134 17905 gene locus_tag LOCUS_14250 <19134 17905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001981812.1:kelch repeat-containing protein >Feature sequence036 1651 83 gene locus_tag LOCUS_14260 gene guaA 1651 83 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812366.1 protein_id gnl|my_center|LOCUS_14260 3115 1655 gene locus_tag LOCUS_14270 gene guaB 3115 1655 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812368.1 protein_id gnl|my_center|LOCUS_14270 4317 3196 gene locus_tag LOCUS_14280 gene proB 4317 3196 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807457.1 protein_id gnl|my_center|LOCUS_14280 5399 4314 gene locus_tag LOCUS_14290 gene obgE 5399 4314 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194312.1 protein_id gnl|my_center|LOCUS_14290 5730 5458 gene locus_tag LOCUS_14300 gene rpmA 5730 5458 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005339028.1 protein_id gnl|my_center|LOCUS_14300 6057 5740 gene locus_tag LOCUS_14310 gene rplU 6057 5740 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807462.1 protein_id gnl|my_center|LOCUS_14310 6904 6116 gene locus_tag LOCUS_14320 6904 6116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 7216 7141 gene locus_tag LOCUS_t00300 7216 7141 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 8128 7262 gene locus_tag LOCUS_14330 gene ybgF 8128 7262 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186614.1 protein_id gnl|my_center|LOCUS_14330 8676 8152 gene locus_tag LOCUS_14340 8676 8152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 10066 8780 gene locus_tag LOCUS_14350 gene tolB 10066 8780 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931417.1 protein_id gnl|my_center|LOCUS_14350 10865 10056 gene locus_tag LOCUS_14360 10865 10056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 11281 10865 gene locus_tag LOCUS_14370 gene tolR 11281 10865 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522197.1 protein_id gnl|my_center|LOCUS_14370 11970 11281 gene locus_tag LOCUS_14380 gene tolQ 11970 11281 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186467.1 protein_id gnl|my_center|LOCUS_14380 12380 11967 gene locus_tag LOCUS_14390 12380 11967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 13420 12377 gene locus_tag LOCUS_14400 gene ruvB 13420 12377 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194268.1 protein_id gnl|my_center|LOCUS_14400 14051 13449 gene locus_tag LOCUS_14410 gene ruvA 14051 13449 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814226.1 protein_id gnl|my_center|LOCUS_14410 14611 14048 gene locus_tag LOCUS_14420 gene ruvC 14611 14048 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196340.1 protein_id gnl|my_center|LOCUS_14420 15333 14608 gene locus_tag LOCUS_14430 15333 14608 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185607.1 protein_id gnl|my_center|LOCUS_14430 15878 15420 gene locus_tag LOCUS_14440 15878 15420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 16014 16610 gene locus_tag LOCUS_14450 gene slmA 16014 16610 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198306.1 protein_id gnl|my_center|LOCUS_14450 17080 16661 gene locus_tag LOCUS_14460 gene dksA 17080 16661 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155227.1 protein_id gnl|my_center|LOCUS_14460 <18691 17129 gene locus_tag LOCUS_14470 <18691 17129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004526459.1:polyribonucleotide nucleotidyltransferase >Feature sequence037 241 250 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 251 1531 gene locus_tag LOCUS_14480 251 1531 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932055.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14480 1546 2292 gene locus_tag LOCUS_14490 1546 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 2357 3025 gene locus_tag LOCUS_14500 gene can 2357 3025 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189176.1 protein_id gnl|my_center|LOCUS_14500 3849 3016 gene locus_tag LOCUS_14510 gene mutM 3849 3016 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102876.1 protein_id gnl|my_center|LOCUS_14510 4570 3851 gene locus_tag LOCUS_14520 4570 3851 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_14520 4966 4757 gene locus_tag LOCUS_14530 4966 4757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 5052 5525 gene locus_tag LOCUS_14540 5052 5525 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142755.1 protein_id gnl|my_center|LOCUS_14540 5788 5522 gene locus_tag LOCUS_14550 5788 5522 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649214.1 protein_id gnl|my_center|LOCUS_14550 6223 5789 gene locus_tag LOCUS_14560 6223 5789 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192775.1 protein_id gnl|my_center|LOCUS_14560 6271 6720 gene locus_tag LOCUS_14570 gene smpB 6271 6720 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197080.1 protein_id gnl|my_center|LOCUS_14570 8127 6862 gene locus_tag LOCUS_14580 gene icd 8127 6862 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189552.1 protein_id gnl|my_center|LOCUS_14580 8469 8227 gene locus_tag LOCUS_14590 8469 8227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 8582 9637 gene locus_tag LOCUS_14600 gene mnmA 8582 9637 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544237.1 protein_id gnl|my_center|LOCUS_14600 10252 9644 gene locus_tag LOCUS_14610 10252 9644 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813020.1 protein_id gnl|my_center|LOCUS_14610 10374 11747 gene locus_tag LOCUS_14620 gene purB 10374 11747 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036678.1 protein_id gnl|my_center|LOCUS_14620 12431 11763 gene locus_tag LOCUS_14630 12431 11763 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444161.1 protein_id gnl|my_center|LOCUS_14630 13363 12428 gene locus_tag LOCUS_14640 gene secF 13363 12428 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219655.1 protein_id gnl|my_center|LOCUS_14640 15189 13369 gene locus_tag LOCUS_14650 gene secD 15189 13369 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194096.1 protein_id gnl|my_center|LOCUS_14650 15525 15208 gene locus_tag LOCUS_14660 gene yajC 15525 15208 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194088.1 protein_id gnl|my_center|LOCUS_14660 16689 15583 gene locus_tag LOCUS_14670 gene tgt 16689 15583 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194199.1 protein_id gnl|my_center|LOCUS_14670 17719 16679 gene locus_tag LOCUS_14680 gene queA 17719 16679 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930156.1 protein_id gnl|my_center|LOCUS_14680 >Feature sequence038 <1 717 gene locus_tag LOCUS_14690 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791940.1:site-specific tyrosine recombinase XerD 730 1146 gene locus_tag LOCUS_14700 730 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 1683 2888 gene locus_tag LOCUS_14710 1683 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 2881 3204 gene locus_tag LOCUS_14720 2881 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 3789 3247 gene locus_tag LOCUS_14730 3789 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 4151 3786 gene locus_tag LOCUS_14740 4151 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 5099 4263 gene locus_tag LOCUS_14750 5099 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 5177 5737 gene locus_tag LOCUS_14760 5177 5737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 7210 6044 gene locus_tag LOCUS_14770 7210 6044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 7421 7684 gene locus_tag LOCUS_14780 7421 7684 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028578677.1 protein_id gnl|my_center|LOCUS_14780 7678 8529 gene locus_tag LOCUS_14790 7678 8529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14790 9498 8680 gene locus_tag LOCUS_14800 9498 8680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 12492 10639 gene locus_tag LOCUS_14810 12492 10639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 14090 12903 gene locus_tag LOCUS_14820 14090 12903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 14628 14245 gene locus_tag LOCUS_14830 14628 14245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 14841 15038 gene locus_tag LOCUS_14840 14841 15038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 16152 15109 gene locus_tag LOCUS_14850 16152 15109 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383518.1 protein_id gnl|my_center|LOCUS_14850 16487 16149 gene locus_tag LOCUS_14860 16487 16149 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974257.1 protein_id gnl|my_center|LOCUS_14860 16614 16934 gene locus_tag LOCUS_14870 16614 16934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 16953 17519 gene locus_tag LOCUS_14880 gene fimE 16953 17519 CDS product type 1 fimbria switch DNA invertase FimE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703357.1 protein_id gnl|my_center|LOCUS_14880 >Feature sequence039 938 2344 gene locus_tag LOCUS_14890 938 2344 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087094.1 protein_id gnl|my_center|LOCUS_14890 2371 3618 gene locus_tag LOCUS_14900 2371 3618 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929017.1 protein_id gnl|my_center|LOCUS_14900 3645 6884 gene locus_tag LOCUS_14910 3645 6884 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085816.1 protein_id gnl|my_center|LOCUS_14910 7650 7726 gene locus_tag LOCUS_t00310 7650 7726 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8250 9872 gene locus_tag LOCUS_14920 gene nifA 8250 9872 CDS product nif-specific transcriptional activator NifA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084834.1 protein_id gnl|my_center|LOCUS_14920 10055 11590 gene locus_tag LOCUS_14930 gene nifB 10055 11590 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084568.1 protein_id gnl|my_center|LOCUS_14930 11627 11848 gene locus_tag LOCUS_14940 11627 11848 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084569.1 protein_id gnl|my_center|LOCUS_14940 11858 12268 gene locus_tag LOCUS_14950 11858 12268 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084564.1 protein_id gnl|my_center|LOCUS_14950 12367 13092 gene locus_tag LOCUS_14960 12367 13092 CDS product 4Fe4S-binding leucine-rich repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338306.1 protein_id gnl|my_center|LOCUS_14960 13106 13408 gene locus_tag LOCUS_14970 13106 13408 CDS product nitrogen fixation protein NifZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028153326.1 protein_id gnl|my_center|LOCUS_14970 13405 13644 gene locus_tag LOCUS_14980 13405 13644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 13984 15111 gene locus_tag LOCUS_14990 gene nifS 13984 15111 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942654.1 protein_id gnl|my_center|LOCUS_14990 15108 15317 gene locus_tag LOCUS_15000 gene nifT 15108 15317 CDS product putative nitrogen fixation protein NifT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533514.1 protein_id gnl|my_center|LOCUS_15000 15319 15576 gene locus_tag LOCUS_15010 15319 15576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 15573 16709 gene locus_tag LOCUS_15020 15573 16709 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582967.1 protein_id gnl|my_center|LOCUS_15020 16741 17037 gene locus_tag LOCUS_15030 16741 17037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 >Feature sequence040 259 32 gene locus_tag LOCUS_15040 259 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 1443 382 gene locus_tag LOCUS_15050 1443 382 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184894.1 protein_id gnl|my_center|LOCUS_15050 1772 1696 gene locus_tag LOCUS_t00320 1772 1696 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3642 1780 gene locus_tag LOCUS_15060 gene rpoD 3642 1780 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930783.1 protein_id gnl|my_center|LOCUS_15060 5462 3702 gene locus_tag LOCUS_15070 gene dnaG 5462 3702 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225052.1 protein_id gnl|my_center|LOCUS_15070 5733 5521 gene locus_tag LOCUS_15080 gene rpsU 5733 5521 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214819.1 protein_id gnl|my_center|LOCUS_15080 6220 5810 gene locus_tag LOCUS_15090 6220 5810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 8095 6233 gene locus_tag LOCUS_15100 gene sppA 8095 6233 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038843.1 protein_id gnl|my_center|LOCUS_15100 8550 8098 gene locus_tag LOCUS_15110 8550 8098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 8737 9255 gene locus_tag LOCUS_15120 8737 9255 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085759.1 protein_id gnl|my_center|LOCUS_15120 9289 10737 gene locus_tag LOCUS_15130 9289 10737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 10755 12530 gene locus_tag LOCUS_15140 10755 12530 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770458.1 protein_id gnl|my_center|LOCUS_15140 12527 14386 gene locus_tag LOCUS_15150 12527 14386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680025.1 protein_id gnl|my_center|LOCUS_15150 14965 14399 gene locus_tag LOCUS_15160 14965 14399 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194433.1 protein_id gnl|my_center|LOCUS_15160 15178 15894 gene locus_tag LOCUS_15170 gene fnr 15178 15894 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212452.1 protein_id gnl|my_center|LOCUS_15170 16113 16760 gene locus_tag LOCUS_15180 16113 16760 CDS product OmpW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173596.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence041 480 800 gene locus_tag LOCUS_15190 480 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 1241 1050 gene locus_tag LOCUS_15200 1241 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 1331 1726 gene locus_tag LOCUS_15210 1331 1726 CDS product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969221.1 protein_id gnl|my_center|LOCUS_15210 1834 2451 gene locus_tag LOCUS_15220 1834 2451 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338238.1 protein_id gnl|my_center|LOCUS_15220 2527 3030 gene locus_tag LOCUS_15230 gene rfaH 2527 3030 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957829.1 protein_id gnl|my_center|LOCUS_15230 3187 4209 gene locus_tag LOCUS_15240 3187 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 5268 4396 gene locus_tag LOCUS_15250 5268 4396 CDS product hydrolase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390872.1 protein_id gnl|my_center|LOCUS_15250 6067 5255 gene locus_tag LOCUS_15260 6067 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 6318 6064 gene locus_tag LOCUS_15270 6318 6064 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390870.1 protein_id gnl|my_center|LOCUS_15270 6397 7722 gene locus_tag LOCUS_15280 6397 7722 CDS product putative O-glycosylation ligase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390842.1 protein_id gnl|my_center|LOCUS_15280 8395 7667 gene locus_tag LOCUS_15290 8395 7667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 9190 8543 gene locus_tag LOCUS_15300 9190 8543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 9406 10269 gene locus_tag LOCUS_15310 9406 10269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 10795 10286 gene locus_tag LOCUS_15320 10795 10286 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087269.1 protein_id gnl|my_center|LOCUS_15320 11076 10792 gene locus_tag LOCUS_15330 11076 10792 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100678.1 protein_id gnl|my_center|LOCUS_15330 11250 11714 gene locus_tag LOCUS_15340 11250 11714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 13826 12069 gene locus_tag LOCUS_15350 13826 12069 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170128385.1 protein_id gnl|my_center|LOCUS_15350 15090 14335 gene locus_tag LOCUS_15360 15090 14335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 15561 15238 gene locus_tag LOCUS_15370 15561 15238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 <16904 15674 gene locus_tag LOCUS_15380 <16904 15674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919356.1:sulfate adenylyltransferase subunit CysN >Feature sequence042 2880 1876 gene locus_tag LOCUS_15390 2880 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 3953 2877 gene locus_tag LOCUS_15400 3953 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 6163 4232 gene locus_tag LOCUS_15410 gene mdoH 6163 4232 CDS product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705025.1 protein_id gnl|my_center|LOCUS_15410 7722 6370 gene locus_tag LOCUS_15420 gene glrR 7722 6370 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098304.1 protein_id gnl|my_center|LOCUS_15420 8597 7719 gene locus_tag LOCUS_15430 8597 7719 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069704.1 protein_id gnl|my_center|LOCUS_15430 8671 8979 gene locus_tag LOCUS_15440 gene grxD 8671 8979 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771068.1 protein_id gnl|my_center|LOCUS_15440 9919 8999 gene locus_tag LOCUS_15450 9919 8999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 10415 10014 gene locus_tag LOCUS_15460 10415 10014 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766041.1 protein_id gnl|my_center|LOCUS_15460 11246 10428 gene locus_tag LOCUS_15470 gene prmC 11246 10428 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347320.1 protein_id gnl|my_center|LOCUS_15470 12331 11243 gene locus_tag LOCUS_15480 gene prfA 12331 11243 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222130.1 protein_id gnl|my_center|LOCUS_15480 13596 12328 gene locus_tag LOCUS_15490 gene hemA 13596 12328 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807616.1 protein_id gnl|my_center|LOCUS_15490 14692 13649 gene locus_tag LOCUS_15500 14692 13649 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815379.1 protein_id gnl|my_center|LOCUS_15500 14966 15625 gene locus_tag LOCUS_15510 gene rpe 14966 15625 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186923.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence043 95 170 gene locus_tag LOCUS_t00330 95 170 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 198 548 gene locus_tag LOCUS_15520 gene secE 198 548 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806884.1 protein_id gnl|my_center|LOCUS_15520 545 1078 gene locus_tag LOCUS_15530 gene nusG 545 1078 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198369.1 protein_id gnl|my_center|LOCUS_15530 1153 1587 gene locus_tag LOCUS_15540 gene rplK 1153 1587 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198368.1 protein_id gnl|my_center|LOCUS_15540 1590 2288 gene locus_tag LOCUS_15550 gene rplA 1590 2288 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806887.1 protein_id gnl|my_center|LOCUS_15550 2521 3048 gene locus_tag LOCUS_15560 gene rplJ 2521 3048 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806888.1 protein_id gnl|my_center|LOCUS_15560 3064 3441 gene locus_tag LOCUS_15570 gene rplL 3064 3441 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806889.1 protein_id gnl|my_center|LOCUS_15570 3573 7643 gene locus_tag LOCUS_15580 gene rpoB 3573 7643 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198365.1 protein_id gnl|my_center|LOCUS_15580 7738 11949 gene locus_tag LOCUS_15590 gene rpoC 7738 11949 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521902.1 protein_id gnl|my_center|LOCUS_15590 12048 12425 gene locus_tag LOCUS_15600 gene rpsL 12048 12425 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093744.1 protein_id gnl|my_center|LOCUS_15600 12460 12930 gene locus_tag LOCUS_15610 gene rpsG 12460 12930 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215391.1 protein_id gnl|my_center|LOCUS_15610 13016 15109 gene locus_tag LOCUS_15620 gene fusA 13016 15109 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198357.1 protein_id gnl|my_center|LOCUS_15620 >Feature sequence044 1046 207 gene locus_tag LOCUS_15630 1046 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 1913 1068 gene locus_tag LOCUS_15640 1913 1068 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389922.1 protein_id gnl|my_center|LOCUS_15640 2260 1925 gene locus_tag LOCUS_15650 gene nifW 2260 1925 CDS product nitrogenase stabilizing/protective protein NifW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084580.1 protein_id gnl|my_center|LOCUS_15650 2984 2271 gene locus_tag LOCUS_15660 gene cysE 2984 2271 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072274.1 protein_id gnl|my_center|LOCUS_15660 4113 2986 gene locus_tag LOCUS_15670 gene nifV 4113 2986 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389924.1 protein_id gnl|my_center|LOCUS_15670 4403 4729 gene locus_tag LOCUS_15680 gene erpA 4403 4729 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551953.1 protein_id gnl|my_center|LOCUS_15680 4742 5062 gene locus_tag LOCUS_15690 gene iscA 4742 5062 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100617.1 protein_id gnl|my_center|LOCUS_15690 5066 6502 gene locus_tag LOCUS_15700 gene sufB 5066 6502 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056341.1 protein_id gnl|my_center|LOCUS_15700 6499 7251 gene locus_tag LOCUS_15710 gene sufC 6499 7251 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057741.1 protein_id gnl|my_center|LOCUS_15710 7248 8441 gene locus_tag LOCUS_15720 gene sufD 7248 8441 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958176.1 protein_id gnl|my_center|LOCUS_15720 8438 9652 gene locus_tag LOCUS_15730 8438 9652 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_15730 9649 10125 gene locus_tag LOCUS_15740 9649 10125 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_15740 10125 10661 gene locus_tag LOCUS_15750 10125 10661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 14314 10817 gene locus_tag LOCUS_15760 14314 10817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 >Feature sequence045 1555 155 gene locus_tag LOCUS_15770 gene pelG 1555 155 CDS product exopolysaccharide Pel transporter PelG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091283.1 protein_id gnl|my_center|LOCUS_15770 3107 1563 gene locus_tag LOCUS_15780 gene pelF 3107 1563 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113954.1 protein_id gnl|my_center|LOCUS_15780 4129 3122 gene locus_tag LOCUS_15790 4129 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 5514 4123 gene locus_tag LOCUS_15800 5514 4123 CDS product PelD GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113952.1 protein_id gnl|my_center|LOCUS_15800 6062 5529 gene locus_tag LOCUS_15810 6062 5529 CDS product pellicle/biofilm biosynthesis outer membrane protein PelC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091288.1 protein_id gnl|my_center|LOCUS_15810 10279 6134 gene locus_tag LOCUS_15820 10279 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 13028 10263 gene locus_tag LOCUS_15830 13028 10263 CDS product bifunctional glycoside hydrolase 114/ polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113950.1 protein_id gnl|my_center|LOCUS_15830 13987 12980 gene locus_tag LOCUS_15840 gene galE 13987 12980 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705040.1 protein_id gnl|my_center|LOCUS_15840 >Feature sequence046 728 438 gene locus_tag LOCUS_15850 gene cas2 728 438 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392029.1 protein_id gnl|my_center|LOCUS_15850 1767 730 gene locus_tag LOCUS_15860 gene cas1c 1767 730 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392030.1 protein_id gnl|my_center|LOCUS_15860 2417 1767 gene locus_tag LOCUS_15870 gene cas4 2417 1767 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392031.1 protein_id gnl|my_center|LOCUS_15870 3397 2411 gene locus_tag LOCUS_15880 gene cas7c 3397 2411 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070169.1 protein_id gnl|my_center|LOCUS_15880 5139 3397 gene locus_tag LOCUS_15890 gene cas8c 5139 3397 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392033.1 protein_id gnl|my_center|LOCUS_15890 5906 5142 gene locus_tag LOCUS_15900 gene cas5c 5906 5142 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392034.1 protein_id gnl|my_center|LOCUS_15900 8256 5920 gene locus_tag LOCUS_15910 8256 5920 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392035.1 protein_id gnl|my_center|LOCUS_15910 9305 8334 gene locus_tag LOCUS_15920 9305 8334 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038601.1 protein_id gnl|my_center|LOCUS_15920 10056 10265 gene locus_tag LOCUS_15930 10056 10265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 11296 12012 gene locus_tag LOCUS_15940 11296 12012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 12009 12242 gene locus_tag LOCUS_15950 12009 12242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 13585 12368 gene locus_tag LOCUS_15960 13585 12368 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938819.1 protein_id gnl|my_center|LOCUS_15960 13834 13748 gene locus_tag LOCUS_t00340 13834 13748 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence047 1413 2219 gene locus_tag LOCUS_15970 1413 2219 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096887.1 protein_id gnl|my_center|LOCUS_15970 2219 3442 gene locus_tag LOCUS_15980 2219 3442 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096884.1 protein_id gnl|my_center|LOCUS_15980 3439 4587 gene locus_tag LOCUS_15990 3439 4587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 4599 7625 gene locus_tag LOCUS_16000 4599 7625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 7746 9479 gene locus_tag LOCUS_16010 gene aprD 7746 9479 CDS product alkaline protease secretion ATP-binding protein AprD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082539.1 protein_id gnl|my_center|LOCUS_16010 9476 10828 gene locus_tag LOCUS_16020 9476 10828 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098666.1 protein_id gnl|my_center|LOCUS_16020 10825 12201 gene locus_tag LOCUS_16030 gene aprF 10825 12201 CDS product alkaline protease secretion protein AprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110827.1 protein_id gnl|my_center|LOCUS_16030 12956 12207 gene locus_tag LOCUS_16040 12956 12207 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948381.1 protein_id gnl|my_center|LOCUS_16040 13255 12953 gene locus_tag LOCUS_16050 13255 12953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 >Feature sequence048 <1 1481 gene locus_tag LOCUS_16060 <1 1481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926979.1:protein-disulfide reductase DsbD 2086 1499 gene locus_tag LOCUS_16070 gene orn 2086 1499 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535917.1 protein_id gnl|my_center|LOCUS_16070 2131 3060 gene locus_tag LOCUS_16080 gene rsgA 2131 3060 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221919.1 protein_id gnl|my_center|LOCUS_16080 3759 2995 gene locus_tag LOCUS_16090 3759 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 4935 3904 gene locus_tag LOCUS_16100 4935 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 5216 5635 gene locus_tag LOCUS_16110 5216 5635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 5650 7527 gene locus_tag LOCUS_16120 gene mnmC 5650 7527 CDS product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554661.1 protein_id gnl|my_center|LOCUS_16120 8621 7500 gene locus_tag LOCUS_16130 gene hemH 8621 7500 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853055.1 protein_id gnl|my_center|LOCUS_16130 9659 8640 gene locus_tag LOCUS_16140 gene hrcA 9659 8640 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194248.1 protein_id gnl|my_center|LOCUS_16140 9689 10597 gene locus_tag LOCUS_16150 9689 10597 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039215.1 protein_id gnl|my_center|LOCUS_16150 10600 12261 gene locus_tag LOCUS_16160 gene recN 10600 12261 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065059.1 protein_id gnl|my_center|LOCUS_16160 12348 12890 gene locus_tag LOCUS_16170 gene grpE 12348 12890 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194243.1 protein_id gnl|my_center|LOCUS_16170 >Feature sequence049 325 567 gene locus_tag LOCUS_16180 325 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 1022 594 gene locus_tag LOCUS_16190 1022 594 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193608.1 protein_id gnl|my_center|LOCUS_16190 1128 3086 gene locus_tag LOCUS_16200 1128 3086 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926646.1 protein_id gnl|my_center|LOCUS_16200 3083 3622 gene locus_tag LOCUS_16210 3083 3622 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811410.1 protein_id gnl|my_center|LOCUS_16210 3619 4098 gene locus_tag LOCUS_16220 gene ccmH 3619 4098 CDS product cytochrome c maturation protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114292.1 protein_id gnl|my_center|LOCUS_16220 4095 5378 gene locus_tag LOCUS_16230 gene ccmI 4095 5378 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083145.1 protein_id gnl|my_center|LOCUS_16230 5387 5995 gene locus_tag LOCUS_16240 gene ccmA 5387 5995 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457758.1 protein_id gnl|my_center|LOCUS_16240 5992 6657 gene locus_tag LOCUS_16250 gene ccmB 5992 6657 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262348.1 protein_id gnl|my_center|LOCUS_16250 6665 7408 gene locus_tag LOCUS_16260 gene ccmC 6665 7408 CDS product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063823.1 protein_id gnl|my_center|LOCUS_16260 7395 7559 gene locus_tag LOCUS_16270 7395 7559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 7556 7993 gene locus_tag LOCUS_16280 gene ccmE 7556 7993 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811414.1 protein_id gnl|my_center|LOCUS_16280 8662 7982 gene locus_tag LOCUS_16290 8662 7982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 9122 8757 gene locus_tag LOCUS_16300 9122 8757 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405261.1 protein_id gnl|my_center|LOCUS_16300 10395 9109 gene locus_tag LOCUS_16310 10395 9109 CDS product DUF3443 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192528.1 protein_id gnl|my_center|LOCUS_16310 10874 10392 gene locus_tag LOCUS_16320 10874 10392 CDS product DUF2844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535926.1 protein_id gnl|my_center|LOCUS_16320 11504 11247 gene locus_tag LOCUS_16330 11504 11247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 11479 11934 gene locus_tag LOCUS_16340 11479 11934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 12093 12169 gene locus_tag LOCUS_t00350 12093 12169 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence050 3211 1496 gene locus_tag LOCUS_16350 3211 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 4491 3208 gene locus_tag LOCUS_16360 gene glgC 4491 3208 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071681.1 protein_id gnl|my_center|LOCUS_16360 4607 6787 gene locus_tag LOCUS_16370 gene glgB 4607 6787 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_16370 6820 8475 gene locus_tag LOCUS_16380 gene pgi 6820 8475 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390697.1 protein_id gnl|my_center|LOCUS_16380 8488 9951 gene locus_tag LOCUS_16390 gene glgA 8488 9951 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389900.1 protein_id gnl|my_center|LOCUS_16390 <12322 10006 gene locus_tag LOCUS_16400 <12322 10006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941039.1:glycosyltransferase family 1 protein >Feature sequence051 83 1417 gene locus_tag LOCUS_16410 gene rimO 83 1417 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705268.1 protein_id gnl|my_center|LOCUS_16410 1414 2292 gene locus_tag LOCUS_16420 1414 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 2571 2359 gene locus_tag LOCUS_16430 2571 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 2458 3447 gene locus_tag LOCUS_16440 gene prfB 2458 3447 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199566.1 protein_id gnl|my_center|LOCUS_16440 3450 4940 gene locus_tag LOCUS_16450 gene lysS 3450 4940 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816835.1 protein_id gnl|my_center|LOCUS_16450 4937 6181 gene locus_tag LOCUS_16460 4937 6181 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 protein_id gnl|my_center|LOCUS_16460 6174 6866 gene locus_tag LOCUS_16470 gene lolD 6174 6866 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195923.1 protein_id gnl|my_center|LOCUS_16470 9032 6876 gene locus_tag LOCUS_16480 9032 6876 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065079.1 protein_id gnl|my_center|LOCUS_16480 11365 9089 gene locus_tag LOCUS_16490 11365 9089 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence052 <1 544 gene locus_tag LOCUS_16500 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404897.1:methionyl-tRNA formyltransferase 1562 579 gene locus_tag LOCUS_16510 gene holA 1562 579 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194041.1 protein_id gnl|my_center|LOCUS_16510 2118 1546 gene locus_tag LOCUS_16520 gene lptE 2118 1546 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194132.1 protein_id gnl|my_center|LOCUS_16520 4540 2120 gene locus_tag LOCUS_16530 gene leuS 4540 2120 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957661.1 protein_id gnl|my_center|LOCUS_16530 4643 6760 gene locus_tag LOCUS_16540 gene uvrD 4643 6760 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980762.1 protein_id gnl|my_center|LOCUS_16540 6859 7482 gene locus_tag LOCUS_16550 6859 7482 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_16550 7529 9019 gene locus_tag LOCUS_16560 7529 9019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 9016 9216 gene locus_tag LOCUS_16570 9016 9216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 9702 9250 gene locus_tag LOCUS_16580 9702 9250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 >Feature sequence053 <1 1135 gene locus_tag LOCUS_16590 <1 1135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004532947.1:hydrogenase 4 subunit B 1132 2079 gene locus_tag LOCUS_16600 1132 2079 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528372.1 protein_id gnl|my_center|LOCUS_16600 2082 2756 gene locus_tag LOCUS_16610 2082 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004542749.1 protein_id gnl|my_center|LOCUS_16610 2759 4210 gene locus_tag LOCUS_16620 2759 4210 CDS product hydrogenase 4 subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548282.1 protein_id gnl|my_center|LOCUS_16620 4227 5738 gene locus_tag LOCUS_16630 4227 5738 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528369.1 protein_id gnl|my_center|LOCUS_16630 6680 5802 gene locus_tag LOCUS_16640 gene rfbA 6680 5802 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105518.1 protein_id gnl|my_center|LOCUS_16640 7744 6665 gene locus_tag LOCUS_16650 gene rfbB 7744 6665 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096179.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence054 1009 497 gene locus_tag LOCUS_16660 1009 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 1605 1120 gene locus_tag LOCUS_16670 1605 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 2210 1719 gene locus_tag LOCUS_16680 2210 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 2436 2197 gene locus_tag LOCUS_16690 2436 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 4953 2596 gene locus_tag LOCUS_16700 4953 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 7453 5051 gene locus_tag LOCUS_16710 7453 5051 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233452.1 protein_id gnl|my_center|LOCUS_16710 8376 7450 gene locus_tag LOCUS_16720 8376 7450 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038232.1 protein_id gnl|my_center|LOCUS_16720 8795 8376 gene locus_tag LOCUS_16730 8795 8376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence055 465 926 gene locus_tag LOCUS_16740 465 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 937 2235 gene locus_tag LOCUS_16750 937 2235 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389920.1 protein_id gnl|my_center|LOCUS_16750 2232 2519 gene locus_tag LOCUS_16760 2232 2519 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389919.1 protein_id gnl|my_center|LOCUS_16760 2549 2875 gene locus_tag LOCUS_16770 2549 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 2899 3465 gene locus_tag LOCUS_16780 2899 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497969.1 protein_id gnl|my_center|LOCUS_16780 3462 3923 gene locus_tag LOCUS_16790 3462 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 4193 3969 gene locus_tag LOCUS_16800 4193 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 4341 5060 gene locus_tag LOCUS_16810 4341 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 5182 5562 gene locus_tag LOCUS_16820 5182 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 5936 6676 gene locus_tag LOCUS_16830 5936 6676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 6716 7450 gene locus_tag LOCUS_16840 gene modA 6716 7450 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463409.1 protein_id gnl|my_center|LOCUS_16840 7489 8160 gene locus_tag LOCUS_16850 gene modB 7489 8160 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence056 3340 794 gene locus_tag LOCUS_16860 3340 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 4335 3337 gene locus_tag LOCUS_16870 4335 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 5231 6793 gene locus_tag LOCUS_16880 5231 6793 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070845.1 protein_id gnl|my_center|LOCUS_16880 8691 6937 gene locus_tag LOCUS_16890 gene arsA 8691 6937 CDS product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705614.1 protein_id gnl|my_center|LOCUS_16890 >Feature sequence057 571 296 gene locus_tag LOCUS_16900 571 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 638 1981 gene locus_tag LOCUS_16910 gene pmbA 638 1981 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522380.1 protein_id gnl|my_center|LOCUS_16910 1989 2432 gene locus_tag LOCUS_16920 gene nrdR 1989 2432 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814871.1 protein_id gnl|my_center|LOCUS_16920 2422 3525 gene locus_tag LOCUS_16930 gene ribD 2422 3525 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113051.1 protein_id gnl|my_center|LOCUS_16930 3526 4140 gene locus_tag LOCUS_16940 3526 4140 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185756.1 protein_id gnl|my_center|LOCUS_16940 4142 5278 gene locus_tag LOCUS_16950 gene ribBA 4142 5278 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808597.1 protein_id gnl|my_center|LOCUS_16950 5295 5756 gene locus_tag LOCUS_16960 gene ribH 5295 5756 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064457.1 protein_id gnl|my_center|LOCUS_16960 5753 6193 gene locus_tag LOCUS_16970 gene nusB 5753 6193 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185707.1 protein_id gnl|my_center|LOCUS_16970 6197 7165 gene locus_tag LOCUS_16980 gene thiL 6197 7165 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707094.1 protein_id gnl|my_center|LOCUS_16980 7162 7650 gene locus_tag LOCUS_16990 7162 7650 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073310.1 protein_id gnl|my_center|LOCUS_16990 7637 8155 gene locus_tag LOCUS_17000 7637 8155 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194139.1 protein_id gnl|my_center|LOCUS_17000 >Feature sequence058 108 2342 gene locus_tag LOCUS_17010 108 2342 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930590.1 protein_id gnl|my_center|LOCUS_17010 2335 3909 gene locus_tag LOCUS_17020 2335 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 3906 4361 gene locus_tag LOCUS_17030 3906 4361 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389344.1 protein_id gnl|my_center|LOCUS_17030 4358 6427 gene locus_tag LOCUS_17040 4358 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 7429 7010 gene locus_tag LOCUS_17050 7429 7010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693479.1 protein_id gnl|my_center|LOCUS_17050 7917 7426 gene locus_tag LOCUS_17060 7917 7426 CDS product Panacea domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703843.1 protein_id gnl|my_center|LOCUS_17060 >Feature sequence059 944 786 gene locus_tag LOCUS_17070 944 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 1649 1161 gene locus_tag LOCUS_17080 1649 1161 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087269.1 protein_id gnl|my_center|LOCUS_17080 1912 1646 gene locus_tag LOCUS_17090 1912 1646 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045874275.1 protein_id gnl|my_center|LOCUS_17090 2812 2246 gene locus_tag LOCUS_17100 2812 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 4084 3404 gene locus_tag LOCUS_17110 4084 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 5004 4438 gene locus_tag LOCUS_17120 5004 4438 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096726.1 protein_id gnl|my_center|LOCUS_17120 5088 5564 gene locus_tag LOCUS_17130 5088 5564 CDS product DUF1348 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529396.1 protein_id gnl|my_center|LOCUS_17130 5629 5937 gene locus_tag LOCUS_17140 5629 5937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 6064 6339 gene locus_tag LOCUS_17150 6064 6339 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064047.1 protein_id gnl|my_center|LOCUS_17150 6317 6595 gene locus_tag LOCUS_17160 6317 6595 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816743.1 protein_id gnl|my_center|LOCUS_17160 6669 6812 gene locus_tag LOCUS_17170 6669 6812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 7065 7316 gene locus_tag LOCUS_17180 7065 7316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 7605 7405 gene locus_tag LOCUS_17190 7605 7405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 >Feature sequence060 1036 584 gene locus_tag LOCUS_17200 1036 584 CDS product DUF2924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383514.1 protein_id gnl|my_center|LOCUS_17200 2190 1855 gene locus_tag LOCUS_17210 2190 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 2077 3690 gene locus_tag LOCUS_17220 gene btuB 2077 3690 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_17220 3772 4362 gene locus_tag LOCUS_17230 3772 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038180.1 protein_id gnl|my_center|LOCUS_17230 4459 4316 gene locus_tag LOCUS_17240 4459 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 4849 4634 gene locus_tag LOCUS_17250 4849 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 5840 5268 gene locus_tag LOCUS_17260 5840 5268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098290.1 protein_id gnl|my_center|LOCUS_17260 6701 5949 gene locus_tag LOCUS_17270 6701 5949 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942220.1 protein_id gnl|my_center|LOCUS_17270 7331 6975 gene locus_tag LOCUS_17280 7331 6975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 >Feature sequence061 1177 545 gene locus_tag LOCUS_17290 1177 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 1304 1471 gene locus_tag LOCUS_17300 1304 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 1720 2412 gene locus_tag LOCUS_17310 1720 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 2625 2903 gene locus_tag LOCUS_17320 2625 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 3202 3393 gene locus_tag LOCUS_17330 3202 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 3386 4858 gene locus_tag LOCUS_17340 gene gabD 3386 4858 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106269.1 protein_id gnl|my_center|LOCUS_17340 4969 5535 gene locus_tag LOCUS_17350 4969 5535 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730455.1 protein_id gnl|my_center|LOCUS_17350 5730 5488 gene locus_tag LOCUS_17360 5730 5488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 5830 6096 gene locus_tag LOCUS_17370 5830 6096 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143987.1 protein_id gnl|my_center|LOCUS_17370 6096 6398 gene locus_tag LOCUS_17380 6096 6398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 >Feature sequence062 1390 656 gene locus_tag LOCUS_17390 1390 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 2497 1406 gene locus_tag LOCUS_17400 2497 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17400 3363 2494 gene locus_tag LOCUS_17410 3363 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17410 4206 3367 gene locus_tag LOCUS_17420 4206 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 5047 4304 gene locus_tag LOCUS_17430 5047 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 6604 5051 gene locus_tag LOCUS_17440 6604 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 >Feature sequence063 1655 969 gene locus_tag LOCUS_17450 gene bluB 1655 969 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185643.1 protein_id gnl|my_center|LOCUS_17450 2947 1652 gene locus_tag LOCUS_17460 2947 1652 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038178.1 protein_id gnl|my_center|LOCUS_17460 3557 2949 gene locus_tag LOCUS_17470 gene cobO 3557 2949 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086769.1 protein_id gnl|my_center|LOCUS_17470 4084 4278 gene locus_tag LOCUS_17480 4084 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 4275 4589 gene locus_tag LOCUS_17490 4275 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 5684 4785 gene locus_tag LOCUS_17500 5684 4785 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205740.1 protein_id gnl|my_center|LOCUS_17500 5721 6194 gene locus_tag LOCUS_17510 5721 6194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 6243 6327 gene locus_tag LOCUS_t00360 6243 6327 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 6410 6483 gene locus_tag LOCUS_t00370 6410 6483 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6497 6571 gene locus_tag LOCUS_t00380 6497 6571 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence064 2503 992 gene locus_tag LOCUS_17520 gene purF 2503 992 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525195.1 protein_id gnl|my_center|LOCUS_17520 2614 3144 gene locus_tag LOCUS_17530 2614 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 3726 3181 gene locus_tag LOCUS_17540 3726 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 4603 3731 gene locus_tag LOCUS_17550 gene accD 4603 3731 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188147.1 protein_id gnl|my_center|LOCUS_17550 5403 4600 gene locus_tag LOCUS_17560 gene trpA 5403 4600 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528976.1 protein_id gnl|my_center|LOCUS_17560 <6470 5413 gene locus_tag LOCUS_17570 <6470 5413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004528977.1:tryptophan synthase subunit beta >Feature sequence065 608 817 gene locus_tag LOCUS_17580 608 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 2015 894 gene locus_tag LOCUS_17590 2015 894 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193445.1 protein_id gnl|my_center|LOCUS_17590 2141 2953 gene locus_tag LOCUS_17600 2141 2953 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384380.1 protein_id gnl|my_center|LOCUS_17600 3126 6392 gene locus_tag LOCUS_17610 3126 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 >Feature sequence066 1799 195 gene locus_tag LOCUS_17620 1799 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 2721 1783 gene locus_tag LOCUS_17630 2721 1783 CDS product XrtA-associated tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390867.1 protein_id gnl|my_center|LOCUS_17630 4268 2739 gene locus_tag LOCUS_17640 4268 2739 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 protein_id gnl|my_center|LOCUS_17640 4976 4344 gene locus_tag LOCUS_17650 4976 4344 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_17650 <5887 5014 gene locus_tag LOCUS_17660 <5887 5014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390850.1:TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase >Feature sequence067 682 1299 gene locus_tag LOCUS_17670 682 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 1302 2609 gene locus_tag LOCUS_17680 1302 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 2618 2890 gene locus_tag LOCUS_17690 2618 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 3792 4109 gene locus_tag LOCUS_17700 3792 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 4257 4087 gene locus_tag LOCUS_17710 4257 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 4645 4238 gene locus_tag LOCUS_17720 4645 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 4818 4645 gene locus_tag LOCUS_17730 4818 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 5206 4811 gene locus_tag LOCUS_17740 5206 4811 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483459.1 protein_id gnl|my_center|LOCUS_17740 5534 5199 gene locus_tag LOCUS_17750 5534 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 5721 5524 gene locus_tag LOCUS_17760 5721 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 >Feature sequence068 <1 752 gene locus_tag LOCUS_17770 <1 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113950.1:bifunctional glycoside hydrolase 114/ polysaccharide deacetylase family protein 832 2349 gene locus_tag LOCUS_17780 832 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 2511 3083 gene locus_tag LOCUS_17790 2511 3083 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689643.1 protein_id gnl|my_center|LOCUS_17790 3468 4100 gene locus_tag LOCUS_17800 3468 4100 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723748.1 protein_id gnl|my_center|LOCUS_17800 4101 4904 gene locus_tag LOCUS_17810 gene cobM 4101 4904 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392606.1 protein_id gnl|my_center|LOCUS_17810 >Feature sequence069 <1 851 gene locus_tag LOCUS_17820 <1 851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388754.1:SIR2 family protein 2041 1649 gene locus_tag LOCUS_17830 2041 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 2406 3284 gene locus_tag LOCUS_17840 gene nifH 2406 3284 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084578.1 protein_id gnl|my_center|LOCUS_17840 3414 4868 gene locus_tag LOCUS_17850 gene nifD 3414 4868 CDS product nitrogenase molybdenum-iron protein alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084552.1 protein_id gnl|my_center|LOCUS_17850 >Feature sequence070 144 1199 gene locus_tag LOCUS_17860 144 1199 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088998.1 protein_id gnl|my_center|LOCUS_17860 1243 2715 gene locus_tag LOCUS_17870 1243 2715 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532370.1 protein_id gnl|my_center|LOCUS_17870 2719 4143 gene locus_tag LOCUS_17880 2719 4143 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087094.1 protein_id gnl|my_center|LOCUS_17880 4302 4823 gene locus_tag LOCUS_17890 4302 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence071 289 214 gene locus_tag LOCUS_t00390 289 214 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 506 324 gene locus_tag LOCUS_17900 506 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 477 2372 gene locus_tag LOCUS_17910 477 2372 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531442.1 protein_id gnl|my_center|LOCUS_17910 2449 3723 gene locus_tag LOCUS_17920 2449 3723 CDS product metabolite/H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529121.1 protein_id gnl|my_center|LOCUS_17920 3720 4247 gene locus_tag LOCUS_17930 gene folA 3720 4247 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707142.1 protein_id gnl|my_center|LOCUS_17930 5097 4435 gene locus_tag LOCUS_17940 5097 4435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 >Feature sequence072 1512 172 gene locus_tag LOCUS_17950 gene prsR 1512 172 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_17950 2389 1592 gene locus_tag LOCUS_17960 2389 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 2581 4158 gene locus_tag LOCUS_17970 2581 4158 CDS product acyl-CoA ligase (AMP-forming), exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551903.1 protein_id gnl|my_center|LOCUS_17970 >Feature sequence073 <1 500 gene locus_tag LOCUS_17980 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529947.1:cysteine hydrolase family protein 497 1000 gene locus_tag LOCUS_17990 497 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 1994 2425 gene locus_tag LOCUS_18000 1994 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 2429 3490 gene locus_tag LOCUS_18010 2429 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 >Feature sequence074 5 895 gene locus_tag LOCUS_18020 5 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 892 3627 gene locus_tag LOCUS_18030 892 3627 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191889.1 protein_id gnl|my_center|LOCUS_18030 3640 4782 gene locus_tag LOCUS_18040 gene odhB 3640 4782 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930204.1 protein_id gnl|my_center|LOCUS_18040 >Feature sequence075 191 451 gene locus_tag LOCUS_18050 191 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 1679 546 gene locus_tag LOCUS_18060 1679 546 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121265.1 protein_id gnl|my_center|LOCUS_18060 3205 1676 gene locus_tag LOCUS_18070 gene xrtA 3205 1676 CDS product exosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390868.1 protein_id gnl|my_center|LOCUS_18070 4410 3202 gene locus_tag LOCUS_18080 4410 3202 CDS product TIGR03087 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_18080 >Feature sequence076 618 331 gene locus_tag LOCUS_18090 618 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 1494 676 gene locus_tag LOCUS_18100 1494 676 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943595.1 protein_id gnl|my_center|LOCUS_18100 1887 1501 gene locus_tag LOCUS_18110 1887 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 2186 1884 gene locus_tag LOCUS_18120 gene fdxB 2186 1884 CDS product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084559.1 protein_id gnl|my_center|LOCUS_18120 2438 2193 gene locus_tag LOCUS_18130 2438 2193 CDS product CCE_0567 family metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970913.1 protein_id gnl|my_center|LOCUS_18130 2977 2516 gene locus_tag LOCUS_18140 2977 2516 CDS product NifX-associated nitrogen fixation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084557.1 protein_id gnl|my_center|LOCUS_18140 3380 2970 gene locus_tag LOCUS_18150 gene nifX 3380 2970 CDS product nitrogen fixation protein NifX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084556.1 protein_id gnl|my_center|LOCUS_18150 4494 3406 gene locus_tag LOCUS_18160 4494 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18160 4460 4469 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence077 70 927 gene locus_tag LOCUS_18170 70 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 927 1265 gene locus_tag LOCUS_18180 927 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 2717 1398 gene locus_tag LOCUS_18190 2717 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 3031 3381 gene locus_tag LOCUS_18200 3031 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 3378 3770 gene locus_tag LOCUS_18210 3378 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 4058 3777 gene locus_tag LOCUS_18220 4058 3777 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277238.1 protein_id gnl|my_center|LOCUS_18220 4311 4045 gene locus_tag LOCUS_18230 4311 4045 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971266.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence078 1735 1547 gene locus_tag LOCUS_18240 1735 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 1931 2122 gene locus_tag LOCUS_18250 1931 2122 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 protein_id gnl|my_center|LOCUS_18250 3618 2119 gene locus_tag LOCUS_18260 3618 2119 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766682.1 protein_id gnl|my_center|LOCUS_18260 4622 3618 gene locus_tag LOCUS_18270 gene cobD 4622 3618 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112352.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence079 <1 1295 gene locus_tag LOCUS_18280 <1 1295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085718.1:efflux RND transporter permease subunit 1292 2428 gene locus_tag LOCUS_18290 1292 2428 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085719.1 protein_id gnl|my_center|LOCUS_18290 2425 3852 gene locus_tag LOCUS_18300 gene opmB 2425 3852 CDS product multidrug efflux RND transporter outer membrane subunit OpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089909.1 protein_id gnl|my_center|LOCUS_18300 3849 4535 gene locus_tag LOCUS_18310 3849 4535 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976633.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence080 75 461 gene locus_tag LOCUS_18320 75 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 690 541 gene locus_tag LOCUS_18330 690 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 1048 875 gene locus_tag LOCUS_18340 1048 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 1210 1061 gene locus_tag LOCUS_18350 1210 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 1323 1916 gene locus_tag LOCUS_18360 1323 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18360 2842 1943 gene locus_tag LOCUS_18370 2842 1943 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194150.1 protein_id gnl|my_center|LOCUS_18370 3200 3451 gene locus_tag LOCUS_18380 3200 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 3571 4416 gene locus_tag LOCUS_18390 3571 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 >Feature sequence081 2740 533 gene locus_tag LOCUS_18400 2740 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 3161 2883 gene locus_tag LOCUS_18410 3161 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 <4368 3242 gene locus_tag LOCUS_18420 <4368 3242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038880.1:type IV conjugative transfer system coupling protein TraD >Feature sequence082 675 1727 gene locus_tag LOCUS_18430 675 1727 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946516.1 protein_id gnl|my_center|LOCUS_18430 1757 2791 gene locus_tag LOCUS_18440 1757 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 3587 2775 gene locus_tag LOCUS_18450 3587 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 >Feature sequence083 735 1019 gene locus_tag LOCUS_18460 735 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 1012 1464 gene locus_tag LOCUS_18470 1012 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 1457 1675 gene locus_tag LOCUS_18480 1457 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 1677 2222 gene locus_tag LOCUS_18490 1677 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 2219 2443 gene locus_tag LOCUS_18500 2219 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 3071 3655 gene locus_tag LOCUS_18510 3071 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 >Feature sequence084 <1 1353 gene locus_tag LOCUS_18520 <1 1353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005618952.1:siroheme synthase CysG 1484 2272 gene locus_tag LOCUS_18530 1484 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 2286 3245 gene locus_tag LOCUS_18540 2286 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 >Feature sequence085 1526 684 gene locus_tag LOCUS_18550 1526 684 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_18550 2671 1523 gene locus_tag LOCUS_18560 gene wecB 2671 1523 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060909.1 protein_id gnl|my_center|LOCUS_18560 <3550 2664 gene locus_tag LOCUS_18570 <3550 2664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390863.1:XrtA-associated ATPase >Feature sequence086 664 891 gene locus_tag LOCUS_18580 664 891 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211161.1 protein_id gnl|my_center|LOCUS_18580 897 1262 gene locus_tag LOCUS_18590 897 1262 CDS product HTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216048.1 protein_id gnl|my_center|LOCUS_18590 1262 2158 gene locus_tag LOCUS_18600 gene trfA 1262 2158 CDS product plasmid replication initiator TrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815848.1 protein_id gnl|my_center|LOCUS_18600 <3548 2868 gene locus_tag LOCUS_18610 <3548 2868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946848.1:EAL domain-containing protein >Feature sequence087 1507 347 gene locus_tag LOCUS_18620 gene dnaN 1507 347 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258498.1 protein_id gnl|my_center|LOCUS_18620 2005 1571 gene locus_tag LOCUS_18630 2005 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 2741 2022 gene locus_tag LOCUS_18640 gene radC 2741 2022 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259440.1 protein_id gnl|my_center|LOCUS_18640 >Feature sequence088 391 645 gene locus_tag LOCUS_18650 391 645 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255927.1 protein_id gnl|my_center|LOCUS_18650 717 977 gene locus_tag LOCUS_18660 717 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 1097 1759 gene locus_tag LOCUS_18670 1097 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 1790 2203 gene locus_tag LOCUS_18680 1790 2203 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123271.1 protein_id gnl|my_center|LOCUS_18680 2226 2630 gene locus_tag LOCUS_18690 2226 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 2640 3005 gene locus_tag LOCUS_18700 2640 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 >Feature sequence089 94 1497 gene locus_tag LOCUS_18710 gene leuC 94 1497 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446523.1 protein_id gnl|my_center|LOCUS_18710 1497 2135 gene locus_tag LOCUS_18720 gene leuD 1497 2135 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010357988.1 protein_id gnl|my_center|LOCUS_18720 2543 2740 gene locus_tag LOCUS_18730 2543 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 >Feature sequence090 <1 513 gene locus_tag LOCUS_18740 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003399826.1:pseudouridine synthase 898 560 gene locus_tag LOCUS_18750 898 560 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101229.1 protein_id gnl|my_center|LOCUS_18750 1149 976 gene locus_tag LOCUS_18760 1149 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 1390 1887 gene locus_tag LOCUS_18770 1390 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 1959 2258 gene locus_tag LOCUS_18780 1959 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 2432 2557 gene locus_tag LOCUS_18790 2432 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18790 >Feature sequence091 293 535 gene locus_tag LOCUS_18800 293 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 635 1603 gene locus_tag LOCUS_18810 gene yghU 635 1603 CDS product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530630.1 protein_id gnl|my_center|LOCUS_18810 1414 1423 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1822 2091 gene locus_tag LOCUS_18820 1822 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 2272 2511 gene locus_tag LOCUS_18830 2272 2511 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144325.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence092 356 847 gene locus_tag LOCUS_18840 356 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 919 1593 gene locus_tag LOCUS_18850 919 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 1692 2075 gene locus_tag LOCUS_18860 1692 2075 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812533.1 protein_id gnl|my_center|LOCUS_18860 >Feature sequence093 349 1674 gene locus_tag LOCUS_18870 349 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 >Feature sequence094 1539 1033 gene locus_tag LOCUS_18880 1539 1033 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941072.1 protein_id gnl|my_center|LOCUS_18880 >Feature sequence095 501 1865 gene locus_tag LOCUS_18890 501 1865 CDS product ISNCY-like element ISRm17 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970069.1 protein_id gnl|my_center|LOCUS_18890 >Feature sequence096 81 482 gene locus_tag LOCUS_18900 81 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 536 883 gene locus_tag LOCUS_18910 536 883 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389669.1 protein_id gnl|my_center|LOCUS_18910 920 1264 gene locus_tag LOCUS_18920 920 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 <2040 1261 gene locus_tag LOCUS_18930 <2040 1261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388763.1:ADP-ribosyl-[dinitrogen reductase] hydrolase >Feature sequence097 >Feature sequence098 1275 1400 gene locus_tag LOCUS_18940 1275 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 >Feature sequence099 271 936 gene locus_tag LOCUS_18950 gene cbiC 271 936 CDS product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999239.1 protein_id gnl|my_center|LOCUS_18950 >Feature sequence100 42 1473 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcatccccgctcgtgcggggaacat >Feature sequence101 320 934 gene locus_tag LOCUS_18960 320 934 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175326.1 protein_id gnl|my_center|LOCUS_18960 >Feature sequence102 655 35 gene locus_tag LOCUS_18970 655 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 700 786 gene locus_tag LOCUS_t00400 700 786 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence103 >Feature sequence104 765 241 gene locus_tag LOCUS_18980 765 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 >Feature sequence105 595 519 gene locus_tag LOCUS_t00410 595 519 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence106 275 30 gene locus_tag LOCUS_18990 275 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 758 297 gene locus_tag LOCUS_19000 758 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 >Feature sequence107 >Feature sequence108 417 342 gene locus_tag LOCUS_t00420 417 342 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence109 >Feature sequence110 314 42 gene locus_tag LOCUS_19010 314 42 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_19010 >Feature sequence111 >Feature sequence112 391 263 gene locus_tag LOCUS_19020 391 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 >Feature sequence113 403 316 gene locus_tag LOCUS_t00430 403 316 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence114 487 496 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 690 614 gene locus_tag LOCUS_t00440 690 614 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence115 >Feature sequence116 271 280 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 353 428 gene locus_tag LOCUS_t00450 353 428 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 500 576 gene locus_tag LOCUS_t00460 500 576 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence117 >Feature sequence118 211 414 gene locus_tag LOCUS_19030 211 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 >Feature sequence119 583 83 gene locus_tag LOCUS_19040 583 83 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404756.1 protein_id gnl|my_center|LOCUS_19040 >Feature sequence120 >Feature sequence121 314 390 gene locus_tag LOCUS_t00470 314 390 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence122 354 635 gene locus_tag LOCUS_19050 354 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 >Feature sequence123 >Feature sequence124 >Feature sequence125 >Feature sequence126 >Feature sequence127 >Feature sequence128 257 348 gene locus_tag LOCUS_t00480 257 348 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence129 316 391 gene locus_tag LOCUS_t00490 316 391 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence130 268 195 gene locus_tag LOCUS_t00500 268 195 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence131 <1 616 gene locus_tag LOCUS_19060 <1 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390869.1:amidotransferase 1, exosortase A system-associated >Feature sequence132 >Feature sequence133 >Feature sequence134 319 244 gene locus_tag LOCUS_t00510 319 244 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence135 >Feature sequence136 261 335 gene locus_tag LOCUS_t00520 261 335 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence137 >Feature sequence138 >Feature sequence139 <1 550 gene locus_tag LOCUS_19070 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_028175650.1:carbon monoxide dehydrogenase subunit G >Feature sequence140 249 174 gene locus_tag LOCUS_t00530 249 174 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence141 185 261 gene locus_tag LOCUS_t00540 185 261 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence142 >Feature sequence143 >Feature sequence144 >Feature sequence145 286 295 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 482 406 gene locus_tag LOCUS_t00550 482 406 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence146 >Feature sequence147 >Feature sequence148 292 462 gene locus_tag LOCUS_19080 292 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 >Feature sequence149 >Feature sequence150 335 259 gene locus_tag LOCUS_t00560 335 259 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence151 >Feature sequence152 <1 531 gene locus_tag LOCUS_19090 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390861.1:FemAB family PEP-CTERM system-associated protein >Feature sequence153 359 284 gene locus_tag LOCUS_t00570 359 284 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 464 389 gene locus_tag LOCUS_t00580 464 389 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence154 >Feature sequence155 234 243 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence156 >Feature sequence157 135 219 gene locus_tag LOCUS_t00590 135 219 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 303 376 gene locus_tag LOCUS_t00600 303 376 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 412 486 gene locus_tag LOCUS_t00610 412 486 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence158 >Feature sequence159 >Feature sequence160 >Feature sequence161 >Feature sequence162 >Feature sequence163 >Feature sequence164 192 267 gene locus_tag LOCUS_t00620 192 267 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence165 >Feature sequence166 128 235 gene locus_tag LOCUS_r00020 128 235 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence167 >Feature sequence168 >Feature sequence169 433 358 gene locus_tag LOCUS_t00630 433 358 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence170 >Feature sequence171 >Feature sequence172 269 522 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtagcgcccgcgccttggtgcgggcgaggattgaaac >Feature sequence173 277 187 gene locus_tag LOCUS_t00640 277 187 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence174 >Feature sequence175 335 260 gene locus_tag LOCUS_t00650 335 260 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence176 >Feature sequence177 >Feature sequence178 >Feature sequence179 >Feature sequence180 >Feature sequence181 176 251 gene locus_tag LOCUS_t00660 176 251 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence182 >Feature sequence183 214 139 gene locus_tag LOCUS_t00670 214 139 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 309 234 gene locus_tag LOCUS_t00680 309 234 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence184 >Feature sequence185 >Feature sequence186 228 303 gene locus_tag LOCUS_t00690 228 303 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence187 258 88 gene locus_tag LOCUS_19100 258 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 >Feature sequence188 256 265 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence189 >Feature sequence190 >Feature sequence191 >Feature sequence192 198 271 gene locus_tag LOCUS_t00700 198 271 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence193 >Feature sequence194 >Feature sequence195