>Feature sequence001 120 854 gene locus_tag LOCUS_00010 120 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1784 870 gene locus_tag LOCUS_00020 gene pstA 1784 870 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404794.1 protein_id gnl|my_center|LOCUS_00020 2740 1784 gene locus_tag LOCUS_00030 gene pstC 2740 1784 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404792.1 protein_id gnl|my_center|LOCUS_00030 3951 2863 gene locus_tag LOCUS_00040 gene pstS 3951 2863 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900236.1 protein_id gnl|my_center|LOCUS_00040 4588 4217 gene locus_tag LOCUS_00050 4588 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5157 4654 gene locus_tag LOCUS_00060 gene sixA 5157 4654 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814151.1 protein_id gnl|my_center|LOCUS_00060 5545 5129 gene locus_tag LOCUS_00070 5545 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6892 5546 gene locus_tag LOCUS_00080 gene der 6892 5546 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208345.1 protein_id gnl|my_center|LOCUS_00080 8090 6903 gene locus_tag LOCUS_00090 gene bamB 8090 6903 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024944077.1 protein_id gnl|my_center|LOCUS_00090 8698 8087 gene locus_tag LOCUS_00100 8698 8087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 10014 8695 gene locus_tag LOCUS_00110 gene hisS 10014 8695 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140461.1 protein_id gnl|my_center|LOCUS_00110 11147 10047 gene locus_tag LOCUS_00120 gene ispG 11147 10047 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380613.1 protein_id gnl|my_center|LOCUS_00120 12120 11137 gene locus_tag LOCUS_00130 gene rodZ 12120 11137 CDS product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370323.1 protein_id gnl|my_center|LOCUS_00130 12975 12133 gene locus_tag LOCUS_00140 12975 12133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 14063 12972 gene locus_tag LOCUS_00150 14063 12972 CDS product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444483.1 protein_id gnl|my_center|LOCUS_00150 14534 14064 gene locus_tag LOCUS_00160 gene ndk 14534 14064 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020029.1 protein_id gnl|my_center|LOCUS_00160 15553 14627 gene locus_tag LOCUS_00170 gene miaA 15553 14627 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113929.1 protein_id gnl|my_center|LOCUS_00170 17343 15550 gene locus_tag LOCUS_00180 gene mutL 17343 15550 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266495.1 protein_id gnl|my_center|LOCUS_00180 17818 17333 gene locus_tag LOCUS_00190 gene tsaE 17818 17333 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037444.1 protein_id gnl|my_center|LOCUS_00190 18286 17831 gene locus_tag LOCUS_00200 18286 17831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 19635 18286 gene locus_tag LOCUS_00210 gene bioA 19635 18286 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880055.1 protein_id gnl|my_center|LOCUS_00210 20476 19622 gene locus_tag LOCUS_00220 20476 19622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 21690 20473 gene locus_tag LOCUS_00230 21690 20473 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207506.1 protein_id gnl|my_center|LOCUS_00230 22332 21751 gene locus_tag LOCUS_00240 gene recR 22332 21751 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260579.1 protein_id gnl|my_center|LOCUS_00240 22680 22357 gene locus_tag LOCUS_00250 22680 22357 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809572.1 protein_id gnl|my_center|LOCUS_00250 24390 22684 gene locus_tag LOCUS_00260 24390 22684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 24651 24561 gene locus_tag LOCUS_t00010 24651 24561 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 25084 24728 gene locus_tag LOCUS_00270 25084 24728 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_00270 26069 25068 gene locus_tag LOCUS_00280 26069 25068 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772605.1 protein_id gnl|my_center|LOCUS_00280 26716 26066 gene locus_tag LOCUS_00290 gene tmk 26716 26066 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267153.1 protein_id gnl|my_center|LOCUS_00290 27726 26713 gene locus_tag LOCUS_00300 gene mltG 27726 26713 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217396.1 protein_id gnl|my_center|LOCUS_00300 28577 27723 gene locus_tag LOCUS_00310 gene pabC 28577 27723 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020799938.1 protein_id gnl|my_center|LOCUS_00310 29826 28585 gene locus_tag LOCUS_00320 gene fabF 29826 28585 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040224.1 protein_id gnl|my_center|LOCUS_00320 30114 29866 gene locus_tag LOCUS_00330 gene acpP 30114 29866 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002814322.1 protein_id gnl|my_center|LOCUS_00330 30948 30199 gene locus_tag LOCUS_00340 gene fabG 30948 30199 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929000.1 protein_id gnl|my_center|LOCUS_00340 31883 30948 gene locus_tag LOCUS_00350 gene fabD 31883 30948 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191372.1 protein_id gnl|my_center|LOCUS_00350 32865 31921 gene locus_tag LOCUS_00360 32865 31921 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 protein_id gnl|my_center|LOCUS_00360 33887 32862 gene locus_tag LOCUS_00370 gene plsX 33887 32862 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192749.1 protein_id gnl|my_center|LOCUS_00370 34110 33925 gene locus_tag LOCUS_00380 gene rpmF 34110 33925 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537694.1 protein_id gnl|my_center|LOCUS_00380 34645 34151 gene locus_tag LOCUS_00390 34645 34151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 35457 34681 gene locus_tag LOCUS_00400 35457 34681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 36281 35559 gene locus_tag LOCUS_00410 36281 35559 CDS product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307333.1 protein_id gnl|my_center|LOCUS_00410 36862 36278 gene locus_tag LOCUS_00420 36862 36278 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948488.1 protein_id gnl|my_center|LOCUS_00420 36983 37600 gene locus_tag LOCUS_00430 36983 37600 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941819.1 protein_id gnl|my_center|LOCUS_00430 37745 38782 gene locus_tag LOCUS_00440 gene purM 37745 38782 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814339.1 protein_id gnl|my_center|LOCUS_00440 38775 39440 gene locus_tag LOCUS_00450 gene purN 38775 39440 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185746.1 protein_id gnl|my_center|LOCUS_00450 39437 40174 gene locus_tag LOCUS_00460 39437 40174 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225729.1 protein_id gnl|my_center|LOCUS_00460 40264 41652 gene locus_tag LOCUS_00470 40264 41652 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978673.1 protein_id gnl|my_center|LOCUS_00470 41686 42471 gene locus_tag LOCUS_00480 41686 42471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 44772 42526 gene locus_tag LOCUS_00490 gene rnr 44772 42526 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407829.1 protein_id gnl|my_center|LOCUS_00490 44810 44896 gene locus_tag LOCUS_t00020 44810 44896 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 45524 45252 gene locus_tag LOCUS_00500 45524 45252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 46922 45627 gene locus_tag LOCUS_00510 46922 45627 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095642.1 protein_id gnl|my_center|LOCUS_00510 48162 46960 gene locus_tag LOCUS_00520 48162 46960 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763027.1 protein_id gnl|my_center|LOCUS_00520 49031 48159 gene locus_tag LOCUS_00530 gene hflC 49031 48159 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390051.1 protein_id gnl|my_center|LOCUS_00530 50221 49028 gene locus_tag LOCUS_00540 gene hflK 50221 49028 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390052.1 protein_id gnl|my_center|LOCUS_00540 51510 50236 gene locus_tag LOCUS_00550 gene hflX 51510 50236 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209152.1 protein_id gnl|my_center|LOCUS_00550 51824 51558 gene locus_tag LOCUS_00560 51824 51558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 52127 54916 gene locus_tag LOCUS_00570 gene ppc 52127 54916 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207161458.1 protein_id gnl|my_center|LOCUS_00570 54928 55506 gene locus_tag LOCUS_00580 54928 55506 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817289.1 protein_id gnl|my_center|LOCUS_00580 56355 55573 gene locus_tag LOCUS_00590 56355 55573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 56574 58127 gene locus_tag LOCUS_00600 56574 58127 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087094.1 protein_id gnl|my_center|LOCUS_00600 58171 59262 gene locus_tag LOCUS_00610 58171 59262 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958004.1 protein_id gnl|my_center|LOCUS_00610 59273 62353 gene locus_tag LOCUS_00620 59273 62353 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772627.1 protein_id gnl|my_center|LOCUS_00620 62596 63462 gene locus_tag LOCUS_00630 gene folD 62596 63462 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087898.1 protein_id gnl|my_center|LOCUS_00630 63455 65560 gene locus_tag LOCUS_00640 gene ppk1 63455 65560 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036175.1 protein_id gnl|my_center|LOCUS_00640 65573 66211 gene locus_tag LOCUS_00650 65573 66211 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035431.1 protein_id gnl|my_center|LOCUS_00650 66195 67667 gene locus_tag LOCUS_00660 66195 67667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 68021 67680 gene locus_tag LOCUS_00670 68021 67680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 70680 68053 gene locus_tag LOCUS_00680 gene pepN 70680 68053 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_00680 71525 70677 gene locus_tag LOCUS_00690 71525 70677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 72351 71731 gene locus_tag LOCUS_00700 gene lexA 72351 71731 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209090.1 protein_id gnl|my_center|LOCUS_00700 72676 73116 gene locus_tag LOCUS_00710 72676 73116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 74707 73139 gene locus_tag LOCUS_00720 74707 73139 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958237.1 protein_id gnl|my_center|LOCUS_00720 74950 74874 gene locus_tag LOCUS_t00030 74950 74874 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 75036 74961 gene locus_tag LOCUS_t00040 75036 74961 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 75321 75049 gene locus_tag LOCUS_00730 75321 75049 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261491.1 protein_id gnl|my_center|LOCUS_00730 78003 75568 gene locus_tag LOCUS_00740 gene lon 78003 75568 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770753.1 protein_id gnl|my_center|LOCUS_00740 79362 78091 gene locus_tag LOCUS_00750 gene clpX 79362 78091 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087924.1 protein_id gnl|my_center|LOCUS_00750 80025 79381 gene locus_tag LOCUS_00760 gene clpP 80025 79381 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482529.1 protein_id gnl|my_center|LOCUS_00760 81351 80065 gene locus_tag LOCUS_00770 gene tig 81351 80065 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087920.1 protein_id gnl|my_center|LOCUS_00770 82012 81425 gene locus_tag LOCUS_00780 gene pyrE 82012 81425 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460653.1 protein_id gnl|my_center|LOCUS_00780 82804 82079 gene locus_tag LOCUS_00790 gene pyrF 82804 82079 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090975.1 protein_id gnl|my_center|LOCUS_00790 83970 82801 gene locus_tag LOCUS_00800 gene lapB 83970 82801 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366230.1 protein_id gnl|my_center|LOCUS_00800 84276 83971 gene locus_tag LOCUS_00810 84276 83971 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189865.1 protein_id gnl|my_center|LOCUS_00810 86147 84441 gene locus_tag LOCUS_00820 gene rpsA 86147 84441 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037340.1 protein_id gnl|my_center|LOCUS_00820 86906 86226 gene locus_tag LOCUS_00830 gene cmk 86906 86226 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946434.1 protein_id gnl|my_center|LOCUS_00830 88204 86903 gene locus_tag LOCUS_00840 gene aroA 88204 86903 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947148.1 protein_id gnl|my_center|LOCUS_00840 89083 88208 gene locus_tag LOCUS_00850 89083 88208 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813366.1 protein_id gnl|my_center|LOCUS_00850 90101 89085 gene locus_tag LOCUS_00860 gene aroF 90101 89085 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546648.1 protein_id gnl|my_center|LOCUS_00860 91203 90106 gene locus_tag LOCUS_00870 gene hisC 91203 90106 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_00870 92285 91203 gene locus_tag LOCUS_00880 gene pheA 92285 91203 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616461.1 protein_id gnl|my_center|LOCUS_00880 93383 92295 gene locus_tag LOCUS_00890 gene serC 93383 92295 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106701.1 protein_id gnl|my_center|LOCUS_00890 95927 93390 gene locus_tag LOCUS_00900 gene gyrA 95927 93390 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444523.1 protein_id gnl|my_center|LOCUS_00900 97036 95984 gene locus_tag LOCUS_00910 gene mtnA 97036 95984 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258877.1 protein_id gnl|my_center|LOCUS_00910 97384 97178 gene locus_tag LOCUS_00920 97384 97178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 97334 98410 gene locus_tag LOCUS_00930 97334 98410 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937801.1 protein_id gnl|my_center|LOCUS_00930 98471 98547 gene locus_tag LOCUS_t00050 98471 98547 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence002 494 267 gene locus_tag LOCUS_00940 494 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 1063 602 gene locus_tag LOCUS_00950 1063 602 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142755.1 protein_id gnl|my_center|LOCUS_00950 1705 1376 gene locus_tag LOCUS_00960 1705 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 2189 1746 gene locus_tag LOCUS_00970 gene cynS 2189 1746 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522069.1 protein_id gnl|my_center|LOCUS_00970 2793 2224 gene locus_tag LOCUS_00980 2793 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 3134 2802 gene locus_tag LOCUS_00990 3134 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 3912 3127 gene locus_tag LOCUS_01000 3912 3127 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995184.1 protein_id gnl|my_center|LOCUS_01000 4405 3947 gene locus_tag LOCUS_01010 4405 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 5073 4492 gene locus_tag LOCUS_01020 5073 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 5408 5557 gene locus_tag LOCUS_01030 5408 5557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 5626 5826 gene locus_tag LOCUS_01040 5626 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01040 6279 6773 gene locus_tag LOCUS_01050 6279 6773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 6777 7451 gene locus_tag LOCUS_01060 6777 7451 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073279.1 protein_id gnl|my_center|LOCUS_01060 7462 8712 gene locus_tag LOCUS_01070 7462 8712 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974548.1 protein_id gnl|my_center|LOCUS_01070 10238 8718 gene locus_tag LOCUS_01080 gene ilvA 10238 8718 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258444.1 protein_id gnl|my_center|LOCUS_01080 10606 10235 gene locus_tag LOCUS_01090 10606 10235 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206717.1 protein_id gnl|my_center|LOCUS_01090 11571 10603 gene locus_tag LOCUS_01100 11571 10603 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189905.1 protein_id gnl|my_center|LOCUS_01100 11777 11568 gene locus_tag LOCUS_01110 11777 11568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 12129 12905 gene locus_tag LOCUS_01120 12129 12905 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266561.1 protein_id gnl|my_center|LOCUS_01120 12902 13804 gene locus_tag LOCUS_01130 gene olsA 12902 13804 CDS product lyso-ornithine lipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112769.1 protein_id gnl|my_center|LOCUS_01130 14861 13758 gene locus_tag LOCUS_01140 gene hemE 14861 13758 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114569.1 protein_id gnl|my_center|LOCUS_01140 16265 14865 gene locus_tag LOCUS_01150 16265 14865 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403026.1 protein_id gnl|my_center|LOCUS_01150 20721 16294 gene locus_tag LOCUS_01160 gene gltB 20721 16294 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050077010.1 protein_id gnl|my_center|LOCUS_01160 21783 20857 gene locus_tag LOCUS_01170 21783 20857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 21688 21993 gene locus_tag LOCUS_01180 21688 21993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 22867 22022 gene locus_tag LOCUS_01190 22867 22022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 23954 22860 gene locus_tag LOCUS_01200 gene aroB 23954 22860 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196751.1 protein_id gnl|my_center|LOCUS_01200 24597 24058 gene locus_tag LOCUS_01210 gene aroK 24597 24058 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381319.1 protein_id gnl|my_center|LOCUS_01210 26939 24594 gene locus_tag LOCUS_01220 26939 24594 CDS product type IV pilus secretin PilQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207829.1 protein_id gnl|my_center|LOCUS_01220 27532 26984 gene locus_tag LOCUS_01230 27532 26984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 28146 27529 gene locus_tag LOCUS_01240 28146 27529 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942673.1 protein_id gnl|my_center|LOCUS_01240 28736 28143 gene locus_tag LOCUS_01250 28736 28143 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765503.1 protein_id gnl|my_center|LOCUS_01250 29797 28733 gene locus_tag LOCUS_01260 gene pilM 29797 28733 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110888.1 protein_id gnl|my_center|LOCUS_01260 30066 30587 gene locus_tag LOCUS_01270 gene tadA 30066 30587 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810985.1 protein_id gnl|my_center|LOCUS_01270 30568 30999 gene locus_tag LOCUS_01280 30568 30999 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972106.1 protein_id gnl|my_center|LOCUS_01280 30999 31424 gene locus_tag LOCUS_01290 30999 31424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 31487 33025 gene locus_tag LOCUS_01300 31487 33025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 33157 34902 gene locus_tag LOCUS_01310 33157 34902 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185769.1 protein_id gnl|my_center|LOCUS_01310 34906 35391 gene locus_tag LOCUS_01320 gene ilvN 34906 35391 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186134.1 protein_id gnl|my_center|LOCUS_01320 35442 36458 gene locus_tag LOCUS_01330 gene ilvC 35442 36458 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942554.1 protein_id gnl|my_center|LOCUS_01330 36576 37238 gene locus_tag LOCUS_01340 36576 37238 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531897.1 protein_id gnl|my_center|LOCUS_01340 37235 37987 gene locus_tag LOCUS_01350 gene pssA 37235 37987 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073396.1 protein_id gnl|my_center|LOCUS_01350 38468 38118 gene locus_tag LOCUS_01360 38468 38118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 41705 38595 gene locus_tag LOCUS_01370 41705 38595 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 protein_id gnl|my_center|LOCUS_01370 43134 41698 gene locus_tag LOCUS_01380 43134 41698 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190973259.1 protein_id gnl|my_center|LOCUS_01380 44420 43131 gene locus_tag LOCUS_01390 44420 43131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 44496 44732 gene locus_tag LOCUS_01400 44496 44732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 45164 45379 gene locus_tag LOCUS_01410 45164 45379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 46503 45454 gene locus_tag LOCUS_01420 46503 45454 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169265.1 protein_id gnl|my_center|LOCUS_01420 47785 46604 gene locus_tag LOCUS_01430 47785 46604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 49671 47785 gene locus_tag LOCUS_01440 49671 47785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01440 50684 49668 gene locus_tag LOCUS_01450 50684 49668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 51832 50681 gene locus_tag LOCUS_01460 51832 50681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 >Feature sequence003 414 2282 gene locus_tag LOCUS_01470 414 2282 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222546.1 protein_id gnl|my_center|LOCUS_01470 2602 2279 gene locus_tag LOCUS_01480 2602 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 2906 2595 gene locus_tag LOCUS_01490 2906 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 4657 2903 gene locus_tag LOCUS_01500 4657 2903 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957390.1 protein_id gnl|my_center|LOCUS_01500 6757 4685 gene locus_tag LOCUS_01510 6757 4685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 7158 7082 gene locus_tag LOCUS_t00060 7158 7082 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8165 7170 gene locus_tag LOCUS_01520 gene ispB 8165 7170 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098929.1 protein_id gnl|my_center|LOCUS_01520 9211 8249 gene locus_tag LOCUS_01530 9211 8249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 10704 9265 gene locus_tag LOCUS_01540 gene glnG 10704 9265 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368973.1 protein_id gnl|my_center|LOCUS_01540 11786 10701 gene locus_tag LOCUS_01550 gene glnL 11786 10701 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555720.1 protein_id gnl|my_center|LOCUS_01550 12095 12841 gene locus_tag LOCUS_01560 12095 12841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113561.1 protein_id gnl|my_center|LOCUS_01560 13151 14614 gene locus_tag LOCUS_01570 13151 14614 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340179.1 protein_id gnl|my_center|LOCUS_01570 14599 15585 gene locus_tag LOCUS_01580 14599 15585 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_01580 15627 18989 gene locus_tag LOCUS_01590 15627 18989 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390311.1 protein_id gnl|my_center|LOCUS_01590 19965 19021 gene locus_tag LOCUS_01600 19965 19021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 20380 20207 gene locus_tag LOCUS_01610 20380 20207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 20537 22471 gene locus_tag LOCUS_01620 20537 22471 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456210.1 protein_id gnl|my_center|LOCUS_01620 22675 22815 gene locus_tag LOCUS_01630 22675 22815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 22918 24222 gene locus_tag LOCUS_01640 22918 24222 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366144.1 protein_id gnl|my_center|LOCUS_01640 24215 25690 gene locus_tag LOCUS_01650 24215 25690 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402050.1 protein_id gnl|my_center|LOCUS_01650 25998 26171 gene locus_tag LOCUS_01660 25998 26171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 26337 26675 gene locus_tag LOCUS_01670 26337 26675 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198020.1 protein_id gnl|my_center|LOCUS_01670 26731 28035 gene locus_tag LOCUS_01680 26731 28035 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978643.1 protein_id gnl|my_center|LOCUS_01680 28402 30942 gene locus_tag LOCUS_01690 28402 30942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 30939 32072 gene locus_tag LOCUS_01700 30939 32072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 32155 33582 gene locus_tag LOCUS_01710 32155 33582 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978643.1 protein_id gnl|my_center|LOCUS_01710 33627 35432 gene locus_tag LOCUS_01720 33627 35432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 35429 36142 gene locus_tag LOCUS_01730 35429 36142 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113559.1 protein_id gnl|my_center|LOCUS_01730 36651 36265 gene locus_tag LOCUS_01740 36651 36265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 36889 37272 gene locus_tag LOCUS_01750 36889 37272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 37789 38634 gene locus_tag LOCUS_01760 37789 38634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01760 38923 38615 gene locus_tag LOCUS_01770 38923 38615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 40233 38920 gene locus_tag LOCUS_01780 gene kch 40233 38920 CDS product voltage-gated potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807739.1 protein_id gnl|my_center|LOCUS_01780 40566 42995 gene locus_tag LOCUS_01790 40566 42995 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613683.1 protein_id gnl|my_center|LOCUS_01790 43022 43417 gene locus_tag LOCUS_01800 43022 43417 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946746.1 protein_id gnl|my_center|LOCUS_01800 43480 43686 gene locus_tag LOCUS_01810 43480 43686 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228864.1 protein_id gnl|my_center|LOCUS_01810 43708 43953 gene locus_tag LOCUS_01820 43708 43953 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889331.1 protein_id gnl|my_center|LOCUS_01820 44714 44061 gene locus_tag LOCUS_01830 44714 44061 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705502.1 protein_id gnl|my_center|LOCUS_01830 45148 44771 gene locus_tag LOCUS_01840 45148 44771 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228135.1 protein_id gnl|my_center|LOCUS_01840 45233 45835 gene locus_tag LOCUS_01850 gene wrbA 45233 45835 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211168.1 protein_id gnl|my_center|LOCUS_01850 45903 46517 gene locus_tag LOCUS_01860 gene gstA 45903 46517 CDS product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210962.1 protein_id gnl|my_center|LOCUS_01860 47812 46643 gene locus_tag LOCUS_01870 47812 46643 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064727.1 protein_id gnl|my_center|LOCUS_01870 49580 47952 gene locus_tag LOCUS_01880 gene pgi 49580 47952 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141691.1 protein_id gnl|my_center|LOCUS_01880 51031 49784 gene locus_tag LOCUS_01890 gene lysA 51031 49784 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114343.1 protein_id gnl|my_center|LOCUS_01890 51213 51028 gene locus_tag LOCUS_01900 51213 51028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 <51767 51210 gene locus_tag LOCUS_01910 <51767 51210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114030.1:argininosuccinate lyase >Feature sequence004 576 980 gene locus_tag LOCUS_01920 576 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 2464 899 gene locus_tag LOCUS_01930 gene emrB 2464 899 CDS product multidrug efflux MFS transporter permease subunit EmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208746.1 protein_id gnl|my_center|LOCUS_01930 3494 2583 gene locus_tag LOCUS_01940 gene prmB 3494 2583 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001542329.1 protein_id gnl|my_center|LOCUS_01940 4256 3495 gene locus_tag LOCUS_01950 gene xth 4256 3495 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_01950 4553 4269 gene locus_tag LOCUS_01960 4553 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 5449 4613 gene locus_tag LOCUS_01970 gene rlmJ 5449 4613 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389691.1 protein_id gnl|my_center|LOCUS_01970 5542 6144 gene locus_tag LOCUS_01980 5542 6144 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094937.1 protein_id gnl|my_center|LOCUS_01980 6150 6923 gene locus_tag LOCUS_01990 gene xth 6150 6923 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862491.1 protein_id gnl|my_center|LOCUS_01990 6920 7942 gene locus_tag LOCUS_02000 gene hemH 6920 7942 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814087.1 protein_id gnl|my_center|LOCUS_02000 7994 8482 gene locus_tag LOCUS_02010 7994 8482 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085816.1 protein_id gnl|my_center|LOCUS_02010 8532 9713 gene locus_tag LOCUS_02020 8532 9713 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038918.1 protein_id gnl|my_center|LOCUS_02020 9691 10590 gene locus_tag LOCUS_02030 gene aroE 9691 10590 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942136.1 protein_id gnl|my_center|LOCUS_02030 10560 12269 gene locus_tag LOCUS_02040 gene pilB 10560 12269 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038212.1 protein_id gnl|my_center|LOCUS_02040 12395 13993 gene locus_tag LOCUS_02050 12395 13993 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038210.1 protein_id gnl|my_center|LOCUS_02050 13990 15348 gene locus_tag LOCUS_02060 gene pilR 13990 15348 CDS product two-component system response regulator PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094694.1 protein_id gnl|my_center|LOCUS_02060 15345 16145 gene locus_tag LOCUS_02070 15345 16145 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707571.1 protein_id gnl|my_center|LOCUS_02070 16146 16748 gene locus_tag LOCUS_02080 gene coaE 16146 16748 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704406.1 protein_id gnl|my_center|LOCUS_02080 16681 16845 gene locus_tag LOCUS_02090 16681 16845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 16865 17617 gene locus_tag LOCUS_02100 gene zapD 16865 17617 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818895.1 protein_id gnl|my_center|LOCUS_02100 17651 18661 gene locus_tag LOCUS_02110 17651 18661 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189384.1 protein_id gnl|my_center|LOCUS_02110 19180 19902 gene locus_tag LOCUS_02120 19180 19902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 19944 21305 gene locus_tag LOCUS_02130 gene xanA2 19944 21305 CDS product xanthomonadin biosynthesis 3-hydroxybenozate--AMP ligase XanA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506148.1 protein_id gnl|my_center|LOCUS_02130 21370 21606 gene locus_tag LOCUS_02140 21370 21606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 21741 22568 gene locus_tag LOCUS_02150 21741 22568 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039079.1 protein_id gnl|my_center|LOCUS_02150 22565 23245 gene locus_tag LOCUS_02160 22565 23245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 23242 25593 gene locus_tag LOCUS_02170 23242 25593 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039076.1 protein_id gnl|my_center|LOCUS_02170 25871 25608 gene locus_tag LOCUS_02180 gene xanC 25871 25608 CDS product xanthomonadin biosynthesis acyl carrier protein XanC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039083.1 protein_id gnl|my_center|LOCUS_02180 26179 27372 gene locus_tag LOCUS_02190 26179 27372 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039069.1 protein_id gnl|my_center|LOCUS_02190 27390 28199 gene locus_tag LOCUS_02200 27390 28199 CDS product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039070.1 protein_id gnl|my_center|LOCUS_02200 28241 28642 gene locus_tag LOCUS_02210 28241 28642 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039075.1 protein_id gnl|my_center|LOCUS_02210 28642 29364 gene locus_tag LOCUS_02220 gene fabG 28642 29364 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039074.1 protein_id gnl|my_center|LOCUS_02220 29361 30644 gene locus_tag LOCUS_02230 29361 30644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 31438 30674 gene locus_tag LOCUS_02240 31438 30674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 31965 31435 gene locus_tag LOCUS_02250 31965 31435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 33822 32758 gene locus_tag LOCUS_02260 33822 32758 CDS product pteridine-dependent deoxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275502.1 protein_id gnl|my_center|LOCUS_02260 35147 33825 gene locus_tag LOCUS_02270 35147 33825 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039084.1 protein_id gnl|my_center|LOCUS_02270 36465 36881 gene locus_tag LOCUS_02280 36465 36881 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094153.1 protein_id gnl|my_center|LOCUS_02280 36881 37546 gene locus_tag LOCUS_02290 36881 37546 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942470.1 protein_id gnl|my_center|LOCUS_02290 37770 37528 gene locus_tag LOCUS_02300 37770 37528 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194052.1 protein_id gnl|my_center|LOCUS_02300 38415 37783 gene locus_tag LOCUS_02310 38415 37783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 39296 38418 gene locus_tag LOCUS_02320 gene prmA 39296 38418 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112237.1 protein_id gnl|my_center|LOCUS_02320 40639 39293 gene locus_tag LOCUS_02330 gene accC 40639 39293 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522043.1 protein_id gnl|my_center|LOCUS_02330 41108 40632 gene locus_tag LOCUS_02340 gene accB 41108 40632 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194067.1 protein_id gnl|my_center|LOCUS_02340 41589 41128 gene locus_tag LOCUS_02350 gene aroQ 41589 41128 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210071.1 protein_id gnl|my_center|LOCUS_02350 41860 42717 gene locus_tag LOCUS_02360 41860 42717 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815103.1 protein_id gnl|my_center|LOCUS_02360 44126 42966 gene locus_tag LOCUS_02370 gene ftsZ 44126 42966 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305686.1 protein_id gnl|my_center|LOCUS_02370 44448 44185 gene locus_tag LOCUS_02380 44448 44185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 >Feature sequence005 <1 802 gene locus_tag LOCUS_02390 <1 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942281.1:amidophosphoribosyltransferase 799 2013 gene locus_tag LOCUS_02400 799 2013 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267161.1 protein_id gnl|my_center|LOCUS_02400 2077 2670 gene locus_tag LOCUS_02410 2077 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 2709 4034 gene locus_tag LOCUS_02420 2709 4034 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195684.1 protein_id gnl|my_center|LOCUS_02420 4045 5082 gene locus_tag LOCUS_02430 gene queA 4045 5082 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266902.1 protein_id gnl|my_center|LOCUS_02430 5079 6194 gene locus_tag LOCUS_02440 gene tgt 5079 6194 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073009.1 protein_id gnl|my_center|LOCUS_02440 6236 6574 gene locus_tag LOCUS_02450 gene yajC 6236 6574 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194088.1 protein_id gnl|my_center|LOCUS_02450 6585 8369 gene locus_tag LOCUS_02460 gene secD 6585 8369 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705625.1 protein_id gnl|my_center|LOCUS_02460 8377 9327 gene locus_tag LOCUS_02470 gene secF 8377 9327 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522118.1 protein_id gnl|my_center|LOCUS_02470 9397 9485 gene locus_tag LOCUS_t00070 9397 9485 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9687 10946 gene locus_tag LOCUS_02480 9687 10946 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197309.1 protein_id gnl|my_center|LOCUS_02480 11037 11795 gene locus_tag LOCUS_02490 gene phoB 11037 11795 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071727.1 protein_id gnl|my_center|LOCUS_02490 11839 13188 gene locus_tag LOCUS_02500 gene phoR 11839 13188 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071728.1 protein_id gnl|my_center|LOCUS_02500 13507 14274 gene locus_tag LOCUS_02510 gene pstB 13507 14274 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930167.1 protein_id gnl|my_center|LOCUS_02510 14286 14999 gene locus_tag LOCUS_02520 gene phoU 14286 14999 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071865.1 protein_id gnl|my_center|LOCUS_02520 15002 16513 gene locus_tag LOCUS_02530 gene ppx 15002 16513 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005731673.1 protein_id gnl|my_center|LOCUS_02530 16557 17693 gene locus_tag LOCUS_02540 16557 17693 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266767.1 protein_id gnl|my_center|LOCUS_02540 17791 18390 gene locus_tag LOCUS_02550 17791 18390 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096354.1 protein_id gnl|my_center|LOCUS_02550 18600 19352 gene locus_tag LOCUS_02560 gene rpsB 18600 19352 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036567.1 protein_id gnl|my_center|LOCUS_02560 19382 20260 gene locus_tag LOCUS_02570 gene tsf 19382 20260 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772548.1 protein_id gnl|my_center|LOCUS_02570 20261 20986 gene locus_tag LOCUS_02580 gene pyrH 20261 20986 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056115.1 protein_id gnl|my_center|LOCUS_02580 20983 21543 gene locus_tag LOCUS_02590 gene frr 20983 21543 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947438.1 protein_id gnl|my_center|LOCUS_02590 21547 22308 gene locus_tag LOCUS_02600 21547 22308 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690027.1 protein_id gnl|my_center|LOCUS_02600 22290 23102 gene locus_tag LOCUS_02610 gene cdsA 22290 23102 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922441.1 protein_id gnl|my_center|LOCUS_02610 23099 24274 gene locus_tag LOCUS_02620 gene ispC 23099 24274 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113864.1 protein_id gnl|my_center|LOCUS_02620 24290 25651 gene locus_tag LOCUS_02630 gene rseP 24290 25651 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949016.1 protein_id gnl|my_center|LOCUS_02630 25648 27993 gene locus_tag LOCUS_02640 gene bamA 25648 27993 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930353.1 protein_id gnl|my_center|LOCUS_02640 28011 28547 gene locus_tag LOCUS_02650 28011 28547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 28549 29610 gene locus_tag LOCUS_02660 gene lpxD 28549 29610 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266978.1 protein_id gnl|my_center|LOCUS_02660 29603 30049 gene locus_tag LOCUS_02670 gene fabZ 29603 30049 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004145858.1 protein_id gnl|my_center|LOCUS_02670 30046 30828 gene locus_tag LOCUS_02680 gene lpxA 30046 30828 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368155.1 protein_id gnl|my_center|LOCUS_02680 30825 31766 gene locus_tag LOCUS_02690 30825 31766 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_02690 31811 32920 gene locus_tag LOCUS_02700 31811 32920 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942902.1 protein_id gnl|my_center|LOCUS_02700 32925 34052 gene locus_tag LOCUS_02710 gene lpxB 32925 34052 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113865.1 protein_id gnl|my_center|LOCUS_02710 34066 34659 gene locus_tag LOCUS_02720 gene rnhB 34066 34659 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113866.1 protein_id gnl|my_center|LOCUS_02720 34656 38156 gene locus_tag LOCUS_02730 gene dnaE 34656 38156 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946697.1 protein_id gnl|my_center|LOCUS_02730 38191 40653 gene locus_tag LOCUS_02740 38191 40653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 41171 41380 gene locus_tag LOCUS_02750 41171 41380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 41355 41675 gene locus_tag LOCUS_02760 41355 41675 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109649.1 protein_id gnl|my_center|LOCUS_02760 >Feature sequence006 428 5038 gene locus_tag LOCUS_02770 428 5038 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877559.1 protein_id gnl|my_center|LOCUS_02770 5138 6394 gene locus_tag LOCUS_02780 gene coaBC 5138 6394 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114358.1 protein_id gnl|my_center|LOCUS_02780 6387 6839 gene locus_tag LOCUS_02790 gene dut 6387 6839 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038933.1 protein_id gnl|my_center|LOCUS_02790 7281 6907 gene locus_tag LOCUS_02800 gene rplQ 7281 6907 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391407.1 protein_id gnl|my_center|LOCUS_02800 8331 7312 gene locus_tag LOCUS_02810 gene rpoA 8331 7312 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555464.1 protein_id gnl|my_center|LOCUS_02810 8980 8354 gene locus_tag LOCUS_02820 gene rpsD 8980 8354 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943460.1 protein_id gnl|my_center|LOCUS_02820 9397 9002 gene locus_tag LOCUS_02830 gene rpsK 9397 9002 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216249.1 protein_id gnl|my_center|LOCUS_02830 9816 9415 gene locus_tag LOCUS_02840 gene rpsM 9816 9415 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090775.1 protein_id gnl|my_center|LOCUS_02840 10176 9958 gene locus_tag LOCUS_02850 gene infA 10176 9958 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521905.1 protein_id gnl|my_center|LOCUS_02850 10839 10177 gene locus_tag LOCUS_02860 10839 10177 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_02860 12167 10836 gene locus_tag LOCUS_02870 gene secY 12167 10836 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806926.1 protein_id gnl|my_center|LOCUS_02870 12604 12167 gene locus_tag LOCUS_02880 gene rplO 12604 12167 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946097.1 protein_id gnl|my_center|LOCUS_02880 12786 12601 gene locus_tag LOCUS_02890 gene rpmD 12786 12601 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215447.1 protein_id gnl|my_center|LOCUS_02890 13309 12779 gene locus_tag LOCUS_02900 gene rpsE 13309 12779 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486682.1 protein_id gnl|my_center|LOCUS_02900 13675 13322 gene locus_tag LOCUS_02910 gene rplR 13675 13322 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215441.1 protein_id gnl|my_center|LOCUS_02910 14218 13694 gene locus_tag LOCUS_02920 gene rplF 14218 13694 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093699.1 protein_id gnl|my_center|LOCUS_02920 14628 14233 gene locus_tag LOCUS_02930 gene rpsH 14628 14233 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806920.1 protein_id gnl|my_center|LOCUS_02930 15379 14837 gene locus_tag LOCUS_02940 gene rplE 15379 14837 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070624.1 protein_id gnl|my_center|LOCUS_02940 15714 15394 gene locus_tag LOCUS_02950 gene rplX 15714 15394 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093711.1 protein_id gnl|my_center|LOCUS_02950 16092 15724 gene locus_tag LOCUS_02960 gene rplN 16092 15724 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307975.1 protein_id gnl|my_center|LOCUS_02960 16364 16089 gene locus_tag LOCUS_02970 16364 16089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 16558 16361 gene locus_tag LOCUS_02980 gene rpmC 16558 16361 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644429.1 protein_id gnl|my_center|LOCUS_02980 16971 16555 gene locus_tag LOCUS_02990 gene rplP 16971 16555 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806911.1 protein_id gnl|my_center|LOCUS_02990 17646 16984 gene locus_tag LOCUS_03000 gene rpsC 17646 16984 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036126.1 protein_id gnl|my_center|LOCUS_03000 17990 17658 gene locus_tag LOCUS_03010 gene rplV 17990 17658 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486710.1 protein_id gnl|my_center|LOCUS_03010 18276 18001 gene locus_tag LOCUS_03020 gene rpsS 18276 18001 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806908.1 protein_id gnl|my_center|LOCUS_03020 19119 18295 gene locus_tag LOCUS_03030 gene rplB 19119 18295 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070620.1 protein_id gnl|my_center|LOCUS_03030 19429 19136 gene locus_tag LOCUS_03040 gene rplW 19429 19136 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555488.1 protein_id gnl|my_center|LOCUS_03040 20043 19426 gene locus_tag LOCUS_03050 gene rplD 20043 19426 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555489.1 protein_id gnl|my_center|LOCUS_03050 20686 20054 gene locus_tag LOCUS_03060 gene rplC 20686 20054 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010672559.1 protein_id gnl|my_center|LOCUS_03060 21012 20704 gene locus_tag LOCUS_03070 gene rpsJ 21012 20704 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036122.1 protein_id gnl|my_center|LOCUS_03070 22361 21012 gene locus_tag LOCUS_03080 gene tuf 22361 21012 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198356.1 protein_id gnl|my_center|LOCUS_03080 22325 22250 gene locus_tag LOCUS_t00080 22325 22250 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 22407 22334 gene locus_tag LOCUS_t00090 22407 22334 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 22552 22468 gene locus_tag LOCUS_t00100 22552 22468 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 22780 23427 gene locus_tag LOCUS_03090 22780 23427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 23528 25219 gene locus_tag LOCUS_03100 gene ubiB 23528 25219 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095885.1 protein_id gnl|my_center|LOCUS_03100 25268 25612 gene locus_tag LOCUS_03110 25268 25612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 26092 25640 gene locus_tag LOCUS_03120 26092 25640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 26693 26373 gene locus_tag LOCUS_03130 26693 26373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 27266 26823 gene locus_tag LOCUS_03140 gene nusB 27266 26823 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035937.1 protein_id gnl|my_center|LOCUS_03140 27740 27276 gene locus_tag LOCUS_03150 gene ribE 27740 27276 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942334.1 protein_id gnl|my_center|LOCUS_03150 28870 27737 gene locus_tag LOCUS_03160 gene ribBA 28870 27737 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122865.1 protein_id gnl|my_center|LOCUS_03160 29523 28867 gene locus_tag LOCUS_03170 29523 28867 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 protein_id gnl|my_center|LOCUS_03170 30600 29527 gene locus_tag LOCUS_03180 gene ribD 30600 29527 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113051.1 protein_id gnl|my_center|LOCUS_03180 31111 30617 gene locus_tag LOCUS_03190 gene nrdR 31111 30617 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208668.1 protein_id gnl|my_center|LOCUS_03190 32365 31121 gene locus_tag LOCUS_03200 32365 31121 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035930.1 protein_id gnl|my_center|LOCUS_03200 33254 32499 gene locus_tag LOCUS_03210 33254 32499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 33510 34628 gene locus_tag LOCUS_03220 33510 34628 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114709.1 protein_id gnl|my_center|LOCUS_03220 34625 35230 gene locus_tag LOCUS_03230 gene metW 34625 35230 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377217.1 protein_id gnl|my_center|LOCUS_03230 35250 35906 gene locus_tag LOCUS_03240 35250 35906 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087105.1 protein_id gnl|my_center|LOCUS_03240 35954 36739 gene locus_tag LOCUS_03250 gene ubiE 35954 36739 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224024.1 protein_id gnl|my_center|LOCUS_03250 36834 39188 gene locus_tag LOCUS_03260 gene metE 36834 39188 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223856.1 protein_id gnl|my_center|LOCUS_03260 39352 39981 gene locus_tag LOCUS_03270 39352 39981 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792222.1 protein_id gnl|my_center|LOCUS_03270 39991 41541 gene locus_tag LOCUS_03280 39991 41541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 >Feature sequence007 222 482 gene locus_tag LOCUS_03290 222 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 801 1832 gene locus_tag LOCUS_03300 801 1832 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533600.1 protein_id gnl|my_center|LOCUS_03300 1922 1846 gene locus_tag LOCUS_t00110 1922 1846 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2411 1959 gene locus_tag LOCUS_03310 2411 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 2685 2386 gene locus_tag LOCUS_03320 2685 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 5092 2696 gene locus_tag LOCUS_03330 gene pheT 5092 2696 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103972.1 protein_id gnl|my_center|LOCUS_03330 6142 5102 gene locus_tag LOCUS_03340 gene pheS 6142 5102 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114409.1 protein_id gnl|my_center|LOCUS_03340 6504 6145 gene locus_tag LOCUS_03350 gene rplT 6504 6145 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214103.1 protein_id gnl|my_center|LOCUS_03350 6720 6523 gene locus_tag LOCUS_03360 gene rpmI 6720 6523 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005596065.1 protein_id gnl|my_center|LOCUS_03360 7230 6730 gene locus_tag LOCUS_03370 gene infC 7230 6730 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071810680.1 protein_id gnl|my_center|LOCUS_03370 9199 7265 gene locus_tag LOCUS_03380 gene thrS 9199 7265 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360261.1 protein_id gnl|my_center|LOCUS_03380 9326 9252 gene locus_tag LOCUS_t00120 9326 9252 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 9676 9362 gene locus_tag LOCUS_03390 9676 9362 CDS product DUF2818 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185355.1 protein_id gnl|my_center|LOCUS_03390 11121 9676 gene locus_tag LOCUS_03400 gene nuoN 11121 9676 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813916.1 protein_id gnl|my_center|LOCUS_03400 12618 11134 gene locus_tag LOCUS_03410 12618 11134 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186137.1 protein_id gnl|my_center|LOCUS_03410 14604 12622 gene locus_tag LOCUS_03420 gene nuoL 14604 12622 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930037.1 protein_id gnl|my_center|LOCUS_03420 14923 14606 gene locus_tag LOCUS_03430 gene nuoK 14923 14606 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 protein_id gnl|my_center|LOCUS_03430 15519 14920 gene locus_tag LOCUS_03440 15519 14920 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813921.1 protein_id gnl|my_center|LOCUS_03440 16026 15535 gene locus_tag LOCUS_03450 gene nuoI 16026 15535 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186558.1 protein_id gnl|my_center|LOCUS_03450 17062 16037 gene locus_tag LOCUS_03460 gene nuoH 17062 16037 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769061.1 protein_id gnl|my_center|LOCUS_03460 19419 17074 gene locus_tag LOCUS_03470 gene nuoG 19419 17074 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958230.1 protein_id gnl|my_center|LOCUS_03470 20702 19419 gene locus_tag LOCUS_03480 gene nuoF 20702 19419 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813930.1 protein_id gnl|my_center|LOCUS_03480 21183 20692 gene locus_tag LOCUS_03490 gene nuoE 21183 20692 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948474.1 protein_id gnl|my_center|LOCUS_03490 22440 21187 gene locus_tag LOCUS_03500 22440 21187 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185833.1 protein_id gnl|my_center|LOCUS_03500 23032 22427 gene locus_tag LOCUS_03510 23032 22427 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186121.1 protein_id gnl|my_center|LOCUS_03510 23512 23036 gene locus_tag LOCUS_03520 23512 23036 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 protein_id gnl|my_center|LOCUS_03520 23859 23503 gene locus_tag LOCUS_03530 23859 23503 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040258.1 protein_id gnl|my_center|LOCUS_03530 24074 23990 gene locus_tag LOCUS_t00130 24074 23990 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 24504 24112 gene locus_tag LOCUS_03540 24504 24112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 25282 24509 gene locus_tag LOCUS_03550 gene tpiA 25282 24509 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121241.1 protein_id gnl|my_center|LOCUS_03550 26766 25402 gene locus_tag LOCUS_03560 gene glmM 26766 25402 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550648.1 protein_id gnl|my_center|LOCUS_03560 27651 26812 gene locus_tag LOCUS_03570 gene folP 27651 26812 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113907.1 protein_id gnl|my_center|LOCUS_03570 29570 27648 gene locus_tag LOCUS_03580 gene ftsH 29570 27648 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039235.1 protein_id gnl|my_center|LOCUS_03580 31111 29666 gene locus_tag LOCUS_03590 gene tldD 31111 29666 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037736.1 protein_id gnl|my_center|LOCUS_03590 31452 34304 gene locus_tag LOCUS_03600 31452 34304 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814928.1 protein_id gnl|my_center|LOCUS_03600 34335 35459 gene locus_tag LOCUS_03610 34335 35459 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194129.1 protein_id gnl|my_center|LOCUS_03610 >Feature sequence008 2572 2243 gene locus_tag LOCUS_03620 2572 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 3418 2711 gene locus_tag LOCUS_03630 3418 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 3837 3595 gene locus_tag LOCUS_03640 3837 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 4288 3911 gene locus_tag LOCUS_03650 4288 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 4600 4328 gene locus_tag LOCUS_03660 4600 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 4866 4597 gene locus_tag LOCUS_03670 4866 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 6034 4859 gene locus_tag LOCUS_03680 gene dotB 6034 4859 CDS product Dot/Icm type IV secretion system ATPase DotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769572.1 protein_id gnl|my_center|LOCUS_03680 6768 6031 gene locus_tag LOCUS_03690 6768 6031 CDS product type IV secretion system DotC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958346.1 protein_id gnl|my_center|LOCUS_03690 7263 6772 gene locus_tag LOCUS_03700 7263 6772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 7508 7433 gene locus_tag LOCUS_t00140 7508 7433 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 8516 7569 gene locus_tag LOCUS_03710 8516 7569 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931310.1 protein_id gnl|my_center|LOCUS_03710 8641 8567 gene locus_tag LOCUS_t00150 8641 8567 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 9491 8646 gene locus_tag LOCUS_03720 gene ispE 9491 8646 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808500.1 protein_id gnl|my_center|LOCUS_03720 10144 9488 gene locus_tag LOCUS_03730 gene lolB 10144 9488 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490532.1 protein_id gnl|my_center|LOCUS_03730 11778 10141 gene locus_tag LOCUS_03740 11778 10141 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195237.1 protein_id gnl|my_center|LOCUS_03740 12038 13189 gene locus_tag LOCUS_03750 gene hemA 12038 13189 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927715.1 protein_id gnl|my_center|LOCUS_03750 13186 14283 gene locus_tag LOCUS_03760 gene prfA 13186 14283 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807618.1 protein_id gnl|my_center|LOCUS_03760 14273 15139 gene locus_tag LOCUS_03770 gene prmC 14273 15139 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527812.1 protein_id gnl|my_center|LOCUS_03770 15142 15954 gene locus_tag LOCUS_03780 gene mutM 15142 15954 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003372546.1 protein_id gnl|my_center|LOCUS_03780 15971 17950 gene locus_tag LOCUS_03790 15971 17950 CDS product dynamin-like GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114887.1 protein_id gnl|my_center|LOCUS_03790 18185 17934 gene locus_tag LOCUS_03800 18185 17934 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084462.1 protein_id gnl|my_center|LOCUS_03800 18739 18215 gene locus_tag LOCUS_03810 gene coaD 18739 18215 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003348749.1 protein_id gnl|my_center|LOCUS_03810 19301 18732 gene locus_tag LOCUS_03820 gene rsmD 19301 18732 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003455683.1 protein_id gnl|my_center|LOCUS_03820 19424 20488 gene locus_tag LOCUS_03830 19424 20488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 20485 21156 gene locus_tag LOCUS_03840 gene ftsE 20485 21156 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074183.1 protein_id gnl|my_center|LOCUS_03840 21153 22058 gene locus_tag LOCUS_03850 gene ftsX 21153 22058 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086480063.1 protein_id gnl|my_center|LOCUS_03850 22133 22984 gene locus_tag LOCUS_03860 gene rpoH 22133 22984 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704351.1 protein_id gnl|my_center|LOCUS_03860 22981 23313 gene locus_tag LOCUS_03870 22981 23313 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761890.1 protein_id gnl|my_center|LOCUS_03870 24663 23335 gene locus_tag LOCUS_03880 gene hslU 24663 23335 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175854.1 protein_id gnl|my_center|LOCUS_03880 25199 24660 gene locus_tag LOCUS_03890 gene hslV 25199 24660 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946377.1 protein_id gnl|my_center|LOCUS_03890 26131 25196 gene locus_tag LOCUS_03900 gene xerC 26131 25196 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266244.1 protein_id gnl|my_center|LOCUS_03900 26808 26125 gene locus_tag LOCUS_03910 26808 26125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 26985 26809 gene locus_tag LOCUS_03920 26985 26809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 27595 26987 gene locus_tag LOCUS_03930 27595 26987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 27479 27820 gene locus_tag LOCUS_03940 27479 27820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 28251 28421 gene locus_tag LOCUS_03950 28251 28421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 29115 28834 gene locus_tag LOCUS_03960 29115 28834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 >Feature sequence009 3 254 gene locus_tag LOCUS_03970 3 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 610 281 gene locus_tag LOCUS_03980 610 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 894 2561 gene locus_tag LOCUS_03990 gene ettA 894 2561 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186903.1 protein_id gnl|my_center|LOCUS_03990 2675 2809 gene locus_tag LOCUS_04000 gene rpmH 2675 2809 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551315.1 protein_id gnl|my_center|LOCUS_04000 2814 3164 gene locus_tag LOCUS_04010 gene rnpA 2814 3164 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001789343.1 protein_id gnl|my_center|LOCUS_04010 3161 3376 gene locus_tag LOCUS_04020 3161 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 3392 4996 gene locus_tag LOCUS_04030 gene yidC 3392 4996 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927254.1 protein_id gnl|my_center|LOCUS_04030 5026 6381 gene locus_tag LOCUS_04040 gene mnmE 5026 6381 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039299.1 protein_id gnl|my_center|LOCUS_04040 6498 9272 gene locus_tag LOCUS_04050 6498 9272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04050 9265 9627 gene locus_tag LOCUS_04060 9265 9627 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406684.1 protein_id gnl|my_center|LOCUS_04060 9645 10721 gene locus_tag LOCUS_04070 9645 10721 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870115.1 protein_id gnl|my_center|LOCUS_04070 10935 10735 gene locus_tag LOCUS_04080 10935 10735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 12316 10946 gene locus_tag LOCUS_04090 12316 10946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 12508 13086 gene locus_tag LOCUS_04100 12508 13086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 13218 13142 gene locus_tag LOCUS_t00160 13218 13142 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 14072 13293 gene locus_tag LOCUS_04110 14072 13293 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192376.1 protein_id gnl|my_center|LOCUS_04110 15010 14069 gene locus_tag LOCUS_04120 15010 14069 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810478.1 protein_id gnl|my_center|LOCUS_04120 15707 14979 gene locus_tag LOCUS_04130 gene coxH3 15707 14979 CDS product Dot/Icm type IV secretion system effector CoxH3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770384.1 protein_id gnl|my_center|LOCUS_04130 16024 15707 gene locus_tag LOCUS_04140 16024 15707 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_04140 16097 16723 gene locus_tag LOCUS_04150 gene coq7 16097 16723 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527787.1 protein_id gnl|my_center|LOCUS_04150 17213 16728 gene locus_tag LOCUS_04160 17213 16728 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941998.1 protein_id gnl|my_center|LOCUS_04160 17649 17224 gene locus_tag LOCUS_04170 17649 17224 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767887.1 protein_id gnl|my_center|LOCUS_04170 18512 17724 gene locus_tag LOCUS_04180 gene trpC 18512 17724 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522001.1 protein_id gnl|my_center|LOCUS_04180 19532 18516 gene locus_tag LOCUS_04190 gene trpD 19532 18516 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085203.1 protein_id gnl|my_center|LOCUS_04190 20101 19529 gene locus_tag LOCUS_04200 20101 19529 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_04200 21233 20313 gene locus_tag LOCUS_04210 21233 20313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 21459 21250 gene locus_tag LOCUS_04220 21459 21250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 22115 22342 gene locus_tag LOCUS_04230 22115 22342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 22488 22330 gene locus_tag LOCUS_04240 22488 22330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 22761 22501 gene locus_tag LOCUS_04250 22761 22501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 24391 22871 gene locus_tag LOCUS_04260 24391 22871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 24884 25315 gene locus_tag LOCUS_04270 24884 25315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 25312 26505 gene locus_tag LOCUS_04280 25312 26505 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310055.1 protein_id gnl|my_center|LOCUS_04280 27416 26829 gene locus_tag LOCUS_04290 27416 26829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 >Feature sequence010 1291 65 gene locus_tag LOCUS_04300 1291 65 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 protein_id gnl|my_center|LOCUS_04300 2415 1675 gene locus_tag LOCUS_04310 2415 1675 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995184.1 protein_id gnl|my_center|LOCUS_04310 2794 2549 gene locus_tag LOCUS_04320 2794 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 3148 3768 gene locus_tag LOCUS_04330 3148 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 3877 4602 gene locus_tag LOCUS_04340 3877 4602 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918603.1 protein_id gnl|my_center|LOCUS_04340 4725 5846 gene locus_tag LOCUS_04350 4725 5846 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865348.1 protein_id gnl|my_center|LOCUS_04350 6254 5859 gene locus_tag LOCUS_04360 6254 5859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 7273 6272 gene locus_tag LOCUS_04370 7273 6272 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_04370 8262 7273 gene locus_tag LOCUS_04380 gene rfaD 8262 7273 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190173.1 protein_id gnl|my_center|LOCUS_04380 8420 10405 gene locus_tag LOCUS_04390 8420 10405 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195204.1 protein_id gnl|my_center|LOCUS_04390 10502 12469 gene locus_tag LOCUS_04400 gene acs 10502 12469 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056731.1 protein_id gnl|my_center|LOCUS_04400 12591 13772 gene locus_tag LOCUS_04410 12591 13772 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583323.1 protein_id gnl|my_center|LOCUS_04410 16380 13780 gene locus_tag LOCUS_04420 gene clpB 16380 13780 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947476.1 protein_id gnl|my_center|LOCUS_04420 17584 16421 gene locus_tag LOCUS_04430 17584 16421 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_04430 18679 17588 gene locus_tag LOCUS_04440 gene aroC 18679 17588 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918437.1 protein_id gnl|my_center|LOCUS_04440 19477 18683 gene locus_tag LOCUS_04450 gene folE2 19477 18683 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195713.1 protein_id gnl|my_center|LOCUS_04450 21394 19520 gene locus_tag LOCUS_04460 gene dxs 21394 19520 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266656.1 protein_id gnl|my_center|LOCUS_04460 22311 21391 gene locus_tag LOCUS_04470 gene ispA 22311 21391 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707087.1 protein_id gnl|my_center|LOCUS_04470 22556 22308 gene locus_tag LOCUS_04480 22556 22308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 22687 23904 gene locus_tag LOCUS_04490 22687 23904 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192717.1 protein_id gnl|my_center|LOCUS_04490 24019 24855 gene locus_tag LOCUS_04500 24019 24855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 25308 24934 gene locus_tag LOCUS_04510 gene trxA 25308 24934 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027416.1 protein_id gnl|my_center|LOCUS_04510 25468 26808 gene locus_tag LOCUS_04520 gene xseA 25468 26808 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693773.1 protein_id gnl|my_center|LOCUS_04520 27317 26865 gene locus_tag LOCUS_04530 27317 26865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 >Feature sequence011 598 2568 gene locus_tag LOCUS_04540 598 2568 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951242.1 protein_id gnl|my_center|LOCUS_04540 2586 4895 gene locus_tag LOCUS_04550 gene parC 2586 4895 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951227.1 protein_id gnl|my_center|LOCUS_04550 5320 4979 gene locus_tag LOCUS_04560 5320 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 5792 6481 gene locus_tag LOCUS_04570 5792 6481 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522523.1 protein_id gnl|my_center|LOCUS_04570 7109 6543 gene locus_tag LOCUS_04580 7109 6543 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061461.1 protein_id gnl|my_center|LOCUS_04580 7470 7114 gene locus_tag LOCUS_04590 7470 7114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 8265 7480 gene locus_tag LOCUS_04600 8265 7480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 9310 8279 gene locus_tag LOCUS_04610 gene ybiB 9310 8279 CDS product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704816.1 protein_id gnl|my_center|LOCUS_04610 12093 9292 gene locus_tag LOCUS_04620 12093 9292 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113578.1 protein_id gnl|my_center|LOCUS_04620 12410 12090 gene locus_tag LOCUS_04630 gene nirD 12410 12090 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530461.1 protein_id gnl|my_center|LOCUS_04630 14874 12421 gene locus_tag LOCUS_04640 gene nirB 14874 12421 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530942.1 protein_id gnl|my_center|LOCUS_04640 16351 15113 gene locus_tag LOCUS_04650 16351 15113 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 protein_id gnl|my_center|LOCUS_04650 17777 16374 gene locus_tag LOCUS_04660 17777 16374 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535279.1 protein_id gnl|my_center|LOCUS_04660 19252 18089 gene locus_tag LOCUS_04670 19252 18089 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160926.1 protein_id gnl|my_center|LOCUS_04670 19487 20185 gene locus_tag LOCUS_04680 gene dnr 19487 20185 CDS product transcriptional regulator Dnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113234.1 protein_id gnl|my_center|LOCUS_04680 20704 20312 gene locus_tag LOCUS_04690 20704 20312 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563881.1 protein_id gnl|my_center|LOCUS_04690 21243 20797 gene locus_tag LOCUS_04700 21243 20797 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880581.1 protein_id gnl|my_center|LOCUS_04700 21698 21240 gene locus_tag LOCUS_04710 21698 21240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 21890 22048 gene locus_tag LOCUS_04720 21890 22048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 23050 22067 gene locus_tag LOCUS_04730 23050 22067 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_04730 23575 23114 gene locus_tag LOCUS_04740 23575 23114 CDS product globin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085591.1 protein_id gnl|my_center|LOCUS_04740 24871 23702 gene locus_tag LOCUS_04750 24871 23702 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447276.1 protein_id gnl|my_center|LOCUS_04750 26301 24868 gene locus_tag LOCUS_04760 26301 24868 CDS product AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036590.1 protein_id gnl|my_center|LOCUS_04760 27278 26301 gene locus_tag LOCUS_04770 27278 26301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 >Feature sequence012 203 460 gene locus_tag LOCUS_04780 203 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 720 1469 gene locus_tag LOCUS_04790 720 1469 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057465.1 protein_id gnl|my_center|LOCUS_04790 2609 1524 gene locus_tag LOCUS_04800 gene amrS 2609 1524 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444592.1 protein_id gnl|my_center|LOCUS_04800 3204 2602 gene locus_tag LOCUS_04810 3204 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 4018 3191 gene locus_tag LOCUS_04820 gene amrB 4018 3191 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388207.1 protein_id gnl|my_center|LOCUS_04820 5409 4102 gene locus_tag LOCUS_04830 5409 4102 CDS product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097417.1 protein_id gnl|my_center|LOCUS_04830 5608 5859 gene locus_tag LOCUS_04840 5608 5859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 6985 5843 gene locus_tag LOCUS_04850 6985 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 7449 7009 gene locus_tag LOCUS_04860 7449 7009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 8045 9088 gene locus_tag LOCUS_04870 8045 9088 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037914.1 protein_id gnl|my_center|LOCUS_04870 9093 10433 gene locus_tag LOCUS_04880 gene hemG 9093 10433 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403969.1 protein_id gnl|my_center|LOCUS_04880 11266 10448 gene locus_tag LOCUS_04890 11266 10448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 13439 11385 gene locus_tag LOCUS_04900 gene recG 13439 11385 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819155.1 protein_id gnl|my_center|LOCUS_04900 13659 13441 gene locus_tag LOCUS_04910 13659 13441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 14050 13661 gene locus_tag LOCUS_04920 14050 13661 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947724.1 protein_id gnl|my_center|LOCUS_04920 16347 14065 gene locus_tag LOCUS_04930 gene spoT 16347 14065 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369143.1 protein_id gnl|my_center|LOCUS_04930 16606 16331 gene locus_tag LOCUS_04940 16606 16331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 17269 16631 gene locus_tag LOCUS_04950 gene gmk 17269 16631 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098317.1 protein_id gnl|my_center|LOCUS_04950 18139 17276 gene locus_tag LOCUS_04960 18139 17276 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094887.1 protein_id gnl|my_center|LOCUS_04960 18360 18722 gene locus_tag LOCUS_04970 18360 18722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 21069 18751 gene locus_tag LOCUS_04980 21069 18751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 21925 21122 gene locus_tag LOCUS_04990 21925 21122 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_04990 22433 22077 gene locus_tag LOCUS_05000 22433 22077 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124705.1 protein_id gnl|my_center|LOCUS_05000 23933 22512 gene locus_tag LOCUS_05010 23933 22512 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124704.1 protein_id gnl|my_center|LOCUS_05010 24532 24329 gene locus_tag LOCUS_05020 24532 24329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 24960 25472 gene locus_tag LOCUS_05030 24960 25472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 >Feature sequence013 1 1179 gene locus_tag LOCUS_05040 1 1179 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728727.1 protein_id gnl|my_center|LOCUS_05040 1828 1193 gene locus_tag LOCUS_05050 1828 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 2883 1891 gene locus_tag LOCUS_05060 gene hemB 2883 1891 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940811.1 protein_id gnl|my_center|LOCUS_05060 3668 2880 gene locus_tag LOCUS_05070 3668 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 4585 3665 gene locus_tag LOCUS_05080 gene hemC 4585 3665 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103001.1 protein_id gnl|my_center|LOCUS_05080 4961 4659 gene locus_tag LOCUS_05090 4961 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 5367 4972 gene locus_tag LOCUS_05100 5367 4972 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_05100 6656 5364 gene locus_tag LOCUS_05110 gene hemL 6656 5364 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093150.1 protein_id gnl|my_center|LOCUS_05110 7312 6659 gene locus_tag LOCUS_05120 gene thiE 7312 6659 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093148.1 protein_id gnl|my_center|LOCUS_05120 8153 7314 gene locus_tag LOCUS_05130 8153 7314 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 protein_id gnl|my_center|LOCUS_05130 8618 8163 gene locus_tag LOCUS_05140 8618 8163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 9211 8867 gene locus_tag LOCUS_05150 9211 8867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 9917 9603 gene locus_tag LOCUS_05160 9917 9603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 10675 9977 gene locus_tag LOCUS_05170 10675 9977 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994029.1 protein_id gnl|my_center|LOCUS_05170 11912 10698 gene locus_tag LOCUS_05180 11912 10698 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094159.1 protein_id gnl|my_center|LOCUS_05180 12560 11940 gene locus_tag LOCUS_05190 gene petA 12560 11940 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100631.1 protein_id gnl|my_center|LOCUS_05190 13406 12579 gene locus_tag LOCUS_05200 13406 12579 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261672.1 protein_id gnl|my_center|LOCUS_05200 13930 13403 gene locus_tag LOCUS_05210 13930 13403 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074258.1 protein_id gnl|my_center|LOCUS_05210 15743 14562 gene locus_tag LOCUS_05220 15743 14562 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199381.1 protein_id gnl|my_center|LOCUS_05220 16670 16458 gene locus_tag LOCUS_05230 16670 16458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 18716 16689 gene locus_tag LOCUS_05240 18716 16689 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389031.1 protein_id gnl|my_center|LOCUS_05240 19665 21020 gene locus_tag LOCUS_05250 gene dnaA 19665 21020 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070424.1 protein_id gnl|my_center|LOCUS_05250 21304 22401 gene locus_tag LOCUS_05260 gene dnaN 21304 22401 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768226.1 protein_id gnl|my_center|LOCUS_05260 22403 23461 gene locus_tag LOCUS_05270 gene recF 22403 23461 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884355.1 protein_id gnl|my_center|LOCUS_05270 23458 25860 gene locus_tag LOCUS_05280 gene gyrB 23458 25860 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220005.1 protein_id gnl|my_center|LOCUS_05280 >Feature sequence014 827 42 gene locus_tag LOCUS_05290 827 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 849 1991 gene locus_tag LOCUS_05300 849 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 2066 3199 gene locus_tag LOCUS_05310 gene dnaJ 2066 3199 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522147.1 protein_id gnl|my_center|LOCUS_05310 3199 4032 gene locus_tag LOCUS_05320 gene dapB 3199 4032 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387915.1 protein_id gnl|my_center|LOCUS_05320 4062 4376 gene locus_tag LOCUS_05330 4062 4376 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886917.1 protein_id gnl|my_center|LOCUS_05330 4393 5469 gene locus_tag LOCUS_05340 gene apbC 4393 5469 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193796.1 protein_id gnl|my_center|LOCUS_05340 5499 6065 gene locus_tag LOCUS_05350 gene dcd 5499 6065 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192666.1 protein_id gnl|my_center|LOCUS_05350 7149 6073 gene locus_tag LOCUS_05360 7149 6073 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204560.1 protein_id gnl|my_center|LOCUS_05360 8711 7293 gene locus_tag LOCUS_05370 8711 7293 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674117.1 protein_id gnl|my_center|LOCUS_05370 9085 8708 gene locus_tag LOCUS_05380 9085 8708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 9449 9189 gene locus_tag LOCUS_05390 9449 9189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 11724 10516 gene locus_tag LOCUS_05400 11724 10516 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948404.1 protein_id gnl|my_center|LOCUS_05400 13258 12470 gene locus_tag LOCUS_05410 13258 12470 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261672.1 protein_id gnl|my_center|LOCUS_05410 13739 13251 gene locus_tag LOCUS_05420 13739 13251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 14237 14070 gene locus_tag LOCUS_05430 14237 14070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 14493 15638 gene locus_tag LOCUS_05440 14493 15638 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108005.1 protein_id gnl|my_center|LOCUS_05440 16358 15921 gene locus_tag LOCUS_05450 16358 15921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 17354 16662 gene locus_tag LOCUS_05460 17354 16662 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957870.1 protein_id gnl|my_center|LOCUS_05460 18488 17526 gene locus_tag LOCUS_05470 18488 17526 CDS product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193901.1 protein_id gnl|my_center|LOCUS_05470 18692 19783 gene locus_tag LOCUS_05480 18692 19783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 20587 19814 gene locus_tag LOCUS_05490 gene fabI 20587 19814 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368564.1 protein_id gnl|my_center|LOCUS_05490 22422 20611 gene locus_tag LOCUS_05500 22422 20611 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120244.1 protein_id gnl|my_center|LOCUS_05500 >Feature sequence015 4139 1620 gene locus_tag LOCUS_05510 4139 1620 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968158.1 protein_id gnl|my_center|LOCUS_05510 4799 5476 gene locus_tag LOCUS_05520 4799 5476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 5503 5691 gene locus_tag LOCUS_05530 5503 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 5691 5948 gene locus_tag LOCUS_05540 5691 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 6447 7268 gene locus_tag LOCUS_05550 gene htpX 6447 7268 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264281.1 protein_id gnl|my_center|LOCUS_05550 7370 7681 gene locus_tag LOCUS_05560 7370 7681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 7671 8570 gene locus_tag LOCUS_05570 7671 8570 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529074.1 protein_id gnl|my_center|LOCUS_05570 8571 8900 gene locus_tag LOCUS_05580 8571 8900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 8897 9508 gene locus_tag LOCUS_05590 8897 9508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 9854 10135 gene locus_tag LOCUS_05600 9854 10135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 10385 10534 gene locus_tag LOCUS_05610 10385 10534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 10563 11090 gene locus_tag LOCUS_05620 10563 11090 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112637.1 protein_id gnl|my_center|LOCUS_05620 11087 13117 gene locus_tag LOCUS_05630 11087 13117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 13117 13686 gene locus_tag LOCUS_05640 13117 13686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 13688 14518 gene locus_tag LOCUS_05650 13688 14518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 14937 15353 gene locus_tag LOCUS_05660 14937 15353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 15631 16332 gene locus_tag LOCUS_05670 15631 16332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 16314 16844 gene locus_tag LOCUS_05680 16314 16844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 17158 16934 gene locus_tag LOCUS_05690 17158 16934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 17217 19151 gene locus_tag LOCUS_05700 17217 19151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 19144 19416 gene locus_tag LOCUS_05710 19144 19416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 19782 20660 gene locus_tag LOCUS_05720 19782 20660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 20657 21214 gene locus_tag LOCUS_05730 20657 21214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 21327 21683 gene locus_tag LOCUS_05740 21327 21683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 21701 21934 gene locus_tag LOCUS_05750 21701 21934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 22673 22146 gene locus_tag LOCUS_05760 22673 22146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 >Feature sequence016 235 417 gene locus_tag LOCUS_05770 235 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 550 846 gene locus_tag LOCUS_05780 550 846 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677634.1 protein_id gnl|my_center|LOCUS_05780 848 1171 gene locus_tag LOCUS_05790 848 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 1453 2664 gene locus_tag LOCUS_05800 gene proB 1453 2664 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381304.1 protein_id gnl|my_center|LOCUS_05800 4975 2624 gene locus_tag LOCUS_05810 4975 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 5357 5638 gene locus_tag LOCUS_05820 5357 5638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 5689 5967 gene locus_tag LOCUS_05830 5689 5967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 6827 6003 gene locus_tag LOCUS_05840 6827 6003 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189857.1 protein_id gnl|my_center|LOCUS_05840 6991 7644 gene locus_tag LOCUS_05850 6991 7644 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268524.1 protein_id gnl|my_center|LOCUS_05850 7678 8337 gene locus_tag LOCUS_05860 7678 8337 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021249004.1 protein_id gnl|my_center|LOCUS_05860 8337 9548 gene locus_tag LOCUS_05870 8337 9548 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191887.1 protein_id gnl|my_center|LOCUS_05870 9571 10365 gene locus_tag LOCUS_05880 9571 10365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 10358 10897 gene locus_tag LOCUS_05890 10358 10897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 11035 11910 gene locus_tag LOCUS_05900 11035 11910 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120431.1 protein_id gnl|my_center|LOCUS_05900 11920 12618 gene locus_tag LOCUS_05910 11920 12618 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360272.1 protein_id gnl|my_center|LOCUS_05910 12896 12636 gene locus_tag LOCUS_05920 12896 12636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 15581 13056 gene locus_tag LOCUS_05930 15581 13056 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_05930 16599 15595 gene locus_tag LOCUS_05940 16599 15595 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973390.1 protein_id gnl|my_center|LOCUS_05940 17110 16622 gene locus_tag LOCUS_05950 17110 16622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 18083 17214 gene locus_tag LOCUS_05960 18083 17214 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216798.1 protein_id gnl|my_center|LOCUS_05960 20669 18225 gene locus_tag LOCUS_05970 20669 18225 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057028.1 protein_id gnl|my_center|LOCUS_05970 20942 20703 gene locus_tag LOCUS_05980 20942 20703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 21457 21041 gene locus_tag LOCUS_05990 21457 21041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 <22920 21705 gene locus_tag LOCUS_06000 <22920 21705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010929604.1:molecular chaperone HtpG >Feature sequence017 <1 1904 gene locus_tag LOCUS_06010 <1 1904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144073.1:aconitate hydratase 1901 3193 gene locus_tag LOCUS_06020 gene icd 1901 3193 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078068420.1 protein_id gnl|my_center|LOCUS_06020 3203 4366 gene locus_tag LOCUS_06030 gene sucC 3203 4366 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048602.1 protein_id gnl|my_center|LOCUS_06030 4368 4712 gene locus_tag LOCUS_06040 4368 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 4709 5581 gene locus_tag LOCUS_06050 gene sucD 4709 5581 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946282.1 protein_id gnl|my_center|LOCUS_06050 5581 7230 gene locus_tag LOCUS_06060 5581 7230 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211555.1 protein_id gnl|my_center|LOCUS_06060 7227 7565 gene locus_tag LOCUS_06070 gene glnB 7227 7565 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717795.1 protein_id gnl|my_center|LOCUS_06070 8227 7610 gene locus_tag LOCUS_06080 8227 7610 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687645.1 protein_id gnl|my_center|LOCUS_06080 8391 9350 gene locus_tag LOCUS_06090 gene rluD 8391 9350 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094686.1 protein_id gnl|my_center|LOCUS_06090 9367 10092 gene locus_tag LOCUS_06100 gene yfiH 9367 10092 CDS product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992642.1 protein_id gnl|my_center|LOCUS_06100 10094 10642 gene locus_tag LOCUS_06110 10094 10642 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201440.1 protein_id gnl|my_center|LOCUS_06110 10639 11811 gene locus_tag LOCUS_06120 gene mtnW 10639 11811 CDS product 2,3-diketo-5-methylthiopentyl-1-phosphate enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245108.1 protein_id gnl|my_center|LOCUS_06120 11811 12464 gene locus_tag LOCUS_06130 11811 12464 CDS product 2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027460.1 protein_id gnl|my_center|LOCUS_06130 12454 13074 gene locus_tag LOCUS_06140 gene mtnB 12454 13074 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111958.1 protein_id gnl|my_center|LOCUS_06140 13076 13597 gene locus_tag LOCUS_06150 13076 13597 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944067.1 protein_id gnl|my_center|LOCUS_06150 13597 14100 gene locus_tag LOCUS_06160 gene def 13597 14100 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944066.1 protein_id gnl|my_center|LOCUS_06160 14299 17112 gene locus_tag LOCUS_06170 14299 17112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 17257 17568 gene locus_tag LOCUS_06180 17257 17568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 17594 18226 gene locus_tag LOCUS_06190 17594 18226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 18608 18937 gene locus_tag LOCUS_06200 18608 18937 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074357.1 protein_id gnl|my_center|LOCUS_06200 18934 19278 gene locus_tag LOCUS_06210 18934 19278 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074358.1 protein_id gnl|my_center|LOCUS_06210 21159 21500 gene locus_tag LOCUS_06220 21159 21500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 21993 21517 gene locus_tag LOCUS_06230 21993 21517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 >Feature sequence018 958 1113 gene locus_tag LOCUS_06240 958 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 2325 1231 gene locus_tag LOCUS_06250 gene mrdB 2325 1231 CDS product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781440.1 protein_id gnl|my_center|LOCUS_06250 3016 2540 gene locus_tag LOCUS_06260 gene mreD 3016 2540 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073800.1 protein_id gnl|my_center|LOCUS_06260 3801 3013 gene locus_tag LOCUS_06270 gene mreC 3801 3013 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704376.1 protein_id gnl|my_center|LOCUS_06270 4920 3877 gene locus_tag LOCUS_06280 gene mreB 4920 3877 CDS product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918653.1 protein_id gnl|my_center|LOCUS_06280 6930 5203 gene locus_tag LOCUS_06290 gene soxB 6930 5203 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926971.1 protein_id gnl|my_center|LOCUS_06290 7374 6949 gene locus_tag LOCUS_06300 7374 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 8180 7848 gene locus_tag LOCUS_06310 gene soxZ 8180 7848 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086297.1 protein_id gnl|my_center|LOCUS_06310 8729 8217 gene locus_tag LOCUS_06320 8729 8217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 10778 9408 gene locus_tag LOCUS_06330 10778 9408 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546410.1 protein_id gnl|my_center|LOCUS_06330 12384 10819 gene locus_tag LOCUS_06340 12384 10819 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545672.1 protein_id gnl|my_center|LOCUS_06340 13910 12381 gene locus_tag LOCUS_06350 13910 12381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 13967 14476 gene locus_tag LOCUS_06360 gene moaC 13967 14476 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 protein_id gnl|my_center|LOCUS_06360 14786 14481 gene locus_tag LOCUS_06370 14786 14481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 14937 17822 gene locus_tag LOCUS_06380 14937 17822 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171192.1 protein_id gnl|my_center|LOCUS_06380 17841 18533 gene locus_tag LOCUS_06390 17841 18533 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533670.1 protein_id gnl|my_center|LOCUS_06390 18543 19481 gene locus_tag LOCUS_06400 18543 19481 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533671.1 protein_id gnl|my_center|LOCUS_06400 19545 20573 gene locus_tag LOCUS_06410 gene moaA 19545 20573 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531699.1 protein_id gnl|my_center|LOCUS_06410 20674 21006 gene locus_tag LOCUS_06420 20674 21006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 21127 21357 gene locus_tag LOCUS_06430 21127 21357 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932528.1 protein_id gnl|my_center|LOCUS_06430 21376 21873 gene locus_tag LOCUS_06440 21376 21873 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_06440 >Feature sequence019 25 1053 gene locus_tag LOCUS_06450 gene istA 25 1053 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047902700.1 protein_id gnl|my_center|LOCUS_06450 1050 1838 gene locus_tag LOCUS_06460 gene istB 1050 1838 CDS product IS21-like element IS100kyp family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001317493.1 protein_id gnl|my_center|LOCUS_06460 2192 1938 gene locus_tag LOCUS_06470 2192 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 3466 2210 gene locus_tag LOCUS_06480 3466 2210 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920728.1 protein_id gnl|my_center|LOCUS_06480 4135 3584 gene locus_tag LOCUS_06490 4135 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 4929 5747 gene locus_tag LOCUS_06500 4929 5747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 6326 5967 gene locus_tag LOCUS_06510 6326 5967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 6392 8320 gene locus_tag LOCUS_06520 6392 8320 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038053.1 protein_id gnl|my_center|LOCUS_06520 8320 8994 gene locus_tag LOCUS_06530 gene tsaB 8320 8994 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221014.1 protein_id gnl|my_center|LOCUS_06530 8991 9461 gene locus_tag LOCUS_06540 gene rimI 8991 9461 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439259.1 protein_id gnl|my_center|LOCUS_06540 9468 11087 gene locus_tag LOCUS_06550 9468 11087 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225531.1 protein_id gnl|my_center|LOCUS_06550 11112 11555 gene locus_tag LOCUS_06560 11112 11555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 13182 11671 gene locus_tag LOCUS_06570 13182 11671 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098248.1 protein_id gnl|my_center|LOCUS_06570 13449 13186 gene locus_tag LOCUS_06580 13449 13186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 14648 13461 gene locus_tag LOCUS_06590 14648 13461 CDS product UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385505.1 protein_id gnl|my_center|LOCUS_06590 15867 14638 gene locus_tag LOCUS_06600 gene ubiH 15867 14638 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705606.1 protein_id gnl|my_center|LOCUS_06600 15997 16812 gene locus_tag LOCUS_06610 15997 16812 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036616.1 protein_id gnl|my_center|LOCUS_06610 16812 17558 gene locus_tag LOCUS_06620 16812 17558 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184121.1 protein_id gnl|my_center|LOCUS_06620 17681 18058 gene locus_tag LOCUS_06630 17681 18058 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930561.1 protein_id gnl|my_center|LOCUS_06630 18071 18943 gene locus_tag LOCUS_06640 18071 18943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 18968 20440 gene locus_tag LOCUS_06650 gene ubiD 18968 20440 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317344.1 protein_id gnl|my_center|LOCUS_06650 >Feature sequence020 2859 370 gene locus_tag LOCUS_06660 2859 370 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958515.1 protein_id gnl|my_center|LOCUS_06660 2961 4385 gene locus_tag LOCUS_06670 gene gltX 2961 4385 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958261.1 protein_id gnl|my_center|LOCUS_06670 4407 5795 gene locus_tag LOCUS_06680 gene cysS 4407 5795 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267207.1 protein_id gnl|my_center|LOCUS_06680 8099 5838 gene locus_tag LOCUS_06690 8099 5838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 8299 9252 gene locus_tag LOCUS_06700 gene rluC 8299 9252 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705035.1 protein_id gnl|my_center|LOCUS_06700 9567 12704 gene locus_tag LOCUS_06710 9567 12704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 13547 12750 gene locus_tag LOCUS_06720 13547 12750 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958026.1 protein_id gnl|my_center|LOCUS_06720 13602 14390 gene locus_tag LOCUS_06730 gene trmJ 13602 14390 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771034.1 protein_id gnl|my_center|LOCUS_06730 14435 15184 gene locus_tag LOCUS_06740 gene cysE 14435 15184 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072274.1 protein_id gnl|my_center|LOCUS_06740 15231 15719 gene locus_tag LOCUS_06750 gene iscR 15231 15719 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005659892.1 protein_id gnl|my_center|LOCUS_06750 15729 17003 gene locus_tag LOCUS_06760 15729 17003 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524724.1 protein_id gnl|my_center|LOCUS_06760 17028 17459 gene locus_tag LOCUS_06770 gene iscU 17028 17459 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213175.1 protein_id gnl|my_center|LOCUS_06770 17469 17792 gene locus_tag LOCUS_06780 gene iscA 17469 17792 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550200.1 protein_id gnl|my_center|LOCUS_06780 17792 18409 gene locus_tag LOCUS_06790 gene hscB 17792 18409 CDS product Fe-S protein assembly co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202016.1 protein_id gnl|my_center|LOCUS_06790 18490 20358 gene locus_tag LOCUS_06800 gene hscA 18490 20358 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938156.1 protein_id gnl|my_center|LOCUS_06800 >Feature sequence021 432 348 gene locus_tag LOCUS_t00170 432 348 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 486 1112 gene locus_tag LOCUS_06810 486 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195097.1 protein_id gnl|my_center|LOCUS_06810 2203 1127 gene locus_tag LOCUS_06820 2203 1127 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103575.1 protein_id gnl|my_center|LOCUS_06820 2928 2200 gene locus_tag LOCUS_06830 2928 2200 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057263.1 protein_id gnl|my_center|LOCUS_06830 3604 2987 gene locus_tag LOCUS_06840 3604 2987 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532404.1 protein_id gnl|my_center|LOCUS_06840 4592 3765 gene locus_tag LOCUS_06850 gene nadC 4592 3765 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770545.1 protein_id gnl|my_center|LOCUS_06850 5938 4589 gene locus_tag LOCUS_06860 gene nhaA 5938 4589 CDS product sodium/proton antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049644.1 protein_id gnl|my_center|LOCUS_06860 8773 5957 gene locus_tag LOCUS_06870 8773 5957 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266818.1 protein_id gnl|my_center|LOCUS_06870 9367 8786 gene locus_tag LOCUS_06880 9367 8786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 9807 9382 gene locus_tag LOCUS_06890 9807 9382 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209309.1 protein_id gnl|my_center|LOCUS_06890 11322 9820 gene locus_tag LOCUS_06900 11322 9820 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266820.1 protein_id gnl|my_center|LOCUS_06900 11439 12560 gene locus_tag LOCUS_06910 gene lptF 11439 12560 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192178.1 protein_id gnl|my_center|LOCUS_06910 12557 13630 gene locus_tag LOCUS_06920 gene lptG 12557 13630 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212823.1 protein_id gnl|my_center|LOCUS_06920 13967 13623 gene locus_tag LOCUS_06930 13967 13623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 14614 13982 gene locus_tag LOCUS_06940 14614 13982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 15135 14683 gene locus_tag LOCUS_06950 15135 14683 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161960933.1 protein_id gnl|my_center|LOCUS_06950 15454 15140 gene locus_tag LOCUS_06960 gene cyaY 15454 15140 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005953.1 protein_id gnl|my_center|LOCUS_06960 17339 15543 gene locus_tag LOCUS_06970 gene recQ 17339 15543 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091724.1 protein_id gnl|my_center|LOCUS_06970 18181 17342 gene locus_tag LOCUS_06980 18181 17342 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522249.1 protein_id gnl|my_center|LOCUS_06980 18553 18185 gene locus_tag LOCUS_06990 18553 18185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 18822 19625 gene locus_tag LOCUS_07000 18822 19625 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903162.1 protein_id gnl|my_center|LOCUS_07000 >Feature sequence022 676 2469 gene locus_tag LOCUS_07010 676 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 2469 4547 gene locus_tag LOCUS_07020 2469 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 5757 5554 gene locus_tag LOCUS_07030 5757 5554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 6039 5782 gene locus_tag LOCUS_07040 6039 5782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 6007 10302 gene locus_tag LOCUS_07050 6007 10302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187336415.1 protein_id gnl|my_center|LOCUS_07050 10868 10299 gene locus_tag LOCUS_07060 10868 10299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 12239 11664 gene locus_tag LOCUS_07070 12239 11664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 12935 12672 gene locus_tag LOCUS_07080 12935 12672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 13458 15050 gene locus_tag LOCUS_07090 gene istA 13458 15050 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917171.1 protein_id gnl|my_center|LOCUS_07090 15090 15854 gene locus_tag LOCUS_07100 gene istB 15090 15854 CDS product IS21-like element IS21 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544830.1 protein_id gnl|my_center|LOCUS_07100 16864 16499 gene locus_tag LOCUS_07110 gene mazF 16864 16499 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392535.1 protein_id gnl|my_center|LOCUS_07110 17124 16864 gene locus_tag LOCUS_07120 17124 16864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 17871 17479 gene locus_tag LOCUS_07130 17871 17479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 18110 17868 gene locus_tag LOCUS_07140 18110 17868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 18500 19378 gene locus_tag LOCUS_07150 18500 19378 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035961988.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07150 19755 19333 gene locus_tag LOCUS_07160 19755 19333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 >Feature sequence023 <1 1121 gene locus_tag LOCUS_07170 <1 1121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957549.1:isoleucine--tRNA ligase 1121 1579 gene locus_tag LOCUS_07180 gene lspA 1121 1579 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266581.1 protein_id gnl|my_center|LOCUS_07180 1753 2043 gene locus_tag LOCUS_07190 1753 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 2865 2119 gene locus_tag LOCUS_07200 2865 2119 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142151.1 protein_id gnl|my_center|LOCUS_07200 3437 2862 gene locus_tag LOCUS_07210 3437 2862 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122936.1 protein_id gnl|my_center|LOCUS_07210 5188 3506 gene locus_tag LOCUS_07220 5188 3506 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090269.1 protein_id gnl|my_center|LOCUS_07220 5396 5878 gene locus_tag LOCUS_07230 5396 5878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 6693 5863 gene locus_tag LOCUS_07240 6693 5863 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946685.1 protein_id gnl|my_center|LOCUS_07240 10388 6690 gene locus_tag LOCUS_07250 10388 6690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 10650 13514 gene locus_tag LOCUS_07260 gene glnE 10650 13514 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056837.1 protein_id gnl|my_center|LOCUS_07260 13527 14450 gene locus_tag LOCUS_07270 gene ilvE 13527 14450 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095783.1 protein_id gnl|my_center|LOCUS_07270 14455 14667 gene locus_tag LOCUS_07280 14455 14667 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958359.1 protein_id gnl|my_center|LOCUS_07280 16480 14687 gene locus_tag LOCUS_07290 gene dsbD 16480 14687 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064751.1 protein_id gnl|my_center|LOCUS_07290 16852 16673 gene locus_tag LOCUS_07300 16852 16673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 17087 16875 gene locus_tag LOCUS_07310 17087 16875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 17040 17681 gene locus_tag LOCUS_07320 17040 17681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 17809 18099 gene locus_tag LOCUS_07330 gene groES 17809 18099 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946424.1 protein_id gnl|my_center|LOCUS_07330 >Feature sequence024 165 809 gene locus_tag LOCUS_07340 165 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 930 939 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 951 2177 gene locus_tag LOCUS_07350 951 2177 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085971.1 protein_id gnl|my_center|LOCUS_07350 2177 3343 gene locus_tag LOCUS_07360 2177 3343 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948653.1 protein_id gnl|my_center|LOCUS_07360 3340 4275 gene locus_tag LOCUS_07370 gene argF 3340 4275 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104892.1 protein_id gnl|my_center|LOCUS_07370 4279 5478 gene locus_tag LOCUS_07380 4279 5478 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_07380 5557 5964 gene locus_tag LOCUS_07390 gene gloA 5557 5964 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814410.1 protein_id gnl|my_center|LOCUS_07390 6764 6036 gene locus_tag LOCUS_07400 gene dnaQ 6764 6036 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957503.1 protein_id gnl|my_center|LOCUS_07400 7231 6755 gene locus_tag LOCUS_07410 gene rnhA 7231 6755 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368579.1 protein_id gnl|my_center|LOCUS_07410 8013 7213 gene locus_tag LOCUS_07420 8013 7213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 8122 8874 gene locus_tag LOCUS_07430 gene gloB 8122 8874 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262416.1 protein_id gnl|my_center|LOCUS_07430 10067 8877 gene locus_tag LOCUS_07440 10067 8877 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414119.1 protein_id gnl|my_center|LOCUS_07440 12322 10244 gene locus_tag LOCUS_07450 gene pnp 12322 10244 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526459.1 protein_id gnl|my_center|LOCUS_07450 12602 12333 gene locus_tag LOCUS_07460 gene rpsO 12602 12333 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111957.1 protein_id gnl|my_center|LOCUS_07460 13523 12639 gene locus_tag LOCUS_07470 gene truB 13523 12639 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100522.1 protein_id gnl|my_center|LOCUS_07470 13912 13520 gene locus_tag LOCUS_07480 gene rbfA 13912 13520 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948461.1 protein_id gnl|my_center|LOCUS_07480 16549 13919 gene locus_tag LOCUS_07490 16549 13919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 18090 16609 gene locus_tag LOCUS_07500 gene nusA 18090 16609 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620402.1 protein_id gnl|my_center|LOCUS_07500 18583 18122 gene locus_tag LOCUS_07510 gene rimP 18583 18122 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005657488.1 protein_id gnl|my_center|LOCUS_07510 18816 18706 gene locus_tag LOCUS_r00010 18816 18706 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence025 758 9 gene locus_tag LOCUS_07520 758 9 CDS product redoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694168.1 protein_id gnl|my_center|LOCUS_07520 1969 851 gene locus_tag LOCUS_07530 gene serB 1969 851 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813898.1 protein_id gnl|my_center|LOCUS_07530 5415 1972 gene locus_tag LOCUS_07540 gene mfd 5415 1972 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113980.1 protein_id gnl|my_center|LOCUS_07540 5571 6284 gene locus_tag LOCUS_07550 gene ispD 5571 6284 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406223.1 protein_id gnl|my_center|LOCUS_07550 6290 6769 gene locus_tag LOCUS_07560 gene ispF 6290 6769 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_07560 6762 7850 gene locus_tag LOCUS_07570 gene truD 6762 7850 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036881.1 protein_id gnl|my_center|LOCUS_07570 7914 8405 gene locus_tag LOCUS_07580 gene cueR 7914 8405 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613681.1 protein_id gnl|my_center|LOCUS_07580 9002 8427 gene locus_tag LOCUS_07590 9002 8427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 9975 9007 gene locus_tag LOCUS_07600 gene trxB 9975 9007 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941156.1 protein_id gnl|my_center|LOCUS_07600 10346 12511 gene locus_tag LOCUS_07610 10346 12511 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037136.1 protein_id gnl|my_center|LOCUS_07610 12483 13175 gene locus_tag LOCUS_07620 gene lolA 12483 13175 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090414.1 protein_id gnl|my_center|LOCUS_07620 13194 14261 gene locus_tag LOCUS_07630 13194 14261 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262117.1 protein_id gnl|my_center|LOCUS_07630 14289 15620 gene locus_tag LOCUS_07640 14289 15620 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958061.1 protein_id gnl|my_center|LOCUS_07640 15613 16878 gene locus_tag LOCUS_07650 gene serS 15613 16878 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704878.1 protein_id gnl|my_center|LOCUS_07650 16883 17116 gene locus_tag LOCUS_07660 16883 17116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 17113 18156 gene locus_tag LOCUS_07670 17113 18156 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103925.1 protein_id gnl|my_center|LOCUS_07670 18315 18391 gene locus_tag LOCUS_t00180 18315 18391 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 18689 18438 gene locus_tag LOCUS_07680 18689 18438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 >Feature sequence026 2 262 gene locus_tag LOCUS_07690 2 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 444 746 gene locus_tag LOCUS_07700 444 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 1141 812 gene locus_tag LOCUS_07710 1141 812 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947715.1 protein_id gnl|my_center|LOCUS_07710 1315 1929 gene locus_tag LOCUS_07720 1315 1929 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703367.1 protein_id gnl|my_center|LOCUS_07720 2540 1968 gene locus_tag LOCUS_07730 gene ampD 2540 1968 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112844.1 protein_id gnl|my_center|LOCUS_07730 2872 2537 gene locus_tag LOCUS_07740 2872 2537 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122849.1 protein_id gnl|my_center|LOCUS_07740 4491 2950 gene locus_tag LOCUS_07750 4491 2950 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522419.1 protein_id gnl|my_center|LOCUS_07750 4691 4488 gene locus_tag LOCUS_07760 4691 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 5951 5079 gene locus_tag LOCUS_07770 5951 5079 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085368.1 protein_id gnl|my_center|LOCUS_07770 6929 6111 gene locus_tag LOCUS_07780 gene metF 6929 6111 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807199.1 protein_id gnl|my_center|LOCUS_07780 8335 6929 gene locus_tag LOCUS_07790 gene ahcY 8335 6929 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099900.1 protein_id gnl|my_center|LOCUS_07790 9693 8524 gene locus_tag LOCUS_07800 gene metK 9693 8524 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225644.1 protein_id gnl|my_center|LOCUS_07800 10441 9836 gene locus_tag LOCUS_07810 10441 9836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 10564 11505 gene locus_tag LOCUS_07820 10564 11505 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522039.1 protein_id gnl|my_center|LOCUS_07820 11904 11518 gene locus_tag LOCUS_07830 11904 11518 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012501288.1 protein_id gnl|my_center|LOCUS_07830 12353 11904 gene locus_tag LOCUS_07840 12353 11904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 12497 14983 gene locus_tag LOCUS_07850 12497 14983 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121835.1 protein_id gnl|my_center|LOCUS_07850 15051 16580 gene locus_tag LOCUS_07860 gene gpmM 15051 16580 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043126577.1 protein_id gnl|my_center|LOCUS_07860 16584 17966 gene locus_tag LOCUS_07870 16584 17966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 >Feature sequence027 220 585 gene locus_tag LOCUS_07880 220 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 1114 623 gene locus_tag LOCUS_07890 1114 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 1442 1645 gene locus_tag LOCUS_07900 1442 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 2316 2056 gene locus_tag LOCUS_07910 2316 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 3194 3634 gene locus_tag LOCUS_07920 3194 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 5345 6364 gene locus_tag LOCUS_07930 5345 6364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 7058 6390 gene locus_tag LOCUS_07940 gene hflD 7058 6390 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295971.1 protein_id gnl|my_center|LOCUS_07940 9732 7132 gene locus_tag LOCUS_07950 gene glnD 9732 7132 CDS product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479040.1 protein_id gnl|my_center|LOCUS_07950 10544 9735 gene locus_tag LOCUS_07960 gene map 10544 9735 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947446.1 protein_id gnl|my_center|LOCUS_07960 11261 10563 gene locus_tag LOCUS_07970 gene sfsA 11261 10563 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943351.1 protein_id gnl|my_center|LOCUS_07970 12163 11288 gene locus_tag LOCUS_07980 gene gluQRS 12163 11288 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941983.1 protein_id gnl|my_center|LOCUS_07980 12225 13247 gene locus_tag LOCUS_07990 gene thiL 12225 13247 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035938.1 protein_id gnl|my_center|LOCUS_07990 13237 13722 gene locus_tag LOCUS_08000 gene pgpA 13237 13722 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283269.1 protein_id gnl|my_center|LOCUS_08000 13737 14576 gene locus_tag LOCUS_08010 13737 14576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 14778 15815 gene locus_tag LOCUS_08020 gene recA 14778 15815 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947527.1 protein_id gnl|my_center|LOCUS_08020 15816 16268 gene locus_tag LOCUS_08030 gene recX 15816 16268 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098485.1 protein_id gnl|my_center|LOCUS_08030 >Feature sequence028 284 1162 gene locus_tag LOCUS_08040 gene bioC 284 1162 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035637.1 protein_id gnl|my_center|LOCUS_08040 1159 1863 gene locus_tag LOCUS_08050 gene bioD 1159 1863 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203536601.1 protein_id gnl|my_center|LOCUS_08050 1982 2878 gene locus_tag LOCUS_08060 gene htpX 1982 2878 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219495.1 protein_id gnl|my_center|LOCUS_08060 2929 3648 gene locus_tag LOCUS_08070 gene aat 2929 3648 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767399.1 protein_id gnl|my_center|LOCUS_08070 3651 4361 gene locus_tag LOCUS_08080 3651 4361 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039188.1 protein_id gnl|my_center|LOCUS_08080 4358 5137 gene locus_tag LOCUS_08090 gene fetB 4358 5137 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012390.1 protein_id gnl|my_center|LOCUS_08090 5145 5750 gene locus_tag LOCUS_08100 gene rnt 5145 5750 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282281.1 protein_id gnl|my_center|LOCUS_08100 5823 6839 gene locus_tag LOCUS_08110 5823 6839 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_08110 6902 7270 gene locus_tag LOCUS_08120 6902 7270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 7660 7364 gene locus_tag LOCUS_08130 7660 7364 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255008.1 protein_id gnl|my_center|LOCUS_08130 8606 7668 gene locus_tag LOCUS_08140 8606 7668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 8796 9443 gene locus_tag LOCUS_08150 8796 9443 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393814.1 protein_id gnl|my_center|LOCUS_08150 9440 10303 gene locus_tag LOCUS_08160 gene argB 9440 10303 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096572.1 protein_id gnl|my_center|LOCUS_08160 11326 10313 gene locus_tag LOCUS_08170 11326 10313 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021579.1 protein_id gnl|my_center|LOCUS_08170 11564 12133 gene locus_tag LOCUS_08180 11564 12133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 13125 12175 gene locus_tag LOCUS_08190 gene bioB 13125 12175 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329308.1 protein_id gnl|my_center|LOCUS_08190 13472 13122 gene locus_tag LOCUS_08200 13472 13122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 13778 13500 gene locus_tag LOCUS_08210 13778 13500 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941530.1 protein_id gnl|my_center|LOCUS_08210 14602 13775 gene locus_tag LOCUS_08220 gene proC 14602 13775 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275316.1 protein_id gnl|my_center|LOCUS_08220 15270 14599 gene locus_tag LOCUS_08230 15270 14599 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266427.1 protein_id gnl|my_center|LOCUS_08230 15371 16420 gene locus_tag LOCUS_08240 15371 16420 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073221.1 protein_id gnl|my_center|LOCUS_08240 16430 17560 gene locus_tag LOCUS_08250 gene pilU 16430 17560 CDS product type IV pilus ATPase PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_08250 >Feature sequence029 1932 1627 gene locus_tag LOCUS_08260 1932 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 2463 2074 gene locus_tag LOCUS_08270 2463 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 4010 2463 gene locus_tag LOCUS_08280 4010 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 4240 4022 gene locus_tag LOCUS_08290 4240 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 4490 4329 gene locus_tag LOCUS_08300 4490 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 6191 4581 gene locus_tag LOCUS_08310 6191 4581 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368514.1 protein_id gnl|my_center|LOCUS_08310 6549 7107 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttcccatccacactcatgcggcacaca 7148 7327 gene locus_tag LOCUS_08320 7148 7327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 8214 7399 gene locus_tag LOCUS_08330 8214 7399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 8895 8218 gene locus_tag LOCUS_08340 8895 8218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 9785 8892 gene locus_tag LOCUS_08350 9785 8892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 10744 9818 gene locus_tag LOCUS_08360 10744 9818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 11343 11086 gene locus_tag LOCUS_08370 11343 11086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 12020 11346 gene locus_tag LOCUS_08380 12020 11346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 12623 12033 gene locus_tag LOCUS_08390 12623 12033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 13513 12620 gene locus_tag LOCUS_08400 13513 12620 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328117.1 protein_id gnl|my_center|LOCUS_08400 13769 13521 gene locus_tag LOCUS_08410 13769 13521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 14317 13796 gene locus_tag LOCUS_08420 14317 13796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 14489 14331 gene locus_tag LOCUS_08430 14489 14331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 15355 14486 gene locus_tag LOCUS_08440 15355 14486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 15633 15355 gene locus_tag LOCUS_08450 15633 15355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 16008 15703 gene locus_tag LOCUS_08460 16008 15703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 16328 16113 gene locus_tag LOCUS_08470 16328 16113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 <17492 16370 gene locus_tag LOCUS_08480 <17492 16370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071541498.1:type I DNA topoisomerase >Feature sequence030 214 2229 gene locus_tag LOCUS_08490 214 2229 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104754.1 protein_id gnl|my_center|LOCUS_08490 2683 2255 gene locus_tag LOCUS_08500 2683 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 3114 2686 gene locus_tag LOCUS_08510 3114 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 4658 3384 gene locus_tag LOCUS_08520 4658 3384 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011381770.1 protein_id gnl|my_center|LOCUS_08520 4263 4325 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5650 4664 gene locus_tag LOCUS_08530 5650 4664 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 protein_id gnl|my_center|LOCUS_08530 6153 5647 gene locus_tag LOCUS_08540 gene pyrR 6153 5647 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084574.1 protein_id gnl|my_center|LOCUS_08540 6581 6150 gene locus_tag LOCUS_08550 gene ruvX 6581 6150 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706124.1 protein_id gnl|my_center|LOCUS_08550 7194 6574 gene locus_tag LOCUS_08560 7194 6574 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461717.1 protein_id gnl|my_center|LOCUS_08560 8140 7202 gene locus_tag LOCUS_08570 gene gshB 8140 7202 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330771.1 protein_id gnl|my_center|LOCUS_08570 9447 8137 gene locus_tag LOCUS_08580 gene gshA 9447 8137 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947573.1 protein_id gnl|my_center|LOCUS_08580 10616 9444 gene locus_tag LOCUS_08590 10616 9444 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143005.1 protein_id gnl|my_center|LOCUS_08590 11134 10763 gene locus_tag LOCUS_08600 gene erpA 11134 10763 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551953.1 protein_id gnl|my_center|LOCUS_08600 14223 11287 gene locus_tag LOCUS_08610 14223 11287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 15308 14328 gene locus_tag LOCUS_08620 15308 14328 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943073.1 protein_id gnl|my_center|LOCUS_08620 16282 15296 gene locus_tag LOCUS_08630 gene pdhA 16282 15296 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943082.1 protein_id gnl|my_center|LOCUS_08630 >Feature sequence031 1 2352 gene locus_tag LOCUS_08640 gene feoB 1 2352 CDS product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390223.1 protein_id gnl|my_center|LOCUS_08640 2349 2714 gene locus_tag LOCUS_08650 2349 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 2818 3690 gene locus_tag LOCUS_08660 gene aguB 2818 3690 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111119.1 protein_id gnl|my_center|LOCUS_08660 3683 4507 gene locus_tag LOCUS_08670 3683 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 5075 4425 gene locus_tag LOCUS_08680 5075 4425 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770132.1 protein_id gnl|my_center|LOCUS_08680 5460 5104 gene locus_tag LOCUS_08690 5460 5104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 6209 5457 gene locus_tag LOCUS_08700 6209 5457 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003708379.1 protein_id gnl|my_center|LOCUS_08700 7137 6211 gene locus_tag LOCUS_08710 7137 6211 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_08710 7223 7825 gene locus_tag LOCUS_08720 7223 7825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 8992 7847 gene locus_tag LOCUS_08730 8992 7847 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902155.1 protein_id gnl|my_center|LOCUS_08730 10203 8989 gene locus_tag LOCUS_08740 10203 8989 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880636.1 protein_id gnl|my_center|LOCUS_08740 12695 10200 gene locus_tag LOCUS_08750 12695 10200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 13535 12705 gene locus_tag LOCUS_08760 13535 12705 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338148.1 protein_id gnl|my_center|LOCUS_08760 13933 13532 gene locus_tag LOCUS_08770 13933 13532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 14059 14382 gene locus_tag LOCUS_08780 14059 14382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 14818 14441 gene locus_tag LOCUS_08790 14818 14441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 15877 14870 gene locus_tag LOCUS_08800 15877 14870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 16272 15922 gene locus_tag LOCUS_08810 16272 15922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 >Feature sequence032 452 285 gene locus_tag LOCUS_08820 452 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 697 452 gene locus_tag LOCUS_08830 697 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 795 1316 gene locus_tag LOCUS_08840 795 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 1316 1606 gene locus_tag LOCUS_08850 1316 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 1603 1794 gene locus_tag LOCUS_08860 1603 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 1791 2093 gene locus_tag LOCUS_08870 1791 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 2489 3913 gene locus_tag LOCUS_08880 2489 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 4139 4414 gene locus_tag LOCUS_08890 4139 4414 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476580.1 protein_id gnl|my_center|LOCUS_08890 4455 4592 gene locus_tag LOCUS_08900 4455 4592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 4571 5185 gene locus_tag LOCUS_08910 4571 5185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 5185 5409 gene locus_tag LOCUS_08920 5185 5409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 5585 7300 gene locus_tag LOCUS_08930 5585 7300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 7311 7577 gene locus_tag LOCUS_08940 7311 7577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 7570 7944 gene locus_tag LOCUS_08950 7570 7944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 8525 8938 gene locus_tag LOCUS_08960 8525 8938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 8931 9254 gene locus_tag LOCUS_08970 8931 9254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 9259 9705 gene locus_tag LOCUS_08980 9259 9705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 9699 10001 gene locus_tag LOCUS_08990 9699 10001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 10141 10698 gene locus_tag LOCUS_09000 10141 10698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 10727 10981 gene locus_tag LOCUS_09010 10727 10981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 10978 11181 gene locus_tag LOCUS_09020 10978 11181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 11296 11496 gene locus_tag LOCUS_09030 11296 11496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 11493 13322 gene locus_tag LOCUS_09040 gene ligA 11493 13322 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674370.1 protein_id gnl|my_center|LOCUS_09040 13323 14009 gene locus_tag LOCUS_09050 13323 14009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 14193 14453 gene locus_tag LOCUS_09060 14193 14453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 14830 15945 gene locus_tag LOCUS_09070 14830 15945 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063891.1 protein_id gnl|my_center|LOCUS_09070 >Feature sequence033 1956 244 gene locus_tag LOCUS_09080 gene ptsP 1956 244 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816751.1 protein_id gnl|my_center|LOCUS_09080 2231 1953 gene locus_tag LOCUS_09090 2231 1953 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198013.1 protein_id gnl|my_center|LOCUS_09090 2679 2257 gene locus_tag LOCUS_09100 2679 2257 CDS product PTS mannose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812601.1 protein_id gnl|my_center|LOCUS_09100 3575 2676 gene locus_tag LOCUS_09110 gene rapZ 3575 2676 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268862.1 protein_id gnl|my_center|LOCUS_09110 4507 3575 gene locus_tag LOCUS_09120 gene hprK 4507 3575 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929965.1 protein_id gnl|my_center|LOCUS_09120 5008 4562 gene locus_tag LOCUS_09130 gene ptsN 5008 4562 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534308.1 protein_id gnl|my_center|LOCUS_09130 5356 5015 gene locus_tag LOCUS_09140 gene raiA 5356 5015 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021962.1 protein_id gnl|my_center|LOCUS_09140 6895 5468 gene locus_tag LOCUS_09150 gene rpoN 6895 5468 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174257.1 protein_id gnl|my_center|LOCUS_09150 7633 6908 gene locus_tag LOCUS_09160 gene lptB 7633 6908 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073698.1 protein_id gnl|my_center|LOCUS_09160 8160 7630 gene locus_tag LOCUS_09170 8160 7630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 8719 8150 gene locus_tag LOCUS_09180 8719 8150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 9299 8745 gene locus_tag LOCUS_09190 9299 8745 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942537.1 protein_id gnl|my_center|LOCUS_09190 10282 9296 gene locus_tag LOCUS_09200 10282 9296 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037924.1 protein_id gnl|my_center|LOCUS_09200 10570 10292 gene locus_tag LOCUS_09210 10570 10292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 11036 10602 gene locus_tag LOCUS_09220 11036 10602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 11715 11026 gene locus_tag LOCUS_09230 11715 11026 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704884.1 protein_id gnl|my_center|LOCUS_09230 12716 11688 gene locus_tag LOCUS_09240 12716 11688 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444878.1 protein_id gnl|my_center|LOCUS_09240 12746 14938 gene locus_tag LOCUS_09250 12746 14938 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003698952.1 protein_id gnl|my_center|LOCUS_09250 >Feature sequence034 335 27 gene locus_tag LOCUS_09260 335 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 402 734 gene locus_tag LOCUS_09270 402 734 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483459.1 protein_id gnl|my_center|LOCUS_09270 1085 894 gene locus_tag LOCUS_09280 1085 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 1626 1372 gene locus_tag LOCUS_09290 1626 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 2335 2120 gene locus_tag LOCUS_09300 2335 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 3081 2680 gene locus_tag LOCUS_09310 3081 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 3381 3103 gene locus_tag LOCUS_09320 3381 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09320 4412 3774 gene locus_tag LOCUS_09330 4412 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 5146 4433 gene locus_tag LOCUS_09340 gene stbB 5146 4433 CDS product StbB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011264012.1 protein_id gnl|my_center|LOCUS_09340 5499 5152 gene locus_tag LOCUS_09350 5499 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 6235 5579 gene locus_tag LOCUS_09360 6235 5579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 6719 6291 gene locus_tag LOCUS_09370 6719 6291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 7737 7321 gene locus_tag LOCUS_09380 7737 7321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 9136 8141 gene locus_tag LOCUS_09390 9136 8141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 9832 9614 gene locus_tag LOCUS_09400 9832 9614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 10175 10648 gene locus_tag LOCUS_09410 10175 10648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 11716 10763 gene locus_tag LOCUS_09420 11716 10763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 11904 12113 gene locus_tag LOCUS_09430 11904 12113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 12106 14559 gene locus_tag LOCUS_09440 12106 14559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 14556 15044 gene locus_tag LOCUS_09450 14556 15044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 15229 15140 gene locus_tag LOCUS_t00190 15229 15140 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 <15929 15240 gene locus_tag LOCUS_09460 <15929 15240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004550744.1:ATP-binding cassette domain-containing protein >Feature sequence035 261 270 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 920 845 gene locus_tag LOCUS_t00200 920 845 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1069 1518 gene locus_tag LOCUS_09470 gene secB 1069 1518 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687381.1 protein_id gnl|my_center|LOCUS_09470 1522 2550 gene locus_tag LOCUS_09480 1522 2550 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460199.1 protein_id gnl|my_center|LOCUS_09480 2692 3735 gene locus_tag LOCUS_09490 2692 3735 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289210.1 protein_id gnl|my_center|LOCUS_09490 3732 5663 gene locus_tag LOCUS_09500 gene shc 3732 5663 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387823.1 protein_id gnl|my_center|LOCUS_09500 5645 6355 gene locus_tag LOCUS_09510 5645 6355 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204721.1 protein_id gnl|my_center|LOCUS_09510 6352 7341 gene locus_tag LOCUS_09520 6352 7341 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387819.1 protein_id gnl|my_center|LOCUS_09520 7381 8538 gene locus_tag LOCUS_09530 gene hpnI 7381 8538 CDS product bacteriohopanetetrol glucosamine biosynthesis glycosyltransferase HpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527445.1 protein_id gnl|my_center|LOCUS_09530 8538 9968 gene locus_tag LOCUS_09540 gene hpnJ 8538 9968 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196953.1 protein_id gnl|my_center|LOCUS_09540 9970 10845 gene locus_tag LOCUS_09550 gene hpnK 9970 10845 CDS product hopanoid biosynthesis-associated protein HpnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192157.1 protein_id gnl|my_center|LOCUS_09550 10823 13528 gene locus_tag LOCUS_09560 10823 13528 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387818.1 protein_id gnl|my_center|LOCUS_09560 13515 14552 gene locus_tag LOCUS_09570 13515 14552 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539843.1 protein_id gnl|my_center|LOCUS_09570 >Feature sequence036 48 386 gene locus_tag LOCUS_09580 gene tnpB 48 386 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529308.1 protein_id gnl|my_center|LOCUS_09580 405 1040 gene locus_tag LOCUS_09590 405 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 1927 1757 gene locus_tag LOCUS_09600 1927 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 4767 1939 gene locus_tag LOCUS_09610 4767 1939 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968623.1 protein_id gnl|my_center|LOCUS_09610 7682 4782 gene locus_tag LOCUS_09620 7682 4782 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 protein_id gnl|my_center|LOCUS_09620 8404 7670 gene locus_tag LOCUS_09630 8404 7670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 9771 8404 gene locus_tag LOCUS_09640 9771 8404 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968626.1 protein_id gnl|my_center|LOCUS_09640 13289 9759 gene locus_tag LOCUS_09650 13289 9759 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968627.1 protein_id gnl|my_center|LOCUS_09650 >Feature sequence037 923 2461 gene locus_tag LOCUS_09660 923 2461 CDS product glucan biosynthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925635.1 protein_id gnl|my_center|LOCUS_09660 3063 2488 gene locus_tag LOCUS_09670 3063 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 3788 3363 gene locus_tag LOCUS_09680 gene msrB 3788 3363 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920044.1 protein_id gnl|my_center|LOCUS_09680 4390 3803 gene locus_tag LOCUS_09690 gene msrA 4390 3803 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089780.1 protein_id gnl|my_center|LOCUS_09690 4564 5472 gene locus_tag LOCUS_09700 4564 5472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 5544 6200 gene locus_tag LOCUS_09710 gene nadD 5544 6200 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707025.1 protein_id gnl|my_center|LOCUS_09710 6224 6580 gene locus_tag LOCUS_09720 gene rsfS 6224 6580 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100305.1 protein_id gnl|my_center|LOCUS_09720 6587 7060 gene locus_tag LOCUS_09730 gene rlmH 6587 7060 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261456.1 protein_id gnl|my_center|LOCUS_09730 7068 7502 gene locus_tag LOCUS_09740 7068 7502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 7499 8347 gene locus_tag LOCUS_09750 7499 8347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 8344 8931 gene locus_tag LOCUS_09760 8344 8931 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268868.1 protein_id gnl|my_center|LOCUS_09760 8928 10418 gene locus_tag LOCUS_09770 gene rng 8928 10418 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_09770 14404 10475 gene locus_tag LOCUS_09780 14404 10475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 15209 15006 gene locus_tag LOCUS_09790 15209 15006 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812875.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence038 <1 707 gene locus_tag LOCUS_09800 <1 707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005770511.1:aminomethyl-transferring glycine dehydrogenase subunit GcvPA 704 2134 gene locus_tag LOCUS_09810 gene gcvPB 704 2134 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958389.1 protein_id gnl|my_center|LOCUS_09810 2131 3039 gene locus_tag LOCUS_09820 2131 3039 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_09820 3036 4037 gene locus_tag LOCUS_09830 3036 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 4037 6052 gene locus_tag LOCUS_09840 4037 6052 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036209.1 protein_id gnl|my_center|LOCUS_09840 7761 6073 gene locus_tag LOCUS_09850 gene msbA 7761 6073 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_09850 8081 7758 gene locus_tag LOCUS_09860 8081 7758 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947640.1 protein_id gnl|my_center|LOCUS_09860 8296 8898 gene locus_tag LOCUS_09870 8296 8898 CDS product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705411.1 protein_id gnl|my_center|LOCUS_09870 9718 8993 gene locus_tag LOCUS_09880 9718 8993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 9822 10682 gene locus_tag LOCUS_09890 9822 10682 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816844.1 protein_id gnl|my_center|LOCUS_09890 10787 11824 gene locus_tag LOCUS_09900 10787 11824 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970504.1 protein_id gnl|my_center|LOCUS_09900 11913 12311 gene locus_tag LOCUS_09910 11913 12311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 12365 12835 gene locus_tag LOCUS_09920 12365 12835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 12828 13613 gene locus_tag LOCUS_09930 gene rlmB 12828 13613 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704663.1 protein_id gnl|my_center|LOCUS_09930 13618 14391 gene locus_tag LOCUS_09940 13618 14391 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448020.1 protein_id gnl|my_center|LOCUS_09940 14388 15146 gene locus_tag LOCUS_09950 14388 15146 CDS product GPMC system MBL fold metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943103.1 protein_id gnl|my_center|LOCUS_09950 15224 15299 gene locus_tag LOCUS_t00210 15224 15299 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence039 644 1429 gene locus_tag LOCUS_09960 644 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 2064 1426 gene locus_tag LOCUS_09970 2064 1426 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634004.1 protein_id gnl|my_center|LOCUS_09970 2918 2076 gene locus_tag LOCUS_09980 2918 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 4264 2960 gene locus_tag LOCUS_09990 4264 2960 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258704.1 protein_id gnl|my_center|LOCUS_09990 6090 4261 gene locus_tag LOCUS_10000 6090 4261 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141069.1 protein_id gnl|my_center|LOCUS_10000 7388 6090 gene locus_tag LOCUS_10010 7388 6090 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803855.1 protein_id gnl|my_center|LOCUS_10010 8593 7331 gene locus_tag LOCUS_10020 8593 7331 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083269077.1 protein_id gnl|my_center|LOCUS_10020 10008 8590 gene locus_tag LOCUS_10030 10008 8590 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928673.1 protein_id gnl|my_center|LOCUS_10030 10716 11546 gene locus_tag LOCUS_10040 10716 11546 CDS product DUF6502 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966857.1 protein_id gnl|my_center|LOCUS_10040 11539 12696 gene locus_tag LOCUS_10050 11539 12696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 13515 12727 gene locus_tag LOCUS_10060 13515 12727 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003586552.1 protein_id gnl|my_center|LOCUS_10060 14424 13519 gene locus_tag LOCUS_10070 14424 13519 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200770.1 protein_id gnl|my_center|LOCUS_10070 15253 14429 gene locus_tag LOCUS_10080 15253 14429 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189439.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence040 <1 1018 gene locus_tag LOCUS_10090 <1 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112740.1:metalloprotease PmbA 2507 954 gene locus_tag LOCUS_10100 gene lnt 2507 954 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268977.1 protein_id gnl|my_center|LOCUS_10100 3388 2504 gene locus_tag LOCUS_10110 3388 2504 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 protein_id gnl|my_center|LOCUS_10110 3878 3381 gene locus_tag LOCUS_10120 gene ybeY 3878 3381 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021208.1 protein_id gnl|my_center|LOCUS_10120 4858 3875 gene locus_tag LOCUS_10130 4858 3875 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093159.1 protein_id gnl|my_center|LOCUS_10130 6218 4863 gene locus_tag LOCUS_10140 gene miaB 6218 4863 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771098.1 protein_id gnl|my_center|LOCUS_10140 6436 7020 gene locus_tag LOCUS_10150 6436 7020 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007598495.1 protein_id gnl|my_center|LOCUS_10150 7055 7642 gene locus_tag LOCUS_10160 7055 7642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 7642 8544 gene locus_tag LOCUS_10170 gene ubiA 7642 8544 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035644.1 protein_id gnl|my_center|LOCUS_10170 8812 10974 gene locus_tag LOCUS_10180 8812 10974 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095847.1 protein_id gnl|my_center|LOCUS_10180 11078 11281 gene locus_tag LOCUS_10190 11078 11281 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_10190 13210 11381 gene locus_tag LOCUS_10200 13210 11381 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037772.1 protein_id gnl|my_center|LOCUS_10200 13485 14492 gene locus_tag LOCUS_10210 13485 14492 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392337.1 protein_id gnl|my_center|LOCUS_10210 14548 14623 gene locus_tag LOCUS_t00220 14548 14623 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 <15363 14703 gene locus_tag LOCUS_10220 <15363 14703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085368.1:phosphoribulokinase >Feature sequence041 1 957 gene locus_tag LOCUS_10230 1 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 1474 998 gene locus_tag LOCUS_10240 1474 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 1770 1471 gene locus_tag LOCUS_10250 1770 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 1943 1776 gene locus_tag LOCUS_10260 1943 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 3392 2196 gene locus_tag LOCUS_10270 3392 2196 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_10270 4591 3656 gene locus_tag LOCUS_10280 gene galE 4591 3656 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876270.1 protein_id gnl|my_center|LOCUS_10280 4562 4753 gene locus_tag LOCUS_10290 4562 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 4960 5538 gene locus_tag LOCUS_10300 gene pal 4960 5538 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118513.1 protein_id gnl|my_center|LOCUS_10300 5559 6362 gene locus_tag LOCUS_10310 gene cpoB 5559 6362 CDS product cell division protein CpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165506.1 protein_id gnl|my_center|LOCUS_10310 6362 7006 gene locus_tag LOCUS_10320 gene queE 6362 7006 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038131.1 protein_id gnl|my_center|LOCUS_10320 7009 7689 gene locus_tag LOCUS_10330 gene queC 7009 7689 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111415.1 protein_id gnl|my_center|LOCUS_10330 8973 7702 gene locus_tag LOCUS_10340 gene tolB 8973 7702 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220087.1 protein_id gnl|my_center|LOCUS_10340 9910 8966 gene locus_tag LOCUS_10350 9910 8966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 10299 9907 gene locus_tag LOCUS_10360 gene tolR 10299 9907 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772109.1 protein_id gnl|my_center|LOCUS_10360 11015 10314 gene locus_tag LOCUS_10370 gene tolQ 11015 10314 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186467.1 protein_id gnl|my_center|LOCUS_10370 11444 11022 gene locus_tag LOCUS_10380 gene ybgC 11444 11022 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201529.1 protein_id gnl|my_center|LOCUS_10380 12459 11434 gene locus_tag LOCUS_10390 gene ruvB 12459 11434 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038139.1 protein_id gnl|my_center|LOCUS_10390 13080 12499 gene locus_tag LOCUS_10400 gene ruvA 13080 12499 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086122.1 protein_id gnl|my_center|LOCUS_10400 13656 13111 gene locus_tag LOCUS_10410 gene ruvC 13656 13111 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112575.1 protein_id gnl|my_center|LOCUS_10410 14443 13691 gene locus_tag LOCUS_10420 14443 13691 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_10420 >Feature sequence042 383 147 gene locus_tag LOCUS_10430 gene rpmB 383 147 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096556.1 protein_id gnl|my_center|LOCUS_10430 494 2530 gene locus_tag LOCUS_10440 gene metG 494 2530 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072568.1 protein_id gnl|my_center|LOCUS_10440 3689 2523 gene locus_tag LOCUS_10450 gene aroF 3689 2523 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363948.1 protein_id gnl|my_center|LOCUS_10450 5112 3733 gene locus_tag LOCUS_10460 gene fumC 5112 3733 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057374.1 protein_id gnl|my_center|LOCUS_10460 6911 5115 gene locus_tag LOCUS_10470 6911 5115 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404064.1 protein_id gnl|my_center|LOCUS_10470 7486 6959 gene locus_tag LOCUS_10480 7486 6959 CDS product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543933.1 protein_id gnl|my_center|LOCUS_10480 7567 9372 gene locus_tag LOCUS_10490 7567 9372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 7709 7805 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9999 9430 gene locus_tag LOCUS_10500 9999 9430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 10159 11622 gene locus_tag LOCUS_10510 gene glgA 10159 11622 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389900.1 protein_id gnl|my_center|LOCUS_10510 11675 13063 gene locus_tag LOCUS_10520 11675 13063 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392701.1 protein_id gnl|my_center|LOCUS_10520 13154 13163 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence043 982 53 gene locus_tag LOCUS_10530 982 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1119 1811 gene locus_tag LOCUS_10540 1119 1811 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110585.1 protein_id gnl|my_center|LOCUS_10540 5278 1826 gene locus_tag LOCUS_10550 gene smc 5278 1826 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225580.1 protein_id gnl|my_center|LOCUS_10550 5340 5765 gene locus_tag LOCUS_10560 5340 5765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 6389 6673 gene locus_tag LOCUS_10570 6389 6673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 6702 7016 gene locus_tag LOCUS_10580 6702 7016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 7346 7020 gene locus_tag LOCUS_10590 7346 7020 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880524.1 protein_id gnl|my_center|LOCUS_10590 10507 7343 gene locus_tag LOCUS_10600 10507 7343 CDS product YbcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880525.1 protein_id gnl|my_center|LOCUS_10600 11253 10480 gene locus_tag LOCUS_10610 11253 10480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 12952 11255 gene locus_tag LOCUS_10620 12952 11255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 >Feature sequence044 149 412 gene locus_tag LOCUS_10630 149 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 417 731 gene locus_tag LOCUS_10640 gene fdxB 417 731 CDS product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720698.1 protein_id gnl|my_center|LOCUS_10640 754 1407 gene locus_tag LOCUS_10650 754 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 1474 2067 gene locus_tag LOCUS_10660 1474 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497969.1 protein_id gnl|my_center|LOCUS_10660 2388 3917 gene locus_tag LOCUS_10670 2388 3917 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524545.1 protein_id gnl|my_center|LOCUS_10670 3914 5347 gene locus_tag LOCUS_10680 3914 5347 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064132.1 protein_id gnl|my_center|LOCUS_10680 5344 6510 gene locus_tag LOCUS_10690 5344 6510 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388614.1 protein_id gnl|my_center|LOCUS_10690 6701 7162 gene locus_tag LOCUS_10700 6701 7162 CDS product globin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085591.1 protein_id gnl|my_center|LOCUS_10700 7457 7251 gene locus_tag LOCUS_10710 7457 7251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 7646 7819 gene locus_tag LOCUS_10720 7646 7819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 7816 8337 gene locus_tag LOCUS_10730 7816 8337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 8334 9404 gene locus_tag LOCUS_10740 8334 9404 CDS product tellurite resistance/C4-dicarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063658.1 protein_id gnl|my_center|LOCUS_10740 9636 10004 gene locus_tag LOCUS_10750 9636 10004 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573822.1 protein_id gnl|my_center|LOCUS_10750 10009 10884 gene locus_tag LOCUS_10760 gene nifU 10009 10884 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937968.1 protein_id gnl|my_center|LOCUS_10760 10887 12095 gene locus_tag LOCUS_10770 gene nifS 10887 12095 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_10770 >Feature sequence045 2008 1646 gene locus_tag LOCUS_10780 2008 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 2310 2618 gene locus_tag LOCUS_10790 2310 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 2881 3207 gene locus_tag LOCUS_10800 2881 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 3247 3492 gene locus_tag LOCUS_10810 3247 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 3514 4122 gene locus_tag LOCUS_10820 3514 4122 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880943.1 protein_id gnl|my_center|LOCUS_10820 4198 4701 gene locus_tag LOCUS_10830 4198 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 4851 5591 gene locus_tag LOCUS_10840 4851 5591 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190252.1 protein_id gnl|my_center|LOCUS_10840 5588 5944 gene locus_tag LOCUS_10850 5588 5944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 5941 7212 gene locus_tag LOCUS_10860 5941 7212 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190526.1 protein_id gnl|my_center|LOCUS_10860 7370 7612 gene locus_tag LOCUS_10870 7370 7612 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141679.1 protein_id gnl|my_center|LOCUS_10870 7612 8034 gene locus_tag LOCUS_10880 7612 8034 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141678.1 protein_id gnl|my_center|LOCUS_10880 8368 11082 gene locus_tag LOCUS_10890 8368 11082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 11091 12089 gene locus_tag LOCUS_10900 11091 12089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 <12941 12195 gene locus_tag LOCUS_10910 <12941 12195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004531014.1:ISL3-like element ISBma1 family transposase >Feature sequence046 712 311 gene locus_tag LOCUS_10920 712 311 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345964.1 protein_id gnl|my_center|LOCUS_10920 1395 712 gene locus_tag LOCUS_10930 1395 712 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141387.1 protein_id gnl|my_center|LOCUS_10930 2100 1579 gene locus_tag LOCUS_10940 2100 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 2256 2170 gene locus_tag LOCUS_t00230 2256 2170 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2858 2322 gene locus_tag LOCUS_10950 2858 2322 CDS product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036208.1 protein_id gnl|my_center|LOCUS_10950 4353 3058 gene locus_tag LOCUS_10960 4353 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 5033 4350 gene locus_tag LOCUS_10970 gene ompR 5033 4350 CDS product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199523.1 protein_id gnl|my_center|LOCUS_10970 5302 5874 gene locus_tag LOCUS_10980 gene orn 5302 5874 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815420.1 protein_id gnl|my_center|LOCUS_10980 6165 7250 gene locus_tag LOCUS_10990 6165 7250 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173087.1 protein_id gnl|my_center|LOCUS_10990 7250 8212 gene locus_tag LOCUS_11000 7250 8212 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226131.1 protein_id gnl|my_center|LOCUS_11000 8234 9124 gene locus_tag LOCUS_11010 8234 9124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 9168 9437 gene locus_tag LOCUS_11020 9168 9437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 9446 11077 gene locus_tag LOCUS_11030 9446 11077 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143971.1 protein_id gnl|my_center|LOCUS_11030 11093 11449 gene locus_tag LOCUS_11040 11093 11449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 11484 11560 gene locus_tag LOCUS_t00240 11484 11560 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 12546 12040 gene locus_tag LOCUS_11050 12546 12040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 12842 12543 gene locus_tag LOCUS_11060 12842 12543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence047 150 470 gene locus_tag LOCUS_11070 150 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 570 803 gene locus_tag LOCUS_11080 570 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 1125 1361 gene locus_tag LOCUS_11090 1125 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 1556 1864 gene locus_tag LOCUS_11100 1556 1864 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213349.1 protein_id gnl|my_center|LOCUS_11100 1967 2179 gene locus_tag LOCUS_11110 1967 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 3034 3270 gene locus_tag LOCUS_11120 3034 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 3267 3455 gene locus_tag LOCUS_11130 3267 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 4813 3809 gene locus_tag LOCUS_11140 4813 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 4976 4800 gene locus_tag LOCUS_11150 4976 4800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 5348 5079 gene locus_tag LOCUS_11160 5348 5079 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971059.1 protein_id gnl|my_center|LOCUS_11160 5550 5332 gene locus_tag LOCUS_11170 5550 5332 CDS product DUF6290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971060.1 protein_id gnl|my_center|LOCUS_11170 6047 5634 gene locus_tag LOCUS_11180 6047 5634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 6945 6112 gene locus_tag LOCUS_11190 6945 6112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 7235 7531 gene locus_tag LOCUS_11200 7235 7531 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967242.1 protein_id gnl|my_center|LOCUS_11200 7588 7935 gene locus_tag LOCUS_11210 7588 7935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 8325 7951 gene locus_tag LOCUS_11220 8325 7951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 8807 9427 gene locus_tag LOCUS_11230 8807 9427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 9496 10062 gene locus_tag LOCUS_11240 9496 10062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 10113 10301 gene locus_tag LOCUS_11250 10113 10301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 12620 10572 gene locus_tag LOCUS_11260 12620 10572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 >Feature sequence048 <1 2593 gene locus_tag LOCUS_11270 <1 2593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266563.1:exodeoxyribonuclease V subunit gamma 2590 6186 gene locus_tag LOCUS_11280 gene recB 2590 6186 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266564.1 protein_id gnl|my_center|LOCUS_11280 6195 8135 gene locus_tag LOCUS_11290 gene recD 6195 8135 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114993.1 protein_id gnl|my_center|LOCUS_11290 8833 8982 gene locus_tag LOCUS_11300 8833 8982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 12297 9898 gene locus_tag LOCUS_11310 12297 9898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 >Feature sequence049 316 325 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 340 684 gene locus_tag LOCUS_11320 340 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11320 726 1799 gene locus_tag LOCUS_11330 726 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 2137 2436 gene locus_tag LOCUS_11340 2137 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 2429 3100 gene locus_tag LOCUS_11350 2429 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 3289 4665 gene locus_tag LOCUS_11360 gene ffh 3289 4665 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704629.1 protein_id gnl|my_center|LOCUS_11360 4736 4996 gene locus_tag LOCUS_11370 gene rpsP 4736 4996 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092643.1 protein_id gnl|my_center|LOCUS_11370 4980 5495 gene locus_tag LOCUS_11380 gene rimM 4980 5495 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113830.1 protein_id gnl|my_center|LOCUS_11380 5495 6247 gene locus_tag LOCUS_11390 gene trmD 5495 6247 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552523.1 protein_id gnl|my_center|LOCUS_11390 6269 6613 gene locus_tag LOCUS_11400 gene rplS 6269 6613 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006080791.1 protein_id gnl|my_center|LOCUS_11400 6628 7860 gene locus_tag LOCUS_11410 6628 7860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 7910 8824 gene locus_tag LOCUS_11420 gene xerD 7910 8824 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092629.1 protein_id gnl|my_center|LOCUS_11420 10361 8844 gene locus_tag LOCUS_11430 10361 8844 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526224.1 protein_id gnl|my_center|LOCUS_11430 11380 10511 gene locus_tag LOCUS_11440 gene trxA 11380 10511 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522640.1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence050 <1 1002 gene locus_tag LOCUS_11450 <1 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044950.1:TolC family protein 999 2081 gene locus_tag LOCUS_11460 999 2081 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140877.1 protein_id gnl|my_center|LOCUS_11460 2074 5367 gene locus_tag LOCUS_11470 2074 5367 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963916.1 protein_id gnl|my_center|LOCUS_11470 5351 5578 gene locus_tag LOCUS_11480 5351 5578 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932662.1 protein_id gnl|my_center|LOCUS_11480 5582 6007 gene locus_tag LOCUS_11490 5582 6007 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815278.1 protein_id gnl|my_center|LOCUS_11490 6010 6291 gene locus_tag LOCUS_11500 gene grxC 6010 6291 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208977.1 protein_id gnl|my_center|LOCUS_11500 6321 6755 gene locus_tag LOCUS_11510 gene trxC 6321 6755 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207653.1 protein_id gnl|my_center|LOCUS_11510 6810 8138 gene locus_tag LOCUS_11520 6810 8138 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763015.1 protein_id gnl|my_center|LOCUS_11520 8200 8856 gene locus_tag LOCUS_11530 8200 8856 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266412.1 protein_id gnl|my_center|LOCUS_11530 8913 8988 gene locus_tag LOCUS_t00250 8913 8988 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 9140 10015 gene locus_tag LOCUS_11540 gene dapA 9140 10015 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317384.1 protein_id gnl|my_center|LOCUS_11540 10054 11181 gene locus_tag LOCUS_11550 10054 11181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 >Feature sequence051 2 235 gene locus_tag LOCUS_11560 2 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 262 906 gene locus_tag LOCUS_11570 262 906 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615637.1 protein_id gnl|my_center|LOCUS_11570 921 1580 gene locus_tag LOCUS_11580 921 1580 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532164.1 protein_id gnl|my_center|LOCUS_11580 1570 2490 gene locus_tag LOCUS_11590 1570 2490 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417254.1 protein_id gnl|my_center|LOCUS_11590 4283 2553 gene locus_tag LOCUS_11600 gene polX 4283 2553 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551361.1 protein_id gnl|my_center|LOCUS_11600 4961 4293 gene locus_tag LOCUS_11610 4961 4293 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228697.1 protein_id gnl|my_center|LOCUS_11610 5245 4949 gene locus_tag LOCUS_11620 5245 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 6204 5269 gene locus_tag LOCUS_11630 6204 5269 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220518.1 protein_id gnl|my_center|LOCUS_11630 6320 8449 gene locus_tag LOCUS_11640 gene uvrD 6320 8449 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096872.1 protein_id gnl|my_center|LOCUS_11640 8467 8874 gene locus_tag LOCUS_11650 8467 8874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 9908 8976 gene locus_tag LOCUS_11660 9908 8976 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007184747.1 protein_id gnl|my_center|LOCUS_11660 10258 9923 gene locus_tag LOCUS_11670 10258 9923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 10998 10279 gene locus_tag LOCUS_11680 10998 10279 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530319.1 protein_id gnl|my_center|LOCUS_11680 11414 11208 gene locus_tag LOCUS_11690 11414 11208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence052 497 1882 gene locus_tag LOCUS_11700 497 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 3101 2010 gene locus_tag LOCUS_11710 gene waaF 3101 2010 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958358.1 protein_id gnl|my_center|LOCUS_11710 3906 3142 gene locus_tag LOCUS_11720 3906 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 5295 3910 gene locus_tag LOCUS_11730 5295 3910 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035947.1 protein_id gnl|my_center|LOCUS_11730 6368 5292 gene locus_tag LOCUS_11740 6368 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 6730 6365 gene locus_tag LOCUS_11750 6730 6365 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707590.1 protein_id gnl|my_center|LOCUS_11750 8575 6734 gene locus_tag LOCUS_11760 8575 6734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 8648 9523 gene locus_tag LOCUS_11770 gene rsmI 8648 9523 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057354.1 protein_id gnl|my_center|LOCUS_11770 9537 9612 gene locus_tag LOCUS_t00260 9537 9612 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 9619 9716 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9714 9789 gene locus_tag LOCUS_t00270 9714 9789 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 10031 9900 gene locus_tag LOCUS_11780 10031 9900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11780 10829 10032 gene locus_tag LOCUS_11790 gene rhuM 10829 10032 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019212714.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11790 >Feature sequence053 462 106 gene locus_tag LOCUS_11800 462 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 1094 459 gene locus_tag LOCUS_11810 1094 459 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706742.1 protein_id gnl|my_center|LOCUS_11810 3292 1259 gene locus_tag LOCUS_11820 gene cyoB 3292 1259 CDS product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467180.1 protein_id gnl|my_center|LOCUS_11820 4276 3311 gene locus_tag LOCUS_11830 gene cyoA 4276 3311 CDS product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167626.1 protein_id gnl|my_center|LOCUS_11830 4597 4277 gene locus_tag LOCUS_11840 4597 4277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 5145 5909 gene locus_tag LOCUS_11850 5145 5909 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195593.1 protein_id gnl|my_center|LOCUS_11850 5899 6558 gene locus_tag LOCUS_11860 gene rpiA 5899 6558 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189743.1 protein_id gnl|my_center|LOCUS_11860 6584 7240 gene locus_tag LOCUS_11870 gene pdxH 6584 7240 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887140.1 protein_id gnl|my_center|LOCUS_11870 7561 7250 gene locus_tag LOCUS_11880 7561 7250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 8205 7558 gene locus_tag LOCUS_11890 gene leuD 8205 7558 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010357988.1 protein_id gnl|my_center|LOCUS_11890 9768 8353 gene locus_tag LOCUS_11900 gene leuC 9768 8353 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446523.1 protein_id gnl|my_center|LOCUS_11900 10357 9815 gene locus_tag LOCUS_11910 10357 9815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11910 10579 10364 gene locus_tag LOCUS_11920 10579 10364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11920 10711 10920 gene locus_tag LOCUS_11930 10711 10920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 11095 11349 gene locus_tag LOCUS_11940 11095 11349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 >Feature sequence054 672 1619 gene locus_tag LOCUS_11950 672 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 2853 1636 gene locus_tag LOCUS_11960 2853 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 4146 3391 gene locus_tag LOCUS_11970 4146 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 5089 4229 gene locus_tag LOCUS_11980 5089 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 6404 5187 gene locus_tag LOCUS_11990 6404 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 7086 6505 gene locus_tag LOCUS_12000 7086 6505 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884059.1 protein_id gnl|my_center|LOCUS_12000 8083 7103 gene locus_tag LOCUS_12010 8083 7103 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_12010 9993 8080 gene locus_tag LOCUS_12020 9993 8080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 10790 9990 gene locus_tag LOCUS_12030 10790 9990 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065995.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence055 256 642 gene locus_tag LOCUS_12040 256 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 683 913 gene locus_tag LOCUS_12050 683 913 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878063.1 protein_id gnl|my_center|LOCUS_12050 956 2095 gene locus_tag LOCUS_12060 956 2095 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878064.1 protein_id gnl|my_center|LOCUS_12060 2113 2739 gene locus_tag LOCUS_12070 2113 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 2866 3843 gene locus_tag LOCUS_12080 gene dusA 2866 3843 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039017.1 protein_id gnl|my_center|LOCUS_12080 4140 3847 gene locus_tag LOCUS_12090 4140 3847 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088517.1 protein_id gnl|my_center|LOCUS_12090 5878 4415 gene locus_tag LOCUS_12100 gene zwf 5878 4415 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080226.1 protein_id gnl|my_center|LOCUS_12100 6799 5879 gene locus_tag LOCUS_12110 gene gnd 6799 5879 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038537.1 protein_id gnl|my_center|LOCUS_12110 6924 8108 gene locus_tag LOCUS_12120 gene purT 6924 8108 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522466.1 protein_id gnl|my_center|LOCUS_12120 9352 8144 gene locus_tag LOCUS_12130 9352 8144 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118408.1 protein_id gnl|my_center|LOCUS_12130 9623 9772 gene locus_tag LOCUS_12140 9623 9772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 9851 10231 gene locus_tag LOCUS_12150 9851 10231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence056 107 1438 gene locus_tag LOCUS_12160 gene tilS 107 1438 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266981.1 protein_id gnl|my_center|LOCUS_12160 2733 1402 gene locus_tag LOCUS_12170 2733 1402 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929354.1 protein_id gnl|my_center|LOCUS_12170 3202 2738 gene locus_tag LOCUS_12180 gene dksA 3202 2738 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490361.1 protein_id gnl|my_center|LOCUS_12180 3374 4138 gene locus_tag LOCUS_12190 3374 4138 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056646.1 protein_id gnl|my_center|LOCUS_12190 5714 4596 gene locus_tag LOCUS_12200 gene bcsZ 5714 4596 CDS product cellulose synthase complex periplasmic endoglucanase BcsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988805.1 protein_id gnl|my_center|LOCUS_12200 8710 5867 gene locus_tag LOCUS_12210 8710 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 10797 8707 gene locus_tag LOCUS_12220 10797 8707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence057 <1 1408 gene locus_tag LOCUS_12230 <1 1408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957543.1:Obg family GTPase CgtA 1405 2535 gene locus_tag LOCUS_12240 gene proB 1405 2535 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094756.1 protein_id gnl|my_center|LOCUS_12240 3005 2532 gene locus_tag LOCUS_12250 gene fur 3005 2532 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131699.1 protein_id gnl|my_center|LOCUS_12250 3072 3419 gene locus_tag LOCUS_12260 3072 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 3900 3436 gene locus_tag LOCUS_12270 3900 3436 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946119.1 protein_id gnl|my_center|LOCUS_12270 5067 3910 gene locus_tag LOCUS_12280 5067 3910 CDS product phosphatidylserine/phosphatidylglycerophosphate/cardiolipin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120863.1 protein_id gnl|my_center|LOCUS_12280 5207 5671 gene locus_tag LOCUS_12290 gene smpB 5207 5671 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948526.1 protein_id gnl|my_center|LOCUS_12290 5664 7337 gene locus_tag LOCUS_12300 5664 7337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 7368 7880 gene locus_tag LOCUS_12310 7368 7880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 9048 7915 gene locus_tag LOCUS_12320 9048 7915 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522681.1 protein_id gnl|my_center|LOCUS_12320 9542 9045 gene locus_tag LOCUS_12330 gene purE 9542 9045 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688684.1 protein_id gnl|my_center|LOCUS_12330 9584 10276 gene locus_tag LOCUS_12340 gene trmB 9584 10276 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038258.1 protein_id gnl|my_center|LOCUS_12340 10644 10913 gene locus_tag LOCUS_12350 10644 10913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 >Feature sequence058 542 390 gene locus_tag LOCUS_12360 542 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 432 441 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1309 737 gene locus_tag LOCUS_12370 1309 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 1598 1607 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3219 2911 gene locus_tag LOCUS_12380 3219 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 3490 3212 gene locus_tag LOCUS_12390 3490 3212 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140411.1 protein_id gnl|my_center|LOCUS_12390 3880 3509 gene locus_tag LOCUS_12400 3880 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 4799 3966 gene locus_tag LOCUS_12410 4799 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 5258 7927 gene locus_tag LOCUS_12420 5258 7927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 8929 10452 gene locus_tag LOCUS_12430 8929 10452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 >Feature sequence059 287 1315 gene locus_tag LOCUS_12440 287 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 1723 2319 gene locus_tag LOCUS_12450 1723 2319 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086527.1 protein_id gnl|my_center|LOCUS_12450 2858 2631 gene locus_tag LOCUS_12460 2858 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 2857 3021 gene locus_tag LOCUS_12470 2857 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 3513 3076 gene locus_tag LOCUS_12480 3513 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 3745 6396 gene locus_tag LOCUS_12490 3745 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 6718 6939 gene locus_tag LOCUS_12500 6718 6939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 8753 7794 gene locus_tag LOCUS_12510 8753 7794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 9535 9281 gene locus_tag LOCUS_12520 9535 9281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 9915 9532 gene locus_tag LOCUS_12530 9915 9532 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626168.1 protein_id gnl|my_center|LOCUS_12530 10410 9988 gene locus_tag LOCUS_12540 10410 9988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 >Feature sequence060 526 1077 gene locus_tag LOCUS_12550 526 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 1272 2552 gene locus_tag LOCUS_12560 1272 2552 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029732907.1 protein_id gnl|my_center|LOCUS_12560 4277 2706 gene locus_tag LOCUS_12570 4277 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 4771 4277 gene locus_tag LOCUS_12580 4771 4277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 4992 4774 gene locus_tag LOCUS_12590 4992 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 5337 5005 gene locus_tag LOCUS_12600 5337 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 5492 6760 gene locus_tag LOCUS_12610 5492 6760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 7880 7410 gene locus_tag LOCUS_12620 7880 7410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 8272 7949 gene locus_tag LOCUS_12630 8272 7949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 8557 9117 gene locus_tag LOCUS_12640 gene pinE 8557 9117 CDS product site-specific DNA recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905000.1 protein_id gnl|my_center|LOCUS_12640 9120 9602 gene locus_tag LOCUS_12650 9120 9602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 9834 10883 gene locus_tag LOCUS_12660 9834 10883 CDS product primase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171673.1 protein_id gnl|my_center|LOCUS_12660 >Feature sequence061 600 1127 gene locus_tag LOCUS_12670 gene ogt 600 1127 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211023.1 protein_id gnl|my_center|LOCUS_12670 2593 1124 gene locus_tag LOCUS_12680 2593 1124 CDS product DNA-3-methyladenine glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391104.1 protein_id gnl|my_center|LOCUS_12680 5081 2700 gene locus_tag LOCUS_12690 5081 2700 CDS product sucrose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056890.1 protein_id gnl|my_center|LOCUS_12690 7218 5074 gene locus_tag LOCUS_12700 7218 5074 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056430.1 protein_id gnl|my_center|LOCUS_12700 8123 7221 gene locus_tag LOCUS_12710 8123 7221 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120323.1 protein_id gnl|my_center|LOCUS_12710 8692 8120 gene locus_tag LOCUS_12720 8692 8120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 8896 10314 gene locus_tag LOCUS_12730 8896 10314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 10700 10311 gene locus_tag LOCUS_12740 10700 10311 CDS product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526443.1 protein_id gnl|my_center|LOCUS_12740 >Feature sequence062 639 199 gene locus_tag LOCUS_12750 gene greA 639 199 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809615.1 protein_id gnl|my_center|LOCUS_12750 396 405 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3875 636 gene locus_tag LOCUS_12760 gene carB 3875 636 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095207.1 protein_id gnl|my_center|LOCUS_12760 5010 3868 gene locus_tag LOCUS_12770 gene carA 5010 3868 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706536.1 protein_id gnl|my_center|LOCUS_12770 5522 5935 gene locus_tag LOCUS_12780 5522 5935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 6214 6894 gene locus_tag LOCUS_12790 6214 6894 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957870.1 protein_id gnl|my_center|LOCUS_12790 6989 7921 gene locus_tag LOCUS_12800 gene cyoA 6989 7921 CDS product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011832113.1 protein_id gnl|my_center|LOCUS_12800 7923 10070 gene locus_tag LOCUS_12810 gene cyoB 7923 10070 CDS product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931208.1 protein_id gnl|my_center|LOCUS_12810 >Feature sequence063 426 3125 gene locus_tag LOCUS_12820 gene polA 426 3125 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540200.1 protein_id gnl|my_center|LOCUS_12820 4390 3128 gene locus_tag LOCUS_12830 gene kch 4390 3128 CDS product voltage-gated potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005049683.1 protein_id gnl|my_center|LOCUS_12830 5223 4456 gene locus_tag LOCUS_12840 gene yihA 5223 4456 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038495.1 protein_id gnl|my_center|LOCUS_12840 5636 5253 gene locus_tag LOCUS_12850 5636 5253 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036943.1 protein_id gnl|my_center|LOCUS_12850 5877 8168 gene locus_tag LOCUS_12860 5877 8168 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673989.1 protein_id gnl|my_center|LOCUS_12860 8236 9495 gene locus_tag LOCUS_12870 gene tyrS 8236 9495 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957422.1 protein_id gnl|my_center|LOCUS_12870 >Feature sequence064 699 1592 gene locus_tag LOCUS_12880 699 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 1589 2272 gene locus_tag LOCUS_12890 1589 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 2287 3639 gene locus_tag LOCUS_12900 2287 3639 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281642.1 protein_id gnl|my_center|LOCUS_12900 3925 4134 gene locus_tag LOCUS_12910 3925 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 5003 4332 gene locus_tag LOCUS_12920 5003 4332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 5446 5676 gene locus_tag LOCUS_12930 5446 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 6061 5873 gene locus_tag LOCUS_12940 6061 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 6114 6755 gene locus_tag LOCUS_12950 6114 6755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 6767 8443 gene locus_tag LOCUS_12960 6767 8443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence065 442 227 gene locus_tag LOCUS_12970 442 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1347 1105 gene locus_tag LOCUS_12980 1347 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 1467 1736 gene locus_tag LOCUS_12990 1467 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 1733 1870 gene locus_tag LOCUS_13000 1733 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 3493 2012 gene locus_tag LOCUS_13010 3493 2012 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967081.1 protein_id gnl|my_center|LOCUS_13010 3841 3599 gene locus_tag LOCUS_13020 3841 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 4014 3787 gene locus_tag LOCUS_13030 4014 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 4423 4163 gene locus_tag LOCUS_13040 4423 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 4712 4416 gene locus_tag LOCUS_13050 4712 4416 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037339.1 protein_id gnl|my_center|LOCUS_13050 4951 4709 gene locus_tag LOCUS_13060 4951 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 5544 6320 gene locus_tag LOCUS_13070 5544 6320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 6331 9009 gene locus_tag LOCUS_13080 6331 9009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 >Feature sequence066 2465 1626 gene locus_tag LOCUS_13090 gene tatC 2465 1626 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815810.1 protein_id gnl|my_center|LOCUS_13090 2896 2525 gene locus_tag LOCUS_13100 2896 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 3121 2903 gene locus_tag LOCUS_13110 gene tatA 3121 2903 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260926.1 protein_id gnl|my_center|LOCUS_13110 3896 3198 gene locus_tag LOCUS_13120 gene hisIE 3896 3198 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228687.1 protein_id gnl|my_center|LOCUS_13120 4740 3979 gene locus_tag LOCUS_13130 gene hisF 4740 3979 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 protein_id gnl|my_center|LOCUS_13130 5473 4745 gene locus_tag LOCUS_13140 gene hisA 5473 4745 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246848.1 protein_id gnl|my_center|LOCUS_13140 6184 5513 gene locus_tag LOCUS_13150 gene hisH 6184 5513 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817212.1 protein_id gnl|my_center|LOCUS_13150 6780 6181 gene locus_tag LOCUS_13160 gene hisB 6780 6181 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096088.1 protein_id gnl|my_center|LOCUS_13160 7856 6777 gene locus_tag LOCUS_13170 gene hisC 7856 6777 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199913.1 protein_id gnl|my_center|LOCUS_13170 9154 7853 gene locus_tag LOCUS_13180 gene hisD 9154 7853 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268859.1 protein_id gnl|my_center|LOCUS_13180 9798 9151 gene locus_tag LOCUS_13190 gene hisG 9798 9151 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199915.1 protein_id gnl|my_center|LOCUS_13190 >Feature sequence067 <1 523 gene locus_tag LOCUS_13200 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003345654.1:excinuclease ABC subunit UvrB 622 1677 gene locus_tag LOCUS_13210 622 1677 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410204.1 protein_id gnl|my_center|LOCUS_13210 1838 3535 gene locus_tag LOCUS_13220 1838 3535 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813705.1 protein_id gnl|my_center|LOCUS_13220 3532 4377 gene locus_tag LOCUS_13230 gene kdsA 3532 4377 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036875.1 protein_id gnl|my_center|LOCUS_13230 4374 5654 gene locus_tag LOCUS_13240 gene eno 4374 5654 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192585.1 protein_id gnl|my_center|LOCUS_13240 5709 6077 gene locus_tag LOCUS_13250 gene ftsB 5709 6077 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813698.1 protein_id gnl|my_center|LOCUS_13250 6686 6126 gene locus_tag LOCUS_13260 gene efp 6686 6126 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388832.1 protein_id gnl|my_center|LOCUS_13260 6776 7078 gene locus_tag LOCUS_13270 6776 7078 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531698.1 protein_id gnl|my_center|LOCUS_13270 7112 8983 gene locus_tag LOCUS_13280 gene uvrC 7112 8983 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113354.1 protein_id gnl|my_center|LOCUS_13280 8986 9573 gene locus_tag LOCUS_13290 gene pgsA 8986 9573 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090349.1 protein_id gnl|my_center|LOCUS_13290 9596 9670 gene locus_tag LOCUS_t00280 9596 9670 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9711 9784 gene locus_tag LOCUS_t00290 9711 9784 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence068 <1 803 gene locus_tag LOCUS_13300 <1 803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932090.1:nitronate monooxygenase 1214 930 gene locus_tag LOCUS_13310 1214 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 1945 2187 gene locus_tag LOCUS_13320 1945 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 2184 2576 gene locus_tag LOCUS_13330 2184 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 3803 5791 gene locus_tag LOCUS_13340 3803 5791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 5841 6317 gene locus_tag LOCUS_13350 5841 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 6320 9064 gene locus_tag LOCUS_13360 6320 9064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 9205 9534 gene locus_tag LOCUS_13370 9205 9534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 9540 9896 gene locus_tag LOCUS_13380 gene tnpB 9540 9896 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971138.1 protein_id gnl|my_center|LOCUS_13380 >Feature sequence069 2337 1156 gene locus_tag LOCUS_13390 gene alaC 2337 1156 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931132.1 protein_id gnl|my_center|LOCUS_13390 2432 2806 gene locus_tag LOCUS_13400 2432 2806 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389515.1 protein_id gnl|my_center|LOCUS_13400 3774 2833 gene locus_tag LOCUS_13410 gene rpoS 3774 2833 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616022.1 protein_id gnl|my_center|LOCUS_13410 4472 3771 gene locus_tag LOCUS_13420 4472 3771 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036884.1 protein_id gnl|my_center|LOCUS_13420 5206 4454 gene locus_tag LOCUS_13430 gene surE 5206 4454 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704774.1 protein_id gnl|my_center|LOCUS_13430 5877 5305 gene locus_tag LOCUS_13440 5877 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 7435 6020 gene locus_tag LOCUS_13450 gene glnA 7435 6020 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074057.1 protein_id gnl|my_center|LOCUS_13450 8752 7589 gene locus_tag LOCUS_13460 8752 7589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 9057 9470 gene locus_tag LOCUS_13470 9057 9470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 9812 9462 gene locus_tag LOCUS_13480 9812 9462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence070 1035 2132 gene locus_tag LOCUS_13490 1035 2132 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966056.1 protein_id gnl|my_center|LOCUS_13490 2399 3118 gene locus_tag LOCUS_13500 2399 3118 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145679980.1 protein_id gnl|my_center|LOCUS_13500 3148 3906 gene locus_tag LOCUS_13510 3148 3906 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206340.1 protein_id gnl|my_center|LOCUS_13510 3963 5318 gene locus_tag LOCUS_13520 3963 5318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 5989 5501 gene locus_tag LOCUS_13530 5989 5501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 6481 6723 gene locus_tag LOCUS_13540 6481 6723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 7471 7268 gene locus_tag LOCUS_13550 7471 7268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 8220 7510 gene locus_tag LOCUS_13560 8220 7510 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392237.1 protein_id gnl|my_center|LOCUS_13560 9523 8324 gene locus_tag LOCUS_13570 9523 8324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence071 147 1211 gene locus_tag LOCUS_13580 gene nagZ 147 1211 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225592.1 protein_id gnl|my_center|LOCUS_13580 1336 1740 gene locus_tag LOCUS_13590 gene rpsF 1336 1740 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551828.1 protein_id gnl|my_center|LOCUS_13590 1756 2034 gene locus_tag LOCUS_13600 gene rpsR 1756 2034 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095634.1 protein_id gnl|my_center|LOCUS_13600 2077 2967 gene locus_tag LOCUS_13610 2077 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 3005 3451 gene locus_tag LOCUS_13620 gene rplI 3005 3451 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317208.1 protein_id gnl|my_center|LOCUS_13620 3477 4850 gene locus_tag LOCUS_13630 gene dnaB 3477 4850 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073663.1 protein_id gnl|my_center|LOCUS_13630 4895 6007 gene locus_tag LOCUS_13640 gene alr 4895 6007 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817869.1 protein_id gnl|my_center|LOCUS_13640 6004 7362 gene locus_tag LOCUS_13650 gene radA 6004 7362 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690821.1 protein_id gnl|my_center|LOCUS_13650 7533 7970 gene locus_tag LOCUS_13660 7533 7970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 7986 9332 gene locus_tag LOCUS_13670 gene pepP 7986 9332 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence072 2721 1015 gene locus_tag LOCUS_13680 2721 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 4034 2727 gene locus_tag LOCUS_13690 gene glgC 4034 2727 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389901.1 protein_id gnl|my_center|LOCUS_13690 4476 6482 gene locus_tag LOCUS_13700 gene glgB 4476 6482 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_13700 6497 6958 gene locus_tag LOCUS_13710 6497 6958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 6934 7863 gene locus_tag LOCUS_13720 6934 7863 CDS product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063757.1 protein_id gnl|my_center|LOCUS_13720 8608 7898 gene locus_tag LOCUS_13730 gene pgl 8608 7898 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547427.1 protein_id gnl|my_center|LOCUS_13730 8749 9177 gene locus_tag LOCUS_13740 8749 9177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 <9745 9113 gene locus_tag LOCUS_13750 <9745 9113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878271.1:translation initiation factor IF-2 >Feature sequence073 997 1941 gene locus_tag LOCUS_13760 997 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 1943 2272 gene locus_tag LOCUS_13770 1943 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 2262 2624 gene locus_tag LOCUS_13780 2262 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 2864 3274 gene locus_tag LOCUS_13790 2864 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 3749 4159 gene locus_tag LOCUS_13800 3749 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 4684 4505 gene locus_tag LOCUS_13810 4684 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 4883 5092 gene locus_tag LOCUS_13820 4883 5092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 5322 5783 gene locus_tag LOCUS_13830 5322 5783 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132355466.1 protein_id gnl|my_center|LOCUS_13830 6022 6579 gene locus_tag LOCUS_13840 6022 6579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 6752 6585 gene locus_tag LOCUS_13850 6752 6585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 7687 7007 gene locus_tag LOCUS_13860 7687 7007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 >Feature sequence074 611 432 gene locus_tag LOCUS_13870 611 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 1495 680 gene locus_tag LOCUS_13880 1495 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 1947 2351 gene locus_tag LOCUS_13890 1947 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 2952 2620 gene locus_tag LOCUS_13900 2952 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 3478 4665 gene locus_tag LOCUS_13910 3478 4665 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_13910 5907 5263 gene locus_tag LOCUS_13920 5907 5263 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183844.1 protein_id gnl|my_center|LOCUS_13920 6626 6099 gene locus_tag LOCUS_13930 6626 6099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 8162 6915 gene locus_tag LOCUS_13940 8162 6915 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400420.1 protein_id gnl|my_center|LOCUS_13940 9093 8149 gene locus_tag LOCUS_13950 gene cyoE 9093 8149 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768584.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence075 287 1642 gene locus_tag LOCUS_13960 287 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 1639 3825 gene locus_tag LOCUS_13970 1639 3825 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545619.1 protein_id gnl|my_center|LOCUS_13970 3837 5255 gene locus_tag LOCUS_13980 3837 5255 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113001.1 protein_id gnl|my_center|LOCUS_13980 6310 8013 gene locus_tag LOCUS_13990 6310 8013 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460998.1 protein_id gnl|my_center|LOCUS_13990 8047 8241 gene locus_tag LOCUS_14000 8047 8241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 8201 8470 gene locus_tag LOCUS_14010 8201 8470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 >Feature sequence076 171 8741 gene locus_tag LOCUS_14020 171 8741 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994041.1 protein_id gnl|my_center|LOCUS_14020 >Feature sequence077 2502 2885 gene locus_tag LOCUS_14030 2502 2885 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036943.1 protein_id gnl|my_center|LOCUS_14030 2898 4127 gene locus_tag LOCUS_14040 2898 4127 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978898.1 protein_id gnl|my_center|LOCUS_14040 4232 4972 gene locus_tag LOCUS_14050 gene yihA 4232 4972 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958433.1 protein_id gnl|my_center|LOCUS_14050 5038 6300 gene locus_tag LOCUS_14060 gene kch 5038 6300 CDS product voltage-gated potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807739.1 protein_id gnl|my_center|LOCUS_14060 8693 6303 gene locus_tag LOCUS_14070 gene polA 8693 6303 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540200.1 protein_id gnl|my_center|LOCUS_14070 >Feature sequence078 77 379 gene locus_tag LOCUS_14080 77 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 376 1083 gene locus_tag LOCUS_14090 gene ubiG 376 1083 CDS product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448326.1 protein_id gnl|my_center|LOCUS_14090 1076 1750 gene locus_tag LOCUS_14100 1076 1750 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039473.1 protein_id gnl|my_center|LOCUS_14100 2662 1712 gene locus_tag LOCUS_14110 2662 1712 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556463.1 protein_id gnl|my_center|LOCUS_14110 2816 4021 gene locus_tag LOCUS_14120 gene dapC 2816 4021 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406264.1 protein_id gnl|my_center|LOCUS_14120 4035 4859 gene locus_tag LOCUS_14130 gene dapD 4035 4859 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191680.1 protein_id gnl|my_center|LOCUS_14130 4870 6018 gene locus_tag LOCUS_14140 gene dapE 4870 6018 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262397.1 protein_id gnl|my_center|LOCUS_14140 6008 6832 gene locus_tag LOCUS_14150 6008 6832 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957937.1 protein_id gnl|my_center|LOCUS_14150 6845 7807 gene locus_tag LOCUS_14160 6845 7807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 >Feature sequence079 181 591 gene locus_tag LOCUS_14170 181 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 630 980 gene locus_tag LOCUS_14180 630 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 1013 2665 gene locus_tag LOCUS_14190 gene merA 1013 2665 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281123.1 protein_id gnl|my_center|LOCUS_14190 2679 3119 gene locus_tag LOCUS_14200 gene merR 2679 3119 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429836.1 protein_id gnl|my_center|LOCUS_14200 4694 3159 gene locus_tag LOCUS_14210 gene efbA 4694 3159 CDS product fibronectin-binding protein EfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379361.1 protein_id gnl|my_center|LOCUS_14210 6402 4729 gene locus_tag LOCUS_14220 6402 4729 CDS product bifunctional sulfate adenylyltransferase/adenylylsulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957747.1 protein_id gnl|my_center|LOCUS_14220 6982 6413 gene locus_tag LOCUS_14230 6982 6413 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633254.1 protein_id gnl|my_center|LOCUS_14230 7339 7779 gene locus_tag LOCUS_14240 7339 7779 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_14240 >Feature sequence080 1404 490 gene locus_tag LOCUS_14250 gene era 1404 490 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036468.1 protein_id gnl|my_center|LOCUS_14250 2077 1397 gene locus_tag LOCUS_14260 gene rnc 2077 1397 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420714.1 protein_id gnl|my_center|LOCUS_14260 2576 2142 gene locus_tag LOCUS_14270 2576 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 3448 2657 gene locus_tag LOCUS_14280 gene lepB 3448 2657 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958009.1 protein_id gnl|my_center|LOCUS_14280 5318 3516 gene locus_tag LOCUS_14290 gene lepA 5318 3516 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193305.1 protein_id gnl|my_center|LOCUS_14290 6910 5426 gene locus_tag LOCUS_14300 6910 5426 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764764.1 protein_id gnl|my_center|LOCUS_14300 7701 7036 gene locus_tag LOCUS_14310 7701 7036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 8171 7698 gene locus_tag LOCUS_14320 8171 7698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 >Feature sequence081 837 2732 gene locus_tag LOCUS_14330 837 2732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 2722 3696 gene locus_tag LOCUS_14340 2722 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 3689 5035 gene locus_tag LOCUS_14350 3689 5035 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281642.1 protein_id gnl|my_center|LOCUS_14350 5128 5754 gene locus_tag LOCUS_14360 5128 5754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 5796 6398 gene locus_tag LOCUS_14370 5796 6398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 6461 7033 gene locus_tag LOCUS_14380 6461 7033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 7060 8121 gene locus_tag LOCUS_14390 7060 8121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 >Feature sequence082 77 1345 gene locus_tag LOCUS_14400 77 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 1342 1689 gene locus_tag LOCUS_14410 1342 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 1705 2958 gene locus_tag LOCUS_14420 1705 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 3028 6102 gene locus_tag LOCUS_14430 3028 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 6161 6400 gene locus_tag LOCUS_14440 gene mazE 6161 6400 CDS product type II toxin-antitoxin system antitoxin MazE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581940.1 protein_id gnl|my_center|LOCUS_14440 6400 6741 gene locus_tag LOCUS_14450 gene mazF 6400 6741 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392535.1 protein_id gnl|my_center|LOCUS_14450 7092 7622 gene locus_tag LOCUS_14460 7092 7622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 >Feature sequence083 1382 429 gene locus_tag LOCUS_14470 gene ispH 1382 429 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769262.1 protein_id gnl|my_center|LOCUS_14470 2281 1556 gene locus_tag LOCUS_14480 2281 1556 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038010.1 protein_id gnl|my_center|LOCUS_14480 2349 2792 gene locus_tag LOCUS_14490 2349 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 2816 3631 gene locus_tag LOCUS_14500 2816 3631 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002234194.1 protein_id gnl|my_center|LOCUS_14500 3687 4631 gene locus_tag LOCUS_14510 gene glpX 3687 4631 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938831.1 protein_id gnl|my_center|LOCUS_14510 4657 6654 gene locus_tag LOCUS_14520 gene tkt 4657 6654 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209965.1 protein_id gnl|my_center|LOCUS_14520 6690 7706 gene locus_tag LOCUS_14530 gene gap 6690 7706 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194065.1 protein_id gnl|my_center|LOCUS_14530 7821 7830 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence084 143 1276 gene locus_tag LOCUS_14540 143 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 1266 2603 gene locus_tag LOCUS_14550 1266 2603 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257684.1 protein_id gnl|my_center|LOCUS_14550 2622 4262 gene locus_tag LOCUS_14560 2622 4262 CDS product TIGR04141 family sporadically distributed protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149523363.1 protein_id gnl|my_center|LOCUS_14560 4259 4873 gene locus_tag LOCUS_14570 4259 4873 CDS product DUF4433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143359.1 protein_id gnl|my_center|LOCUS_14570 4887 5948 gene locus_tag LOCUS_14580 4887 5948 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071656.1 protein_id gnl|my_center|LOCUS_14580 7339 6110 gene locus_tag LOCUS_14590 7339 6110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 7908 7447 gene locus_tag LOCUS_14600 7908 7447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 >Feature sequence085 656 87 gene locus_tag LOCUS_14610 gene pth 656 87 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185241.1 protein_id gnl|my_center|LOCUS_14610 1271 663 gene locus_tag LOCUS_14620 1271 663 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099279.1 protein_id gnl|my_center|LOCUS_14620 3197 1284 gene locus_tag LOCUS_14630 gene mrdA 3197 1284 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_14630 3285 3524 gene locus_tag LOCUS_14640 3285 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 3534 3860 gene locus_tag LOCUS_14650 3534 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 4053 4673 gene locus_tag LOCUS_14660 4053 4673 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105381.1 protein_id gnl|my_center|LOCUS_14660 6594 4822 gene locus_tag LOCUS_14670 6594 4822 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186839.1 protein_id gnl|my_center|LOCUS_14670 7351 6698 gene locus_tag LOCUS_14680 7351 6698 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522277.1 protein_id gnl|my_center|LOCUS_14680 >Feature sequence086 538 287 gene locus_tag LOCUS_14690 538 287 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002804328.1 protein_id gnl|my_center|LOCUS_14690 977 753 gene locus_tag LOCUS_14700 977 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 1488 997 gene locus_tag LOCUS_14710 1488 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 4508 1569 gene locus_tag LOCUS_14720 4508 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 4748 7369 gene locus_tag LOCUS_14730 4748 7369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 7620 7270 gene locus_tag LOCUS_14740 7620 7270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 >Feature sequence087 564 875 gene locus_tag LOCUS_14750 564 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 995 1627 gene locus_tag LOCUS_14760 995 1627 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931888.1 protein_id gnl|my_center|LOCUS_14760 1624 2937 gene locus_tag LOCUS_14770 1624 2937 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931889.1 protein_id gnl|my_center|LOCUS_14770 3137 4360 gene locus_tag LOCUS_14780 3137 4360 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146571912.1 protein_id gnl|my_center|LOCUS_14780 4399 5400 gene locus_tag LOCUS_14790 4399 5400 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393804.1 protein_id gnl|my_center|LOCUS_14790 >Feature sequence088 1665 1489 gene locus_tag LOCUS_14800 1665 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 1967 1827 gene locus_tag LOCUS_14810 1967 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 2766 2476 gene locus_tag LOCUS_14820 2766 2476 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261491.1 protein_id gnl|my_center|LOCUS_14820 3071 2853 gene locus_tag LOCUS_14830 3071 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 4798 3740 gene locus_tag LOCUS_14840 4798 3740 CDS product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724803.1 protein_id gnl|my_center|LOCUS_14840 5061 4849 gene locus_tag LOCUS_14850 5061 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 5711 5082 gene locus_tag LOCUS_14860 gene parA 5711 5082 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666923.1 protein_id gnl|my_center|LOCUS_14860 6010 5750 gene locus_tag LOCUS_14870 6010 5750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 6581 6024 gene locus_tag LOCUS_14880 6581 6024 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387723.1 protein_id gnl|my_center|LOCUS_14880 7013 7207 gene locus_tag LOCUS_14890 7013 7207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536233.1 protein_id gnl|my_center|LOCUS_14890 7209 7505 gene locus_tag LOCUS_14900 7209 7505 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303876.1 protein_id gnl|my_center|LOCUS_14900 >Feature sequence089 105 1160 gene locus_tag LOCUS_14910 105 1160 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880213.1 protein_id gnl|my_center|LOCUS_14910 1150 1968 gene locus_tag LOCUS_14920 1150 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 1992 2711 gene locus_tag LOCUS_14930 1992 2711 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880215.1 protein_id gnl|my_center|LOCUS_14930 2704 3615 gene locus_tag LOCUS_14940 2704 3615 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880216.1 protein_id gnl|my_center|LOCUS_14940 3682 4128 gene locus_tag LOCUS_14950 3682 4128 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880581.1 protein_id gnl|my_center|LOCUS_14950 4125 4520 gene locus_tag LOCUS_14960 4125 4520 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880217.1 protein_id gnl|my_center|LOCUS_14960 4576 5013 gene locus_tag LOCUS_14970 4576 5013 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880218.1 protein_id gnl|my_center|LOCUS_14970 5098 6219 gene locus_tag LOCUS_14980 5098 6219 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880219.1 protein_id gnl|my_center|LOCUS_14980 6268 7338 gene locus_tag LOCUS_14990 6268 7338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 >Feature sequence090 <1 585 gene locus_tag LOCUS_15000 <1 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080709.1:type III pantothenate kinase 639 1541 gene locus_tag LOCUS_15010 639 1541 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039215.1 protein_id gnl|my_center|LOCUS_15010 1541 3217 gene locus_tag LOCUS_15020 gene recN 1541 3217 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036657.1 protein_id gnl|my_center|LOCUS_15020 3387 4871 gene locus_tag LOCUS_15030 3387 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 4871 5371 gene locus_tag LOCUS_15040 4871 5371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 5373 6758 gene locus_tag LOCUS_15050 gene glrR 5373 6758 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625590.1 protein_id gnl|my_center|LOCUS_15050 6832 7536 gene locus_tag LOCUS_15060 6832 7536 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807035.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence091 <1 665 gene locus_tag LOCUS_15070 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_166204126.1:IS3-like element ISRj2 family transposase 871 4002 gene locus_tag LOCUS_15080 871 4002 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103421.1 protein_id gnl|my_center|LOCUS_15080 4008 4793 gene locus_tag LOCUS_15090 4008 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 6510 5092 gene locus_tag LOCUS_15100 6510 5092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 6935 6507 gene locus_tag LOCUS_15110 6935 6507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 >Feature sequence092 <1 1993 gene locus_tag LOCUS_15120 <1 1993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266458.1:bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase 2008 2931 gene locus_tag LOCUS_15130 gene ilvE 2008 2931 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095783.1 protein_id gnl|my_center|LOCUS_15130 2897 3148 gene locus_tag LOCUS_15140 2897 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 4974 3169 gene locus_tag LOCUS_15150 gene dsbD 4974 3169 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064751.1 protein_id gnl|my_center|LOCUS_15150 4961 5290 gene locus_tag LOCUS_15160 4961 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 5418 6179 gene locus_tag LOCUS_15170 5418 6179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 6313 6603 gene locus_tag LOCUS_15180 gene groES 6313 6603 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946424.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence093 1402 404 gene locus_tag LOCUS_15190 1402 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 2211 1387 gene locus_tag LOCUS_15200 gene mshM 2211 1387 CDS product MSHA fimbrial biogenesis protein MshM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704366.1 protein_id gnl|my_center|LOCUS_15200 3935 2211 gene locus_tag LOCUS_15210 gene mshL 3935 2211 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227124.1 protein_id gnl|my_center|LOCUS_15210 4240 3938 gene locus_tag LOCUS_15220 4240 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 4974 4237 gene locus_tag LOCUS_15230 4974 4237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 5615 4971 gene locus_tag LOCUS_15240 5615 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 6523 5612 gene locus_tag LOCUS_15250 6523 5612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence094 380 189 gene locus_tag LOCUS_15260 380 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1226 1951 gene locus_tag LOCUS_15270 1226 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 2210 1914 gene locus_tag LOCUS_15280 2210 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 3086 4309 gene locus_tag LOCUS_15290 3086 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 4309 5757 gene locus_tag LOCUS_15300 4309 5757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210308580.1 protein_id gnl|my_center|LOCUS_15300 5903 6106 gene locus_tag LOCUS_15310 5903 6106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 6217 6002 gene locus_tag LOCUS_15320 6217 6002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 6539 6309 gene locus_tag LOCUS_15330 6539 6309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 >Feature sequence095 82 996 gene locus_tag LOCUS_15340 gene lpxC 82 996 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_15340 1448 936 gene locus_tag LOCUS_15350 1448 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 1499 4246 gene locus_tag LOCUS_15360 gene secA 1499 4246 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707576.1 protein_id gnl|my_center|LOCUS_15360 4256 5482 gene locus_tag LOCUS_15370 gene argJ 4256 5482 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110156.1 protein_id gnl|my_center|LOCUS_15370 5482 6471 gene locus_tag LOCUS_15380 5482 6471 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064924.1 protein_id gnl|my_center|LOCUS_15380 >Feature sequence096 <1 697 gene locus_tag LOCUS_15390 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010927127.1:A/G-specific adenine glycosylase 828 1100 gene locus_tag LOCUS_15400 828 1100 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_15400 1281 2807 gene locus_tag LOCUS_15410 1281 2807 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707724.1 protein_id gnl|my_center|LOCUS_15410 2812 3108 gene locus_tag LOCUS_15420 2812 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 3114 4493 gene locus_tag LOCUS_15430 gene glrR 3114 4493 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172694.1 protein_id gnl|my_center|LOCUS_15430 4628 5236 gene locus_tag LOCUS_15440 4628 5236 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028596.1 protein_id gnl|my_center|LOCUS_15440 6101 5265 gene locus_tag LOCUS_15450 gene speE 6101 5265 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038944.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence097 2758 1940 gene locus_tag LOCUS_15460 gene lgt 2758 1940 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112963.1 protein_id gnl|my_center|LOCUS_15460 3861 2830 gene locus_tag LOCUS_15470 3861 2830 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_15470 3949 4662 gene locus_tag LOCUS_15480 3949 4662 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640345.1 protein_id gnl|my_center|LOCUS_15480 4659 5108 gene locus_tag LOCUS_15490 4659 5108 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194031.1 protein_id gnl|my_center|LOCUS_15490 5166 5666 gene locus_tag LOCUS_15500 gene rppH 5166 5666 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417607.1 protein_id gnl|my_center|LOCUS_15500 >Feature sequence098 <1 641 gene locus_tag LOCUS_15510 <1 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097556.1:two-component system sensor histidine kinase KdpD 645 1388 gene locus_tag LOCUS_15520 gene kdpE 645 1388 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097557.1 protein_id gnl|my_center|LOCUS_15520 2187 1441 gene locus_tag LOCUS_15530 2187 1441 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022982.1 protein_id gnl|my_center|LOCUS_15530 3190 2192 gene locus_tag LOCUS_15540 3190 2192 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066343.1 protein_id gnl|my_center|LOCUS_15540 3724 3209 gene locus_tag LOCUS_15550 3724 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 3896 5494 gene locus_tag LOCUS_15560 3896 5494 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957525.1 protein_id gnl|my_center|LOCUS_15560 >Feature sequence099 626 159 gene locus_tag LOCUS_15570 626 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 1429 623 gene locus_tag LOCUS_15580 gene rsmA 1429 623 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768067.1 protein_id gnl|my_center|LOCUS_15580 1474 2046 gene locus_tag LOCUS_15590 1474 2046 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037574.1 protein_id gnl|my_center|LOCUS_15590 3074 2073 gene locus_tag LOCUS_15600 gene pdxA 3074 2073 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951346.1 protein_id gnl|my_center|LOCUS_15600 3334 3071 gene locus_tag LOCUS_15610 3334 3071 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391634.1 protein_id gnl|my_center|LOCUS_15610 4257 3337 gene locus_tag LOCUS_15620 4257 3337 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521934.1 protein_id gnl|my_center|LOCUS_15620 4537 4250 gene locus_tag LOCUS_15630 4537 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 5202 4564 gene locus_tag LOCUS_15640 5202 4564 CDS product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687105.1 protein_id gnl|my_center|LOCUS_15640 5676 5215 gene locus_tag LOCUS_15650 gene mlaD 5676 5215 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815777.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence100 40 489 gene locus_tag LOCUS_15660 40 489 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207064.1 protein_id gnl|my_center|LOCUS_15660 486 722 gene locus_tag LOCUS_15670 486 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 722 1243 gene locus_tag LOCUS_15680 722 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 4723 1373 gene locus_tag LOCUS_15690 4723 1373 CDS product VPA1262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477100.1 protein_id gnl|my_center|LOCUS_15690 5481 4759 gene locus_tag LOCUS_15700 5481 4759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 >Feature sequence101 827 639 gene locus_tag LOCUS_15710 827 639 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523495.1 protein_id gnl|my_center|LOCUS_15710 996 2288 gene locus_tag LOCUS_15720 996 2288 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037502.1 protein_id gnl|my_center|LOCUS_15720 3142 2294 gene locus_tag LOCUS_15730 gene murI 3142 2294 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028988894.1 protein_id gnl|my_center|LOCUS_15730 4089 3142 gene locus_tag LOCUS_15740 4089 3142 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942346.1 protein_id gnl|my_center|LOCUS_15740 <5883 4082 gene locus_tag LOCUS_15750 <5883 4082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250760.1:DUF1926 domain-containing protein >Feature sequence102 108 467 gene locus_tag LOCUS_15760 108 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 659 474 gene locus_tag LOCUS_15770 659 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 990 1259 gene locus_tag LOCUS_15780 990 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 1326 2204 gene locus_tag LOCUS_15790 1326 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142083.1 protein_id gnl|my_center|LOCUS_15790 2260 2817 gene locus_tag LOCUS_15800 2260 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 2885 3922 gene locus_tag LOCUS_15810 gene pyrC 2885 3922 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 protein_id gnl|my_center|LOCUS_15810 4006 5682 gene locus_tag LOCUS_15820 gene ilvD 4006 5682 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143160.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence103 499 308 gene locus_tag LOCUS_15830 499 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 569 838 gene locus_tag LOCUS_15840 569 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 1666 2274 gene locus_tag LOCUS_15850 1666 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 2694 2317 gene locus_tag LOCUS_15860 2694 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 2811 3092 gene locus_tag LOCUS_15870 2811 3092 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679831.1 protein_id gnl|my_center|LOCUS_15870 3089 3331 gene locus_tag LOCUS_15880 3089 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 3459 3581 gene locus_tag LOCUS_15890 3459 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 4019 3750 gene locus_tag LOCUS_15900 4019 3750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 4999 4352 gene locus_tag LOCUS_15910 4999 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 <5614 5058 gene locus_tag LOCUS_15920 <5614 5058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_097383638.1:Ti-type conjugative transfer relaxase TraA >Feature sequence104 728 549 gene locus_tag LOCUS_15930 728 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 714 884 gene locus_tag LOCUS_15940 714 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 2102 1047 gene locus_tag LOCUS_15950 2102 1047 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083692.1 protein_id gnl|my_center|LOCUS_15950 2289 2214 gene locus_tag LOCUS_t00300 2289 2214 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2419 2985 gene locus_tag LOCUS_15960 2419 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15960 3250 2996 gene locus_tag LOCUS_15970 3250 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 3192 4208 gene locus_tag LOCUS_15980 gene mltB 3192 4208 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926823.1 protein_id gnl|my_center|LOCUS_15980 4294 5343 gene locus_tag LOCUS_15990 4294 5343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 >Feature sequence105 300 2483 gene locus_tag LOCUS_16000 300 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 2515 3312 gene locus_tag LOCUS_16010 gene truA 2515 3312 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770596.1 protein_id gnl|my_center|LOCUS_16010 3373 3984 gene locus_tag LOCUS_16020 3373 3984 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619689.1 protein_id gnl|my_center|LOCUS_16020 3995 5194 gene locus_tag LOCUS_16030 gene trpB 3995 5194 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528977.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence106 130 402 gene locus_tag LOCUS_16040 130 402 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816743.1 protein_id gnl|my_center|LOCUS_16040 657 1976 gene locus_tag LOCUS_16050 657 1976 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082638.1 protein_id gnl|my_center|LOCUS_16050 2203 2457 gene locus_tag LOCUS_16060 2203 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 3736 2507 gene locus_tag LOCUS_16070 3736 2507 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198019.1 protein_id gnl|my_center|LOCUS_16070 3966 4796 gene locus_tag LOCUS_16080 3966 4796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 4825 5295 gene locus_tag LOCUS_16090 4825 5295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 >Feature sequence107 691 416 gene locus_tag LOCUS_16100 691 416 CDS product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219685598.1 protein_id gnl|my_center|LOCUS_16100 737 1030 gene locus_tag LOCUS_16110 737 1030 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210984.1 protein_id gnl|my_center|LOCUS_16110 1021 1905 gene locus_tag LOCUS_16120 1021 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16120 2419 2147 gene locus_tag LOCUS_16130 2419 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 3295 2495 gene locus_tag LOCUS_16140 gene istB 3295 2495 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064816995.1 protein_id gnl|my_center|LOCUS_16140 4770 3292 gene locus_tag LOCUS_16150 gene istA 4770 3292 CDS product IS21-like element ISBj11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084518.1 protein_id gnl|my_center|LOCUS_16150 >Feature sequence108 393 2084 gene locus_tag LOCUS_16160 gene cysI 393 2084 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243849.1 protein_id gnl|my_center|LOCUS_16160 2092 2823 gene locus_tag LOCUS_16170 2092 2823 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004565842.1 protein_id gnl|my_center|LOCUS_16170 2829 3764 gene locus_tag LOCUS_16180 gene cysD 2829 3764 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813323.1 protein_id gnl|my_center|LOCUS_16180 >Feature sequence109 2323 1289 gene locus_tag LOCUS_16190 gene argC 2323 1289 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113169.1 protein_id gnl|my_center|LOCUS_16190 2788 2402 gene locus_tag LOCUS_16200 gene rpsI 2788 2402 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210133.1 protein_id gnl|my_center|LOCUS_16200 3229 2801 gene locus_tag LOCUS_16210 gene rplM 3229 2801 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847559.1 protein_id gnl|my_center|LOCUS_16210 3682 3470 gene locus_tag LOCUS_16220 3682 3470 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720124.1 protein_id gnl|my_center|LOCUS_16220 4369 3770 gene locus_tag LOCUS_16230 4369 3770 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100063.1 protein_id gnl|my_center|LOCUS_16230 >Feature sequence110 1333 506 gene locus_tag LOCUS_16240 1333 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 2832 1963 gene locus_tag LOCUS_16250 2832 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 4269 4144 gene locus_tag LOCUS_16260 4269 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 >Feature sequence111 709 416 gene locus_tag LOCUS_16270 709 416 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550171.1 protein_id gnl|my_center|LOCUS_16270 992 696 gene locus_tag LOCUS_16280 992 696 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067437.1 protein_id gnl|my_center|LOCUS_16280 3938 1143 gene locus_tag LOCUS_16290 3938 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 >Feature sequence112 42 449 gene locus_tag LOCUS_16300 42 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 662 1294 gene locus_tag LOCUS_16310 662 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 1434 1688 gene locus_tag LOCUS_16320 1434 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 1699 2094 gene locus_tag LOCUS_16330 1699 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 2307 2789 gene locus_tag LOCUS_16340 2307 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 2984 3196 gene locus_tag LOCUS_16350 2984 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 3193 4104 gene locus_tag LOCUS_16360 3193 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 >Feature sequence113 252 261 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 312 1094 gene locus_tag LOCUS_16370 312 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16370 1113 1667 gene locus_tag LOCUS_16380 1113 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 2094 2234 gene locus_tag LOCUS_16390 2094 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 2361 2924 gene locus_tag LOCUS_16400 2361 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 3168 4121 gene locus_tag LOCUS_16410 3168 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 >Feature sequence114 682 398 gene locus_tag LOCUS_16420 682 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 1961 963 gene locus_tag LOCUS_16430 1961 963 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764768.1 protein_id gnl|my_center|LOCUS_16430 2890 2033 gene locus_tag LOCUS_16440 2890 2033 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149764770.1 protein_id gnl|my_center|LOCUS_16440 3750 2893 gene locus_tag LOCUS_16450 3750 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16450 4115 3729 gene locus_tag LOCUS_16460 4115 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 >Feature sequence115 1063 23 gene locus_tag LOCUS_16470 1063 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 1338 1060 gene locus_tag LOCUS_16480 1338 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 2069 1335 gene locus_tag LOCUS_16490 2069 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 3439 2066 gene locus_tag LOCUS_16500 3439 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 >Feature sequence116 <1 679 gene locus_tag LOCUS_16510 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533239.1:C1 family peptidase 651 1433 gene locus_tag LOCUS_16520 651 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533240.1 protein_id gnl|my_center|LOCUS_16520 2113 1406 gene locus_tag LOCUS_16530 2113 1406 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533247.1 protein_id gnl|my_center|LOCUS_16530 3285 2110 gene locus_tag LOCUS_16540 3285 2110 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533246.1 protein_id gnl|my_center|LOCUS_16540 >Feature sequence117 306 40 gene locus_tag LOCUS_16550 306 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 1653 394 gene locus_tag LOCUS_16560 gene cfaB 1653 394 CDS product C17 cyclopropane fatty acid synthase CfaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114148.1 protein_id gnl|my_center|LOCUS_16560 2052 1741 gene locus_tag LOCUS_16570 2052 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 2440 2063 gene locus_tag LOCUS_16580 gene crcB 2440 2063 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941171.1 protein_id gnl|my_center|LOCUS_16580 2752 2450 gene locus_tag LOCUS_16590 2752 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 <4052 2900 gene locus_tag LOCUS_16600 <4052 2900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143571.1:glycosyltransferase family 39 protein >Feature sequence118 447 1916 gene locus_tag LOCUS_16610 447 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 2306 3028 gene locus_tag LOCUS_16620 2306 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 3015 3329 gene locus_tag LOCUS_16630 3015 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 >Feature sequence119 <1 2760 gene locus_tag LOCUS_16640 <1 2760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000141537.1:type I restriction endonuclease subunit R 3049 3525 gene locus_tag LOCUS_16650 3049 3525 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928694.1 protein_id gnl|my_center|LOCUS_16650 3525 3764 gene locus_tag LOCUS_16660 3525 3764 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389170.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence120 773 387 gene locus_tag LOCUS_16670 gene rplL 773 387 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806889.1 protein_id gnl|my_center|LOCUS_16670 1324 803 gene locus_tag LOCUS_16680 gene rplJ 1324 803 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806888.1 protein_id gnl|my_center|LOCUS_16680 2161 1469 gene locus_tag LOCUS_16690 gene rplA 2161 1469 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185135.1 protein_id gnl|my_center|LOCUS_16690 2593 2165 gene locus_tag LOCUS_16700 gene rplK 2593 2165 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806886.1 protein_id gnl|my_center|LOCUS_16700 3181 2648 gene locus_tag LOCUS_16710 gene nusG 3181 2648 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198369.1 protein_id gnl|my_center|LOCUS_16710 3532 3182 gene locus_tag LOCUS_16720 3532 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 3630 3555 gene locus_tag LOCUS_t00310 3630 3555 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence121 562 957 gene locus_tag LOCUS_16730 562 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 1573 3111 gene locus_tag LOCUS_16740 gene ltrA 1573 3111 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189111.1 protein_id gnl|my_center|LOCUS_16740 >Feature sequence122 267 276 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 278 949 gene locus_tag LOCUS_16750 278 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 1593 1180 gene locus_tag LOCUS_16760 1593 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 1921 3165 gene locus_tag LOCUS_16770 1921 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 >Feature sequence123 685 389 gene locus_tag LOCUS_16780 685 389 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303511.1 protein_id gnl|my_center|LOCUS_16780 873 685 gene locus_tag LOCUS_16790 873 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302048.1 protein_id gnl|my_center|LOCUS_16790 2152 1916 gene locus_tag LOCUS_16800 2152 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 3054 2599 gene locus_tag LOCUS_16810 3054 2599 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141121.1 protein_id gnl|my_center|LOCUS_16810 >Feature sequence124 33 251 gene locus_tag LOCUS_16820 33 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 3023 2709 gene locus_tag LOCUS_16830 3023 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence125 257 856 gene locus_tag LOCUS_16840 257 856 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085913.1 protein_id gnl|my_center|LOCUS_16840 2198 2842 gene locus_tag LOCUS_16850 2198 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 >Feature sequence126 1002 640 gene locus_tag LOCUS_16860 1002 640 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212575.1 protein_id gnl|my_center|LOCUS_16860 1688 1050 gene locus_tag LOCUS_16870 1688 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212574.1 protein_id gnl|my_center|LOCUS_16870 2251 1685 gene locus_tag LOCUS_16880 2251 1685 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212573.1 protein_id gnl|my_center|LOCUS_16880 <3297 2305 gene locus_tag LOCUS_16890 <3297 2305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002212572.1:response regulator >Feature sequence127 1264 332 gene locus_tag LOCUS_16900 1264 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 1480 1286 gene locus_tag LOCUS_16910 1480 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 >Feature sequence128 <1 1029 gene locus_tag LOCUS_16920 <1 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388763.1:ADP-ribosyl-[dinitrogen reductase] hydrolase 1091 2728 gene locus_tag LOCUS_16930 gene nifA 1091 2728 CDS product nif-specific transcriptional activator NifA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388748.1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence129 2018 1107 gene locus_tag LOCUS_16940 2018 1107 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141003.1 protein_id gnl|my_center|LOCUS_16940 2672 2292 gene locus_tag LOCUS_16950 2672 2292 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252024.1 protein_id gnl|my_center|LOCUS_16950 2923 2675 gene locus_tag LOCUS_16960 2923 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 >Feature sequence130 554 796 gene locus_tag LOCUS_16970 554 796 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141679.1 protein_id gnl|my_center|LOCUS_16970 796 1227 gene locus_tag LOCUS_16980 796 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 1240 1368 gene locus_tag LOCUS_16990 1240 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 1416 2222 gene locus_tag LOCUS_17000 gene fghA 1416 2222 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931631.1 protein_id gnl|my_center|LOCUS_17000 2309 2509 gene locus_tag LOCUS_17010 gene thiS 2309 2509 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807812.1 protein_id gnl|my_center|LOCUS_17010 >Feature sequence131 506 303 gene locus_tag LOCUS_17020 gene rpmE 506 303 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003027123.1 protein_id gnl|my_center|LOCUS_17020 1958 582 gene locus_tag LOCUS_17030 gene rho 1958 582 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769919.1 protein_id gnl|my_center|LOCUS_17030 2281 1955 gene locus_tag LOCUS_17040 gene trxA 2281 1955 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070766.1 protein_id gnl|my_center|LOCUS_17040 2590 2498 gene locus_tag LOCUS_t00320 2590 2498 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence132 1917 2492 gene locus_tag LOCUS_17050 1917 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 >Feature sequence133 <1 1800 gene locus_tag LOCUS_17060 <1 1800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527907.1:cytochrome c biogenesis protein ResB 1793 2980 gene locus_tag LOCUS_17070 gene ccsB 1793 2980 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554622.1 protein_id gnl|my_center|LOCUS_17070 >Feature sequence134 <1 1244 gene locus_tag LOCUS_17080 <1 1244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107015.1:relaxase/mobilization nuclease domain-containing protein 1643 1981 gene locus_tag LOCUS_17090 1643 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 2076 2603 gene locus_tag LOCUS_17100 2076 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 2695 2907 gene locus_tag LOCUS_17110 2695 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 >Feature sequence135 8 178 gene locus_tag LOCUS_17120 8 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 699 550 gene locus_tag LOCUS_17130 699 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 1426 1944 gene locus_tag LOCUS_17140 1426 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 >Feature sequence136 607 272 gene locus_tag LOCUS_17150 607 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 1752 1970 gene locus_tag LOCUS_17160 1752 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 2338 2018 gene locus_tag LOCUS_17170 2338 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 >Feature sequence137 1970 90 gene locus_tag LOCUS_17180 gene thrS 1970 90 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360261.1 protein_id gnl|my_center|LOCUS_17180 >Feature sequence138 <1 1086 gene locus_tag LOCUS_17190 <1 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099258689.1:ISL3 family transposase >Feature sequence139 46 1278 gene locus_tag LOCUS_17200 46 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence140 <1 951 gene locus_tag LOCUS_17210 <1 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206548.1:cytosine permease 977 1669 gene locus_tag LOCUS_17220 977 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 >Feature sequence141 440 787 gene locus_tag LOCUS_17230 440 787 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092272.1 protein_id gnl|my_center|LOCUS_17230 >Feature sequence142 >Feature sequence143 285 112 gene locus_tag LOCUS_17240 285 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1362 382 gene locus_tag LOCUS_17250 1362 382 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140590772.1 protein_id gnl|my_center|LOCUS_17250 >Feature sequence144 485 285 gene locus_tag LOCUS_17260 485 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 832 840 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence145 >Feature sequence146 264 273 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence147 151 276 gene locus_tag LOCUS_17270 151 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 276 509 gene locus_tag LOCUS_17280 276 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 682 503 gene locus_tag LOCUS_17290 682 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 1353 679 gene locus_tag LOCUS_17300 1353 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 >Feature sequence148 513 869 gene locus_tag LOCUS_17310 513 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 874 1230 gene locus_tag LOCUS_17320 gene tnpB 874 1230 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971138.1 protein_id gnl|my_center|LOCUS_17320 >Feature sequence149 769 350 gene locus_tag LOCUS_17330 769 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17330 360 369 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence150 >Feature sequence151 >Feature sequence152 >Feature sequence153 <1 659 gene locus_tag LOCUS_17340 <1 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011114737.1:IS3 family transposase 1199 696 gene locus_tag LOCUS_17350 1199 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 >Feature sequence154 601 74 gene locus_tag LOCUS_17360 601 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 >Feature sequence155 >Feature sequence156 537 794 gene locus_tag LOCUS_17370 537 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 897 906 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence157 482 601 gene locus_tag LOCUS_17380 482 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 >Feature sequence158 666 944 gene locus_tag LOCUS_17390 666 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 >Feature sequence159 >Feature sequence160 >Feature sequence161 345 815 gene locus_tag LOCUS_17400 gene rfbC 345 815 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771397.1 protein_id gnl|my_center|LOCUS_17400 776 785 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence162 1026 562 gene locus_tag LOCUS_17410 1026 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 >Feature sequence163 >Feature sequence164 790 578 gene locus_tag LOCUS_17420 790 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 >Feature sequence165 479 718 gene locus_tag LOCUS_17430 479 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 620 629 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence166 >Feature sequence167 766 389 gene locus_tag LOCUS_17440 766 389 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_17440 >Feature sequence168 654 223 gene locus_tag LOCUS_17450 gene ruvX 654 223 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706124.1 protein_id gnl|my_center|LOCUS_17450 >Feature sequence169 773 928 gene locus_tag LOCUS_17460 773 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 >Feature sequence170 159 530 gene locus_tag LOCUS_17470 159 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 536 892 gene locus_tag LOCUS_17480 gene tnpB 536 892 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971138.1 protein_id gnl|my_center|LOCUS_17480 >Feature sequence171 92 367 gene locus_tag LOCUS_17490 92 367 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836217.1 protein_id gnl|my_center|LOCUS_17490 327 596 gene locus_tag LOCUS_17500 327 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 >Feature sequence172 491 670 gene locus_tag LOCUS_17510 491 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 >Feature sequence173 403 89 gene locus_tag LOCUS_17520 403 89 CDS product DUF2818 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526463.1 protein_id gnl|my_center|LOCUS_17520 <917 403 gene locus_tag LOCUS_17530 <917 403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015443945.1:NADH-quinone oxidoreductase subunit NuoN >Feature sequence174 354 839 gene locus_tag LOCUS_17540 354 839 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194993.1 protein_id gnl|my_center|LOCUS_17540 >Feature sequence175 >Feature sequence176 >Feature sequence177 285 294 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 578 587 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence178 473 482 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 566 850 gene locus_tag LOCUS_17550 566 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 >Feature sequence179 315 494 gene locus_tag LOCUS_17560 315 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 >Feature sequence180 93 317 gene locus_tag LOCUS_17570 93 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 314 460 gene locus_tag LOCUS_17580 314 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 >Feature sequence181 125 397 gene locus_tag LOCUS_17590 125 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 546 555 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence182 688 434 gene locus_tag LOCUS_17600 688 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 >Feature sequence183 95 256 gene locus_tag LOCUS_17610 95 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 >Feature sequence184 <1 776 gene locus_tag LOCUS_17620 <1 776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193866.1:carbamoyl-phosphate synthase large subunit >Feature sequence185 <848 288 gene locus_tag LOCUS_17630 <848 288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_047816295.1:tyrosine-type recombinase/integrase note possible pseudo, frameshifted >Feature sequence186 <840 321 gene locus_tag LOCUS_17640 <840 321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112889.1:dihydroorotase >Feature sequence187 427 783 gene locus_tag LOCUS_17650 427 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 >Feature sequence188 820 563 gene locus_tag LOCUS_17660 820 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 >Feature sequence189 >Feature sequence190 2 238 gene locus_tag LOCUS_17670 2 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 410 562 gene locus_tag LOCUS_17680 410 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 >Feature sequence191 >Feature sequence192 539 279 gene locus_tag LOCUS_17690 539 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 796 620 gene locus_tag LOCUS_17700 796 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 >Feature sequence193 359 754 gene locus_tag LOCUS_17710 359 754 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946746.1 protein_id gnl|my_center|LOCUS_17710 >Feature sequence194 >Feature sequence195 282 291 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 422 550 gene locus_tag LOCUS_17720 422 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 >Feature sequence196 >Feature sequence197 >Feature sequence198 >Feature sequence199 362 529 gene locus_tag LOCUS_17730 362 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 >Feature sequence200 >Feature sequence201 359 231 gene locus_tag LOCUS_17740 359 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 >Feature sequence202 >Feature sequence203 >Feature sequence204 >Feature sequence205 >Feature sequence206 >Feature sequence207 200 577 gene locus_tag LOCUS_17750 200 577 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497752.1 protein_id gnl|my_center|LOCUS_17750 >Feature sequence208 293 218 gene locus_tag LOCUS_t00330 293 218 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 374 299 gene locus_tag LOCUS_t00340 374 299 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 563 489 gene locus_tag LOCUS_t00350 563 489 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence209 >Feature sequence210 >Feature sequence211 341 36 gene locus_tag LOCUS_17760 341 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 >Feature sequence212 642 319 gene locus_tag LOCUS_17770 642 319 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003493505.1 protein_id gnl|my_center|LOCUS_17770 >Feature sequence213 >Feature sequence214 >Feature sequence215 >Feature sequence216 94 267 gene locus_tag LOCUS_17780 94 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 >Feature sequence217 >Feature sequence218 >Feature sequence219 413 219 gene locus_tag LOCUS_17790 413 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 >Feature sequence220 >Feature sequence221 >Feature sequence222 >Feature sequence223 <1 628 gene locus_tag LOCUS_17800 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083692.1:site-specific integrase >Feature sequence224 >Feature sequence225 >Feature sequence226 605 477 gene locus_tag LOCUS_17810 605 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 >Feature sequence227 387 34 gene locus_tag LOCUS_17820 387 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 >Feature sequence228 >Feature sequence229 >Feature sequence230 321 330 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence231 >Feature sequence232 >Feature sequence233 >Feature sequence234 >Feature sequence235 >Feature sequence236 510 298 gene locus_tag LOCUS_17830 510 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 >Feature sequence237 >Feature sequence238 >Feature sequence239 619 188 gene locus_tag LOCUS_17840 619 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 232 241 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence240 >Feature sequence241 148 402 gene locus_tag LOCUS_17850 148 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 >Feature sequence242 >Feature sequence243 >Feature sequence244 >Feature sequence245 >Feature sequence246 >Feature sequence247 >Feature sequence248 >Feature sequence249 605 141 gene locus_tag LOCUS_17860 605 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 >Feature sequence250 298 307 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence251 >Feature sequence252 208 8 gene locus_tag LOCUS_17870 208 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 264 273 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence253 >Feature sequence254 >Feature sequence255 >Feature sequence256 >Feature sequence257 >Feature sequence258 365 562 gene locus_tag LOCUS_17880 365 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 >Feature sequence259 1 381 gene locus_tag LOCUS_17890 1 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 268 277 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence260 246 255 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence261 1 447 gene locus_tag LOCUS_17900 1 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 >Feature sequence262 338 505 gene locus_tag LOCUS_17910 338 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 >Feature sequence263 >Feature sequence264 >Feature sequence265 >Feature sequence266 >Feature sequence267 <581 52 gene locus_tag LOCUS_17920 <581 52 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003409202.1:IS66-like element ISPsy5 family transposase >Feature sequence268 >Feature sequence269 >Feature sequence270 215 523 gene locus_tag LOCUS_17930 215 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 >Feature sequence271 >Feature sequence272 >Feature sequence273 >Feature sequence274 >Feature sequence275 >Feature sequence276 >Feature sequence277 >Feature sequence278 >Feature sequence279 >Feature sequence280 >Feature sequence281 >Feature sequence282 >Feature sequence283 >Feature sequence284 >Feature sequence285 473 117 gene locus_tag LOCUS_17940 473 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 >Feature sequence286 >Feature sequence287 >Feature sequence288 >Feature sequence289 >Feature sequence290 242 36 gene locus_tag LOCUS_17950 242 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 >Feature sequence291 >Feature sequence292 >Feature sequence293 >Feature sequence294 72 380 gene locus_tag LOCUS_17960 72 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 >Feature sequence295 >Feature sequence296 >Feature sequence297 >Feature sequence298 >Feature sequence299 >Feature sequence300 >Feature sequence301 >Feature sequence302 >Feature sequence303 >Feature sequence304 336 73 gene locus_tag LOCUS_17970 gene dinJ 336 73 CDS product type II toxin-antitoxin system antitoxin DinJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729704.1 protein_id gnl|my_center|LOCUS_17970 >Feature sequence305 >Feature sequence306 >Feature sequence307 >Feature sequence308 >Feature sequence309 >Feature sequence310 354 187 gene locus_tag LOCUS_17980 354 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 >Feature sequence311 >Feature sequence312 >Feature sequence313 >Feature sequence314 >Feature sequence315 >Feature sequence316 >Feature sequence317 >Feature sequence318 >Feature sequence319 >Feature sequence320 >Feature sequence321 >Feature sequence322 114 311 gene locus_tag LOCUS_17990 114 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence323 >Feature sequence324 193 330 gene locus_tag LOCUS_18000 193 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 >Feature sequence325 231 464 gene locus_tag LOCUS_18010 231 464 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034522604.1 protein_id gnl|my_center|LOCUS_18010 >Feature sequence326 310 480 gene locus_tag LOCUS_18020 310 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 >Feature sequence327 >Feature sequence328 >Feature sequence329 >Feature sequence330 86 421 gene locus_tag LOCUS_18030 86 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 >Feature sequence331 198 503 gene locus_tag LOCUS_18040 198 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 >Feature sequence332 >Feature sequence333 >Feature sequence334