>Feature sequence01 2880 2805 gene locus_tag LOCUS_t00010 2880 2805 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2984 2908 gene locus_tag LOCUS_t00020 2984 2908 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 4623 3084 gene locus_tag LOCUS_r00010 4623 3084 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5661 4837 gene locus_tag LOCUS_00010 gene aroE 5661 4837 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039025.1 protein_id gnl|my_center|LOCUS_00010 6641 5700 gene locus_tag LOCUS_00020 gene hemB 6641 5700 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521908.1 protein_id gnl|my_center|LOCUS_00020 7715 6747 gene locus_tag LOCUS_00030 gene hemF 7715 6747 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172302.1 protein_id gnl|my_center|LOCUS_00030 8290 7712 gene locus_tag LOCUS_00040 8290 7712 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038838.1 protein_id gnl|my_center|LOCUS_00040 10836 8287 gene locus_tag LOCUS_00050 10836 8287 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038837.1 protein_id gnl|my_center|LOCUS_00050 11390 10896 gene locus_tag LOCUS_00060 11390 10896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 12439 11387 gene locus_tag LOCUS_00070 12439 11387 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_00070 12818 13339 gene locus_tag LOCUS_00080 gene def 12818 13339 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690288.1 protein_id gnl|my_center|LOCUS_00080 13349 14293 gene locus_tag LOCUS_00090 gene fmt 13349 14293 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038830.1 protein_id gnl|my_center|LOCUS_00090 14356 15741 gene locus_tag LOCUS_00100 gene rsmB 14356 15741 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114643.1 protein_id gnl|my_center|LOCUS_00100 15968 15729 gene locus_tag LOCUS_00110 15968 15729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 15849 16316 gene locus_tag LOCUS_00120 15849 16316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 16328 18523 gene locus_tag LOCUS_00130 16328 18523 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038749.1 protein_id gnl|my_center|LOCUS_00130 18520 19830 gene locus_tag LOCUS_00140 18520 19830 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224766.1 protein_id gnl|my_center|LOCUS_00140 20031 19834 gene locus_tag LOCUS_00150 20031 19834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 20324 20046 gene locus_tag LOCUS_00160 20324 20046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 20610 20290 gene locus_tag LOCUS_00170 20610 20290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 21332 20745 gene locus_tag LOCUS_00180 gene folE 21332 20745 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087639.1 protein_id gnl|my_center|LOCUS_00180 21445 22743 gene locus_tag LOCUS_00190 21445 22743 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888344.1 protein_id gnl|my_center|LOCUS_00190 22740 23666 gene locus_tag LOCUS_00200 22740 23666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 23793 25529 gene locus_tag LOCUS_00210 23793 25529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 25526 25927 gene locus_tag LOCUS_00220 25526 25927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 25993 27066 gene locus_tag LOCUS_00230 25993 27066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 27063 27365 gene locus_tag LOCUS_00240 27063 27365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 27370 27690 gene locus_tag LOCUS_00250 27370 27690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 27684 30140 gene locus_tag LOCUS_00260 gene trbE 27684 30140 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533267.1 protein_id gnl|my_center|LOCUS_00260 30130 30948 gene locus_tag LOCUS_00270 30130 30948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 30945 32021 gene locus_tag LOCUS_00280 30945 32021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 32026 32199 gene locus_tag LOCUS_00290 32026 32199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 32196 32870 gene locus_tag LOCUS_00300 32196 32870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 33066 32848 gene locus_tag LOCUS_00310 33066 32848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 32974 33585 gene locus_tag LOCUS_00320 32974 33585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 34295 33996 gene locus_tag LOCUS_00330 34295 33996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 34203 34760 gene locus_tag LOCUS_00340 34203 34760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 34799 34887 gene locus_tag LOCUS_t00030 34799 34887 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 35158 34943 gene locus_tag LOCUS_00350 35158 34943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 36858 35464 gene locus_tag LOCUS_00360 36858 35464 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958566.1 protein_id gnl|my_center|LOCUS_00360 37148 36855 gene locus_tag LOCUS_00370 37148 36855 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770065.1 protein_id gnl|my_center|LOCUS_00370 38269 37145 gene locus_tag LOCUS_00380 38269 37145 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174136.1 protein_id gnl|my_center|LOCUS_00380 38367 38981 gene locus_tag LOCUS_00390 38367 38981 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037574.1 protein_id gnl|my_center|LOCUS_00390 39034 39699 gene locus_tag LOCUS_00400 39034 39699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 39713 40087 gene locus_tag LOCUS_00410 gene queD 39713 40087 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090505.1 protein_id gnl|my_center|LOCUS_00410 40170 40745 gene locus_tag LOCUS_00420 40170 40745 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073158.1 protein_id gnl|my_center|LOCUS_00420 41574 40717 gene locus_tag LOCUS_00430 gene cysQ 41574 40717 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071807.1 protein_id gnl|my_center|LOCUS_00430 41917 42162 gene locus_tag LOCUS_00440 41917 42162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 42324 42181 gene locus_tag LOCUS_00450 42324 42181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 42732 42472 gene locus_tag LOCUS_00460 42732 42472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 45206 42738 gene locus_tag LOCUS_00470 gene fadE 45206 42738 CDS product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973130.1 protein_id gnl|my_center|LOCUS_00470 47171 45321 gene locus_tag LOCUS_00480 gene glmS 47171 45321 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269442.1 protein_id gnl|my_center|LOCUS_00480 48525 47179 gene locus_tag LOCUS_00490 gene glmU 48525 47179 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064821.1 protein_id gnl|my_center|LOCUS_00490 48983 48561 gene locus_tag LOCUS_00500 48983 48561 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195832.1 protein_id gnl|my_center|LOCUS_00500 50408 48990 gene locus_tag LOCUS_00510 gene atpD 50408 48990 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948666.1 protein_id gnl|my_center|LOCUS_00510 51279 50419 gene locus_tag LOCUS_00520 gene atpG 51279 50419 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097132.1 protein_id gnl|my_center|LOCUS_00520 52836 51283 gene locus_tag LOCUS_00530 gene atpA 52836 51283 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948668.1 protein_id gnl|my_center|LOCUS_00530 53416 52886 gene locus_tag LOCUS_00540 53416 52886 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097135.1 protein_id gnl|my_center|LOCUS_00540 53886 53413 gene locus_tag LOCUS_00550 gene atpF 53886 53413 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884340.1 protein_id gnl|my_center|LOCUS_00550 54225 53932 gene locus_tag LOCUS_00560 gene atpE 54225 53932 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770030.1 protein_id gnl|my_center|LOCUS_00560 55088 54282 gene locus_tag LOCUS_00570 gene atpB 55088 54282 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770029.1 protein_id gnl|my_center|LOCUS_00570 55405 55034 gene locus_tag LOCUS_00580 55405 55034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 56454 55585 gene locus_tag LOCUS_00590 56454 55585 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_00590 57331 56498 gene locus_tag LOCUS_00600 57331 56498 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555991.1 protein_id gnl|my_center|LOCUS_00600 58014 57328 gene locus_tag LOCUS_00610 gene rsmG 58014 57328 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039110.1 protein_id gnl|my_center|LOCUS_00610 59630 58014 gene locus_tag LOCUS_00620 59630 58014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070676.1 protein_id gnl|my_center|LOCUS_00620 60272 59841 gene locus_tag LOCUS_00630 60272 59841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 61470 60385 gene locus_tag LOCUS_00640 61470 60385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 62894 61479 gene locus_tag LOCUS_00650 62894 61479 CDS product bifunctional 2-methylcitrate dehydratase/aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930897.1 protein_id gnl|my_center|LOCUS_00650 64015 62891 gene locus_tag LOCUS_00660 gene prpC 64015 62891 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267427.1 protein_id gnl|my_center|LOCUS_00660 64917 64012 gene locus_tag LOCUS_00670 gene prpB 64917 64012 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706118.1 protein_id gnl|my_center|LOCUS_00670 65982 64957 gene locus_tag LOCUS_00680 65982 64957 CDS product acryloyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233163.1 protein_id gnl|my_center|LOCUS_00680 66800 65979 gene locus_tag LOCUS_00690 66800 65979 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994121.1 protein_id gnl|my_center|LOCUS_00690 68827 66983 gene locus_tag LOCUS_00700 gene mnmG 68827 66983 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499797.1 protein_id gnl|my_center|LOCUS_00700 70248 68899 gene locus_tag LOCUS_00710 gene mnmE 70248 68899 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703904.1 protein_id gnl|my_center|LOCUS_00710 71915 70245 gene locus_tag LOCUS_00720 gene yidC 71915 70245 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114648.1 protein_id gnl|my_center|LOCUS_00720 72527 72156 gene locus_tag LOCUS_00730 72527 72156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 72989 74326 gene locus_tag LOCUS_00740 gene dnaA 72989 74326 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703901.1 protein_id gnl|my_center|LOCUS_00740 74537 75652 gene locus_tag LOCUS_00750 gene dnaN 74537 75652 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769934.1 protein_id gnl|my_center|LOCUS_00750 76997 79318 gene locus_tag LOCUS_00760 gene gyrB 76997 79318 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704050.1 protein_id gnl|my_center|LOCUS_00760 80090 79338 gene locus_tag LOCUS_00770 80090 79338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 80653 80087 gene locus_tag LOCUS_00780 gene gmhB 80653 80087 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814404.1 protein_id gnl|my_center|LOCUS_00780 82767 80650 gene locus_tag LOCUS_00790 gene glyS 82767 80650 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114646.1 protein_id gnl|my_center|LOCUS_00790 83627 82764 gene locus_tag LOCUS_00800 gene glyQ 83627 82764 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002044989.1 protein_id gnl|my_center|LOCUS_00800 83869 85290 gene locus_tag LOCUS_00810 gene glnA 83869 85290 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099376.1 protein_id gnl|my_center|LOCUS_00810 85327 85938 gene locus_tag LOCUS_00820 85327 85938 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099256.1 protein_id gnl|my_center|LOCUS_00820 86001 87029 gene locus_tag LOCUS_00830 gene glnL 86001 87029 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213151.1 protein_id gnl|my_center|LOCUS_00830 87029 88438 gene locus_tag LOCUS_00840 gene ntrC 87029 88438 CDS product two-component system response regulator NtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_00840 88435 89178 gene locus_tag LOCUS_00850 88435 89178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 89798 89193 gene locus_tag LOCUS_00860 89798 89193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 92628 89827 gene locus_tag LOCUS_00870 92628 89827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 93082 92639 gene locus_tag LOCUS_00880 93082 92639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 93923 93072 gene locus_tag LOCUS_00890 93923 93072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 94374 93925 gene locus_tag LOCUS_00900 94374 93925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 94859 94371 gene locus_tag LOCUS_00910 94859 94371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 95395 94985 gene locus_tag LOCUS_00920 95395 94985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 95871 95398 gene locus_tag LOCUS_00930 95871 95398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 95870 96922 gene locus_tag LOCUS_00940 gene tsaD 95870 96922 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204325.1 protein_id gnl|my_center|LOCUS_00940 96912 97274 gene locus_tag LOCUS_00950 gene folB 96912 97274 CDS product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465889.1 protein_id gnl|my_center|LOCUS_00950 98053 97298 gene locus_tag LOCUS_00960 98053 97298 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_00960 99206 98064 gene locus_tag LOCUS_00970 99206 98064 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958285.1 protein_id gnl|my_center|LOCUS_00970 99542 99270 gene locus_tag LOCUS_00980 99542 99270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 100155 99823 gene locus_tag LOCUS_00990 100155 99823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 100747 100142 gene locus_tag LOCUS_01000 100747 100142 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506786.1 protein_id gnl|my_center|LOCUS_01000 100810 102855 gene locus_tag LOCUS_01010 100810 102855 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038847.1 protein_id gnl|my_center|LOCUS_01010 102936 104648 gene locus_tag LOCUS_01020 gene argS 102936 104648 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958595.1 protein_id gnl|my_center|LOCUS_01020 104771 105262 gene locus_tag LOCUS_01030 104771 105262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 106415 105273 gene locus_tag LOCUS_01040 106415 105273 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958470.1 protein_id gnl|my_center|LOCUS_01040 108040 106448 gene locus_tag LOCUS_01050 gene ubiB 108040 106448 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095885.1 protein_id gnl|my_center|LOCUS_01050 108600 108037 gene locus_tag LOCUS_01060 108600 108037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 109349 108597 gene locus_tag LOCUS_01070 gene ubiE 109349 108597 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229009.1 protein_id gnl|my_center|LOCUS_01070 109696 109346 gene locus_tag LOCUS_01080 109696 109346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 110572 109703 gene locus_tag LOCUS_01090 gene xth 110572 109703 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812032.1 protein_id gnl|my_center|LOCUS_01090 110605 111159 gene locus_tag LOCUS_01100 110605 111159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 111716 111291 gene locus_tag LOCUS_01110 111716 111291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 111624 111875 gene locus_tag LOCUS_01120 111624 111875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 112474 111893 gene locus_tag LOCUS_01130 112474 111893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 113654 112479 gene locus_tag LOCUS_01140 gene mshG 113654 112479 CDS product MSHA fimbrial biogenesis protein MshG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704369.1 protein_id gnl|my_center|LOCUS_01140 115144 113708 gene locus_tag LOCUS_01150 gene mshE 115144 113708 CDS product MSHA fimbrial ATPase MshE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704368.1 protein_id gnl|my_center|LOCUS_01150 115058 115486 gene locus_tag LOCUS_01160 115058 115486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 116289 115435 gene locus_tag LOCUS_01170 116289 115435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 117131 116286 gene locus_tag LOCUS_01180 117131 116286 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073813.1 protein_id gnl|my_center|LOCUS_01180 118895 117144 gene locus_tag LOCUS_01190 gene mshL 118895 117144 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073814.1 protein_id gnl|my_center|LOCUS_01190 119254 118892 gene locus_tag LOCUS_01200 119254 118892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 119882 119235 gene locus_tag LOCUS_01210 119882 119235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 120526 119900 gene locus_tag LOCUS_01220 120526 119900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 121443 120523 gene locus_tag LOCUS_01230 gene mshI 121443 120523 CDS product MSHA fimbrial biogenesis protein MshI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704361.1 protein_id gnl|my_center|LOCUS_01230 122564 121599 gene locus_tag LOCUS_01240 122564 121599 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_01240 123541 122561 gene locus_tag LOCUS_01250 gene gpsA 123541 122561 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704301.1 protein_id gnl|my_center|LOCUS_01250 124046 123567 gene locus_tag LOCUS_01260 gene secB 124046 123567 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772050.1 protein_id gnl|my_center|LOCUS_01260 124345 124073 gene locus_tag LOCUS_01270 gene grxC 124345 124073 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772051.1 protein_id gnl|my_center|LOCUS_01270 124770 124342 gene locus_tag LOCUS_01280 124770 124342 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026029413.1 protein_id gnl|my_center|LOCUS_01280 125482 124808 gene locus_tag LOCUS_01290 125482 124808 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112747.1 protein_id gnl|my_center|LOCUS_01290 125604 127037 gene locus_tag LOCUS_01300 125604 127037 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945788.1 protein_id gnl|my_center|LOCUS_01300 127568 127759 gene locus_tag LOCUS_01310 127568 127759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 127844 128185 gene locus_tag LOCUS_01320 127844 128185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 129323 128466 gene locus_tag LOCUS_01330 129323 128466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 130192 129320 gene locus_tag LOCUS_01340 130192 129320 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036685.1 protein_id gnl|my_center|LOCUS_01340 130557 130189 gene locus_tag LOCUS_01350 130557 130189 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768967.1 protein_id gnl|my_center|LOCUS_01350 131867 130884 gene locus_tag LOCUS_01360 131867 130884 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886970.1 protein_id gnl|my_center|LOCUS_01360 132227 132652 gene locus_tag LOCUS_01370 132227 132652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01370 134533 132659 gene locus_tag LOCUS_01380 gene rpoD 134533 132659 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085035.1 protein_id gnl|my_center|LOCUS_01380 134979 134824 gene locus_tag LOCUS_01390 134979 134824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 135811 136011 gene locus_tag LOCUS_01400 135811 136011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 136936 138144 gene locus_tag LOCUS_01410 136936 138144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 138583 138317 gene locus_tag LOCUS_01420 138583 138317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 140250 138619 gene locus_tag LOCUS_01430 gene dnaG 140250 138619 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038900.1 protein_id gnl|my_center|LOCUS_01430 140720 140274 gene locus_tag LOCUS_01440 140720 140274 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190948.1 protein_id gnl|my_center|LOCUS_01440 140944 140729 gene locus_tag LOCUS_01450 gene rpsU 140944 140729 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 protein_id gnl|my_center|LOCUS_01450 141550 140990 gene locus_tag LOCUS_01460 141550 140990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 142530 141529 gene locus_tag LOCUS_01470 142530 141529 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327978.1 protein_id gnl|my_center|LOCUS_01470 143497 142520 gene locus_tag LOCUS_01480 143497 142520 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838603.1 protein_id gnl|my_center|LOCUS_01480 144888 143482 gene locus_tag LOCUS_01490 gene ablA 144888 143482 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_01490 145717 145641 gene locus_tag LOCUS_t00040 145717 145641 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 146765 145770 gene locus_tag LOCUS_01500 gene hemH 146765 145770 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073218.1 protein_id gnl|my_center|LOCUS_01500 148048 146762 gene locus_tag LOCUS_01510 148048 146762 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102247.1 protein_id gnl|my_center|LOCUS_01510 148206 148580 gene locus_tag LOCUS_01520 148206 148580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 150349 148646 gene locus_tag LOCUS_01530 150349 148646 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084137.1 protein_id gnl|my_center|LOCUS_01530 151080 150382 gene locus_tag LOCUS_01540 151080 150382 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010440639.1 protein_id gnl|my_center|LOCUS_01540 151042 151725 gene locus_tag LOCUS_01550 151042 151725 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_01550 151728 154208 gene locus_tag LOCUS_01560 151728 154208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 154205 155200 gene locus_tag LOCUS_01570 154205 155200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 156480 155119 gene locus_tag LOCUS_01580 156480 155119 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142346.1 protein_id gnl|my_center|LOCUS_01580 157243 156551 gene locus_tag LOCUS_01590 157243 156551 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816759.1 protein_id gnl|my_center|LOCUS_01590 157836 157240 gene locus_tag LOCUS_01600 157836 157240 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168199.1 protein_id gnl|my_center|LOCUS_01600 159244 157922 gene locus_tag LOCUS_01610 159244 157922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 159446 159928 gene locus_tag LOCUS_01620 159446 159928 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931240.1 protein_id gnl|my_center|LOCUS_01620 160018 161175 gene locus_tag LOCUS_01630 160018 161175 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036619.1 protein_id gnl|my_center|LOCUS_01630 161165 163528 gene locus_tag LOCUS_01640 161165 163528 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444009.1 protein_id gnl|my_center|LOCUS_01640 163832 163437 gene locus_tag LOCUS_01650 163832 163437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 164686 163829 gene locus_tag LOCUS_01660 164686 163829 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391113.1 protein_id gnl|my_center|LOCUS_01660 164754 166364 gene locus_tag LOCUS_01670 164754 166364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 167365 166370 gene locus_tag LOCUS_01680 gene yedA 167365 166370 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038991.1 protein_id gnl|my_center|LOCUS_01680 167591 168052 gene locus_tag LOCUS_01690 gene dtd 167591 168052 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038819.1 protein_id gnl|my_center|LOCUS_01690 168105 168335 gene locus_tag LOCUS_01700 168105 168335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 168415 168651 gene locus_tag LOCUS_01710 168415 168651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 168648 169400 gene locus_tag LOCUS_01720 gene tatC 168648 169400 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266364.1 protein_id gnl|my_center|LOCUS_01720 170304 169420 gene locus_tag LOCUS_01730 170304 169420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 170867 170301 gene locus_tag LOCUS_01740 170867 170301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 172922 171537 gene locus_tag LOCUS_01750 172922 171537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 173363 173890 gene locus_tag LOCUS_01760 173363 173890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 173943 174917 gene locus_tag LOCUS_01770 173943 174917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 175434 174940 gene locus_tag LOCUS_01780 175434 174940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 175869 175441 gene locus_tag LOCUS_01790 175869 175441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 176366 175878 gene locus_tag LOCUS_01800 176366 175878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 177062 176421 gene locus_tag LOCUS_01810 177062 176421 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_01810 178380 177139 gene locus_tag LOCUS_01820 gene rocD 178380 177139 CDS product ornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242970.1 protein_id gnl|my_center|LOCUS_01820 178520 179716 gene locus_tag LOCUS_01830 gene hemW 178520 179716 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114885.1 protein_id gnl|my_center|LOCUS_01830 182385 179686 gene locus_tag LOCUS_01840 gene pepN 182385 179686 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149504110.1 protein_id gnl|my_center|LOCUS_01840 183284 182658 gene locus_tag LOCUS_01850 183284 182658 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173616.1 protein_id gnl|my_center|LOCUS_01850 184066 183281 gene locus_tag LOCUS_01860 gene rph 184066 183281 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038353.1 protein_id gnl|my_center|LOCUS_01860 184229 184044 gene locus_tag LOCUS_01870 184229 184044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 184370 184672 gene locus_tag LOCUS_01880 184370 184672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 185716 185168 gene locus_tag LOCUS_01890 185716 185168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 186050 186126 gene locus_tag LOCUS_t00050 186050 186126 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 186835 186230 gene locus_tag LOCUS_01900 186835 186230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 188115 186832 gene locus_tag LOCUS_01910 188115 186832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 188564 188112 gene locus_tag LOCUS_01920 188564 188112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 189070 188561 gene locus_tag LOCUS_01930 189070 188561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 190154 189102 gene locus_tag LOCUS_01940 190154 189102 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187516.1 protein_id gnl|my_center|LOCUS_01940 191614 190151 gene locus_tag LOCUS_01950 191614 190151 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537540.1 protein_id gnl|my_center|LOCUS_01950 192171 191611 gene locus_tag LOCUS_01960 192171 191611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 193348 192152 gene locus_tag LOCUS_01970 193348 192152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 194886 193345 gene locus_tag LOCUS_01980 194886 193345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 195245 194874 gene locus_tag LOCUS_01990 195245 194874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 196390 195242 gene locus_tag LOCUS_02000 196390 195242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 196511 197938 gene locus_tag LOCUS_02010 196511 197938 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978087.1 protein_id gnl|my_center|LOCUS_02010 198860 197946 gene locus_tag LOCUS_02020 gene ubiA 198860 197946 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035644.1 protein_id gnl|my_center|LOCUS_02020 199480 198857 gene locus_tag LOCUS_02030 199480 198857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 200988 199477 gene locus_tag LOCUS_02040 200988 199477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 202626 201571 gene locus_tag LOCUS_02050 202626 201571 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948029.1 protein_id gnl|my_center|LOCUS_02050 203794 202637 gene locus_tag LOCUS_02060 gene pilU 203794 202637 CDS product type IV pilus ATPase PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_02060 204870 203806 gene locus_tag LOCUS_02070 204870 203806 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003489919.1 protein_id gnl|my_center|LOCUS_02070 204997 205782 gene locus_tag LOCUS_02080 gene proC 204997 205782 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769432.1 protein_id gnl|my_center|LOCUS_02080 205779 206321 gene locus_tag LOCUS_02090 205779 206321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 206487 206825 gene locus_tag LOCUS_02100 206487 206825 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957599.1 protein_id gnl|my_center|LOCUS_02100 207972 209288 gene locus_tag LOCUS_02110 gene gltA 207972 209288 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969265.1 protein_id gnl|my_center|LOCUS_02110 209943 209332 gene locus_tag LOCUS_02120 209943 209332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 212503 210014 gene locus_tag LOCUS_02130 212503 210014 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958515.1 protein_id gnl|my_center|LOCUS_02130 212603 213664 gene locus_tag LOCUS_02140 212603 213664 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 protein_id gnl|my_center|LOCUS_02140 213661 214272 gene locus_tag LOCUS_02150 gene pilN 213661 214272 CDS product type 4a pilus biogenesis protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_02150 214269 214913 gene locus_tag LOCUS_02160 gene pilO 214269 214913 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403037.1 protein_id gnl|my_center|LOCUS_02160 214910 215440 gene locus_tag LOCUS_02170 214910 215440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 215447 217594 gene locus_tag LOCUS_02180 gene pilQ 215447 217594 CDS product type IV pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946666.1 protein_id gnl|my_center|LOCUS_02180 218023 217748 gene locus_tag LOCUS_02190 218023 217748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 218744 218244 gene locus_tag LOCUS_02200 218744 218244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 218871 219065 gene locus_tag LOCUS_02210 218871 219065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 219116 219622 gene locus_tag LOCUS_02220 219116 219622 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357579.1 protein_id gnl|my_center|LOCUS_02220 219604 220713 gene locus_tag LOCUS_02230 gene aroB 219604 220713 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207828.1 protein_id gnl|my_center|LOCUS_02230 220710 221429 gene locus_tag LOCUS_02240 gene pyrF 220710 221429 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140020.1 protein_id gnl|my_center|LOCUS_02240 221426 222508 gene locus_tag LOCUS_02250 gene hemE 221426 222508 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444333.1 protein_id gnl|my_center|LOCUS_02250 222505 223140 gene locus_tag LOCUS_02260 gene gmk 222505 223140 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930442.1 protein_id gnl|my_center|LOCUS_02260 223193 223828 gene locus_tag LOCUS_02270 223193 223828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 223828 224826 gene locus_tag LOCUS_02280 223828 224826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 224823 225941 gene locus_tag LOCUS_02290 224823 225941 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_02290 225938 227164 gene locus_tag LOCUS_02300 225938 227164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 227161 228348 gene locus_tag LOCUS_02310 gene pseC 227161 228348 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_02310 228345 229013 gene locus_tag LOCUS_02320 gene wlbG 228345 229013 CDS product O-antigen biosynthesis protein WlbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038693.1 protein_id gnl|my_center|LOCUS_02320 229041 229301 gene locus_tag LOCUS_02330 229041 229301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 229497 229796 gene locus_tag LOCUS_02340 229497 229796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 230496 229900 gene locus_tag LOCUS_02350 230496 229900 CDS product fuculose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173835.1 protein_id gnl|my_center|LOCUS_02350 231212 230478 gene locus_tag LOCUS_02360 gene cpdA 231212 230478 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102066.1 protein_id gnl|my_center|LOCUS_02360 231283 231966 gene locus_tag LOCUS_02370 231283 231966 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_02370 232431 233015 gene locus_tag LOCUS_02380 232431 233015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02380 234495 233077 gene locus_tag LOCUS_02390 gene ahcY 234495 233077 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125935.1 protein_id gnl|my_center|LOCUS_02390 235686 234508 gene locus_tag LOCUS_02400 gene metK 235686 234508 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817040.1 protein_id gnl|my_center|LOCUS_02400 236618 235743 gene locus_tag LOCUS_02410 gene pstA 236618 235743 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404794.1 protein_id gnl|my_center|LOCUS_02410 237558 236611 gene locus_tag LOCUS_02420 gene pstC 237558 236611 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404792.1 protein_id gnl|my_center|LOCUS_02420 238643 237573 gene locus_tag LOCUS_02430 gene pstS 238643 237573 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900236.1 protein_id gnl|my_center|LOCUS_02430 238919 240886 gene locus_tag LOCUS_02440 gene tkt 238919 240886 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080531.1 protein_id gnl|my_center|LOCUS_02440 240883 241893 gene locus_tag LOCUS_02450 gene gap 240883 241893 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522067.1 protein_id gnl|my_center|LOCUS_02450 241896 243086 gene locus_tag LOCUS_02460 241896 243086 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038295.1 protein_id gnl|my_center|LOCUS_02460 243086 244516 gene locus_tag LOCUS_02470 gene pyk 243086 244516 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453949.1 protein_id gnl|my_center|LOCUS_02470 244572 244937 gene locus_tag LOCUS_02480 244572 244937 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196851.1 protein_id gnl|my_center|LOCUS_02480 245828 244974 gene locus_tag LOCUS_02490 gene murI 245828 244974 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938069.1 protein_id gnl|my_center|LOCUS_02490 246433 245825 gene locus_tag LOCUS_02500 246433 245825 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705602.1 protein_id gnl|my_center|LOCUS_02500 246553 247077 gene locus_tag LOCUS_02510 gene ppa 246553 247077 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055068.1 protein_id gnl|my_center|LOCUS_02510 247132 247584 gene locus_tag LOCUS_02520 gene rplM 247132 247584 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483082.1 protein_id gnl|my_center|LOCUS_02520 247620 248018 gene locus_tag LOCUS_02530 gene rpsI 247620 248018 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631594.1 protein_id gnl|my_center|LOCUS_02530 248033 248106 gene locus_tag LOCUS_t00060 248033 248106 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 248572 248234 gene locus_tag LOCUS_02540 248572 248234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 248859 248569 gene locus_tag LOCUS_02550 248859 248569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 249769 252267 gene locus_tag LOCUS_02560 249769 252267 CDS product bifunctional glycoside hydrolase 114/ polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113950.1 protein_id gnl|my_center|LOCUS_02560 252227 253084 gene locus_tag LOCUS_02570 252227 253084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 253081 256287 gene locus_tag LOCUS_02580 253081 256287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 256313 256849 gene locus_tag LOCUS_02590 256313 256849 CDS product pellicle/biofilm biosynthesis outer membrane protein PelC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091288.1 protein_id gnl|my_center|LOCUS_02590 256906 258135 gene locus_tag LOCUS_02600 256906 258135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 258135 259049 gene locus_tag LOCUS_02610 258135 259049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 259049 260545 gene locus_tag LOCUS_02620 gene pelF 259049 260545 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113954.1 protein_id gnl|my_center|LOCUS_02620 260548 261918 gene locus_tag LOCUS_02630 gene pelG 260548 261918 CDS product exopolysaccharide Pel transporter PelG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091283.1 protein_id gnl|my_center|LOCUS_02630 261926 262879 gene locus_tag LOCUS_02640 261926 262879 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400349.1 protein_id gnl|my_center|LOCUS_02640 263175 263363 gene locus_tag LOCUS_02650 263175 263363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 264005 265261 gene locus_tag LOCUS_02660 264005 265261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 265254 266375 gene locus_tag LOCUS_02670 gene wecB 265254 266375 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_02670 267230 266538 gene locus_tag LOCUS_02680 gene rpiA 267230 266538 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038367.1 protein_id gnl|my_center|LOCUS_02680 267690 267322 gene locus_tag LOCUS_02690 267690 267322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 268260 267763 gene locus_tag LOCUS_02700 268260 267763 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110309.1 protein_id gnl|my_center|LOCUS_02700 268865 268257 gene locus_tag LOCUS_02710 268865 268257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 269416 269096 gene locus_tag LOCUS_02720 269416 269096 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038364.1 protein_id gnl|my_center|LOCUS_02720 269628 269413 gene locus_tag LOCUS_02730 269628 269413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 269779 271095 gene locus_tag LOCUS_02740 gene pepP 269779 271095 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_02740 271092 272276 gene locus_tag LOCUS_02750 271092 272276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 272273 273445 gene locus_tag LOCUS_02760 272273 273445 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266320.1 protein_id gnl|my_center|LOCUS_02760 273445 276045 gene locus_tag LOCUS_02770 273445 276045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 276054 279371 gene locus_tag LOCUS_02780 276054 279371 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064283.1 protein_id gnl|my_center|LOCUS_02780 279371 281635 gene locus_tag LOCUS_02790 gene parC 279371 281635 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958500.1 protein_id gnl|my_center|LOCUS_02790 283722 281665 gene locus_tag LOCUS_02800 283722 281665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 284775 283738 gene locus_tag LOCUS_02810 gene epmB 284775 283738 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037417.1 protein_id gnl|my_center|LOCUS_02810 284851 285420 gene locus_tag LOCUS_02820 gene efp 284851 285420 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444882.1 protein_id gnl|my_center|LOCUS_02820 285417 286373 gene locus_tag LOCUS_02830 gene epmA 285417 286373 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065622721.1 protein_id gnl|my_center|LOCUS_02830 286370 286912 gene locus_tag LOCUS_02840 286370 286912 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806996.1 protein_id gnl|my_center|LOCUS_02840 287862 286930 gene locus_tag LOCUS_02850 gene asd 287862 286930 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113924.1 protein_id gnl|my_center|LOCUS_02850 287849 288787 gene locus_tag LOCUS_02860 gene prmB 287849 288787 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072977.1 protein_id gnl|my_center|LOCUS_02860 288777 289871 gene locus_tag LOCUS_02870 gene aroC 288777 289871 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706197.1 protein_id gnl|my_center|LOCUS_02870 289868 290899 gene locus_tag LOCUS_02880 289868 290899 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948008.1 protein_id gnl|my_center|LOCUS_02880 290966 293107 gene locus_tag LOCUS_02890 290966 293107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 293100 293918 gene locus_tag LOCUS_02900 gene truA 293100 293918 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037676.1 protein_id gnl|my_center|LOCUS_02900 293944 294801 gene locus_tag LOCUS_02910 gene accD 293944 294801 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318491.1 protein_id gnl|my_center|LOCUS_02910 294798 296123 gene locus_tag LOCUS_02920 gene folC 294798 296123 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039854.1 protein_id gnl|my_center|LOCUS_02920 296116 296700 gene locus_tag LOCUS_02930 296116 296700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 296697 297182 gene locus_tag LOCUS_02940 296697 297182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 297187 298659 gene locus_tag LOCUS_02950 gene purF 297187 298659 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091383.1 protein_id gnl|my_center|LOCUS_02950 299385 298666 gene locus_tag LOCUS_02960 gene lpxH 299385 298666 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706567.1 protein_id gnl|my_center|LOCUS_02960 299572 299862 gene locus_tag LOCUS_02970 gene groES 299572 299862 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946424.1 protein_id gnl|my_center|LOCUS_02970 299927 301558 gene locus_tag LOCUS_02980 gene groL 299927 301558 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035771.1 protein_id gnl|my_center|LOCUS_02980 >Feature sequence02 130 2067 gene locus_tag LOCUS_02990 gene tdc 130 2067 CDS product tyrosine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286400.1 protein_id gnl|my_center|LOCUS_02990 2426 3553 gene locus_tag LOCUS_03000 2426 3553 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038728.1 protein_id gnl|my_center|LOCUS_03000 4133 3684 gene locus_tag LOCUS_03010 4133 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 4243 5895 gene locus_tag LOCUS_03020 4243 5895 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092366.1 protein_id gnl|my_center|LOCUS_03020 5892 6725 gene locus_tag LOCUS_03030 gene kdsA 5892 6725 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946916.1 protein_id gnl|my_center|LOCUS_03030 6722 7120 gene locus_tag LOCUS_03040 gene ftsB 6722 7120 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209390.1 protein_id gnl|my_center|LOCUS_03040 7117 7902 gene locus_tag LOCUS_03050 7117 7902 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036346.1 protein_id gnl|my_center|LOCUS_03050 8493 7939 gene locus_tag LOCUS_03060 8493 7939 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161962652.1 protein_id gnl|my_center|LOCUS_03060 8532 9329 gene locus_tag LOCUS_03070 gene surE 8532 9329 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770587.1 protein_id gnl|my_center|LOCUS_03070 9322 9996 gene locus_tag LOCUS_03080 9322 9996 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928874.1 protein_id gnl|my_center|LOCUS_03080 9933 10706 gene locus_tag LOCUS_03090 9933 10706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 10706 11710 gene locus_tag LOCUS_03100 gene rpoS 10706 11710 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113871.1 protein_id gnl|my_center|LOCUS_03100 12096 11698 gene locus_tag LOCUS_03110 12096 11698 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389515.1 protein_id gnl|my_center|LOCUS_03110 12168 14042 gene locus_tag LOCUS_03120 gene recJ 12168 14042 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020281.1 protein_id gnl|my_center|LOCUS_03120 14529 15542 gene locus_tag LOCUS_03130 gene prfB 14529 15542 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098729101.1 protein_id gnl|my_center|LOCUS_03130 15539 17077 gene locus_tag LOCUS_03140 gene lysS 15539 17077 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037023.1 protein_id gnl|my_center|LOCUS_03140 18061 17102 gene locus_tag LOCUS_03150 gene trxB 18061 17102 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941156.1 protein_id gnl|my_center|LOCUS_03150 18169 19227 gene locus_tag LOCUS_03160 gene ald 18169 19227 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107857.1 protein_id gnl|my_center|LOCUS_03160 19358 21622 gene locus_tag LOCUS_03170 19358 21622 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037136.1 protein_id gnl|my_center|LOCUS_03170 21622 22317 gene locus_tag LOCUS_03180 21622 22317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 22314 23636 gene locus_tag LOCUS_03190 22314 23636 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_03190 23673 24959 gene locus_tag LOCUS_03200 gene serS 23673 24959 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008499983.1 protein_id gnl|my_center|LOCUS_03200 24956 26596 gene locus_tag LOCUS_03210 gene pgm 24956 26596 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268077.1 protein_id gnl|my_center|LOCUS_03210 26802 28100 gene locus_tag LOCUS_03220 26802 28100 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724487.1 protein_id gnl|my_center|LOCUS_03220 29076 28156 gene locus_tag LOCUS_03230 29076 28156 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037285.1 protein_id gnl|my_center|LOCUS_03230 29051 29311 gene locus_tag LOCUS_03240 29051 29311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 29333 29713 gene locus_tag LOCUS_03250 gene sdhC 29333 29713 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083343.1 protein_id gnl|my_center|LOCUS_03250 29727 30104 gene locus_tag LOCUS_03260 29727 30104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 30107 31888 gene locus_tag LOCUS_03270 gene sdhA 30107 31888 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265974.1 protein_id gnl|my_center|LOCUS_03270 31913 32695 gene locus_tag LOCUS_03280 31913 32695 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972458.1 protein_id gnl|my_center|LOCUS_03280 32718 32999 gene locus_tag LOCUS_03290 32718 32999 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507842.1 protein_id gnl|my_center|LOCUS_03290 33673 33311 gene locus_tag LOCUS_03300 33673 33311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 34664 33717 gene locus_tag LOCUS_03310 gene hpnK 34664 33717 CDS product hopanoid biosynthesis-associated protein HpnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552372.1 protein_id gnl|my_center|LOCUS_03310 36111 34678 gene locus_tag LOCUS_03320 gene hpnJ 36111 34678 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196953.1 protein_id gnl|my_center|LOCUS_03320 37262 36108 gene locus_tag LOCUS_03330 gene hpnI 37262 36108 CDS product bacteriohopanetetrol glucosamine biosynthesis glycosyltransferase HpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197829.1 protein_id gnl|my_center|LOCUS_03330 37396 38427 gene locus_tag LOCUS_03340 37396 38427 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529382.1 protein_id gnl|my_center|LOCUS_03340 38357 38566 gene locus_tag LOCUS_03350 38357 38566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 38563 39660 gene locus_tag LOCUS_03360 38563 39660 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554743.1 protein_id gnl|my_center|LOCUS_03360 39690 41663 gene locus_tag LOCUS_03370 gene shc 39690 41663 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085788.1 protein_id gnl|my_center|LOCUS_03370 41651 42388 gene locus_tag LOCUS_03380 41651 42388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 42594 43607 gene locus_tag LOCUS_03390 gene mvaD 42594 43607 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101527.1 protein_id gnl|my_center|LOCUS_03390 43604 46270 gene locus_tag LOCUS_03400 43604 46270 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387818.1 protein_id gnl|my_center|LOCUS_03400 46273 47358 gene locus_tag LOCUS_03410 46273 47358 CDS product HpnL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206084.1 protein_id gnl|my_center|LOCUS_03410 47481 49769 gene locus_tag LOCUS_03420 47481 49769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 49759 50391 gene locus_tag LOCUS_03430 gene idi 49759 50391 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 protein_id gnl|my_center|LOCUS_03430 50412 51554 gene locus_tag LOCUS_03440 gene hpnH 50412 51554 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187762.1 protein_id gnl|my_center|LOCUS_03440 52594 51551 gene locus_tag LOCUS_03450 52594 51551 CDS product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700070.1 protein_id gnl|my_center|LOCUS_03450 52821 54038 gene locus_tag LOCUS_03460 52821 54038 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876399.1 protein_id gnl|my_center|LOCUS_03460 54086 54175 gene locus_tag LOCUS_t00070 54086 54175 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 54456 55460 gene locus_tag LOCUS_03470 54456 55460 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735619.1 protein_id gnl|my_center|LOCUS_03470 56378 55599 gene locus_tag LOCUS_03480 56378 55599 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704187.1 protein_id gnl|my_center|LOCUS_03480 56634 56350 gene locus_tag LOCUS_03490 56634 56350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 56877 56650 gene locus_tag LOCUS_03500 56877 56650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 >Feature sequence03 2388 1000 gene locus_tag LOCUS_03510 2388 1000 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198049.1 protein_id gnl|my_center|LOCUS_03510 2772 3287 gene locus_tag LOCUS_03520 2772 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 3314 3556 gene locus_tag LOCUS_03530 gene rpsR 3314 3556 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095634.1 protein_id gnl|my_center|LOCUS_03530 3606 4577 gene locus_tag LOCUS_03540 3606 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 4793 5242 gene locus_tag LOCUS_03550 gene rplI 4793 5242 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095627.1 protein_id gnl|my_center|LOCUS_03550 5289 6680 gene locus_tag LOCUS_03560 gene dnaB 5289 6680 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946475.1 protein_id gnl|my_center|LOCUS_03560 6707 7858 gene locus_tag LOCUS_03570 gene dadX 6707 7858 CDS product catabolic alanine racemase DadX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705840.1 protein_id gnl|my_center|LOCUS_03570 7948 9264 gene locus_tag LOCUS_03580 gene radA 7948 9264 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928233.1 protein_id gnl|my_center|LOCUS_03580 9807 9286 gene locus_tag LOCUS_03590 9807 9286 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313469.1 protein_id gnl|my_center|LOCUS_03590 11864 9831 gene locus_tag LOCUS_03600 11864 9831 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036460.1 protein_id gnl|my_center|LOCUS_03600 12539 11913 gene locus_tag LOCUS_03610 12539 11913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 13373 12552 gene locus_tag LOCUS_03620 13373 12552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 13797 13531 gene locus_tag LOCUS_03630 13797 13531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 13714 14655 gene locus_tag LOCUS_03640 13714 14655 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920885.1 protein_id gnl|my_center|LOCUS_03640 16028 14631 gene locus_tag LOCUS_03650 gene glgA 16028 14631 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040961719.1 protein_id gnl|my_center|LOCUS_03650 17905 16025 gene locus_tag LOCUS_03660 gene glgB 17905 16025 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939518.1 protein_id gnl|my_center|LOCUS_03660 18158 19411 gene locus_tag LOCUS_03670 gene glgC 18158 19411 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706551.1 protein_id gnl|my_center|LOCUS_03670 19655 20338 gene locus_tag LOCUS_03680 gene carO 19655 20338 CDS product ornithine uptake porin CarO type 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207379.1 protein_id gnl|my_center|LOCUS_03680 21744 20461 gene locus_tag LOCUS_03690 gene eno 21744 20461 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869074.1 protein_id gnl|my_center|LOCUS_03690 22243 23259 gene locus_tag LOCUS_03700 gene dusA 22243 23259 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073658.1 protein_id gnl|my_center|LOCUS_03700 25019 23208 gene locus_tag LOCUS_03710 25019 23208 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258194.1 protein_id gnl|my_center|LOCUS_03710 26733 25087 gene locus_tag LOCUS_03720 26733 25087 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186395.1 protein_id gnl|my_center|LOCUS_03720 26936 26730 gene locus_tag LOCUS_03730 26936 26730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 27917 27171 gene locus_tag LOCUS_03740 gene pgl 27917 27171 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056919.1 protein_id gnl|my_center|LOCUS_03740 29299 27914 gene locus_tag LOCUS_03750 gene zwf 29299 27914 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974206.1 protein_id gnl|my_center|LOCUS_03750 30315 29296 gene locus_tag LOCUS_03760 gene gnd 30315 29296 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528920.1 protein_id gnl|my_center|LOCUS_03760 33024 30409 gene locus_tag LOCUS_03770 33024 30409 CDS product bifunctional transaldolase/phosoglucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402866.1 protein_id gnl|my_center|LOCUS_03770 35452 33125 gene locus_tag LOCUS_03780 35452 33125 CDS product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974204.1 protein_id gnl|my_center|LOCUS_03780 36697 35471 gene locus_tag LOCUS_03790 gene xcpS 36697 35471 CDS product GspF family T2SS innner membrane protein variant XcpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091376.1 protein_id gnl|my_center|LOCUS_03790 38100 36700 gene locus_tag LOCUS_03800 gene xcpR 38100 36700 CDS product GspE family T2SS ATPase variant XcpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091377.1 protein_id gnl|my_center|LOCUS_03800 40148 38232 gene locus_tag LOCUS_03810 gene gspD 40148 38232 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498847.1 protein_id gnl|my_center|LOCUS_03810 40849 40355 gene locus_tag LOCUS_03820 40849 40355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 41396 41746 gene locus_tag LOCUS_03830 41396 41746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 41746 44019 gene locus_tag LOCUS_03840 gene clpA 41746 44019 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317954.1 protein_id gnl|my_center|LOCUS_03840 44093 44911 gene locus_tag LOCUS_03850 44093 44911 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063753.1 protein_id gnl|my_center|LOCUS_03850 45663 46652 gene locus_tag LOCUS_03860 45663 46652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 48853 46742 gene locus_tag LOCUS_03870 48853 46742 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_03870 49421 50047 gene locus_tag LOCUS_03880 49421 50047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 50186 51499 gene locus_tag LOCUS_03890 50186 51499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 >Feature sequence04 <1 843 gene locus_tag LOCUS_03900 <1 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009939035.1:excinuclease ABC subunit UvrA 954 2648 gene locus_tag LOCUS_03910 954 2648 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388194.1 protein_id gnl|my_center|LOCUS_03910 2795 3412 gene locus_tag LOCUS_03920 gene ccmA 2795 3412 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895571.1 protein_id gnl|my_center|LOCUS_03920 3409 4068 gene locus_tag LOCUS_03930 gene ccmB 3409 4068 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705298.1 protein_id gnl|my_center|LOCUS_03930 4072 4836 gene locus_tag LOCUS_03940 gene ccmC 4072 4836 CDS product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036839.1 protein_id gnl|my_center|LOCUS_03940 4833 5003 gene locus_tag LOCUS_03950 4833 5003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 5028 5474 gene locus_tag LOCUS_03960 gene ccmE 5028 5474 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107323.1 protein_id gnl|my_center|LOCUS_03960 5471 7447 gene locus_tag LOCUS_03970 5471 7447 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765253.1 protein_id gnl|my_center|LOCUS_03970 7444 7998 gene locus_tag LOCUS_03980 7444 7998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 7995 8453 gene locus_tag LOCUS_03990 7995 8453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 8450 9694 gene locus_tag LOCUS_04000 gene ccmI 8450 9694 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063825.1 protein_id gnl|my_center|LOCUS_04000 9694 10602 gene locus_tag LOCUS_04010 9694 10602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 10636 11532 gene locus_tag LOCUS_04020 10636 11532 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220518.1 protein_id gnl|my_center|LOCUS_04020 11594 12343 gene locus_tag LOCUS_04030 11594 12343 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188660.1 protein_id gnl|my_center|LOCUS_04030 12711 13448 gene locus_tag LOCUS_04040 12711 13448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 13772 13688 gene locus_tag LOCUS_t00080 13772 13688 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13860 16049 gene locus_tag LOCUS_04050 gene rnr 13860 16049 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407829.1 protein_id gnl|my_center|LOCUS_04050 16050 16871 gene locus_tag LOCUS_04060 gene rlmB 16050 16871 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887393.1 protein_id gnl|my_center|LOCUS_04060 17077 19077 gene locus_tag LOCUS_04070 17077 19077 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038053.1 protein_id gnl|my_center|LOCUS_04070 19058 19720 gene locus_tag LOCUS_04080 gene tsaB 19058 19720 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029839.1 protein_id gnl|my_center|LOCUS_04080 19796 20518 gene locus_tag LOCUS_04090 gene phoB 19796 20518 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036177.1 protein_id gnl|my_center|LOCUS_04090 20515 21837 gene locus_tag LOCUS_04100 20515 21837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 21875 22654 gene locus_tag LOCUS_04110 21875 22654 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405915.1 protein_id gnl|my_center|LOCUS_04110 22684 23517 gene locus_tag LOCUS_04120 22684 23517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 23514 24263 gene locus_tag LOCUS_04130 gene phoU 23514 24263 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005334097.1 protein_id gnl|my_center|LOCUS_04130 24260 24745 gene locus_tag LOCUS_04140 24260 24745 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207954.1 protein_id gnl|my_center|LOCUS_04140 25922 24765 gene locus_tag LOCUS_04150 gene dapE 25922 24765 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705377.1 protein_id gnl|my_center|LOCUS_04150 26734 25919 gene locus_tag LOCUS_04160 gene dapD 26734 25919 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812536.1 protein_id gnl|my_center|LOCUS_04160 27954 26707 gene locus_tag LOCUS_04170 gene dapC 27954 26707 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092403.1 protein_id gnl|my_center|LOCUS_04170 28736 27969 gene locus_tag LOCUS_04180 gene map 28736 27969 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036574.1 protein_id gnl|my_center|LOCUS_04180 28987 29916 gene locus_tag LOCUS_04190 gene rpsB 28987 29916 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193246.1 protein_id gnl|my_center|LOCUS_04190 29948 30823 gene locus_tag LOCUS_04200 gene tsf 29948 30823 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947440.1 protein_id gnl|my_center|LOCUS_04200 30789 31619 gene locus_tag LOCUS_04210 gene pyrH 30789 31619 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036563.1 protein_id gnl|my_center|LOCUS_04210 31616 32173 gene locus_tag LOCUS_04220 gene frr 31616 32173 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947438.1 protein_id gnl|my_center|LOCUS_04220 32175 32912 gene locus_tag LOCUS_04230 32175 32912 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140112.1 protein_id gnl|my_center|LOCUS_04230 33208 32876 gene locus_tag LOCUS_04240 33208 32876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 33179 33730 gene locus_tag LOCUS_04250 33179 33730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 33771 35132 gene locus_tag LOCUS_04260 gene rseP 33771 35132 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406254.1 protein_id gnl|my_center|LOCUS_04260 35195 37609 gene locus_tag LOCUS_04270 gene bamA 35195 37609 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266976.1 protein_id gnl|my_center|LOCUS_04270 37621 38193 gene locus_tag LOCUS_04280 37621 38193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 38198 39247 gene locus_tag LOCUS_04290 gene lpxD 38198 39247 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098585.1 protein_id gnl|my_center|LOCUS_04290 39228 39695 gene locus_tag LOCUS_04300 gene fabZ 39228 39695 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192266.1 protein_id gnl|my_center|LOCUS_04300 39713 40480 gene locus_tag LOCUS_04310 gene lpxA 39713 40480 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811774.1 protein_id gnl|my_center|LOCUS_04310 40582 41625 gene locus_tag LOCUS_04320 gene lpxB 40582 41625 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113865.1 protein_id gnl|my_center|LOCUS_04320 41622 42218 gene locus_tag LOCUS_04330 gene rnhB 41622 42218 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063751.1 protein_id gnl|my_center|LOCUS_04330 42215 45703 gene locus_tag LOCUS_04340 gene dnaE 42215 45703 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958160.1 protein_id gnl|my_center|LOCUS_04340 45753 46718 gene locus_tag LOCUS_04350 gene accA 45753 46718 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349878.1 protein_id gnl|my_center|LOCUS_04350 46971 46687 gene locus_tag LOCUS_04360 46971 46687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 46867 48099 gene locus_tag LOCUS_04370 gene tilS 46867 48099 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418721.1 protein_id gnl|my_center|LOCUS_04370 48537 48812 gene locus_tag LOCUS_04380 48537 48812 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888120.1 protein_id gnl|my_center|LOCUS_04380 48812 49147 gene locus_tag LOCUS_04390 48812 49147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 49606 49256 gene locus_tag LOCUS_04400 gene fosX 49606 49256 CDS product FosX/FosE/FosI family fosfomycin resistance hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014794455.1 protein_id gnl|my_center|LOCUS_04400 49490 49882 gene locus_tag LOCUS_04410 49490 49882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 49932 50381 gene locus_tag LOCUS_04420 49932 50381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04420 50711 50427 gene locus_tag LOCUS_04430 50711 50427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 50946 50671 gene locus_tag LOCUS_04440 50946 50671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 50887 51117 gene locus_tag LOCUS_04450 50887 51117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04450 >Feature sequence05 672 43 gene locus_tag LOCUS_04460 672 43 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036216.1 protein_id gnl|my_center|LOCUS_04460 839 1036 gene locus_tag LOCUS_04470 gene rpmF 839 1036 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947121.1 protein_id gnl|my_center|LOCUS_04470 1058 2095 gene locus_tag LOCUS_04480 gene plsX 1058 2095 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065089.1 protein_id gnl|my_center|LOCUS_04480 2092 3075 gene locus_tag LOCUS_04490 2092 3075 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 protein_id gnl|my_center|LOCUS_04490 3874 3044 gene locus_tag LOCUS_04500 3874 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 4536 3871 gene locus_tag LOCUS_04510 4536 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04510 5372 4533 gene locus_tag LOCUS_04520 5372 4533 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947174.1 protein_id gnl|my_center|LOCUS_04520 6563 5379 gene locus_tag LOCUS_04530 6563 5379 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191887.1 protein_id gnl|my_center|LOCUS_04530 7315 6617 gene locus_tag LOCUS_04540 7315 6617 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958411.1 protein_id gnl|my_center|LOCUS_04540 7428 7343 gene locus_tag LOCUS_t00090 7428 7343 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7465 7767 gene locus_tag LOCUS_04550 7465 7767 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689792.1 protein_id gnl|my_center|LOCUS_04550 7772 8104 gene locus_tag LOCUS_04560 7772 8104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 8101 9021 gene locus_tag LOCUS_04570 8101 9021 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529440.1 protein_id gnl|my_center|LOCUS_04570 11196 9121 gene locus_tag LOCUS_04580 gene ligA 11196 9121 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213368.1 protein_id gnl|my_center|LOCUS_04580 14687 11202 gene locus_tag LOCUS_04590 gene smc 14687 11202 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205139.1 protein_id gnl|my_center|LOCUS_04590 14795 15244 gene locus_tag LOCUS_04600 14795 15244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 15478 16416 gene locus_tag LOCUS_04610 15478 16416 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972807.1 protein_id gnl|my_center|LOCUS_04610 16409 17290 gene locus_tag LOCUS_04620 16409 17290 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972808.1 protein_id gnl|my_center|LOCUS_04620 17293 18300 gene locus_tag LOCUS_04630 17293 18300 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143950639.1 protein_id gnl|my_center|LOCUS_04630 18297 19289 gene locus_tag LOCUS_04640 18297 19289 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027033306.1 protein_id gnl|my_center|LOCUS_04640 19299 20972 gene locus_tag LOCUS_04650 19299 20972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 21668 21096 gene locus_tag LOCUS_04660 21668 21096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 22851 21751 gene locus_tag LOCUS_04670 gene ychF 22851 21751 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815179.1 protein_id gnl|my_center|LOCUS_04670 23440 22853 gene locus_tag LOCUS_04680 gene pth 23440 22853 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687802.1 protein_id gnl|my_center|LOCUS_04680 24136 23453 gene locus_tag LOCUS_04690 24136 23453 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099279.1 protein_id gnl|my_center|LOCUS_04690 25197 24193 gene locus_tag LOCUS_04700 25197 24193 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195243.1 protein_id gnl|my_center|LOCUS_04700 25271 25197 gene locus_tag LOCUS_t00100 25271 25197 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 26024 25371 gene locus_tag LOCUS_04710 26024 25371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 27734 26028 gene locus_tag LOCUS_04720 27734 26028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 27853 29169 gene locus_tag LOCUS_04730 gene hemA 27853 29169 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095001.1 protein_id gnl|my_center|LOCUS_04730 29166 30248 gene locus_tag LOCUS_04740 29166 30248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 31241 30267 gene locus_tag LOCUS_04750 31241 30267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 32783 31248 gene locus_tag LOCUS_04760 32783 31248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 33787 32807 gene locus_tag LOCUS_04770 33787 32807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 33935 34147 gene locus_tag LOCUS_04780 33935 34147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 34939 34445 gene locus_tag LOCUS_04790 34939 34445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 36153 34969 gene locus_tag LOCUS_04800 36153 34969 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 protein_id gnl|my_center|LOCUS_04800 37547 36150 gene locus_tag LOCUS_04810 37547 36150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 37577 38479 gene locus_tag LOCUS_04820 gene prmC 37577 38479 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706934.1 protein_id gnl|my_center|LOCUS_04820 38959 38495 gene locus_tag LOCUS_04830 38959 38495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 39676 39041 gene locus_tag LOCUS_04840 39676 39041 CDS product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351085.1 protein_id gnl|my_center|LOCUS_04840 39725 40486 gene locus_tag LOCUS_04850 39725 40486 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365615.1 protein_id gnl|my_center|LOCUS_04850 41925 40483 gene locus_tag LOCUS_04860 gene gatB 41925 40483 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552444.1 protein_id gnl|my_center|LOCUS_04860 43382 41937 gene locus_tag LOCUS_04870 gene gatA 43382 41937 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772005.1 protein_id gnl|my_center|LOCUS_04870 43672 43379 gene locus_tag LOCUS_04880 gene gatC 43672 43379 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555109.1 protein_id gnl|my_center|LOCUS_04880 43799 44845 gene locus_tag LOCUS_04890 43799 44845 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007651015.1 protein_id gnl|my_center|LOCUS_04890 44858 45763 gene locus_tag LOCUS_04900 44858 45763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 45760 46230 gene locus_tag LOCUS_04910 gene mreD 45760 46230 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094389.1 protein_id gnl|my_center|LOCUS_04910 >Feature sequence06 2913 205 gene locus_tag LOCUS_04920 gene polA 2913 205 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039091.1 protein_id gnl|my_center|LOCUS_04920 3108 4433 gene locus_tag LOCUS_04930 3108 4433 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522602.1 protein_id gnl|my_center|LOCUS_04930 5022 4417 gene locus_tag LOCUS_04940 5022 4417 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200504.1 protein_id gnl|my_center|LOCUS_04940 5701 5039 gene locus_tag LOCUS_04950 5701 5039 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038262.1 protein_id gnl|my_center|LOCUS_04950 6141 5698 gene locus_tag LOCUS_04960 6141 5698 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087490.1 protein_id gnl|my_center|LOCUS_04960 6928 6248 gene locus_tag LOCUS_04970 6928 6248 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_04970 7653 6925 gene locus_tag LOCUS_04980 7653 6925 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530319.1 protein_id gnl|my_center|LOCUS_04980 9867 7675 gene locus_tag LOCUS_04990 gene uvrD 9867 7675 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703984.1 protein_id gnl|my_center|LOCUS_04990 9921 10802 gene locus_tag LOCUS_05000 9921 10802 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_05000 10896 11999 gene locus_tag LOCUS_05010 10896 11999 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015931.1 protein_id gnl|my_center|LOCUS_05010 12154 13548 gene locus_tag LOCUS_05020 12154 13548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 16066 13484 gene locus_tag LOCUS_05030 gene ppsA 16066 13484 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941469.1 protein_id gnl|my_center|LOCUS_05030 16318 17307 gene locus_tag LOCUS_05040 gene bioB 16318 17307 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072679.1 protein_id gnl|my_center|LOCUS_05040 17304 18494 gene locus_tag LOCUS_05050 gene bioF 17304 18494 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113248.1 protein_id gnl|my_center|LOCUS_05050 18500 19324 gene locus_tag LOCUS_05060 gene bioC 18500 19324 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035637.1 protein_id gnl|my_center|LOCUS_05060 19321 20022 gene locus_tag LOCUS_05070 gene bioD 19321 20022 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044849.1 protein_id gnl|my_center|LOCUS_05070 20034 20621 gene locus_tag LOCUS_05080 20034 20621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 20648 21508 gene locus_tag LOCUS_05090 20648 21508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 21614 23194 gene locus_tag LOCUS_05100 gene ctaD 21614 23194 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074203.1 protein_id gnl|my_center|LOCUS_05100 23134 23340 gene locus_tag LOCUS_05110 23134 23340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 23414 24298 gene locus_tag LOCUS_05120 23414 24298 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038909.1 protein_id gnl|my_center|LOCUS_05120 24524 24318 gene locus_tag LOCUS_05130 24524 24318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 24595 25323 gene locus_tag LOCUS_05140 24595 25323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 25316 25939 gene locus_tag LOCUS_05150 25316 25939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 25952 26983 gene locus_tag LOCUS_05160 25952 26983 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115033.1 protein_id gnl|my_center|LOCUS_05160 26992 27915 gene locus_tag LOCUS_05170 gene cyoE 26992 27915 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074210.1 protein_id gnl|my_center|LOCUS_05170 28905 28033 gene locus_tag LOCUS_05180 gene rpoH 28905 28033 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038853.1 protein_id gnl|my_center|LOCUS_05180 29086 29664 gene locus_tag LOCUS_05190 29086 29664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 29624 30814 gene locus_tag LOCUS_05200 29624 30814 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038731.1 protein_id gnl|my_center|LOCUS_05200 30889 31659 gene locus_tag LOCUS_05210 30889 31659 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037001.1 protein_id gnl|my_center|LOCUS_05210 31656 33287 gene locus_tag LOCUS_05220 31656 33287 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035873.1 protein_id gnl|my_center|LOCUS_05220 33345 34094 gene locus_tag LOCUS_05230 33345 34094 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035863.1 protein_id gnl|my_center|LOCUS_05230 34097 35065 gene locus_tag LOCUS_05240 34097 35065 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035862.1 protein_id gnl|my_center|LOCUS_05240 35062 37005 gene locus_tag LOCUS_05250 35062 37005 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113499.1 protein_id gnl|my_center|LOCUS_05250 37036 38280 gene locus_tag LOCUS_05260 37036 38280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 38450 39022 gene locus_tag LOCUS_05270 38450 39022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 39036 41426 gene locus_tag LOCUS_05280 39036 41426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 <42393 41650 gene locus_tag LOCUS_05290 <42393 41650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_116269310.1:tetratricopeptide repeat protein >Feature sequence07 3261 2011 gene locus_tag LOCUS_05300 3261 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 4250 3258 gene locus_tag LOCUS_05310 4250 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 5035 4247 gene locus_tag LOCUS_05320 5035 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 5982 5032 gene locus_tag LOCUS_05330 gene hemC 5982 5032 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812742.1 protein_id gnl|my_center|LOCUS_05330 7538 5985 gene locus_tag LOCUS_05340 7538 5985 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257170.1 protein_id gnl|my_center|LOCUS_05340 7467 7790 gene locus_tag LOCUS_05350 7467 7790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 8569 7802 gene locus_tag LOCUS_05360 8569 7802 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401565.1 protein_id gnl|my_center|LOCUS_05360 9698 8616 gene locus_tag LOCUS_05370 9698 8616 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318424.1 protein_id gnl|my_center|LOCUS_05370 10600 9695 gene locus_tag LOCUS_05380 10600 9695 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 protein_id gnl|my_center|LOCUS_05380 12456 10597 gene locus_tag LOCUS_05390 gene speA 12456 10597 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095365.1 protein_id gnl|my_center|LOCUS_05390 12584 13456 gene locus_tag LOCUS_05400 gene speE 12584 13456 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038944.1 protein_id gnl|my_center|LOCUS_05400 13577 13825 gene locus_tag LOCUS_05410 13577 13825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 13788 14519 gene locus_tag LOCUS_05420 13788 14519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 14642 14965 gene locus_tag LOCUS_05430 14642 14965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05430 15356 14985 gene locus_tag LOCUS_05440 15356 14985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 15783 15349 gene locus_tag LOCUS_05450 15783 15349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 16138 15800 gene locus_tag LOCUS_05460 gene glnK 16138 15800 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_05460 16381 17385 gene locus_tag LOCUS_05470 16381 17385 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038918.1 protein_id gnl|my_center|LOCUS_05470 17767 17399 gene locus_tag LOCUS_05480 gene erpA 17767 17399 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085254.1 protein_id gnl|my_center|LOCUS_05480 18241 17810 gene locus_tag LOCUS_05490 18241 17810 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909388.1 protein_id gnl|my_center|LOCUS_05490 18362 18784 gene locus_tag LOCUS_05500 gene hemJ 18362 18784 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947265.1 protein_id gnl|my_center|LOCUS_05500 20235 18772 gene locus_tag LOCUS_05510 20235 18772 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933544.1 protein_id gnl|my_center|LOCUS_05510 20262 21257 gene locus_tag LOCUS_05520 20262 21257 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192857.1 protein_id gnl|my_center|LOCUS_05520 21254 22045 gene locus_tag LOCUS_05530 21254 22045 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810400.1 protein_id gnl|my_center|LOCUS_05530 22110 23081 gene locus_tag LOCUS_05540 22110 23081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 23078 23719 gene locus_tag LOCUS_05550 gene nadD 23078 23719 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093199.1 protein_id gnl|my_center|LOCUS_05550 23694 24074 gene locus_tag LOCUS_05560 gene rsfS 23694 24074 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098046.1 protein_id gnl|my_center|LOCUS_05560 24071 24541 gene locus_tag LOCUS_05570 gene rlmH 24071 24541 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093193.1 protein_id gnl|my_center|LOCUS_05570 24538 25128 gene locus_tag LOCUS_05580 24538 25128 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112737.1 protein_id gnl|my_center|LOCUS_05580 25609 25022 gene locus_tag LOCUS_05590 gene lptE 25609 25022 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097585.1 protein_id gnl|my_center|LOCUS_05590 28068 25606 gene locus_tag LOCUS_05600 gene leuS 28068 25606 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_154223677.1 protein_id gnl|my_center|LOCUS_05600 29590 28073 gene locus_tag LOCUS_05610 gene lnt 29590 28073 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853024.1 protein_id gnl|my_center|LOCUS_05610 30462 29587 gene locus_tag LOCUS_05620 30462 29587 CDS product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957666.1 protein_id gnl|my_center|LOCUS_05620 30925 30455 gene locus_tag LOCUS_05630 gene ybeY 30925 30455 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093160.1 protein_id gnl|my_center|LOCUS_05630 31884 30922 gene locus_tag LOCUS_05640 31884 30922 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093159.1 protein_id gnl|my_center|LOCUS_05640 33227 31881 gene locus_tag LOCUS_05650 gene miaB 33227 31881 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947064.1 protein_id gnl|my_center|LOCUS_05650 35030 33309 gene locus_tag LOCUS_05660 35030 33309 CDS product bifunctional sulfate adenylyltransferase/adenylylsulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722319.1 protein_id gnl|my_center|LOCUS_05660 35188 35646 gene locus_tag LOCUS_05670 35188 35646 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 protein_id gnl|my_center|LOCUS_05670 >Feature sequence08 2713 290 gene locus_tag LOCUS_05680 2713 290 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090828103.1 protein_id gnl|my_center|LOCUS_05680 3150 4985 gene locus_tag LOCUS_05690 3150 4985 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815090.1 protein_id gnl|my_center|LOCUS_05690 5001 5552 gene locus_tag LOCUS_05700 5001 5552 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036032.1 protein_id gnl|my_center|LOCUS_05700 6378 5452 gene locus_tag LOCUS_05710 6378 5452 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102817.1 protein_id gnl|my_center|LOCUS_05710 7241 6366 gene locus_tag LOCUS_05720 7241 6366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 7891 7238 gene locus_tag LOCUS_05730 gene ampD 7891 7238 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707565.1 protein_id gnl|my_center|LOCUS_05730 7886 9289 gene locus_tag LOCUS_05740 7886 9289 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266413.1 protein_id gnl|my_center|LOCUS_05740 9293 10045 gene locus_tag LOCUS_05750 9293 10045 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194189.1 protein_id gnl|my_center|LOCUS_05750 10531 10058 gene locus_tag LOCUS_05760 10531 10058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 15768 10528 gene locus_tag LOCUS_05770 15768 10528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 17912 15786 gene locus_tag LOCUS_05780 17912 15786 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621029.1 protein_id gnl|my_center|LOCUS_05780 18531 17992 gene locus_tag LOCUS_05790 18531 17992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 18898 18521 gene locus_tag LOCUS_05800 gene pilH 18898 18521 CDS product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084587.1 protein_id gnl|my_center|LOCUS_05800 19361 18924 gene locus_tag LOCUS_05810 gene pilG 19361 18924 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 protein_id gnl|my_center|LOCUS_05810 19456 20433 gene locus_tag LOCUS_05820 gene gshB 19456 20433 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316740.1 protein_id gnl|my_center|LOCUS_05820 20438 21334 gene locus_tag LOCUS_05830 20438 21334 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038050.1 protein_id gnl|my_center|LOCUS_05830 21375 21938 gene locus_tag LOCUS_05840 21375 21938 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054768.1 protein_id gnl|my_center|LOCUS_05840 21931 22353 gene locus_tag LOCUS_05850 21931 22353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 22551 23264 gene locus_tag LOCUS_05860 22551 23264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 23297 24139 gene locus_tag LOCUS_05870 23297 24139 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_05870 24537 24136 gene locus_tag LOCUS_05880 24537 24136 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116996.1 protein_id gnl|my_center|LOCUS_05880 26736 24562 gene locus_tag LOCUS_05890 26736 24562 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144347086.1 protein_id gnl|my_center|LOCUS_05890 27055 26771 gene locus_tag LOCUS_05900 27055 26771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 31366 27137 gene locus_tag LOCUS_05910 gene rpoC 31366 27137 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036119.1 protein_id gnl|my_center|LOCUS_05910 35503 31406 gene locus_tag LOCUS_05920 gene rpoB 35503 31406 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114335.1 protein_id gnl|my_center|LOCUS_05920 >Feature sequence09 96 323 gene locus_tag LOCUS_05930 96 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 394 576 gene locus_tag LOCUS_05940 394 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 1032 721 gene locus_tag LOCUS_05950 1032 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 2473 1037 gene locus_tag LOCUS_05960 gene hisS 2473 1037 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036976.1 protein_id gnl|my_center|LOCUS_05960 3328 2510 gene locus_tag LOCUS_05970 gene trxA 3328 2510 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522640.1 protein_id gnl|my_center|LOCUS_05970 3781 3706 gene locus_tag LOCUS_t00110 3781 3706 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4090 3863 gene locus_tag LOCUS_05980 4090 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 4016 5200 gene locus_tag LOCUS_05990 gene pcnB 4016 5200 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036939.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05990 5204 5707 gene locus_tag LOCUS_06000 gene folK 5204 5707 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771454.1 protein_id gnl|my_center|LOCUS_06000 5691 6356 gene locus_tag LOCUS_06010 5691 6356 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532195.1 protein_id gnl|my_center|LOCUS_06010 6356 7222 gene locus_tag LOCUS_06020 gene panB 6356 7222 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036941.1 protein_id gnl|my_center|LOCUS_06020 7224 8099 gene locus_tag LOCUS_06030 gene panC 7224 8099 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246105.1 protein_id gnl|my_center|LOCUS_06030 8127 8534 gene locus_tag LOCUS_06040 8127 8534 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036943.1 protein_id gnl|my_center|LOCUS_06040 9390 8542 gene locus_tag LOCUS_06050 9390 8542 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189857.1 protein_id gnl|my_center|LOCUS_06050 10484 9474 gene locus_tag LOCUS_06060 gene queG 10484 9474 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110324.1 protein_id gnl|my_center|LOCUS_06060 10734 12182 gene locus_tag LOCUS_06070 gene nnr 10734 12182 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186277862.1 protein_id gnl|my_center|LOCUS_06070 12179 12688 gene locus_tag LOCUS_06080 12179 12688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 13333 12731 gene locus_tag LOCUS_06090 13333 12731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 14214 13330 gene locus_tag LOCUS_06100 14214 13330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 14969 14211 gene locus_tag LOCUS_06110 14969 14211 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937914.1 protein_id gnl|my_center|LOCUS_06110 16102 14966 gene locus_tag LOCUS_06120 16102 14966 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522941.1 protein_id gnl|my_center|LOCUS_06120 16331 17683 gene locus_tag LOCUS_06130 16331 17683 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087245.1 protein_id gnl|my_center|LOCUS_06130 18644 17856 gene locus_tag LOCUS_06140 18644 17856 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_06140 19638 18775 gene locus_tag LOCUS_06150 19638 18775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847040.1 protein_id gnl|my_center|LOCUS_06150 20120 19635 gene locus_tag LOCUS_06160 20120 19635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 21588 20167 gene locus_tag LOCUS_06170 21588 20167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 22316 21585 gene locus_tag LOCUS_06180 22316 21585 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016348992.1 protein_id gnl|my_center|LOCUS_06180 22566 23699 gene locus_tag LOCUS_06190 22566 23699 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942255.1 protein_id gnl|my_center|LOCUS_06190 23790 26930 gene locus_tag LOCUS_06200 23790 26930 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144016.1 protein_id gnl|my_center|LOCUS_06200 27222 30431 gene locus_tag LOCUS_06210 27222 30431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_06210 >Feature sequence10 535 242 gene locus_tag LOCUS_06220 535 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 443 2119 gene locus_tag LOCUS_06230 gene mutL 443 2119 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065015.1 protein_id gnl|my_center|LOCUS_06230 2116 3081 gene locus_tag LOCUS_06240 gene miaA 2116 3081 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175510.1 protein_id gnl|my_center|LOCUS_06240 3431 3688 gene locus_tag LOCUS_06250 3431 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 3699 5048 gene locus_tag LOCUS_06260 gene hflX 3699 5048 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551820.1 protein_id gnl|my_center|LOCUS_06260 5050 6168 gene locus_tag LOCUS_06270 5050 6168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 6165 7022 gene locus_tag LOCUS_06280 6165 7022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 7031 8377 gene locus_tag LOCUS_06290 7031 8377 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095642.1 protein_id gnl|my_center|LOCUS_06290 8724 9230 gene locus_tag LOCUS_06300 8724 9230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 10124 9279 gene locus_tag LOCUS_06310 10124 9279 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388162.1 protein_id gnl|my_center|LOCUS_06310 10845 10108 gene locus_tag LOCUS_06320 10845 10108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 11516 10842 gene locus_tag LOCUS_06330 11516 10842 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037412.1 protein_id gnl|my_center|LOCUS_06330 12228 11521 gene locus_tag LOCUS_06340 12228 11521 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113434.1 protein_id gnl|my_center|LOCUS_06340 13559 12225 gene locus_tag LOCUS_06350 13559 12225 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957634.1 protein_id gnl|my_center|LOCUS_06350 13733 14779 gene locus_tag LOCUS_06360 gene mtnA 13733 14779 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036755.1 protein_id gnl|my_center|LOCUS_06360 14876 17446 gene locus_tag LOCUS_06370 gene gyrA 14876 17446 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444523.1 protein_id gnl|my_center|LOCUS_06370 17443 18549 gene locus_tag LOCUS_06380 gene serC 17443 18549 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036771.1 protein_id gnl|my_center|LOCUS_06380 18542 19687 gene locus_tag LOCUS_06390 gene hisC 18542 19687 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_06390 19684 20382 gene locus_tag LOCUS_06400 gene cmk 19684 20382 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813361.1 protein_id gnl|my_center|LOCUS_06400 20512 22224 gene locus_tag LOCUS_06410 gene rpsA 20512 22224 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091442.1 protein_id gnl|my_center|LOCUS_06410 22221 22577 gene locus_tag LOCUS_06420 gene ihfB 22221 22577 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211322.1 protein_id gnl|my_center|LOCUS_06420 22614 22952 gene locus_tag LOCUS_06430 22614 22952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 22949 24232 gene locus_tag LOCUS_06440 gene lapB 22949 24232 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037337.1 protein_id gnl|my_center|LOCUS_06440 24225 25133 gene locus_tag LOCUS_06450 gene galU 24225 25133 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522195.1 protein_id gnl|my_center|LOCUS_06450 25710 25051 gene locus_tag LOCUS_06460 25710 25051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 25893 25968 gene locus_tag LOCUS_t00120 25893 25968 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 26056 26637 gene locus_tag LOCUS_06470 26056 26637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06470 26598 27056 gene locus_tag LOCUS_06480 26598 27056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06480 27517 27212 gene locus_tag LOCUS_06490 27517 27212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 28072 28746 gene locus_tag LOCUS_06500 28072 28746 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932831.1 protein_id gnl|my_center|LOCUS_06500 28743 29894 gene locus_tag LOCUS_06510 28743 29894 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933903.1 protein_id gnl|my_center|LOCUS_06510 29891 30385 gene locus_tag LOCUS_06520 29891 30385 CDS product DUF4411 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933904.1 protein_id gnl|my_center|LOCUS_06520 30382 31965 gene locus_tag LOCUS_06530 30382 31965 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932832.1 protein_id gnl|my_center|LOCUS_06530 31949 34549 gene locus_tag LOCUS_06540 31949 34549 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926995.1 protein_id gnl|my_center|LOCUS_06540 34509 34862 gene locus_tag LOCUS_06550 34509 34862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 >Feature sequence11 <1 977 gene locus_tag LOCUS_06560 <1 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986648.1:sugar phosphate isomerase/epimerase 988 1515 gene locus_tag LOCUS_06570 988 1515 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723733.1 protein_id gnl|my_center|LOCUS_06570 1512 2675 gene locus_tag LOCUS_06580 1512 2675 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368549.1 protein_id gnl|my_center|LOCUS_06580 2638 3351 gene locus_tag LOCUS_06590 gene ubiG 2638 3351 CDS product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448326.1 protein_id gnl|my_center|LOCUS_06590 3355 4260 gene locus_tag LOCUS_06600 3355 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 4664 7270 gene locus_tag LOCUS_06610 gene alaS 4664 7270 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191158.1 protein_id gnl|my_center|LOCUS_06610 7257 8522 gene locus_tag LOCUS_06620 7257 8522 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707428.1 protein_id gnl|my_center|LOCUS_06620 8721 9044 gene locus_tag LOCUS_06630 8721 9044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 9087 9180 gene locus_tag LOCUS_t00130 9087 9180 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9845 9411 gene locus_tag LOCUS_06640 9845 9411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 9877 10095 gene locus_tag LOCUS_06650 9877 10095 CDS product conjugal transfer protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015316600.1 protein_id gnl|my_center|LOCUS_06650 10952 10092 gene locus_tag LOCUS_06660 10952 10092 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024997765.1 protein_id gnl|my_center|LOCUS_06660 11776 10949 gene locus_tag LOCUS_06670 11776 10949 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120708963.1 protein_id gnl|my_center|LOCUS_06670 12313 11975 gene locus_tag LOCUS_06680 12313 11975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 12194 12436 gene locus_tag LOCUS_06690 12194 12436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 12773 13219 gene locus_tag LOCUS_06700 12773 13219 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391482.1 protein_id gnl|my_center|LOCUS_06700 13220 13687 gene locus_tag LOCUS_06710 13220 13687 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391483.1 protein_id gnl|my_center|LOCUS_06710 14530 14709 gene locus_tag LOCUS_06720 14530 14709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 15904 14912 gene locus_tag LOCUS_06730 gene ftsX 15904 14912 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074182.1 protein_id gnl|my_center|LOCUS_06730 16677 15901 gene locus_tag LOCUS_06740 gene ftsE 16677 15901 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704349.1 protein_id gnl|my_center|LOCUS_06740 18810 16756 gene locus_tag LOCUS_06750 18810 16756 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072838.1 protein_id gnl|my_center|LOCUS_06750 18941 19546 gene locus_tag LOCUS_06760 gene rsmD 18941 19546 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037534.1 protein_id gnl|my_center|LOCUS_06760 19580 20071 gene locus_tag LOCUS_06770 gene coaD 19580 20071 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003348749.1 protein_id gnl|my_center|LOCUS_06770 21649 20090 gene locus_tag LOCUS_06780 21649 20090 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_06780 22411 21716 gene locus_tag LOCUS_06790 22411 21716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096987.1 protein_id gnl|my_center|LOCUS_06790 24575 22428 gene locus_tag LOCUS_06800 24575 22428 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895708.1 protein_id gnl|my_center|LOCUS_06800 24874 25314 gene locus_tag LOCUS_06810 24874 25314 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036247.1 protein_id gnl|my_center|LOCUS_06810 25467 26912 gene locus_tag LOCUS_06820 25467 26912 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262646.1 protein_id gnl|my_center|LOCUS_06820 27750 26971 gene locus_tag LOCUS_06830 27750 26971 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420864.1 protein_id gnl|my_center|LOCUS_06830 28712 27747 gene locus_tag LOCUS_06840 28712 27747 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267141.1 protein_id gnl|my_center|LOCUS_06840 29179 28712 gene locus_tag LOCUS_06850 29179 28712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 30501 29191 gene locus_tag LOCUS_06860 30501 29191 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942945.1 protein_id gnl|my_center|LOCUS_06860 30750 31091 gene locus_tag LOCUS_06870 gene trxA 30750 31091 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 protein_id gnl|my_center|LOCUS_06870 31088 32479 gene locus_tag LOCUS_06880 gene rho 31088 32479 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096334.1 protein_id gnl|my_center|LOCUS_06880 32985 32476 gene locus_tag LOCUS_06890 32985 32476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 34348 33065 gene locus_tag LOCUS_06900 gene purD 34348 33065 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207146.1 protein_id gnl|my_center|LOCUS_06900 >Feature sequence12 1 267 gene locus_tag LOCUS_06910 1 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 320 1321 gene locus_tag LOCUS_06920 320 1321 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_06920 1417 3120 gene locus_tag LOCUS_06930 gene pilB 1417 3120 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103350.1 protein_id gnl|my_center|LOCUS_06930 3143 4399 gene locus_tag LOCUS_06940 3143 4399 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070775.1 protein_id gnl|my_center|LOCUS_06940 4399 5235 gene locus_tag LOCUS_06950 gene pilD 4399 5235 CDS product type IV prepilin peptidase/methyltransferase PilD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112839.1 protein_id gnl|my_center|LOCUS_06950 5289 5840 gene locus_tag LOCUS_06960 gene coaE 5289 5840 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194322.1 protein_id gnl|my_center|LOCUS_06960 5837 6631 gene locus_tag LOCUS_06970 gene zapD 5837 6631 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167091.1 protein_id gnl|my_center|LOCUS_06970 7670 6741 gene locus_tag LOCUS_06980 7670 6741 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815027.1 protein_id gnl|my_center|LOCUS_06980 10384 7688 gene locus_tag LOCUS_06990 gene secA 10384 7688 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905789.1 protein_id gnl|my_center|LOCUS_06990 10548 10949 gene locus_tag LOCUS_07000 10548 10949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 11889 10978 gene locus_tag LOCUS_07010 gene lpxC 11889 10978 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_07010 13194 11992 gene locus_tag LOCUS_07020 gene ftsZ 13194 11992 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035966.1 protein_id gnl|my_center|LOCUS_07020 14506 13256 gene locus_tag LOCUS_07030 gene ftsA 14506 13256 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377649.1 protein_id gnl|my_center|LOCUS_07030 15204 14503 gene locus_tag LOCUS_07040 15204 14503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 16102 15197 gene locus_tag LOCUS_07050 16102 15197 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095576.1 protein_id gnl|my_center|LOCUS_07050 17003 16122 gene locus_tag LOCUS_07060 gene murB 17003 16122 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357031.1 protein_id gnl|my_center|LOCUS_07060 18406 17000 gene locus_tag LOCUS_07070 gene murC 18406 17000 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094121.1 protein_id gnl|my_center|LOCUS_07070 19503 18403 gene locus_tag LOCUS_07080 gene murG 19503 18403 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064960.1 protein_id gnl|my_center|LOCUS_07080 20624 19500 gene locus_tag LOCUS_07090 gene ftsW 20624 19500 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216490.1 protein_id gnl|my_center|LOCUS_07090 22009 20645 gene locus_tag LOCUS_07100 gene murD 22009 20645 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268846.1 protein_id gnl|my_center|LOCUS_07100 23070 22006 gene locus_tag LOCUS_07110 gene mraY 23070 22006 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769458.1 protein_id gnl|my_center|LOCUS_07110 24436 23051 gene locus_tag LOCUS_07120 24436 23051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 25998 24430 gene locus_tag LOCUS_07130 25998 24430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 27701 25995 gene locus_tag LOCUS_07140 27701 25995 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957390.1 protein_id gnl|my_center|LOCUS_07140 27967 27698 gene locus_tag LOCUS_07150 27967 27698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 28878 27952 gene locus_tag LOCUS_07160 gene rsmH 28878 27952 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970479.1 protein_id gnl|my_center|LOCUS_07160 29336 28881 gene locus_tag LOCUS_07170 gene mraZ 29336 28881 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213343.1 protein_id gnl|my_center|LOCUS_07170 31297 30869 gene locus_tag LOCUS_07180 31297 30869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 31731 31399 gene locus_tag LOCUS_07190 31731 31399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 31618 32166 gene locus_tag LOCUS_07200 31618 32166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 >Feature sequence13 <1 1096 gene locus_tag LOCUS_07210 <1 1096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072790.1:DUF2066 domain-containing protein 1093 1668 gene locus_tag LOCUS_07220 1093 1668 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948488.1 protein_id gnl|my_center|LOCUS_07220 1665 2462 gene locus_tag LOCUS_07230 1665 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 2459 2881 gene locus_tag LOCUS_07240 2459 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 3064 3825 gene locus_tag LOCUS_07250 3064 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 3954 4760 gene locus_tag LOCUS_07260 gene wbbL 3954 4760 CDS product N-acetylglucosaminyl-diphospho-decaprenol L-rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417100.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07260 4777 5064 gene locus_tag LOCUS_07270 4777 5064 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102385.1 protein_id gnl|my_center|LOCUS_07270 5524 5081 gene locus_tag LOCUS_07280 5524 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 7500 5641 gene locus_tag LOCUS_07290 gene proS 7500 5641 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260694.1 protein_id gnl|my_center|LOCUS_07290 7883 8839 gene locus_tag LOCUS_07300 gene ilvC 7883 8839 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173279.1 protein_id gnl|my_center|LOCUS_07300 8836 9624 gene locus_tag LOCUS_07310 gene pssA 8836 9624 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035883.1 protein_id gnl|my_center|LOCUS_07310 9621 10385 gene locus_tag LOCUS_07320 9621 10385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 10382 10921 gene locus_tag LOCUS_07330 gene rimI 10382 10921 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439259.1 protein_id gnl|my_center|LOCUS_07330 11480 10848 gene locus_tag LOCUS_07340 11480 10848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 11562 12587 gene locus_tag LOCUS_07350 11562 12587 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191283.1 protein_id gnl|my_center|LOCUS_07350 12584 14149 gene locus_tag LOCUS_07360 12584 14149 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037984.1 protein_id gnl|my_center|LOCUS_07360 14146 15423 gene locus_tag LOCUS_07370 14146 15423 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644782.1 protein_id gnl|my_center|LOCUS_07370 17497 15377 gene locus_tag LOCUS_07380 17497 15377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07380 18407 17487 gene locus_tag LOCUS_07390 18407 17487 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036210.1 protein_id gnl|my_center|LOCUS_07390 19357 18404 gene locus_tag LOCUS_07400 19357 18404 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036211.1 protein_id gnl|my_center|LOCUS_07400 19489 20568 gene locus_tag LOCUS_07410 gene apbC 19489 20568 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448044.1 protein_id gnl|my_center|LOCUS_07410 20568 21131 gene locus_tag LOCUS_07420 gene dcd 20568 21131 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381535.1 protein_id gnl|my_center|LOCUS_07420 21136 21606 gene locus_tag LOCUS_07430 21136 21606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 22270 21578 gene locus_tag LOCUS_07440 22270 21578 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365553.1 protein_id gnl|my_center|LOCUS_07440 22396 23610 gene locus_tag LOCUS_07450 gene ribBA 22396 23610 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707098.1 protein_id gnl|my_center|LOCUS_07450 23607 24107 gene locus_tag LOCUS_07460 gene ribH 23607 24107 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035936.1 protein_id gnl|my_center|LOCUS_07460 24104 24562 gene locus_tag LOCUS_07470 gene nusB 24104 24562 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166503.1 protein_id gnl|my_center|LOCUS_07470 24720 24529 gene locus_tag LOCUS_07480 24720 24529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 24655 25515 gene locus_tag LOCUS_07490 gene thiL 24655 25515 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073311.1 protein_id gnl|my_center|LOCUS_07490 25512 25994 gene locus_tag LOCUS_07500 25512 25994 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073310.1 protein_id gnl|my_center|LOCUS_07500 25991 27415 gene locus_tag LOCUS_07510 25991 27415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 28188 27355 gene locus_tag LOCUS_07520 gene folE2 28188 27355 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039532.1 protein_id gnl|my_center|LOCUS_07520 28353 28709 gene locus_tag LOCUS_07530 28353 28709 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958235.1 protein_id gnl|my_center|LOCUS_07530 28700 29176 gene locus_tag LOCUS_07540 28700 29176 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 protein_id gnl|my_center|LOCUS_07540 29186 29881 gene locus_tag LOCUS_07550 29186 29881 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958234.1 protein_id gnl|my_center|LOCUS_07550 >Feature sequence14 <1 558 gene locus_tag LOCUS_07560 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004190901.1:aldehyde dehydrogenase family protein 1125 2162 gene locus_tag LOCUS_07570 1125 2162 CDS product DUF3667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018972380.1 protein_id gnl|my_center|LOCUS_07570 3616 2240 gene locus_tag LOCUS_07580 3616 2240 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772424.1 protein_id gnl|my_center|LOCUS_07580 6490 3731 gene locus_tag LOCUS_07590 6490 3731 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202335.1 protein_id gnl|my_center|LOCUS_07590 8031 6811 gene locus_tag LOCUS_07600 8031 6811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 9946 9074 gene locus_tag LOCUS_07610 9946 9074 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114805.1 protein_id gnl|my_center|LOCUS_07610 10070 9995 gene locus_tag LOCUS_t00140 10070 9995 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 11188 10205 gene locus_tag LOCUS_07620 11188 10205 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088295.1 protein_id gnl|my_center|LOCUS_07620 13385 11376 gene locus_tag LOCUS_07630 13385 11376 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903716.1 protein_id gnl|my_center|LOCUS_07630 13770 14330 gene locus_tag LOCUS_07640 13770 14330 CDS product DUF1993 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083593.1 protein_id gnl|my_center|LOCUS_07640 15783 14518 gene locus_tag LOCUS_07650 15783 14518 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101151.1 protein_id gnl|my_center|LOCUS_07650 16042 18933 gene locus_tag LOCUS_07660 16042 18933 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038503.1 protein_id gnl|my_center|LOCUS_07660 19000 19076 gene locus_tag LOCUS_t00150 19000 19076 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 19443 20015 gene locus_tag LOCUS_07670 19443 20015 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816758.1 protein_id gnl|my_center|LOCUS_07670 21357 20239 gene locus_tag LOCUS_07680 21357 20239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 22950 21805 gene locus_tag LOCUS_07690 22950 21805 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083772618.1 protein_id gnl|my_center|LOCUS_07690 24464 22947 gene locus_tag LOCUS_07700 24464 22947 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141163.1 protein_id gnl|my_center|LOCUS_07700 25259 24468 gene locus_tag LOCUS_07710 25259 24468 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141114.1 protein_id gnl|my_center|LOCUS_07710 26299 29061 gene locus_tag LOCUS_07720 26299 29061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 29543 29468 gene locus_tag LOCUS_t00160 29543 29468 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence15 212 682 gene locus_tag LOCUS_07730 gene infC 212 682 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446215.1 protein_id gnl|my_center|LOCUS_07730 784 981 gene locus_tag LOCUS_07740 gene rpmI 784 981 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002811096.1 protein_id gnl|my_center|LOCUS_07740 994 1359 gene locus_tag LOCUS_07750 gene rplT 994 1359 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553161.1 protein_id gnl|my_center|LOCUS_07750 1387 2457 gene locus_tag LOCUS_07760 gene pheS 1387 2457 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367019.1 protein_id gnl|my_center|LOCUS_07760 2448 4838 gene locus_tag LOCUS_07770 gene pheT 2448 4838 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772935.1 protein_id gnl|my_center|LOCUS_07770 4819 5145 gene locus_tag LOCUS_07780 gene ihfA 4819 5145 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090661.1 protein_id gnl|my_center|LOCUS_07780 5126 5488 gene locus_tag LOCUS_07790 5126 5488 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090655.1 protein_id gnl|my_center|LOCUS_07790 5508 5584 gene locus_tag LOCUS_t00170 5508 5584 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6833 5832 gene locus_tag LOCUS_07800 gene rhuM 6833 5832 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_07800 7306 6830 gene locus_tag LOCUS_07810 7306 6830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 8369 7287 gene locus_tag LOCUS_07820 8369 7287 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224940.1 protein_id gnl|my_center|LOCUS_07820 9365 8823 gene locus_tag LOCUS_07830 9365 8823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 10347 9547 gene locus_tag LOCUS_07840 10347 9547 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205929.1 protein_id gnl|my_center|LOCUS_07840 12656 10473 gene locus_tag LOCUS_07850 12656 10473 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140683.1 protein_id gnl|my_center|LOCUS_07850 12864 13958 gene locus_tag LOCUS_07860 12864 13958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07860 14648 14079 gene locus_tag LOCUS_07870 14648 14079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07870 17890 14945 gene locus_tag LOCUS_07880 17890 14945 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207500.1 protein_id gnl|my_center|LOCUS_07880 18420 17959 gene locus_tag LOCUS_07890 18420 17959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 19949 18417 gene locus_tag LOCUS_07900 gene pepA 19949 18417 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397172.1 protein_id gnl|my_center|LOCUS_07900 20071 21165 gene locus_tag LOCUS_07910 gene lptF 20071 21165 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316899.1 protein_id gnl|my_center|LOCUS_07910 21162 22232 gene locus_tag LOCUS_07920 gene lptG 21162 22232 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005054063.1 protein_id gnl|my_center|LOCUS_07920 22327 22896 gene locus_tag LOCUS_07930 22327 22896 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194252.1 protein_id gnl|my_center|LOCUS_07930 23019 23474 gene locus_tag LOCUS_07940 23019 23474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 23542 24306 gene locus_tag LOCUS_07950 23542 24306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 24303 25094 gene locus_tag LOCUS_07960 24303 25094 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470656.1 protein_id gnl|my_center|LOCUS_07960 25294 25938 gene locus_tag LOCUS_07970 25294 25938 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004542505.1 protein_id gnl|my_center|LOCUS_07970 <27333 26035 gene locus_tag LOCUS_07980 <27333 26035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096258.1:two-component system sensor histidine kinase AmgS >Feature sequence16 255 1286 gene locus_tag LOCUS_07990 gene purM 255 1286 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065013.1 protein_id gnl|my_center|LOCUS_07990 1283 1939 gene locus_tag LOCUS_08000 gene purN 1283 1939 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112584.1 protein_id gnl|my_center|LOCUS_08000 1959 2702 gene locus_tag LOCUS_08010 1959 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 4972 2864 gene locus_tag LOCUS_08020 4972 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 5042 6694 gene locus_tag LOCUS_08030 gene metG 5042 6694 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005049047.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08030 6687 7040 gene locus_tag LOCUS_08040 6687 7040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08040 7040 7690 gene locus_tag LOCUS_08050 7040 7690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 7656 8345 gene locus_tag LOCUS_08060 gene nth 7656 8345 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948566.1 protein_id gnl|my_center|LOCUS_08060 8342 8815 gene locus_tag LOCUS_08070 8342 8815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 8843 9673 gene locus_tag LOCUS_08080 8843 9673 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091343.1 protein_id gnl|my_center|LOCUS_08080 9667 11334 gene locus_tag LOCUS_08090 gene recN 9667 11334 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930962.1 protein_id gnl|my_center|LOCUS_08090 11391 11738 gene locus_tag LOCUS_08100 11391 11738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 11949 11644 gene locus_tag LOCUS_08110 11949 11644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 12400 11939 gene locus_tag LOCUS_08120 12400 11939 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705344.1 protein_id gnl|my_center|LOCUS_08120 12479 12958 gene locus_tag LOCUS_08130 gene smpB 12479 12958 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197080.1 protein_id gnl|my_center|LOCUS_08130 13866 12955 gene locus_tag LOCUS_08140 13866 12955 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820280.1 protein_id gnl|my_center|LOCUS_08140 13938 14795 gene locus_tag LOCUS_08150 13938 14795 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389061.1 protein_id gnl|my_center|LOCUS_08150 14973 15443 gene locus_tag LOCUS_08160 14973 15443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 15448 16470 gene locus_tag LOCUS_08170 15448 16470 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957810.1 protein_id gnl|my_center|LOCUS_08170 16467 18029 gene locus_tag LOCUS_08180 16467 18029 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460814.1 protein_id gnl|my_center|LOCUS_08180 19154 18090 gene locus_tag LOCUS_08190 19154 18090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 19303 19782 gene locus_tag LOCUS_08200 19303 19782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 19779 20204 gene locus_tag LOCUS_08210 19779 20204 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070678.1 protein_id gnl|my_center|LOCUS_08210 20759 20430 gene locus_tag LOCUS_08220 20759 20430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 21436 20756 gene locus_tag LOCUS_08230 21436 20756 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946580.1 protein_id gnl|my_center|LOCUS_08230 21911 21438 gene locus_tag LOCUS_08240 gene mlaD 21911 21438 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377572.1 protein_id gnl|my_center|LOCUS_08240 22715 21939 gene locus_tag LOCUS_08250 gene mlaE 22715 21939 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815775.1 protein_id gnl|my_center|LOCUS_08250 23569 22712 gene locus_tag LOCUS_08260 gene mlaF 23569 22712 CDS product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012534228.1 protein_id gnl|my_center|LOCUS_08260 24591 23566 gene locus_tag LOCUS_08270 24591 23566 CDS product fructose-bisphosphate aldolase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536006.1 protein_id gnl|my_center|LOCUS_08270 25092 24727 gene locus_tag LOCUS_08280 25092 24727 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036225.1 protein_id gnl|my_center|LOCUS_08280 <26224 25219 gene locus_tag LOCUS_08290 <26224 25219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_143830395.1:DNA polymerase III subunit delta' >Feature sequence17 1432 1220 gene locus_tag LOCUS_08300 1432 1220 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889077.1 protein_id gnl|my_center|LOCUS_08300 4082 1608 gene locus_tag LOCUS_08310 4082 1608 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033450289.1 protein_id gnl|my_center|LOCUS_08310 4489 4079 gene locus_tag LOCUS_08320 gene cueR 4489 4079 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061812.1 protein_id gnl|my_center|LOCUS_08320 5238 5747 gene locus_tag LOCUS_08330 gene purE 5238 5747 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 protein_id gnl|my_center|LOCUS_08330 5751 6860 gene locus_tag LOCUS_08340 5751 6860 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037635.1 protein_id gnl|my_center|LOCUS_08340 7701 6898 gene locus_tag LOCUS_08350 gene dsbG 7701 6898 CDS product thiol:disulfide interchange protein DsbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039720.1 protein_id gnl|my_center|LOCUS_08350 9343 7775 gene locus_tag LOCUS_08360 9343 7775 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479846.1 protein_id gnl|my_center|LOCUS_08360 10803 9340 gene locus_tag LOCUS_08370 10803 9340 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125939.1 protein_id gnl|my_center|LOCUS_08370 10973 10800 gene locus_tag LOCUS_08380 10973 10800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 12210 10984 gene locus_tag LOCUS_08390 12210 10984 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382099.1 protein_id gnl|my_center|LOCUS_08390 13605 12262 gene locus_tag LOCUS_08400 13605 12262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 15972 13717 gene locus_tag LOCUS_08410 15972 13717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 18569 16245 gene locus_tag LOCUS_08420 18569 16245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 19444 18695 gene locus_tag LOCUS_08430 19444 18695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 20262 19441 gene locus_tag LOCUS_08440 20262 19441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 20400 23072 gene locus_tag LOCUS_08450 20400 23072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 23166 24473 gene locus_tag LOCUS_08460 23166 24473 CDS product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040400.1 protein_id gnl|my_center|LOCUS_08460 24519 24884 gene locus_tag LOCUS_08470 24519 24884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 25603 24842 gene locus_tag LOCUS_08480 25603 24842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence18 <1 1464 gene locus_tag LOCUS_08490 <1 1464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942126.1:MDR family MFS transporter 2788 1556 gene locus_tag LOCUS_08500 2788 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 3974 2781 gene locus_tag LOCUS_08510 3974 2781 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338822.1 protein_id gnl|my_center|LOCUS_08510 5508 3979 gene locus_tag LOCUS_08520 5508 3979 CDS product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338823.1 protein_id gnl|my_center|LOCUS_08520 6190 5594 gene locus_tag LOCUS_08530 gene kdpC 6190 5594 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039225.1 protein_id gnl|my_center|LOCUS_08530 8262 6202 gene locus_tag LOCUS_08540 gene kdpB 8262 6202 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209651.1 protein_id gnl|my_center|LOCUS_08540 10037 8259 gene locus_tag LOCUS_08550 gene kdpA 10037 8259 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814045.1 protein_id gnl|my_center|LOCUS_08550 10420 13206 gene locus_tag LOCUS_08560 gene kdpD 10420 13206 CDS product two-component system sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167969.1 protein_id gnl|my_center|LOCUS_08560 13184 13876 gene locus_tag LOCUS_08570 gene kdpE 13184 13876 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186103.1 protein_id gnl|my_center|LOCUS_08570 13873 14946 gene locus_tag LOCUS_08580 gene mutY 13873 14946 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707498.1 protein_id gnl|my_center|LOCUS_08580 14954 15229 gene locus_tag LOCUS_08590 14954 15229 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768500.1 protein_id gnl|my_center|LOCUS_08590 15278 15353 gene locus_tag LOCUS_t00180 15278 15353 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 15771 15577 gene locus_tag LOCUS_08600 15771 15577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 15787 15996 gene locus_tag LOCUS_08610 15787 15996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08610 18435 18067 gene locus_tag LOCUS_08620 18435 18067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08620 19622 18435 gene locus_tag LOCUS_08630 19622 18435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08630 20165 19644 gene locus_tag LOCUS_08640 20165 19644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08640 20379 20167 gene locus_tag LOCUS_08650 20379 20167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 20624 20376 gene locus_tag LOCUS_08660 20624 20376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 21334 20624 gene locus_tag LOCUS_08670 21334 20624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 22071 21307 gene locus_tag LOCUS_08680 22071 21307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 22372 22061 gene locus_tag LOCUS_08690 22372 22061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08690 22719 22438 gene locus_tag LOCUS_08700 22719 22438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08700 23442 22789 gene locus_tag LOCUS_08710 23442 22789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08710 23633 23439 gene locus_tag LOCUS_08720 23633 23439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 25273 23750 gene locus_tag LOCUS_08730 25273 23750 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948598.1 protein_id gnl|my_center|LOCUS_08730 25828 25496 gene locus_tag LOCUS_08740 25828 25496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08740 >Feature sequence19 442 5 gene locus_tag LOCUS_08750 442 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 1762 557 gene locus_tag LOCUS_08760 gene kch 1762 557 CDS product voltage-gated potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005049683.1 protein_id gnl|my_center|LOCUS_08760 2208 1759 gene locus_tag LOCUS_08770 2208 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 3606 2215 gene locus_tag LOCUS_08780 3606 2215 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036680.1 protein_id gnl|my_center|LOCUS_08780 3732 5117 gene locus_tag LOCUS_08790 gene purB 3732 5117 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446450.1 protein_id gnl|my_center|LOCUS_08790 5114 6019 gene locus_tag LOCUS_08800 5114 6019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 6029 7171 gene locus_tag LOCUS_08810 gene mnmA 6029 7171 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210913.1 protein_id gnl|my_center|LOCUS_08810 7215 9881 gene locus_tag LOCUS_08820 gene acnA 7215 9881 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259000.1 protein_id gnl|my_center|LOCUS_08820 10721 9912 gene locus_tag LOCUS_08830 10721 9912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 10811 12667 gene locus_tag LOCUS_08840 10811 12667 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_08840 12832 13452 gene locus_tag LOCUS_08850 12832 13452 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026312796.1 protein_id gnl|my_center|LOCUS_08850 13867 13679 gene locus_tag LOCUS_08860 13867 13679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 14283 15653 gene locus_tag LOCUS_08870 14283 15653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 15669 15866 gene locus_tag LOCUS_08880 15669 15866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 16774 19179 gene locus_tag LOCUS_08890 16774 19179 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388093.1 protein_id gnl|my_center|LOCUS_08890 19172 20776 gene locus_tag LOCUS_08900 19172 20776 CDS product CRISPR-associated protein Cse1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388094.1 protein_id gnl|my_center|LOCUS_08900 20773 21303 gene locus_tag LOCUS_08910 20773 21303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 21310 22443 gene locus_tag LOCUS_08920 gene cas7e 21310 22443 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388097.1 protein_id gnl|my_center|LOCUS_08920 22449 23162 gene locus_tag LOCUS_08930 gene cas5e 22449 23162 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388098.1 protein_id gnl|my_center|LOCUS_08930 23159 23857 gene locus_tag LOCUS_08940 23159 23857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 23854 24753 gene locus_tag LOCUS_08950 gene cas1e 23854 24753 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388100.1 protein_id gnl|my_center|LOCUS_08950 25079 25351 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtctaccccgcgcatgcggggatcgaccc >Feature sequence20 1113 1409 gene locus_tag LOCUS_08960 1113 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 1406 2659 gene locus_tag LOCUS_08970 1406 2659 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639983.1 protein_id gnl|my_center|LOCUS_08970 3037 2714 gene locus_tag LOCUS_08980 3037 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 3136 3972 gene locus_tag LOCUS_08990 3136 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 4520 4430 gene locus_tag LOCUS_t00190 4520 4430 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5340 5053 gene locus_tag LOCUS_09000 5340 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 6251 5346 gene locus_tag LOCUS_09010 gene dapA 6251 5346 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086270.1 protein_id gnl|my_center|LOCUS_09010 6363 6893 gene locus_tag LOCUS_09020 6363 6893 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036914.1 protein_id gnl|my_center|LOCUS_09020 6899 7369 gene locus_tag LOCUS_09030 6899 7369 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521302.1 protein_id gnl|my_center|LOCUS_09030 7386 8792 gene locus_tag LOCUS_09040 7386 8792 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036911.1 protein_id gnl|my_center|LOCUS_09040 8969 10336 gene locus_tag LOCUS_09050 8969 10336 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706004.1 protein_id gnl|my_center|LOCUS_09050 10438 11328 gene locus_tag LOCUS_09060 10438 11328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 13248 11362 gene locus_tag LOCUS_09070 gene sppA 13248 11362 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211674.1 protein_id gnl|my_center|LOCUS_09070 13431 14144 gene locus_tag LOCUS_09080 13431 14144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 14154 15221 gene locus_tag LOCUS_09090 14154 15221 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084490.1 protein_id gnl|my_center|LOCUS_09090 17395 15275 gene locus_tag LOCUS_09100 gene pnp 17395 15275 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707071.1 protein_id gnl|my_center|LOCUS_09100 17664 17392 gene locus_tag LOCUS_09110 gene rpsO 17664 17392 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369527.1 protein_id gnl|my_center|LOCUS_09110 18693 17758 gene locus_tag LOCUS_09120 gene truB 18693 17758 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016351717.1 protein_id gnl|my_center|LOCUS_09120 19095 18706 gene locus_tag LOCUS_09130 19095 18706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 21566 19095 gene locus_tag LOCUS_09140 gene infB 21566 19095 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958223.1 protein_id gnl|my_center|LOCUS_09140 23074 21566 gene locus_tag LOCUS_09150 gene nusA 23074 21566 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037645.1 protein_id gnl|my_center|LOCUS_09150 23565 23071 gene locus_tag LOCUS_09160 gene rimP 23565 23071 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456065.1 protein_id gnl|my_center|LOCUS_09160 24103 23864 gene locus_tag LOCUS_09170 24103 23864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 >Feature sequence21 2 139 gene locus_tag LOCUS_09180 2 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 162 473 gene locus_tag LOCUS_09190 gene rpsJ 162 473 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116694.1 protein_id gnl|my_center|LOCUS_09190 608 1267 gene locus_tag LOCUS_09200 gene rplC 608 1267 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925687.1 protein_id gnl|my_center|LOCUS_09200 1267 1890 gene locus_tag LOCUS_09210 gene rplD 1267 1890 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005340616.1 protein_id gnl|my_center|LOCUS_09210 1887 2198 gene locus_tag LOCUS_09220 gene rplW 1887 2198 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002811694.1 protein_id gnl|my_center|LOCUS_09220 2214 3038 gene locus_tag LOCUS_09230 gene rplB 2214 3038 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806907.1 protein_id gnl|my_center|LOCUS_09230 3050 3334 gene locus_tag LOCUS_09240 gene rpsS 3050 3334 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307960.1 protein_id gnl|my_center|LOCUS_09240 3352 3684 gene locus_tag LOCUS_09250 gene rplV 3352 3684 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383164.1 protein_id gnl|my_center|LOCUS_09250 3694 4404 gene locus_tag LOCUS_09260 gene rpsC 3694 4404 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036126.1 protein_id gnl|my_center|LOCUS_09260 4409 4822 gene locus_tag LOCUS_09270 gene rplP 4409 4822 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806911.1 protein_id gnl|my_center|LOCUS_09270 4819 5025 gene locus_tag LOCUS_09280 4819 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 5022 5321 gene locus_tag LOCUS_09290 gene rpsQ 5022 5321 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946087.1 protein_id gnl|my_center|LOCUS_09290 5318 5686 gene locus_tag LOCUS_09300 gene rplN 5318 5686 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690075.1 protein_id gnl|my_center|LOCUS_09300 5698 6012 gene locus_tag LOCUS_09310 gene rplX 5698 6012 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008571669.1 protein_id gnl|my_center|LOCUS_09310 6005 6562 gene locus_tag LOCUS_09320 gene rplE 6005 6562 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010371090.1 protein_id gnl|my_center|LOCUS_09320 6585 6890 gene locus_tag LOCUS_09330 gene rpsN 6585 6890 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216244.1 protein_id gnl|my_center|LOCUS_09330 6901 7296 gene locus_tag LOCUS_09340 gene rpsH 6901 7296 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806920.1 protein_id gnl|my_center|LOCUS_09340 7314 7847 gene locus_tag LOCUS_09350 gene rplF 7314 7847 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036130.1 protein_id gnl|my_center|LOCUS_09350 7870 8229 gene locus_tag LOCUS_09360 gene rplR 7870 8229 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771517.1 protein_id gnl|my_center|LOCUS_09360 8259 8768 gene locus_tag LOCUS_09370 gene rpsE 8259 8768 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644438.1 protein_id gnl|my_center|LOCUS_09370 8765 8980 gene locus_tag LOCUS_09380 gene rpmD 8765 8980 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093696.1 protein_id gnl|my_center|LOCUS_09380 8967 9401 gene locus_tag LOCUS_09390 gene rplO 8967 9401 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957463.1 protein_id gnl|my_center|LOCUS_09390 9403 10731 gene locus_tag LOCUS_09400 gene secY 9403 10731 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806926.1 protein_id gnl|my_center|LOCUS_09400 10937 11299 gene locus_tag LOCUS_09410 gene rpsM 10937 11299 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093692.1 protein_id gnl|my_center|LOCUS_09410 11366 11752 gene locus_tag LOCUS_09420 gene rpsK 11366 11752 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874452.1 protein_id gnl|my_center|LOCUS_09420 11791 12426 gene locus_tag LOCUS_09430 gene rpsD 11791 12426 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070631.1 protein_id gnl|my_center|LOCUS_09430 12443 13468 gene locus_tag LOCUS_09440 gene rpoA 12443 13468 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555464.1 protein_id gnl|my_center|LOCUS_09440 13488 13997 gene locus_tag LOCUS_09450 13488 13997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 16864 14021 gene locus_tag LOCUS_09460 gene uvrA 16864 14021 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093663.1 protein_id gnl|my_center|LOCUS_09460 18294 16861 gene locus_tag LOCUS_09470 18294 16861 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035947.1 protein_id gnl|my_center|LOCUS_09470 18875 18279 gene locus_tag LOCUS_09480 18875 18279 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094149.1 protein_id gnl|my_center|LOCUS_09480 20779 18872 gene locus_tag LOCUS_09490 20779 18872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 20935 21732 gene locus_tag LOCUS_09500 gene rsmI 20935 21732 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120901.1 protein_id gnl|my_center|LOCUS_09500 <22739 22115 gene locus_tag LOCUS_09510 <22739 22115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546790.1:adenylate kinase >Feature sequence22 <1 777 gene locus_tag LOCUS_09520 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004191371.1:3'-5' exonuclease 758 2128 gene locus_tag LOCUS_09530 gene rlmD 758 2128 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926715.1 protein_id gnl|my_center|LOCUS_09530 2172 2666 gene locus_tag LOCUS_09540 2172 2666 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_09540 2653 3717 gene locus_tag LOCUS_09550 gene nagZ 2653 3717 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704881.1 protein_id gnl|my_center|LOCUS_09550 3714 4304 gene locus_tag LOCUS_09560 3714 4304 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002242054.1 protein_id gnl|my_center|LOCUS_09560 4297 5049 gene locus_tag LOCUS_09570 4297 5049 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036479.1 protein_id gnl|my_center|LOCUS_09570 5707 5018 gene locus_tag LOCUS_09580 5707 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 9254 5700 gene locus_tag LOCUS_09590 gene mfd 9254 5700 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037828.1 protein_id gnl|my_center|LOCUS_09590 12603 9289 gene locus_tag LOCUS_09600 12603 9289 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_09600 10816 10908 gene locus_tag LOCUS_t00200 10816 10908 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 12919 13569 gene locus_tag LOCUS_09610 12919 13569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 15430 13820 gene locus_tag LOCUS_09620 15430 13820 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957525.1 protein_id gnl|my_center|LOCUS_09620 15670 16275 gene locus_tag LOCUS_09630 gene pdxH 15670 16275 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403320.1 protein_id gnl|my_center|LOCUS_09630 16390 17457 gene locus_tag LOCUS_09640 16390 17457 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143817.1 protein_id gnl|my_center|LOCUS_09640 17708 17433 gene locus_tag LOCUS_09650 17708 17433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 18402 17698 gene locus_tag LOCUS_09660 18402 17698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 18815 18417 gene locus_tag LOCUS_09670 18815 18417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 19542 18910 gene locus_tag LOCUS_09680 19542 18910 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141387.1 protein_id gnl|my_center|LOCUS_09680 19911 20262 gene locus_tag LOCUS_tm00010 19911 20262 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 20618 21214 gene locus_tag LOCUS_09690 20618 21214 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807607.1 protein_id gnl|my_center|LOCUS_09690 21201 22226 gene locus_tag LOCUS_09700 21201 22226 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807609.1 protein_id gnl|my_center|LOCUS_09700 >Feature sequence23 2 196 gene locus_tag LOCUS_09710 2 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 193 699 gene locus_tag LOCUS_09720 gene nuoE 193 699 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948474.1 protein_id gnl|my_center|LOCUS_09720 696 2021 gene locus_tag LOCUS_09730 gene nuoF 696 2021 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443944.1 protein_id gnl|my_center|LOCUS_09730 2018 4402 gene locus_tag LOCUS_09740 gene nuoG 2018 4402 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131407368.1 protein_id gnl|my_center|LOCUS_09740 4399 5442 gene locus_tag LOCUS_09750 gene nuoH 4399 5442 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948471.1 protein_id gnl|my_center|LOCUS_09750 5447 5935 gene locus_tag LOCUS_09760 gene nuoI 5447 5935 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508211.1 protein_id gnl|my_center|LOCUS_09760 5944 6570 gene locus_tag LOCUS_09770 5944 6570 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919807.1 protein_id gnl|my_center|LOCUS_09770 6580 6882 gene locus_tag LOCUS_09780 gene nuoK 6580 6882 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813920.1 protein_id gnl|my_center|LOCUS_09780 6892 8847 gene locus_tag LOCUS_09790 gene nuoL 6892 8847 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813919.1 protein_id gnl|my_center|LOCUS_09790 8864 10366 gene locus_tag LOCUS_09800 8864 10366 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186137.1 protein_id gnl|my_center|LOCUS_09800 10398 11855 gene locus_tag LOCUS_09810 gene nuoN 10398 11855 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003694246.1 protein_id gnl|my_center|LOCUS_09810 11951 12027 gene locus_tag LOCUS_t00210 11951 12027 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 13254 13544 gene locus_tag LOCUS_09820 13254 13544 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074357.1 protein_id gnl|my_center|LOCUS_09820 13541 13921 gene locus_tag LOCUS_09830 13541 13921 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074358.1 protein_id gnl|my_center|LOCUS_09830 14402 14001 gene locus_tag LOCUS_09840 14402 14001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 14781 14365 gene locus_tag LOCUS_09850 14781 14365 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143863.1 protein_id gnl|my_center|LOCUS_09850 15026 14778 gene locus_tag LOCUS_09860 gene vapB 15026 14778 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143862.1 protein_id gnl|my_center|LOCUS_09860 18699 15565 gene locus_tag LOCUS_09870 18699 15565 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087230.1 protein_id gnl|my_center|LOCUS_09870 21888 18703 gene locus_tag LOCUS_09880 21888 18703 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087229.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence24 2309 942 gene locus_tag LOCUS_09890 2309 942 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390238.1 protein_id gnl|my_center|LOCUS_09890 4090 2309 gene locus_tag LOCUS_09900 4090 2309 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_09900 4850 4077 gene locus_tag LOCUS_09910 gene otsB 4850 4077 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338618.1 protein_id gnl|my_center|LOCUS_09910 6557 4962 gene locus_tag LOCUS_09920 6557 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 7825 6644 gene locus_tag LOCUS_09930 7825 6644 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439496.1 protein_id gnl|my_center|LOCUS_09930 9000 7831 gene locus_tag LOCUS_09940 9000 7831 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038987.1 protein_id gnl|my_center|LOCUS_09940 9719 8997 gene locus_tag LOCUS_09950 9719 8997 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038986.1 protein_id gnl|my_center|LOCUS_09950 10980 9730 gene locus_tag LOCUS_09960 10980 9730 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275499.1 protein_id gnl|my_center|LOCUS_09960 12294 11065 gene locus_tag LOCUS_09970 12294 11065 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971979.1 protein_id gnl|my_center|LOCUS_09970 13067 12291 gene locus_tag LOCUS_09980 13067 12291 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388482.1 protein_id gnl|my_center|LOCUS_09980 14398 13064 gene locus_tag LOCUS_09990 14398 13064 CDS product NAD/FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388481.1 protein_id gnl|my_center|LOCUS_09990 15819 14395 gene locus_tag LOCUS_10000 15819 14395 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390653.1 protein_id gnl|my_center|LOCUS_10000 15950 16747 gene locus_tag LOCUS_10010 15950 16747 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969349.1 protein_id gnl|my_center|LOCUS_10010 16753 17595 gene locus_tag LOCUS_10020 16753 17595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534300.1 protein_id gnl|my_center|LOCUS_10020 18036 20471 gene locus_tag LOCUS_10030 18036 20471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 21446 20478 gene locus_tag LOCUS_10040 21446 20478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 >Feature sequence25 1354 8 gene locus_tag LOCUS_10050 gene amiB 1354 8 CDS product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_10050 4095 1420 gene locus_tag LOCUS_10060 4095 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 5504 4140 gene locus_tag LOCUS_10070 5504 4140 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037978.1 protein_id gnl|my_center|LOCUS_10070 8757 5569 gene locus_tag LOCUS_10080 gene putA 8757 5569 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038915.1 protein_id gnl|my_center|LOCUS_10080 10033 8762 gene locus_tag LOCUS_10090 10033 8762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 10968 10075 gene locus_tag LOCUS_10100 10968 10075 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539670.1 protein_id gnl|my_center|LOCUS_10100 12031 10976 gene locus_tag LOCUS_10110 12031 10976 CDS product bifunctional UDP-4-keto-pentose/UDP-xylose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193921.1 protein_id gnl|my_center|LOCUS_10110 12960 12028 gene locus_tag LOCUS_10120 12960 12028 CDS product formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192441.1 protein_id gnl|my_center|LOCUS_10120 13982 12957 gene locus_tag LOCUS_10130 13982 12957 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191549.1 protein_id gnl|my_center|LOCUS_10130 15130 13979 gene locus_tag LOCUS_10140 15130 13979 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527179.1 protein_id gnl|my_center|LOCUS_10140 15504 15127 gene locus_tag LOCUS_10150 15504 15127 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192320.1 protein_id gnl|my_center|LOCUS_10150 17186 15501 gene locus_tag LOCUS_10160 17186 15501 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535987.1 protein_id gnl|my_center|LOCUS_10160 18403 17183 gene locus_tag LOCUS_10170 18403 17183 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530058.1 protein_id gnl|my_center|LOCUS_10170 18621 18547 gene locus_tag LOCUS_t00220 18621 18547 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 20103 18901 gene locus_tag LOCUS_10180 20103 18901 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301722.1 protein_id gnl|my_center|LOCUS_10180 <21599 20096 gene locus_tag LOCUS_10190 <21599 20096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_122400454.1:PAS domain S-box protein >Feature sequence26 118 1944 gene locus_tag LOCUS_10200 gene typA 118 1944 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021411.1 protein_id gnl|my_center|LOCUS_10200 2013 3071 gene locus_tag LOCUS_10210 gene hppD 2013 3071 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070689502.1 protein_id gnl|my_center|LOCUS_10210 3586 4716 gene locus_tag LOCUS_10220 3586 4716 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706477.1 protein_id gnl|my_center|LOCUS_10220 4787 5806 gene locus_tag LOCUS_10230 4787 5806 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035835.1 protein_id gnl|my_center|LOCUS_10230 5803 6465 gene locus_tag LOCUS_10240 gene maiA 5803 6465 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071821.1 protein_id gnl|my_center|LOCUS_10240 6462 8888 gene locus_tag LOCUS_10250 6462 8888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 10471 9119 gene locus_tag LOCUS_10260 gene pilR 10471 9119 CDS product two-component system response regulator PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094694.1 protein_id gnl|my_center|LOCUS_10260 12063 10468 gene locus_tag LOCUS_10270 12063 10468 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769277.1 protein_id gnl|my_center|LOCUS_10270 12171 13334 gene locus_tag LOCUS_10280 gene sucC 12171 13334 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210728.1 protein_id gnl|my_center|LOCUS_10280 13331 14206 gene locus_tag LOCUS_10290 gene sucD 13331 14206 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165487.1 protein_id gnl|my_center|LOCUS_10290 14214 15863 gene locus_tag LOCUS_10300 14214 15863 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815768.1 protein_id gnl|my_center|LOCUS_10300 16630 15818 gene locus_tag LOCUS_10310 16630 15818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 16654 17661 gene locus_tag LOCUS_10320 gene rluD 16654 17661 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957782.1 protein_id gnl|my_center|LOCUS_10320 17655 18497 gene locus_tag LOCUS_10330 gene pgeF 17655 18497 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926866.1 protein_id gnl|my_center|LOCUS_10330 18487 21099 gene locus_tag LOCUS_10340 gene clpB 18487 21099 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707734.1 protein_id gnl|my_center|LOCUS_10340 >Feature sequence27 1843 167 gene locus_tag LOCUS_10350 1843 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 3141 1915 gene locus_tag LOCUS_10360 gene fabF 3141 1915 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104132.1 protein_id gnl|my_center|LOCUS_10360 3507 3259 gene locus_tag LOCUS_10370 gene acpP 3507 3259 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002814322.1 protein_id gnl|my_center|LOCUS_10370 4459 3716 gene locus_tag LOCUS_10380 gene fabG 4459 3716 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318510.1 protein_id gnl|my_center|LOCUS_10380 5409 4456 gene locus_tag LOCUS_10390 gene fabD 5409 4456 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225819.1 protein_id gnl|my_center|LOCUS_10390 6216 5512 gene locus_tag LOCUS_10400 6216 5512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 6439 6894 gene locus_tag LOCUS_10410 gene xcpT 6439 6894 CDS product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 protein_id gnl|my_center|LOCUS_10410 6891 7517 gene locus_tag LOCUS_10420 6891 7517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 7510 8067 gene locus_tag LOCUS_10430 7510 8067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 8064 8702 gene locus_tag LOCUS_10440 8064 8702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 8699 9616 gene locus_tag LOCUS_10450 gene gspK 8699 9616 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121457.1 protein_id gnl|my_center|LOCUS_10450 9648 10844 gene locus_tag LOCUS_10460 gene exeL 9648 10844 CDS product GspL family type II secretion system protein ExeL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704547.1 protein_id gnl|my_center|LOCUS_10460 10846 11346 gene locus_tag LOCUS_10470 10846 11346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 11352 12161 gene locus_tag LOCUS_10480 11352 12161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 12163 13440 gene locus_tag LOCUS_10490 gene tviB 12163 13440 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063859.1 protein_id gnl|my_center|LOCUS_10490 13437 14357 gene locus_tag LOCUS_10500 gene rluC 13437 14357 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201356046.1 protein_id gnl|my_center|LOCUS_10500 15308 14724 gene locus_tag LOCUS_10510 gene sodB 15308 14724 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931119.1 protein_id gnl|my_center|LOCUS_10510 15446 16126 gene locus_tag LOCUS_10520 15446 16126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 16131 16988 gene locus_tag LOCUS_10530 gene nadC 16131 16988 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536000.1 protein_id gnl|my_center|LOCUS_10530 18317 16998 gene locus_tag LOCUS_10540 gene tyrS 18317 16998 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229300.1 protein_id gnl|my_center|LOCUS_10540 <20973 18390 gene locus_tag LOCUS_10550 <20973 18390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_080517681.1:bifunctional diguanylate cyclase/phosphodiesterase >Feature sequence28 1432 38 gene locus_tag LOCUS_10560 gene hisD 1432 38 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220532.1 protein_id gnl|my_center|LOCUS_10560 2718 1432 gene locus_tag LOCUS_10570 gene murA 2718 1432 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094332.1 protein_id gnl|my_center|LOCUS_10570 2960 2715 gene locus_tag LOCUS_10580 2960 2715 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037923.1 protein_id gnl|my_center|LOCUS_10580 3072 4079 gene locus_tag LOCUS_10590 3072 4079 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037924.1 protein_id gnl|my_center|LOCUS_10590 4079 4588 gene locus_tag LOCUS_10600 gene kdsC 4079 4588 CDS product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369496.1 protein_id gnl|my_center|LOCUS_10600 5136 4492 gene locus_tag LOCUS_10610 5136 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 5135 5719 gene locus_tag LOCUS_10620 5135 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 5716 6441 gene locus_tag LOCUS_10630 gene lptB 5716 6441 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206203.1 protein_id gnl|my_center|LOCUS_10630 6455 7849 gene locus_tag LOCUS_10640 gene rpoN 6455 7849 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040768.1 protein_id gnl|my_center|LOCUS_10640 7846 8178 gene locus_tag LOCUS_10650 gene hpf 7846 8178 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946225.1 protein_id gnl|my_center|LOCUS_10650 8213 9085 gene locus_tag LOCUS_10660 gene rapZ 8213 9085 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468663.1 protein_id gnl|my_center|LOCUS_10660 10239 9034 gene locus_tag LOCUS_10670 10239 9034 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114804.1 protein_id gnl|my_center|LOCUS_10670 10313 11068 gene locus_tag LOCUS_10680 10313 11068 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390884.1 protein_id gnl|my_center|LOCUS_10680 11065 12000 gene locus_tag LOCUS_10690 11065 12000 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927008.1 protein_id gnl|my_center|LOCUS_10690 12005 13267 gene locus_tag LOCUS_10700 12005 13267 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207256.1 protein_id gnl|my_center|LOCUS_10700 13322 15238 gene locus_tag LOCUS_10710 13322 15238 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258483.1 protein_id gnl|my_center|LOCUS_10710 15891 15268 gene locus_tag LOCUS_10720 15891 15268 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014509047.1 protein_id gnl|my_center|LOCUS_10720 16017 16790 gene locus_tag LOCUS_10730 16017 16790 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401354.1 protein_id gnl|my_center|LOCUS_10730 17410 18540 gene locus_tag LOCUS_10740 17410 18540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 18624 18827 gene locus_tag LOCUS_10750 18624 18827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10750 19120 19545 gene locus_tag LOCUS_10760 19120 19545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 >Feature sequence29 1697 1233 gene locus_tag LOCUS_10770 1697 1233 CDS product Arginine pathway regulatory protein ArgR, repressor of arg regulon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444813.1 protein_id gnl|my_center|LOCUS_10770 1949 3040 gene locus_tag LOCUS_10780 1949 3040 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404943.1 protein_id gnl|my_center|LOCUS_10780 3045 4046 gene locus_tag LOCUS_10790 3045 4046 CDS product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404944.1 protein_id gnl|my_center|LOCUS_10790 4043 4942 gene locus_tag LOCUS_10800 gene argB 4043 4942 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878775.1 protein_id gnl|my_center|LOCUS_10800 4939 6303 gene locus_tag LOCUS_10810 gene argH 4939 6303 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404947.1 protein_id gnl|my_center|LOCUS_10810 6300 7511 gene locus_tag LOCUS_10820 gene argG 6300 7511 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404940.1 protein_id gnl|my_center|LOCUS_10820 7505 8557 gene locus_tag LOCUS_10830 7505 8557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404941.1 protein_id gnl|my_center|LOCUS_10830 8554 9585 gene locus_tag LOCUS_10840 gene argC 8554 9585 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065747.1 protein_id gnl|my_center|LOCUS_10840 9704 10135 gene locus_tag LOCUS_10850 gene ndk 9704 10135 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092811.1 protein_id gnl|my_center|LOCUS_10850 10117 11229 gene locus_tag LOCUS_10860 gene rlmN 10117 11229 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063936.1 protein_id gnl|my_center|LOCUS_10860 11205 11984 gene locus_tag LOCUS_10870 gene tapF 11205 11984 CDS product PilW family type IVa pilus biogenesis/stability lipoprotein TapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705643.1 protein_id gnl|my_center|LOCUS_10870 11981 12790 gene locus_tag LOCUS_10880 11981 12790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 12841 13575 gene locus_tag LOCUS_10890 12841 13575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 13572 14729 gene locus_tag LOCUS_10900 gene bamB 13572 14729 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810701.1 protein_id gnl|my_center|LOCUS_10900 14737 16083 gene locus_tag LOCUS_10910 gene der 14737 16083 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037150.1 protein_id gnl|my_center|LOCUS_10910 16080 17150 gene locus_tag LOCUS_10920 16080 17150 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037373.1 protein_id gnl|my_center|LOCUS_10920 17164 18009 gene locus_tag LOCUS_10930 17164 18009 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763632.1 protein_id gnl|my_center|LOCUS_10930 18014 18442 gene locus_tag LOCUS_10940 18014 18442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 18755 18919 gene locus_tag LOCUS_10950 18755 18919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 >Feature sequence30 3830 2598 gene locus_tag LOCUS_10960 3830 2598 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114484.1 protein_id gnl|my_center|LOCUS_10960 4811 3834 gene locus_tag LOCUS_10970 4811 3834 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006448747.1 protein_id gnl|my_center|LOCUS_10970 5889 4804 gene locus_tag LOCUS_10980 gene pdhA 5889 4804 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213838.1 protein_id gnl|my_center|LOCUS_10980 5925 6890 gene locus_tag LOCUS_10990 5925 6890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 7609 6989 gene locus_tag LOCUS_11000 7609 6989 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545448.1 protein_id gnl|my_center|LOCUS_11000 8086 8445 gene locus_tag LOCUS_11010 8086 8445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 9479 8658 gene locus_tag LOCUS_11020 gene mutM 9479 8658 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102876.1 protein_id gnl|my_center|LOCUS_11020 10356 9454 gene locus_tag LOCUS_11030 10356 9454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 11719 10367 gene locus_tag LOCUS_11040 11719 10367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 12481 11726 gene locus_tag LOCUS_11050 gene gldF 12481 11726 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_11050 13452 12478 gene locus_tag LOCUS_11060 13452 12478 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_11060 13699 13544 gene locus_tag LOCUS_11070 gene rpmG 13699 13544 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392084.1 protein_id gnl|my_center|LOCUS_11070 13965 13729 gene locus_tag LOCUS_11080 gene rpmB 13965 13729 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091955.1 protein_id gnl|my_center|LOCUS_11080 14059 15318 gene locus_tag LOCUS_11090 gene coaBC 14059 15318 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 protein_id gnl|my_center|LOCUS_11090 15315 15764 gene locus_tag LOCUS_11100 gene dut 15315 15764 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298007.1 protein_id gnl|my_center|LOCUS_11100 15676 16092 gene locus_tag LOCUS_11110 15676 16092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11110 16200 16805 gene locus_tag LOCUS_11120 16200 16805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11120 16851 16926 gene locus_tag LOCUS_t00230 16851 16926 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 17189 17641 gene locus_tag LOCUS_11130 17189 17641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 17677 18387 gene locus_tag LOCUS_11140 17677 18387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 18499 18855 gene locus_tag LOCUS_11150 18499 18855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 >Feature sequence31 188 610 gene locus_tag LOCUS_11160 188 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 840 607 gene locus_tag LOCUS_11170 840 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 919 1098 gene locus_tag LOCUS_11180 919 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1192 1119 gene locus_tag LOCUS_t00240 1192 1119 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1248 1451 gene locus_tag LOCUS_11190 gene thiS 1248 1451 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_11190 1715 2245 gene locus_tag LOCUS_11200 1715 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 2242 2922 gene locus_tag LOCUS_11210 2242 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 3551 2919 gene locus_tag LOCUS_11220 3551 2919 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888969.1 protein_id gnl|my_center|LOCUS_11220 4834 3578 gene locus_tag LOCUS_11230 4834 3578 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963843.1 protein_id gnl|my_center|LOCUS_11230 6320 5016 gene locus_tag LOCUS_11240 6320 5016 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523086.1 protein_id gnl|my_center|LOCUS_11240 7114 6317 gene locus_tag LOCUS_11250 7114 6317 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133882877.1 protein_id gnl|my_center|LOCUS_11250 7181 7846 gene locus_tag LOCUS_11260 gene pyrE 7181 7846 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096586.1 protein_id gnl|my_center|LOCUS_11260 8032 8658 gene locus_tag LOCUS_11270 8032 8658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 8681 10120 gene locus_tag LOCUS_11280 8681 10120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 10616 10143 gene locus_tag LOCUS_11290 10616 10143 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880938.1 protein_id gnl|my_center|LOCUS_11290 10722 11921 gene locus_tag LOCUS_11300 gene kbl 10722 11921 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213845.1 protein_id gnl|my_center|LOCUS_11300 11918 12955 gene locus_tag LOCUS_11310 gene tdh 11918 12955 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194543.1 protein_id gnl|my_center|LOCUS_11310 12952 13404 gene locus_tag LOCUS_11320 12952 13404 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228632.1 protein_id gnl|my_center|LOCUS_11320 13532 14119 gene locus_tag LOCUS_11330 13532 14119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 16570 14144 gene locus_tag LOCUS_11340 16570 14144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 >Feature sequence32 1557 436 gene locus_tag LOCUS_11350 1557 436 CDS product TQO small subunit DoxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112642.1 protein_id gnl|my_center|LOCUS_11350 2622 1582 gene locus_tag LOCUS_11360 2622 1582 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978086.1 protein_id gnl|my_center|LOCUS_11360 3234 2689 gene locus_tag LOCUS_11370 3234 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 3369 4328 gene locus_tag LOCUS_11380 3369 4328 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_11380 4754 4335 gene locus_tag LOCUS_11390 4754 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 4986 4810 gene locus_tag LOCUS_11400 4986 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 5712 4996 gene locus_tag LOCUS_11410 5712 4996 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408266.1 protein_id gnl|my_center|LOCUS_11410 5760 7181 gene locus_tag LOCUS_11420 5760 7181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 7178 8260 gene locus_tag LOCUS_11430 7178 8260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 8257 11541 gene locus_tag LOCUS_11440 8257 11541 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963916.1 protein_id gnl|my_center|LOCUS_11440 11580 11810 gene locus_tag LOCUS_11450 11580 11810 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073000.1 protein_id gnl|my_center|LOCUS_11450 11794 12294 gene locus_tag LOCUS_11460 11794 12294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 12913 12383 gene locus_tag LOCUS_11470 12913 12383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 13063 13443 gene locus_tag LOCUS_11480 13063 13443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 14218 13595 gene locus_tag LOCUS_11490 14218 13595 CDS product lipid-binding SYLF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070689.1 protein_id gnl|my_center|LOCUS_11490 14477 14250 gene locus_tag LOCUS_11500 14477 14250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 16077 14539 gene locus_tag LOCUS_11510 gene gshA 16077 14539 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535409.1 protein_id gnl|my_center|LOCUS_11510 16646 16203 gene locus_tag LOCUS_11520 gene pilE 16646 16203 CDS product type 4a pilus minor pilin PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094721.1 protein_id gnl|my_center|LOCUS_11520 16921 16643 gene locus_tag LOCUS_11530 16921 16643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 <18399 16950 gene locus_tag LOCUS_11540 <18399 16950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011213223.1:PilC/PilY family type IV pilus protein >Feature sequence33 1209 907 gene locus_tag LOCUS_11550 1209 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11550 2804 1737 gene locus_tag LOCUS_11560 2804 1737 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980466.1 protein_id gnl|my_center|LOCUS_11560 2733 2897 gene locus_tag LOCUS_11570 2733 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 3008 3652 gene locus_tag LOCUS_11580 3008 3652 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705502.1 protein_id gnl|my_center|LOCUS_11580 4490 3696 gene locus_tag LOCUS_11590 gene trpA 4490 3696 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083161.1 protein_id gnl|my_center|LOCUS_11590 5692 4487 gene locus_tag LOCUS_11600 gene trpB 5692 4487 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706727.1 protein_id gnl|my_center|LOCUS_11600 7089 5689 gene locus_tag LOCUS_11610 gene trpCF 7089 5689 CDS product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818276.1 protein_id gnl|my_center|LOCUS_11610 8095 7079 gene locus_tag LOCUS_11620 gene trpD 8095 7079 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706725.1 protein_id gnl|my_center|LOCUS_11620 8709 8092 gene locus_tag LOCUS_11630 8709 8092 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465090.1 protein_id gnl|my_center|LOCUS_11630 10283 8706 gene locus_tag LOCUS_11640 10283 8706 CDS product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030227.1 protein_id gnl|my_center|LOCUS_11640 11290 10280 gene locus_tag LOCUS_11650 gene aroF 11290 10280 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392848.1 protein_id gnl|my_center|LOCUS_11650 11788 12774 gene locus_tag LOCUS_11660 gene nadA 11788 12774 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533321.1 protein_id gnl|my_center|LOCUS_11660 12771 14300 gene locus_tag LOCUS_11670 12771 14300 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973560.1 protein_id gnl|my_center|LOCUS_11670 14326 15045 gene locus_tag LOCUS_11680 14326 15045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 15057 15752 gene locus_tag LOCUS_11690 15057 15752 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256873.1 protein_id gnl|my_center|LOCUS_11690 >Feature sequence34 539 648 gene locus_tag LOCUS_r00020 539 648 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 804 1601 gene locus_tag LOCUS_11700 804 1601 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036519.1 protein_id gnl|my_center|LOCUS_11700 1604 2662 gene locus_tag LOCUS_11710 1604 2662 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044885.1 protein_id gnl|my_center|LOCUS_11710 2670 3635 gene locus_tag LOCUS_11720 2670 3635 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242008.1 protein_id gnl|my_center|LOCUS_11720 3952 3602 gene locus_tag LOCUS_11730 3952 3602 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036180.1 protein_id gnl|my_center|LOCUS_11730 4085 4918 gene locus_tag LOCUS_11740 4085 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 4915 5580 gene locus_tag LOCUS_11750 gene plsY 4915 5580 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228511.1 protein_id gnl|my_center|LOCUS_11750 5570 6574 gene locus_tag LOCUS_11760 gene birA 5570 6574 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039011.1 protein_id gnl|my_center|LOCUS_11760 6571 7344 gene locus_tag LOCUS_11770 6571 7344 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768914.1 protein_id gnl|my_center|LOCUS_11770 7341 8144 gene locus_tag LOCUS_11780 7341 8144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 8298 8498 gene locus_tag LOCUS_11790 8298 8498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 9766 9548 gene locus_tag LOCUS_11800 9766 9548 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 protein_id gnl|my_center|LOCUS_11800 10623 12674 gene locus_tag LOCUS_11810 10623 12674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 13013 12786 gene locus_tag LOCUS_11820 13013 12786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 13691 13470 gene locus_tag LOCUS_11830 13691 13470 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 protein_id gnl|my_center|LOCUS_11830 14768 14040 gene locus_tag LOCUS_11840 14768 14040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 >Feature sequence35 1293 178 gene locus_tag LOCUS_11850 1293 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1588 1301 gene locus_tag LOCUS_11860 1588 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 2349 2131 gene locus_tag LOCUS_11870 2349 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 2558 2896 gene locus_tag LOCUS_11880 2558 2896 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946746.1 protein_id gnl|my_center|LOCUS_11880 2899 4569 gene locus_tag LOCUS_11890 2899 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 4634 5239 gene locus_tag LOCUS_11900 gene recR 4634 5239 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195023.1 protein_id gnl|my_center|LOCUS_11900 5267 5614 gene locus_tag LOCUS_11910 5267 5614 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131883.1 protein_id gnl|my_center|LOCUS_11910 5611 6192 gene locus_tag LOCUS_11920 gene orn 5611 6192 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813303.1 protein_id gnl|my_center|LOCUS_11920 6275 6871 gene locus_tag LOCUS_11930 gene rpoE 6275 6871 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813797.1 protein_id gnl|my_center|LOCUS_11930 6911 7528 gene locus_tag LOCUS_11940 6911 7528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 7528 8496 gene locus_tag LOCUS_11950 7528 8496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 8493 8774 gene locus_tag LOCUS_11960 8493 8774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 8771 10588 gene locus_tag LOCUS_11970 gene lepA 8771 10588 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947592.1 protein_id gnl|my_center|LOCUS_11970 10629 11399 gene locus_tag LOCUS_11980 gene lepB 10629 11399 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444404.1 protein_id gnl|my_center|LOCUS_11980 11387 11791 gene locus_tag LOCUS_11990 11387 11791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 11788 12471 gene locus_tag LOCUS_12000 gene rnc 11788 12471 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036467.1 protein_id gnl|my_center|LOCUS_12000 12468 13379 gene locus_tag LOCUS_12010 gene era 12468 13379 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937363.1 protein_id gnl|my_center|LOCUS_12010 13376 14182 gene locus_tag LOCUS_12020 gene recO 13376 14182 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405347.1 protein_id gnl|my_center|LOCUS_12020 14166 14918 gene locus_tag LOCUS_12030 gene pdxJ 14166 14918 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101974.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence36 97 1005 gene locus_tag LOCUS_12040 97 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 1169 2071 gene locus_tag LOCUS_12050 1169 2071 CDS product DUF4382 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479922.1 protein_id gnl|my_center|LOCUS_12050 2245 3297 gene locus_tag LOCUS_12060 gene hrcA 2245 3297 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628994.1 protein_id gnl|my_center|LOCUS_12060 3359 3949 gene locus_tag LOCUS_12070 3359 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 4016 5947 gene locus_tag LOCUS_12080 gene dnaK 4016 5947 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770882.1 protein_id gnl|my_center|LOCUS_12080 6027 7124 gene locus_tag LOCUS_12090 gene dnaJ 6027 7124 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209249.1 protein_id gnl|my_center|LOCUS_12090 7121 7879 gene locus_tag LOCUS_12100 gene dapB 7121 7879 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037010.1 protein_id gnl|my_center|LOCUS_12100 7976 9199 gene locus_tag LOCUS_12110 gene carA 7976 9199 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095209.1 protein_id gnl|my_center|LOCUS_12110 9183 12479 gene locus_tag LOCUS_12120 gene carB 9183 12479 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037013.1 protein_id gnl|my_center|LOCUS_12120 12503 12964 gene locus_tag LOCUS_12130 gene greA 12503 12964 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001341894.1 protein_id gnl|my_center|LOCUS_12130 12986 13612 gene locus_tag LOCUS_12140 12986 13612 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958173.1 protein_id gnl|my_center|LOCUS_12140 >Feature sequence37 334 675 gene locus_tag LOCUS_12150 334 675 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037236.1 protein_id gnl|my_center|LOCUS_12150 2026 683 gene locus_tag LOCUS_12160 2026 683 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036689.1 protein_id gnl|my_center|LOCUS_12160 2657 2055 gene locus_tag LOCUS_12170 2657 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 2998 2654 gene locus_tag LOCUS_12180 2998 2654 CDS product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 protein_id gnl|my_center|LOCUS_12180 3543 2986 gene locus_tag LOCUS_12190 3543 2986 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408503.1 protein_id gnl|my_center|LOCUS_12190 5530 3620 gene locus_tag LOCUS_12200 gene aspS 5530 3620 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554661.1 protein_id gnl|my_center|LOCUS_12200 6367 5723 gene locus_tag LOCUS_12210 6367 5723 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772090.1 protein_id gnl|my_center|LOCUS_12210 6749 6372 gene locus_tag LOCUS_12220 6749 6372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 7670 6819 gene locus_tag LOCUS_12230 gene hutG 7670 6819 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931099.1 protein_id gnl|my_center|LOCUS_12230 9052 7667 gene locus_tag LOCUS_12240 9052 7667 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088984.1 protein_id gnl|my_center|LOCUS_12240 9017 10204 gene locus_tag LOCUS_12250 gene hutI 9017 10204 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114456.1 protein_id gnl|my_center|LOCUS_12250 10201 11742 gene locus_tag LOCUS_12260 gene hutH 10201 11742 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269251.1 protein_id gnl|my_center|LOCUS_12260 11751 12608 gene locus_tag LOCUS_12270 11751 12608 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035554.1 protein_id gnl|my_center|LOCUS_12270 12640 14076 gene locus_tag LOCUS_12280 12640 14076 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037909.1 protein_id gnl|my_center|LOCUS_12280 14438 14283 gene locus_tag LOCUS_12290 14438 14283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 >Feature sequence38 336 1268 gene locus_tag LOCUS_12300 336 1268 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038480.1 protein_id gnl|my_center|LOCUS_12300 2209 1361 gene locus_tag LOCUS_12310 2209 1361 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521810.1 protein_id gnl|my_center|LOCUS_12310 3747 2209 gene locus_tag LOCUS_12320 3747 2209 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947081.1 protein_id gnl|my_center|LOCUS_12320 4929 3778 gene locus_tag LOCUS_12330 4929 3778 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213649.1 protein_id gnl|my_center|LOCUS_12330 6712 5267 gene locus_tag LOCUS_12340 6712 5267 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978673.1 protein_id gnl|my_center|LOCUS_12340 7110 7727 gene locus_tag LOCUS_12350 7110 7727 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095305.1 protein_id gnl|my_center|LOCUS_12350 8890 7781 gene locus_tag LOCUS_12360 8890 7781 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937438.1 protein_id gnl|my_center|LOCUS_12360 10005 8890 gene locus_tag LOCUS_12370 10005 8890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 11747 10002 gene locus_tag LOCUS_12380 11747 10002 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391778.1 protein_id gnl|my_center|LOCUS_12380 12777 11737 gene locus_tag LOCUS_12390 12777 11737 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812256.1 protein_id gnl|my_center|LOCUS_12390 13231 13548 gene locus_tag LOCUS_12400 13231 13548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 >Feature sequence39 6123 727 gene locus_tag LOCUS_12410 6123 727 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625869.1 protein_id gnl|my_center|LOCUS_12410 6584 6877 gene locus_tag LOCUS_12420 6584 6877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 8372 6804 gene locus_tag LOCUS_12430 gene mdoG 8372 6804 CDS product glucans biosynthesis protein MdoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069327.1 protein_id gnl|my_center|LOCUS_12430 10815 8950 gene locus_tag LOCUS_12440 gene mdoG 10815 8950 CDS product glucans biosynthesis protein MdoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001562609.1 protein_id gnl|my_center|LOCUS_12440 12751 10754 gene locus_tag LOCUS_12450 gene mdoH 12751 10754 CDS product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103448.1 protein_id gnl|my_center|LOCUS_12450 13158 12817 gene locus_tag LOCUS_12460 13158 12817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 13561 13643 gene locus_tag LOCUS_t00250 13561 13643 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13807 14163 gene locus_tag LOCUS_12470 13807 14163 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979093.1 protein_id gnl|my_center|LOCUS_12470 >Feature sequence40 3106 413 gene locus_tag LOCUS_12480 gene aceE 3106 413 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444499.1 protein_id gnl|my_center|LOCUS_12480 3221 4306 gene locus_tag LOCUS_12490 gene pyrC 3221 4306 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958384.1 protein_id gnl|my_center|LOCUS_12490 4303 4953 gene locus_tag LOCUS_12500 gene rnt 4303 4953 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412908.1 protein_id gnl|my_center|LOCUS_12500 5325 4978 gene locus_tag LOCUS_12510 5325 4978 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816377.1 protein_id gnl|my_center|LOCUS_12510 6281 5439 gene locus_tag LOCUS_12520 6281 5439 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776901.1 protein_id gnl|my_center|LOCUS_12520 7123 6278 gene locus_tag LOCUS_12530 gene lgt 7123 6278 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112963.1 protein_id gnl|my_center|LOCUS_12530 8146 7181 gene locus_tag LOCUS_12540 8146 7181 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_12540 9615 8143 gene locus_tag LOCUS_12550 gene gcvPB 9615 8143 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958389.1 protein_id gnl|my_center|LOCUS_12550 10112 9612 gene locus_tag LOCUS_12560 gene tpx 10112 9612 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439256.1 protein_id gnl|my_center|LOCUS_12560 11560 10145 gene locus_tag LOCUS_12570 gene gcvPA 11560 10145 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770511.1 protein_id gnl|my_center|LOCUS_12570 11954 11553 gene locus_tag LOCUS_12580 gene gcvH 11954 11553 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695621.1 protein_id gnl|my_center|LOCUS_12580 13064 11964 gene locus_tag LOCUS_12590 gene gcvT 13064 11964 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114049.1 protein_id gnl|my_center|LOCUS_12590 >Feature sequence41 1393 2529 gene locus_tag LOCUS_12600 1393 2529 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171355.1 protein_id gnl|my_center|LOCUS_12600 2670 3731 gene locus_tag LOCUS_12610 2670 3731 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946749.1 protein_id gnl|my_center|LOCUS_12610 3728 4918 gene locus_tag LOCUS_12620 3728 4918 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036490.1 protein_id gnl|my_center|LOCUS_12620 5209 6546 gene locus_tag LOCUS_12630 5209 6546 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973074.1 protein_id gnl|my_center|LOCUS_12630 6549 7349 gene locus_tag LOCUS_12640 6549 7349 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930516.1 protein_id gnl|my_center|LOCUS_12640 7346 9370 gene locus_tag LOCUS_12650 7346 9370 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337543.1 protein_id gnl|my_center|LOCUS_12650 9367 10311 gene locus_tag LOCUS_12660 9367 10311 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389693.1 protein_id gnl|my_center|LOCUS_12660 10373 12268 gene locus_tag LOCUS_12670 10373 12268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 12265 13209 gene locus_tag LOCUS_12680 12265 13209 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_12680 >Feature sequence42 <1 864 gene locus_tag LOCUS_12690 <1 864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003148380.1:serine hydroxymethyltransferase 871 1371 gene locus_tag LOCUS_12700 gene nrdR 871 1371 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107181.1 protein_id gnl|my_center|LOCUS_12700 1398 2489 gene locus_tag LOCUS_12710 gene ribD 1398 2489 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704561.1 protein_id gnl|my_center|LOCUS_12710 2489 3124 gene locus_tag LOCUS_12720 2489 3124 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392433.1 protein_id gnl|my_center|LOCUS_12720 4619 3045 gene locus_tag LOCUS_12730 4619 3045 CDS product thioredoxin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230910.1 protein_id gnl|my_center|LOCUS_12730 7751 4659 gene locus_tag LOCUS_12740 7751 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_12740 7814 8638 gene locus_tag LOCUS_12750 7814 8638 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529074.1 protein_id gnl|my_center|LOCUS_12750 8672 9193 gene locus_tag LOCUS_12760 8672 9193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 10519 9242 gene locus_tag LOCUS_12770 10519 9242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 12598 10574 gene locus_tag LOCUS_12780 gene dsbD 12598 10574 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064751.1 protein_id gnl|my_center|LOCUS_12780 >Feature sequence43 <1 2385 gene locus_tag LOCUS_12790 <1 2385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000449873.1:methylmalonyl-CoA mutase family protein 2382 3305 gene locus_tag LOCUS_12800 gene xerD 2382 3305 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092629.1 protein_id gnl|my_center|LOCUS_12800 3651 3328 gene locus_tag LOCUS_12810 3651 3328 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036917.1 protein_id gnl|my_center|LOCUS_12810 4268 3690 gene locus_tag LOCUS_12820 4268 3690 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_12820 4397 4311 gene locus_tag LOCUS_t00260 4397 4311 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5273 4488 gene locus_tag LOCUS_12830 5273 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 5308 6354 gene locus_tag LOCUS_12840 gene queA 5308 6354 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002248769.1 protein_id gnl|my_center|LOCUS_12840 6574 6332 gene locus_tag LOCUS_12850 6574 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 6470 7462 gene locus_tag LOCUS_12860 gene tgt 6470 7462 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778950.1 protein_id gnl|my_center|LOCUS_12860 7489 7818 gene locus_tag LOCUS_12870 gene yajC 7489 7818 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958034.1 protein_id gnl|my_center|LOCUS_12870 7861 9705 gene locus_tag LOCUS_12880 gene secD 7861 9705 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947717.1 protein_id gnl|my_center|LOCUS_12880 9728 10660 gene locus_tag LOCUS_12890 gene secF 9728 10660 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772700.1 protein_id gnl|my_center|LOCUS_12890 11478 10657 gene locus_tag LOCUS_12900 11478 10657 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947474.1 protein_id gnl|my_center|LOCUS_12900 11565 12773 gene locus_tag LOCUS_12910 11565 12773 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705635.1 protein_id gnl|my_center|LOCUS_12910 12760 13224 gene locus_tag LOCUS_12920 12760 13224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 >Feature sequence44 2303 3313 gene locus_tag LOCUS_12930 gene mbfA 2303 3313 CDS product iron exporter MbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090619.1 protein_id gnl|my_center|LOCUS_12930 3516 3440 gene locus_tag LOCUS_t00270 3516 3440 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5781 3646 gene locus_tag LOCUS_12940 gene uvrB 5781 3646 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104590.1 protein_id gnl|my_center|LOCUS_12940 5824 7074 gene locus_tag LOCUS_12950 5824 7074 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118408.1 protein_id gnl|my_center|LOCUS_12950 7071 7850 gene locus_tag LOCUS_12960 7071 7850 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037490.1 protein_id gnl|my_center|LOCUS_12960 7932 9323 gene locus_tag LOCUS_12970 gene hemN 7932 9323 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087267.1 protein_id gnl|my_center|LOCUS_12970 9539 11341 gene locus_tag LOCUS_12980 9539 11341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 11510 12817 gene locus_tag LOCUS_12990 11510 12817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 >Feature sequence45 <1 694 gene locus_tag LOCUS_13000 <1 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005771755.1:UDP-N-acetylglucosamine 1-carboxyvinyltransferase 1229 621 gene locus_tag LOCUS_13010 1229 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 1376 2803 gene locus_tag LOCUS_13020 1376 2803 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094159.1 protein_id gnl|my_center|LOCUS_13020 2800 3555 gene locus_tag LOCUS_13030 2800 3555 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994029.1 protein_id gnl|my_center|LOCUS_13030 3629 4009 gene locus_tag LOCUS_13040 3629 4009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 4769 4074 gene locus_tag LOCUS_13050 gene petA 4769 4074 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707597.1 protein_id gnl|my_center|LOCUS_13050 5404 4904 gene locus_tag LOCUS_13060 5404 4904 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_13060 5553 6851 gene locus_tag LOCUS_13070 5553 6851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 6912 7298 gene locus_tag LOCUS_13080 6912 7298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 9851 7269 gene locus_tag LOCUS_13090 gene mutS 9851 7269 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095574877.1 protein_id gnl|my_center|LOCUS_13090 10092 10592 gene locus_tag LOCUS_13100 10092 10592 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016945236.1 protein_id gnl|my_center|LOCUS_13100 10600 11151 gene locus_tag LOCUS_13110 gene thpR 10600 11151 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807724.1 protein_id gnl|my_center|LOCUS_13110 11179 12213 gene locus_tag LOCUS_13120 gene recA 11179 12213 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947527.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence46 1255 317 gene locus_tag LOCUS_13130 1255 317 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050911213.1 protein_id gnl|my_center|LOCUS_13130 3225 1252 gene locus_tag LOCUS_13140 3225 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 3325 4125 gene locus_tag LOCUS_13150 gene djlA 3325 4125 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220839.1 protein_id gnl|my_center|LOCUS_13150 4167 4865 gene locus_tag LOCUS_13160 gene rpe 4167 4865 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019237199.1 protein_id gnl|my_center|LOCUS_13160 4959 5807 gene locus_tag LOCUS_13170 gene speD 4959 5807 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869485.1 protein_id gnl|my_center|LOCUS_13170 6454 5819 gene locus_tag LOCUS_13180 gene coq7 6454 5819 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035727.1 protein_id gnl|my_center|LOCUS_13180 6501 7508 gene locus_tag LOCUS_13190 6501 7508 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088878.1 protein_id gnl|my_center|LOCUS_13190 7505 8839 gene locus_tag LOCUS_13200 7505 8839 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943098.1 protein_id gnl|my_center|LOCUS_13200 9695 8817 gene locus_tag LOCUS_13210 9695 8817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 10587 9769 gene locus_tag LOCUS_13220 10587 9769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 12118 10745 gene locus_tag LOCUS_13230 12118 10745 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957528.1 protein_id gnl|my_center|LOCUS_13230 >Feature sequence47 <1 534 gene locus_tag LOCUS_13240 <1 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940195.1:2,3-diphosphoglycerate-dependent phosphoglycerate mutase 1382 435 gene locus_tag LOCUS_13250 1382 435 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_13250 2419 1379 gene locus_tag LOCUS_13260 2419 1379 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_13260 2706 2416 gene locus_tag LOCUS_13270 2706 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 2826 4073 gene locus_tag LOCUS_13280 2826 4073 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 protein_id gnl|my_center|LOCUS_13280 4066 4776 gene locus_tag LOCUS_13290 gene lolD 4066 4776 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817672.1 protein_id gnl|my_center|LOCUS_13290 4813 5439 gene locus_tag LOCUS_13300 4813 5439 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037273.1 protein_id gnl|my_center|LOCUS_13300 5436 5879 gene locus_tag LOCUS_13310 5436 5879 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037272.1 protein_id gnl|my_center|LOCUS_13310 5876 7633 gene locus_tag LOCUS_13320 gene msbA 5876 7633 CDS product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170994.1 protein_id gnl|my_center|LOCUS_13320 7641 8684 gene locus_tag LOCUS_13330 gene lpxK 7641 8684 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555967.1 protein_id gnl|my_center|LOCUS_13330 8681 8872 gene locus_tag LOCUS_13340 8681 8872 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196455.1 protein_id gnl|my_center|LOCUS_13340 8869 9630 gene locus_tag LOCUS_13350 gene kdsB 8869 9630 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185994.1 protein_id gnl|my_center|LOCUS_13350 9755 10096 gene locus_tag LOCUS_13360 gene rplS 9755 10096 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771383.1 protein_id gnl|my_center|LOCUS_13360 10249 11931 gene locus_tag LOCUS_13370 10249 11931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 >Feature sequence48 668 2029 gene locus_tag LOCUS_13380 gene mpl 668 2029 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038392.1 protein_id gnl|my_center|LOCUS_13380 3950 1962 gene locus_tag LOCUS_13390 3950 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 5258 3960 gene locus_tag LOCUS_13400 gene hemL 5258 3960 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095641.1 protein_id gnl|my_center|LOCUS_13400 5992 5342 gene locus_tag LOCUS_13410 gene thiE 5992 5342 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093148.1 protein_id gnl|my_center|LOCUS_13410 6816 5983 gene locus_tag LOCUS_13420 6816 5983 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 protein_id gnl|my_center|LOCUS_13420 6888 7040 gene locus_tag LOCUS_13430 6888 7040 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770288.1 protein_id gnl|my_center|LOCUS_13430 7098 8393 gene locus_tag LOCUS_13440 7098 8393 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388514.1 protein_id gnl|my_center|LOCUS_13440 8451 9350 gene locus_tag LOCUS_13450 8451 9350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 10343 9366 gene locus_tag LOCUS_13460 10343 9366 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720898.1 protein_id gnl|my_center|LOCUS_13460 11613 10804 gene locus_tag LOCUS_13470 11613 10804 CDS product DUF929 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979644.1 protein_id gnl|my_center|LOCUS_13470 >Feature sequence49 783 1073 gene locus_tag LOCUS_13480 783 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 1070 2110 gene locus_tag LOCUS_13490 1070 2110 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_13490 2107 3054 gene locus_tag LOCUS_13500 2107 3054 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_13500 3698 2955 gene locus_tag LOCUS_13510 gene gpmA 3698 2955 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940195.1 protein_id gnl|my_center|LOCUS_13510 3858 7049 gene locus_tag LOCUS_13520 3858 7049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_13520 8444 7107 gene locus_tag LOCUS_13530 gene aroA 8444 7107 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479628.1 protein_id gnl|my_center|LOCUS_13530 8638 10029 gene locus_tag LOCUS_13540 8638 10029 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526169.1 protein_id gnl|my_center|LOCUS_13540 10026 10277 gene locus_tag LOCUS_13550 10026 10277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 10460 11029 gene locus_tag LOCUS_13560 10460 11029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 <11596 11030 gene locus_tag LOCUS_13570 <11596 11030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083827.1:MBL fold metallo-hydrolase >Feature sequence50 3 2264 gene locus_tag LOCUS_13580 3 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 5505 3862 gene locus_tag LOCUS_13590 gene merA 5505 3862 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281123.1 protein_id gnl|my_center|LOCUS_13590 5718 6167 gene locus_tag LOCUS_13600 gene merR 5718 6167 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166628.1 protein_id gnl|my_center|LOCUS_13600 6318 6842 gene locus_tag LOCUS_13610 6318 6842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 6846 7367 gene locus_tag LOCUS_13620 6846 7367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 7479 7850 gene locus_tag LOCUS_13630 7479 7850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 7834 8094 gene locus_tag LOCUS_13640 7834 8094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 8874 8362 gene locus_tag LOCUS_13650 8874 8362 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089084.1 protein_id gnl|my_center|LOCUS_13650 10237 8891 gene locus_tag LOCUS_13660 10237 8891 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528369.1 protein_id gnl|my_center|LOCUS_13660 <11473 10342 gene locus_tag LOCUS_13670 <11473 10342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004548282.1:hydrogenase 4 subunit F >Feature sequence51 1314 1535 gene locus_tag LOCUS_13680 1314 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 1548 3041 gene locus_tag LOCUS_13690 1548 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 4454 3165 gene locus_tag LOCUS_13700 4454 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 6121 4451 gene locus_tag LOCUS_13710 gene hutU 6121 4451 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895695.1 protein_id gnl|my_center|LOCUS_13710 10091 6102 gene locus_tag LOCUS_13720 gene purL 10091 6102 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819788.1 protein_id gnl|my_center|LOCUS_13720 10896 10177 gene locus_tag LOCUS_13730 10896 10177 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143390.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence52 <1 718 gene locus_tag LOCUS_13740 <1 718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015443940.1:ATP-dependent zinc metalloprotease FtsH 729 1574 gene locus_tag LOCUS_13750 gene folP 729 1574 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113907.1 protein_id gnl|my_center|LOCUS_13750 1571 2935 gene locus_tag LOCUS_13760 gene glmM 1571 2935 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 protein_id gnl|my_center|LOCUS_13760 2947 3729 gene locus_tag LOCUS_13770 gene tpiA 2947 3729 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186004.1 protein_id gnl|my_center|LOCUS_13770 3746 4129 gene locus_tag LOCUS_13780 3746 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 4185 4269 gene locus_tag LOCUS_t00280 4185 4269 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4441 4626 gene locus_tag LOCUS_13790 4441 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 4640 5140 gene locus_tag LOCUS_13800 4640 5140 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095198.1 protein_id gnl|my_center|LOCUS_13800 8025 5581 gene locus_tag LOCUS_13810 8025 5581 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141271.1 protein_id gnl|my_center|LOCUS_13810 10569 8101 gene locus_tag LOCUS_13820 10569 8101 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928775.1 protein_id gnl|my_center|LOCUS_13820 >Feature sequence53 4028 1164 gene locus_tag LOCUS_13830 4028 1164 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994072.1 protein_id gnl|my_center|LOCUS_13830 4027 4881 gene locus_tag LOCUS_13840 4027 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 4883 6304 gene locus_tag LOCUS_13850 4883 6304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 6301 7050 gene locus_tag LOCUS_13860 6301 7050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 7047 8369 gene locus_tag LOCUS_13870 7047 8369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 8366 9484 gene locus_tag LOCUS_13880 8366 9484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 10353 9481 gene locus_tag LOCUS_13890 10353 9481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 >Feature sequence54 <1 1423 gene locus_tag LOCUS_13900 <1 1423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257648.1:DUF2309 domain-containing protein 1781 2053 gene locus_tag LOCUS_13910 1781 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 2046 2567 gene locus_tag LOCUS_13920 2046 2567 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969542.1 protein_id gnl|my_center|LOCUS_13920 2950 2597 gene locus_tag LOCUS_13930 2950 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 4827 3328 gene locus_tag LOCUS_13940 4827 3328 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948598.1 protein_id gnl|my_center|LOCUS_13940 5279 4824 gene locus_tag LOCUS_13950 5279 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 5637 5296 gene locus_tag LOCUS_13960 5637 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 5804 6232 gene locus_tag LOCUS_13970 5804 6232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 6548 6473 gene locus_tag LOCUS_t00290 6548 6473 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 8002 6569 gene locus_tag LOCUS_13980 gene gltX 8002 6569 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026051153.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence55 1127 423 gene locus_tag LOCUS_13990 1127 423 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038434.1 protein_id gnl|my_center|LOCUS_13990 1327 3201 gene locus_tag LOCUS_14000 gene thiC 1327 3201 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244346.1 protein_id gnl|my_center|LOCUS_14000 4563 3205 gene locus_tag LOCUS_14010 gene hslU 4563 3205 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099313.1 protein_id gnl|my_center|LOCUS_14010 5114 4560 gene locus_tag LOCUS_14020 gene hslV 5114 4560 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038588.1 protein_id gnl|my_center|LOCUS_14020 6025 5111 gene locus_tag LOCUS_14030 gene xerC 6025 5111 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114345.1 protein_id gnl|my_center|LOCUS_14030 6665 6003 gene locus_tag LOCUS_14040 6665 6003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 7558 6662 gene locus_tag LOCUS_14050 gene dapF 7558 6662 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114344.1 protein_id gnl|my_center|LOCUS_14050 7657 8097 gene locus_tag LOCUS_14060 7657 8097 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174003.1 protein_id gnl|my_center|LOCUS_14060 8821 8081 gene locus_tag LOCUS_14070 8821 8081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 8942 9202 gene locus_tag LOCUS_14080 gene xseB 8942 9202 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428423.1 protein_id gnl|my_center|LOCUS_14080 9212 10090 gene locus_tag LOCUS_14090 9212 10090 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114915.1 protein_id gnl|my_center|LOCUS_14090 >Feature sequence56 <1 550 gene locus_tag LOCUS_14100 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226986854.1:Fic family protein 1584 1880 gene locus_tag LOCUS_14110 1584 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14110 1859 2164 gene locus_tag LOCUS_14120 1859 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14120 2553 2882 gene locus_tag LOCUS_14130 2553 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 2875 3984 gene locus_tag LOCUS_14140 2875 3984 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_14140 5626 4280 gene locus_tag LOCUS_14150 5626 4280 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074151.1 protein_id gnl|my_center|LOCUS_14150 6906 5623 gene locus_tag LOCUS_14160 6906 5623 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074152.1 protein_id gnl|my_center|LOCUS_14160 7076 7696 gene locus_tag LOCUS_14170 7076 7696 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_14170 8479 7754 gene locus_tag LOCUS_14180 8479 7754 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921905.1 protein_id gnl|my_center|LOCUS_14180 9140 8514 gene locus_tag LOCUS_14190 gene wrbA 9140 8514 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941470.1 protein_id gnl|my_center|LOCUS_14190 10041 9166 gene locus_tag LOCUS_14200 10041 9166 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075524.1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence57 1586 438 gene locus_tag LOCUS_14210 gene metK 1586 438 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869412.1 protein_id gnl|my_center|LOCUS_14210 2977 1583 gene locus_tag LOCUS_14220 2977 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 3632 2970 gene locus_tag LOCUS_14230 3632 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 5065 3632 gene locus_tag LOCUS_14240 5065 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 6326 5490 gene locus_tag LOCUS_14250 6326 5490 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092159.1 protein_id gnl|my_center|LOCUS_14250 6441 6365 gene locus_tag LOCUS_t00300 6441 6365 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6523 6447 gene locus_tag LOCUS_t00310 6523 6447 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6611 7552 gene locus_tag LOCUS_14260 gene folD 6611 7552 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087898.1 protein_id gnl|my_center|LOCUS_14260 9111 7726 gene locus_tag LOCUS_14270 gene cysS 9111 7726 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947038.1 protein_id gnl|my_center|LOCUS_14270 <10177 9104 gene locus_tag LOCUS_14280 <10177 9104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958261.1:glutamate--tRNA ligase >Feature sequence58 326 1201 gene locus_tag LOCUS_14290 gene yghU 326 1201 CDS product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085723.1 protein_id gnl|my_center|LOCUS_14290 4928 1371 gene locus_tag LOCUS_14300 4928 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_14300 7494 5044 gene locus_tag LOCUS_14310 7494 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 7711 9123 gene locus_tag LOCUS_14320 7711 9123 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114462.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence59 582 1490 gene locus_tag LOCUS_14330 582 1490 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946804.1 protein_id gnl|my_center|LOCUS_14330 1920 2471 gene locus_tag LOCUS_14340 1920 2471 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633254.1 protein_id gnl|my_center|LOCUS_14340 2468 3394 gene locus_tag LOCUS_14350 2468 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 3404 4894 gene locus_tag LOCUS_14360 3404 4894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 5411 5487 gene locus_tag LOCUS_t00320 5411 5487 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5989 5624 gene locus_tag LOCUS_14370 5989 5624 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_14370 6110 7546 gene locus_tag LOCUS_14380 6110 7546 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190901.1 protein_id gnl|my_center|LOCUS_14380 7788 8333 gene locus_tag LOCUS_14390 7788 8333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 >Feature sequence60 460 672 gene locus_tag LOCUS_14400 460 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 669 941 gene locus_tag LOCUS_14410 669 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 1994 1440 gene locus_tag LOCUS_14420 1994 1440 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403937.1 protein_id gnl|my_center|LOCUS_14420 2111 2425 gene locus_tag LOCUS_14430 2111 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 6058 2492 gene locus_tag LOCUS_14440 6058 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 6250 7596 gene locus_tag LOCUS_14450 gene fucP 6250 7596 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036694.1 protein_id gnl|my_center|LOCUS_14450 7589 8578 gene locus_tag LOCUS_14460 7589 8578 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275390.1 protein_id gnl|my_center|LOCUS_14460 >Feature sequence61 300 485 gene locus_tag LOCUS_14470 300 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 1128 547 gene locus_tag LOCUS_14480 1128 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 1381 2031 gene locus_tag LOCUS_14490 1381 2031 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968439.1 protein_id gnl|my_center|LOCUS_14490 2695 2066 gene locus_tag LOCUS_14500 gene lipB 2695 2066 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038550.1 protein_id gnl|my_center|LOCUS_14500 3561 2692 gene locus_tag LOCUS_14510 3561 2692 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929622.1 protein_id gnl|my_center|LOCUS_14510 4729 3566 gene locus_tag LOCUS_14520 4729 3566 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_14520 5663 4839 gene locus_tag LOCUS_14530 5663 4839 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957937.1 protein_id gnl|my_center|LOCUS_14530 6614 5667 gene locus_tag LOCUS_14540 gene mltB 6614 5667 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132500.1 protein_id gnl|my_center|LOCUS_14540 7763 6624 gene locus_tag LOCUS_14550 gene rodA 7763 6624 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649852.1 protein_id gnl|my_center|LOCUS_14550 <8549 7760 gene locus_tag LOCUS_14560 <8549 7760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957656.1:penicillin-binding protein 2 >Feature sequence62 417 1682 gene locus_tag LOCUS_14570 417 1682 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 protein_id gnl|my_center|LOCUS_14570 1657 2643 gene locus_tag LOCUS_14580 1657 2643 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957524.1 protein_id gnl|my_center|LOCUS_14580 3167 2640 gene locus_tag LOCUS_14590 3167 2640 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811310.1 protein_id gnl|my_center|LOCUS_14590 3287 4405 gene locus_tag LOCUS_14600 3287 4405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 4402 5019 gene locus_tag LOCUS_14610 4402 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 7061 5004 gene locus_tag LOCUS_14620 gene acs 7061 5004 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404429.1 protein_id gnl|my_center|LOCUS_14620 7911 7117 gene locus_tag LOCUS_14630 7911 7117 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192376.1 protein_id gnl|my_center|LOCUS_14630 >Feature sequence63 423 4316 gene locus_tag LOCUS_14640 423 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 4324 4695 gene locus_tag LOCUS_14650 4324 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 4692 5525 gene locus_tag LOCUS_14660 4692 5525 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039539.1 protein_id gnl|my_center|LOCUS_14660 <7918 5560 gene locus_tag LOCUS_14670 <7918 5560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037508.1:NAD-glutamate dehydrogenase >Feature sequence64 118 966 gene locus_tag LOCUS_14680 gene apaH 118 966 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095538.1 protein_id gnl|my_center|LOCUS_14680 966 1595 gene locus_tag LOCUS_14690 966 1595 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528654.1 protein_id gnl|my_center|LOCUS_14690 1732 2520 gene locus_tag LOCUS_14700 gene pstB 1732 2520 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500183.1 protein_id gnl|my_center|LOCUS_14700 2618 3157 gene locus_tag LOCUS_14710 2618 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 3148 3657 gene locus_tag LOCUS_14720 3148 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 3654 4523 gene locus_tag LOCUS_14730 3654 4523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 4527 5138 gene locus_tag LOCUS_14740 4527 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 >Feature sequence65 197 2062 gene locus_tag LOCUS_14750 197 2062 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141384.1 protein_id gnl|my_center|LOCUS_14750 2078 2530 gene locus_tag LOCUS_14760 2078 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 2536 4290 gene locus_tag LOCUS_14770 2536 4290 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920964.1 protein_id gnl|my_center|LOCUS_14770 4309 5850 gene locus_tag LOCUS_14780 4309 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 >Feature sequence66 2694 1186 gene locus_tag LOCUS_14790 gene guaB 2694 1186 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314194.1 protein_id gnl|my_center|LOCUS_14790 2743 4155 gene locus_tag LOCUS_14800 gene xseA 2743 4155 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037447.1 protein_id gnl|my_center|LOCUS_14800 4152 5648 gene locus_tag LOCUS_14810 gene dacB 4152 5648 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091272.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence67 410 201 gene locus_tag LOCUS_14820 410 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 297 2693 gene locus_tag LOCUS_14830 gene lon 297 2693 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193454.1 protein_id gnl|my_center|LOCUS_14830 2861 3133 gene locus_tag LOCUS_14840 2861 3133 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043034.1 protein_id gnl|my_center|LOCUS_14840 3144 3219 gene locus_tag LOCUS_t00330 3144 3219 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3228 3304 gene locus_tag LOCUS_t00340 3228 3304 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 3382 5301 gene locus_tag LOCUS_14850 3382 5301 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036187.1 protein_id gnl|my_center|LOCUS_14850 6369 5554 gene locus_tag LOCUS_14860 6369 5554 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947580.1 protein_id gnl|my_center|LOCUS_14860 >Feature sequence68 <1 1185 gene locus_tag LOCUS_14870 <1 1185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990734.1:YncE family protein 1444 1827 gene locus_tag LOCUS_14880 1444 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 1952 2197 gene locus_tag LOCUS_14890 1952 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 2194 3138 gene locus_tag LOCUS_14900 gene rfaD 2194 3138 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005632797.1 protein_id gnl|my_center|LOCUS_14900 3135 4151 gene locus_tag LOCUS_14910 gene waaF 3135 4151 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109905.1 protein_id gnl|my_center|LOCUS_14910 4199 5245 gene locus_tag LOCUS_14920 4199 5245 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037914.1 protein_id gnl|my_center|LOCUS_14920 <6269 5206 gene locus_tag LOCUS_14930 <6269 5206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036196.1:glycosyltransferase family 9 protein >Feature sequence69 3260 453 gene locus_tag LOCUS_14940 gene ileS 3260 453 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286823.1 protein_id gnl|my_center|LOCUS_14940 4215 3253 gene locus_tag LOCUS_14950 gene ribF 4215 3253 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073366.1 protein_id gnl|my_center|LOCUS_14950 5825 4212 gene locus_tag LOCUS_14960 gene murJ 5825 4212 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102622.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence70 1312 356 gene locus_tag LOCUS_14970 1312 356 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406772.1 protein_id gnl|my_center|LOCUS_14970 2434 1343 gene locus_tag LOCUS_14980 2434 1343 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035287.1 protein_id gnl|my_center|LOCUS_14980 3289 2465 gene locus_tag LOCUS_14990 3289 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 <5878 3882 gene locus_tag LOCUS_15000 <5878 3882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073927.1:S9 family peptidase >Feature sequence71 1845 460 gene locus_tag LOCUS_15010 gene cysS 1845 460 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947038.1 protein_id gnl|my_center|LOCUS_15010 3283 1838 gene locus_tag LOCUS_15020 gene gltX 3283 1838 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880773.1 protein_id gnl|my_center|LOCUS_15020 3422 3790 gene locus_tag LOCUS_15030 3422 3790 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632829.1 protein_id gnl|my_center|LOCUS_15030 3787 4365 gene locus_tag LOCUS_15040 3787 4365 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194069.1 protein_id gnl|my_center|LOCUS_15040 4465 4923 gene locus_tag LOCUS_15050 gene aroQ 4465 4923 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035767.1 protein_id gnl|my_center|LOCUS_15050 4910 5389 gene locus_tag LOCUS_15060 gene accB 4910 5389 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098992.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence72 216 698 gene locus_tag LOCUS_15070 216 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 730 1770 gene locus_tag LOCUS_15080 730 1770 CDS product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063757.1 protein_id gnl|my_center|LOCUS_15080 2548 1715 gene locus_tag LOCUS_15090 gene rsmA 2548 1715 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113212.1 protein_id gnl|my_center|LOCUS_15090 3533 2520 gene locus_tag LOCUS_15100 gene pdxA 3533 2520 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704880.1 protein_id gnl|my_center|LOCUS_15100 4948 3530 gene locus_tag LOCUS_15110 4948 3530 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444876.1 protein_id gnl|my_center|LOCUS_15110 >Feature sequence73 1894 950 gene locus_tag LOCUS_15120 1894 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 1775 2494 gene locus_tag LOCUS_15130 1775 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 2491 4272 gene locus_tag LOCUS_15140 2491 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 >Feature sequence74 992 522 gene locus_tag LOCUS_15150 gene rnhA 992 522 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036192.1 protein_id gnl|my_center|LOCUS_15150 1600 989 gene locus_tag LOCUS_15160 1600 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 1484 1759 gene locus_tag LOCUS_15170 1484 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 1992 2783 gene locus_tag LOCUS_15180 gene gloB 1992 2783 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526568.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence75 1905 61 gene locus_tag LOCUS_15190 gene uvrC 1905 61 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113354.1 protein_id gnl|my_center|LOCUS_15190 3350 1917 gene locus_tag LOCUS_15200 3350 1917 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026880.1 protein_id gnl|my_center|LOCUS_15200 3622 3347 gene locus_tag LOCUS_15210 3622 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 4144 3962 gene locus_tag LOCUS_15220 4144 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15220 >Feature sequence76 50 421 gene locus_tag LOCUS_15230 50 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15230 989 1366 gene locus_tag LOCUS_15240 gene rpsL 989 1366 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399892.1 protein_id gnl|my_center|LOCUS_15240 1397 1867 gene locus_tag LOCUS_15250 gene rpsG 1397 1867 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005626581.1 protein_id gnl|my_center|LOCUS_15250 1913 4012 gene locus_tag LOCUS_15260 gene fusA 1913 4012 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957451.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence77 1099 458 gene locus_tag LOCUS_15270 1099 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004542749.1 protein_id gnl|my_center|LOCUS_15270 2059 1103 gene locus_tag LOCUS_15280 2059 1103 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528372.1 protein_id gnl|my_center|LOCUS_15280 4047 2056 gene locus_tag LOCUS_15290 gene hyfB 4047 2056 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532947.1 protein_id gnl|my_center|LOCUS_15290 >Feature sequence78 772 1473 gene locus_tag LOCUS_15300 772 1473 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262418.1 protein_id gnl|my_center|LOCUS_15300 1560 2780 gene locus_tag LOCUS_15310 1560 2780 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933016.1 protein_id gnl|my_center|LOCUS_15310 2790 3515 gene locus_tag LOCUS_15320 2790 3515 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057606.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence79 598 3651 gene locus_tag LOCUS_15330 598 3651 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_15330 >Feature sequence80 89 14 gene locus_tag LOCUS_t00350 89 14 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 213 137 gene locus_tag LOCUS_t00360 213 137 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1642 269 gene locus_tag LOCUS_15340 1642 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 2485 1655 gene locus_tag LOCUS_15350 2485 1655 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221994.1 protein_id gnl|my_center|LOCUS_15350 3432 2482 gene locus_tag LOCUS_15360 3432 2482 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327302.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence81 1311 613 gene locus_tag LOCUS_15370 gene queC 1311 613 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111415.1 protein_id gnl|my_center|LOCUS_15370 1979 1308 gene locus_tag LOCUS_15380 gene queE 1979 1308 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038131.1 protein_id gnl|my_center|LOCUS_15380 2794 1976 gene locus_tag LOCUS_15390 2794 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 <3836 2816 gene locus_tag LOCUS_15400 <3836 2816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038134.1:Tol-Pal system beta propeller repeat protein TolB >Feature sequence82 422 36 gene locus_tag LOCUS_15410 gene rplL 422 36 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946072.1 protein_id gnl|my_center|LOCUS_15410 1008 475 gene locus_tag LOCUS_15420 gene rplJ 1008 475 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806888.1 protein_id gnl|my_center|LOCUS_15420 1927 1235 gene locus_tag LOCUS_15430 gene rplA 1927 1235 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093749.1 protein_id gnl|my_center|LOCUS_15430 2360 1929 gene locus_tag LOCUS_15440 gene rplK 2360 1929 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946069.1 protein_id gnl|my_center|LOCUS_15440 2931 2398 gene locus_tag LOCUS_15450 gene nusG 2931 2398 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287510.1 protein_id gnl|my_center|LOCUS_15450 3312 2935 gene locus_tag LOCUS_15460 3312 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 3422 3347 gene locus_tag LOCUS_t00370 3422 3347 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence83 3128 594 gene locus_tag LOCUS_15470 3128 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 >Feature sequence84 <1 1117 gene locus_tag LOCUS_15480 <1 1117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164829993.1:catalase/peroxidase HPI 1404 1826 gene locus_tag LOCUS_15490 1404 1826 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_15490 1838 3268 gene locus_tag LOCUS_15500 1838 3268 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_15500 >Feature sequence85 424 2112 gene locus_tag LOCUS_15510 424 2112 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257649.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence86 1310 66 gene locus_tag LOCUS_15520 gene glcF 1310 66 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227984.1 protein_id gnl|my_center|LOCUS_15520 1427 2170 gene locus_tag LOCUS_15530 1427 2170 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994123.1 protein_id gnl|my_center|LOCUS_15530 <3061 2192 gene locus_tag LOCUS_15540 <3061 2192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704886.1:energy-dependent translational throttle protein EttA >Feature sequence87 204 776 gene locus_tag LOCUS_15550 204 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 1442 843 gene locus_tag LOCUS_15560 1442 843 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408270.1 protein_id gnl|my_center|LOCUS_15560 1756 1683 gene locus_tag LOCUS_t00380 1756 1683 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1882 1807 gene locus_tag LOCUS_t00390 1882 1807 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2566 1943 gene locus_tag LOCUS_15570 gene gstA 2566 1943 CDS product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210962.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence88 2654 2256 gene locus_tag LOCUS_15580 2654 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 >Feature sequence89 <2607 1130 gene locus_tag LOCUS_15590 <2607 1130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257170.1:peptidase S10 >Feature sequence90 542 1525 gene locus_tag LOCUS_15600 gene rimK 542 1525 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684328.1 protein_id gnl|my_center|LOCUS_15600 >Feature sequence91 1104 658 gene locus_tag LOCUS_15610 gene ssb 1104 658 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771486.1 protein_id gnl|my_center|LOCUS_15610 <2262 1239 gene locus_tag LOCUS_15620 <2262 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957472.1:MFS transporter >Feature sequence92 1515 1667 gene locus_tag LOCUS_15630 1515 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 1664 1969 gene locus_tag LOCUS_15640 1664 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 >Feature sequence93 <1965 1382 gene locus_tag LOCUS_15650 <1965 1382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004525080.1:DUF3501 family protein >Feature sequence94