>Feature sequence01 427 2049 gene locus_tag LOCUS_00010 427 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2052 3092 gene locus_tag LOCUS_00020 2052 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3110 3991 gene locus_tag LOCUS_00030 gene pstB 3110 3991 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460191.1 protein_id gnl|my_center|LOCUS_00030 4017 4697 gene locus_tag LOCUS_00040 gene phoU 4017 4697 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941756.1 protein_id gnl|my_center|LOCUS_00040 4672 5358 gene locus_tag LOCUS_00050 4672 5358 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_00050 5414 6604 gene locus_tag LOCUS_00060 5414 6604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 8220 6775 gene locus_tag LOCUS_00070 8220 6775 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922492.1 protein_id gnl|my_center|LOCUS_00070 11321 8223 gene locus_tag LOCUS_00080 11321 8223 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922491.1 protein_id gnl|my_center|LOCUS_00080 11470 12750 gene locus_tag LOCUS_00090 11470 12750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 12765 13730 gene locus_tag LOCUS_00100 12765 13730 CDS product D-threonate 4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059575.1 protein_id gnl|my_center|LOCUS_00100 13978 16386 gene locus_tag LOCUS_00110 13978 16386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 18798 16459 gene locus_tag LOCUS_00120 18798 16459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 18989 19516 gene locus_tag LOCUS_00130 18989 19516 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389192.1 protein_id gnl|my_center|LOCUS_00130 19535 20593 gene locus_tag LOCUS_00140 gene fpvR 19535 20593 CDS product pyoverdine signaling pathway anti-sigma factor FpvR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115643.1 protein_id gnl|my_center|LOCUS_00140 20692 23931 gene locus_tag LOCUS_00150 20692 23931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 23940 27014 gene locus_tag LOCUS_00160 23940 27014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 27011 27856 gene locus_tag LOCUS_00170 27011 27856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 28458 27961 gene locus_tag LOCUS_00180 28458 27961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 28689 28765 gene locus_tag LOCUS_t00010 28689 28765 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 28941 29017 gene locus_tag LOCUS_t00020 28941 29017 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 29641 29126 gene locus_tag LOCUS_00190 29641 29126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 32976 29842 gene locus_tag LOCUS_00200 32976 29842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 33203 34789 gene locus_tag LOCUS_00210 33203 34789 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234705053.1 protein_id gnl|my_center|LOCUS_00210 34848 37832 gene locus_tag LOCUS_00220 34848 37832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 39581 38061 gene locus_tag LOCUS_00230 39581 38061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 40040 40336 gene locus_tag LOCUS_00240 40040 40336 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953389.1 protein_id gnl|my_center|LOCUS_00240 40422 41912 gene locus_tag LOCUS_00250 40422 41912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 42536 42018 gene locus_tag LOCUS_00260 42536 42018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 42638 44038 gene locus_tag LOCUS_00270 gene argH 42638 44038 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383408.1 protein_id gnl|my_center|LOCUS_00270 44347 45777 gene locus_tag LOCUS_00280 44347 45777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 45839 47671 gene locus_tag LOCUS_00290 gene mutL 45839 47671 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037442.1 protein_id gnl|my_center|LOCUS_00290 47729 50263 gene locus_tag LOCUS_00300 47729 50263 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706264.1 protein_id gnl|my_center|LOCUS_00300 50904 52136 gene locus_tag LOCUS_00310 50904 52136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 52284 52469 gene locus_tag LOCUS_00320 52284 52469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 52480 52869 gene locus_tag LOCUS_00330 52480 52869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 54699 53338 gene locus_tag LOCUS_00340 54699 53338 CDS product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403312.1 protein_id gnl|my_center|LOCUS_00340 54706 55254 gene locus_tag LOCUS_00350 54706 55254 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977514.1 protein_id gnl|my_center|LOCUS_00350 55864 55226 gene locus_tag LOCUS_00360 55864 55226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 56413 57450 gene locus_tag LOCUS_00370 gene ald 56413 57450 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905011.1 protein_id gnl|my_center|LOCUS_00370 57587 58459 gene locus_tag LOCUS_00380 57587 58459 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815329.1 protein_id gnl|my_center|LOCUS_00380 59182 58661 gene locus_tag LOCUS_00390 59182 58661 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087459.1 protein_id gnl|my_center|LOCUS_00390 59265 60320 gene locus_tag LOCUS_00400 59265 60320 CDS product NUP-family purine nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265508.1 protein_id gnl|my_center|LOCUS_00400 61154 60561 gene locus_tag LOCUS_00410 61154 60561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 61965 61276 gene locus_tag LOCUS_00420 61965 61276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 64077 62422 gene locus_tag LOCUS_00430 64077 62422 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144042.1 protein_id gnl|my_center|LOCUS_00430 65700 64093 gene locus_tag LOCUS_00440 65700 64093 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257472.1 protein_id gnl|my_center|LOCUS_00440 67348 65708 gene locus_tag LOCUS_00450 67348 65708 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257472.1 protein_id gnl|my_center|LOCUS_00450 70129 67400 gene locus_tag LOCUS_00460 70129 67400 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920510.1 protein_id gnl|my_center|LOCUS_00460 70879 70322 gene locus_tag LOCUS_00470 70879 70322 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256187.1 protein_id gnl|my_center|LOCUS_00470 70987 72075 gene locus_tag LOCUS_00480 gene recF 70987 72075 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058276.1 protein_id gnl|my_center|LOCUS_00480 72072 72803 gene locus_tag LOCUS_00490 72072 72803 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122308.1 protein_id gnl|my_center|LOCUS_00490 78268 73070 gene locus_tag LOCUS_00500 78268 73070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 78657 78454 gene locus_tag LOCUS_00510 78657 78454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 78569 79129 gene locus_tag LOCUS_00520 gene ruvC 78569 79129 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084351.1 protein_id gnl|my_center|LOCUS_00520 82059 79351 gene locus_tag LOCUS_00530 82059 79351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 83090 82056 gene locus_tag LOCUS_00540 gene hemH 83090 82056 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962227.1 protein_id gnl|my_center|LOCUS_00540 86446 83180 gene locus_tag LOCUS_00550 86446 83180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 86837 86520 gene locus_tag LOCUS_00560 86837 86520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 86997 88583 gene locus_tag LOCUS_00570 gene gpmI 86997 88583 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435040.1 protein_id gnl|my_center|LOCUS_00570 88783 89862 gene locus_tag LOCUS_00580 88783 89862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 90001 91788 gene locus_tag LOCUS_00590 gene aspS 90001 91788 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_00590 93401 91974 gene locus_tag LOCUS_00600 93401 91974 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206175.1 protein_id gnl|my_center|LOCUS_00600 94739 93426 gene locus_tag LOCUS_00610 gene gltS 94739 93426 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693557.1 protein_id gnl|my_center|LOCUS_00610 94989 97106 gene locus_tag LOCUS_00620 94989 97106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 97258 97596 gene locus_tag LOCUS_00630 gene glnB 97258 97596 CDS product nitrogen regulator P-II GlnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880011.1 protein_id gnl|my_center|LOCUS_00630 97847 99334 gene locus_tag LOCUS_00640 97847 99334 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163308.1 protein_id gnl|my_center|LOCUS_00640 99353 99691 gene locus_tag LOCUS_00650 gene glnB 99353 99691 CDS product nitrogen regulator P-II GlnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880011.1 protein_id gnl|my_center|LOCUS_00650 99863 101389 gene locus_tag LOCUS_00660 99863 101389 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163308.1 protein_id gnl|my_center|LOCUS_00660 101414 101752 gene locus_tag LOCUS_00670 101414 101752 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812839.1 protein_id gnl|my_center|LOCUS_00670 103909 101966 gene locus_tag LOCUS_00680 gene thrS 103909 101966 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329329.1 protein_id gnl|my_center|LOCUS_00680 104117 104344 gene locus_tag LOCUS_00690 104117 104344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 105936 104461 gene locus_tag LOCUS_00700 gene cysS 105936 104461 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873400.1 protein_id gnl|my_center|LOCUS_00700 106075 109059 gene locus_tag LOCUS_00710 106075 109059 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640332.1 protein_id gnl|my_center|LOCUS_00710 109302 110018 gene locus_tag LOCUS_00720 109302 110018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 110146 111156 gene locus_tag LOCUS_00730 gene hemB 110146 111156 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056277.1 protein_id gnl|my_center|LOCUS_00730 111792 111199 gene locus_tag LOCUS_00740 111792 111199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 112754 111927 gene locus_tag LOCUS_00750 112754 111927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 112939 114000 gene locus_tag LOCUS_00760 112939 114000 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143073.1 protein_id gnl|my_center|LOCUS_00760 114153 114237 gene locus_tag LOCUS_t00030 114153 114237 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 114326 115231 gene locus_tag LOCUS_00770 114326 115231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 115248 117050 gene locus_tag LOCUS_00780 115248 117050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 117110 117949 gene locus_tag LOCUS_00790 117110 117949 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970449.1 protein_id gnl|my_center|LOCUS_00790 118489 117983 gene locus_tag LOCUS_00800 118489 117983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 119217 118552 gene locus_tag LOCUS_00810 119217 118552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 120075 119326 gene locus_tag LOCUS_00820 120075 119326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 120246 122087 gene locus_tag LOCUS_00830 120246 122087 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962807.1 protein_id gnl|my_center|LOCUS_00830 122096 123349 gene locus_tag LOCUS_00840 122096 123349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 124069 123527 gene locus_tag LOCUS_00850 124069 123527 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640141.1 protein_id gnl|my_center|LOCUS_00850 124576 124175 gene locus_tag LOCUS_00860 124576 124175 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941946.1 protein_id gnl|my_center|LOCUS_00860 125371 124676 gene locus_tag LOCUS_00870 125371 124676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 125606 127555 gene locus_tag LOCUS_00880 gene dnaK 125606 127555 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_00880 127659 127955 gene locus_tag LOCUS_00890 gene groES 127659 127955 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943951.1 protein_id gnl|my_center|LOCUS_00890 128001 129635 gene locus_tag LOCUS_00900 gene groL 128001 129635 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545192.1 protein_id gnl|my_center|LOCUS_00900 129741 130553 gene locus_tag LOCUS_00910 129741 130553 CDS product BPL-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336892.1 protein_id gnl|my_center|LOCUS_00910 130599 131378 gene locus_tag LOCUS_00920 130599 131378 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403269.1 protein_id gnl|my_center|LOCUS_00920 131545 132147 gene locus_tag LOCUS_00930 131545 132147 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941998.1 protein_id gnl|my_center|LOCUS_00930 132177 132377 gene locus_tag LOCUS_00940 132177 132377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 132486 133838 gene locus_tag LOCUS_00950 132486 133838 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403196.1 protein_id gnl|my_center|LOCUS_00950 133904 134899 gene locus_tag LOCUS_00960 133904 134899 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941999.1 protein_id gnl|my_center|LOCUS_00960 134931 135920 gene locus_tag LOCUS_00970 134931 135920 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941999.1 protein_id gnl|my_center|LOCUS_00970 135947 136753 gene locus_tag LOCUS_00980 135947 136753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 136753 137649 gene locus_tag LOCUS_00990 gene cysT 136753 137649 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942000.1 protein_id gnl|my_center|LOCUS_00990 137656 138540 gene locus_tag LOCUS_01000 gene cysW 137656 138540 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942001.1 protein_id gnl|my_center|LOCUS_01000 138551 139603 gene locus_tag LOCUS_01010 138551 139603 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942002.1 protein_id gnl|my_center|LOCUS_01010 139685 140674 gene locus_tag LOCUS_01020 gene cysK 139685 140674 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257225.1 protein_id gnl|my_center|LOCUS_01020 142590 140800 gene locus_tag LOCUS_01030 142590 140800 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720836.1 protein_id gnl|my_center|LOCUS_01030 142658 143734 gene locus_tag LOCUS_01040 gene cysK 142658 143734 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528637.1 protein_id gnl|my_center|LOCUS_01040 143945 145066 gene locus_tag LOCUS_01050 143945 145066 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_01050 145231 146946 gene locus_tag LOCUS_01060 145231 146946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 146955 148490 gene locus_tag LOCUS_01070 146955 148490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 148495 148860 gene locus_tag LOCUS_01080 148495 148860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 148884 149273 gene locus_tag LOCUS_01090 148884 149273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 150196 149378 gene locus_tag LOCUS_01100 gene ctaG 150196 149378 CDS product cytochrome c oxidase assembly factor CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069023.1 protein_id gnl|my_center|LOCUS_01100 150649 150311 gene locus_tag LOCUS_01110 150649 150311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 151502 150654 gene locus_tag LOCUS_01120 151502 150654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 153557 151542 gene locus_tag LOCUS_01130 gene ctaD 153557 151542 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011371630.1 protein_id gnl|my_center|LOCUS_01130 154980 153679 gene locus_tag LOCUS_01140 gene coxB 154980 153679 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745271.1 protein_id gnl|my_center|LOCUS_01140 155313 155780 gene locus_tag LOCUS_01150 155313 155780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 156543 156070 gene locus_tag LOCUS_01160 156543 156070 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326238.1 protein_id gnl|my_center|LOCUS_01160 157424 156540 gene locus_tag LOCUS_01170 gene cyoE 157424 156540 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062574.1 protein_id gnl|my_center|LOCUS_01170 158425 157421 gene locus_tag LOCUS_01180 158425 157421 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405086.1 protein_id gnl|my_center|LOCUS_01180 158512 159435 gene locus_tag LOCUS_01190 158512 159435 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837921.1 protein_id gnl|my_center|LOCUS_01190 159432 160337 gene locus_tag LOCUS_01200 159432 160337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 161262 160492 gene locus_tag LOCUS_01210 161262 160492 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_01210 161485 161937 gene locus_tag LOCUS_01220 161485 161937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 161995 163125 gene locus_tag LOCUS_01230 161995 163125 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393848.1 protein_id gnl|my_center|LOCUS_01230 163250 164173 gene locus_tag LOCUS_01240 163250 164173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 165182 164274 gene locus_tag LOCUS_01250 gene lipA 165182 164274 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963587.1 protein_id gnl|my_center|LOCUS_01250 167441 165354 gene locus_tag LOCUS_01260 167441 165354 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_01260 168160 167438 gene locus_tag LOCUS_01270 gene lipB 168160 167438 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144397.1 protein_id gnl|my_center|LOCUS_01270 169166 168174 gene locus_tag LOCUS_01280 169166 168174 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258797.1 protein_id gnl|my_center|LOCUS_01280 169235 169864 gene locus_tag LOCUS_01290 169235 169864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 171777 169972 gene locus_tag LOCUS_01300 171777 169972 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 protein_id gnl|my_center|LOCUS_01300 171877 173079 gene locus_tag LOCUS_01310 171877 173079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 174085 173147 gene locus_tag LOCUS_01320 174085 173147 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119121.1 protein_id gnl|my_center|LOCUS_01320 174183 174605 gene locus_tag LOCUS_01330 174183 174605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 174632 176485 gene locus_tag LOCUS_01340 174632 176485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 176551 180792 gene locus_tag LOCUS_01350 176551 180792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 180969 184094 gene locus_tag LOCUS_01360 180969 184094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 184231 185445 gene locus_tag LOCUS_01370 184231 185445 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234976.1 protein_id gnl|my_center|LOCUS_01370 186362 185577 gene locus_tag LOCUS_01380 186362 185577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 188361 186805 gene locus_tag LOCUS_01390 188361 186805 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013060927.1 protein_id gnl|my_center|LOCUS_01390 188578 190857 gene locus_tag LOCUS_01400 188578 190857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 200825 191172 gene locus_tag LOCUS_01410 200825 191172 CDS product autotransporter-associated beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104543246.1 protein_id gnl|my_center|LOCUS_01410 196377 196449 gene locus_tag LOCUS_t00040 196377 196449 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 202185 200932 gene locus_tag LOCUS_01420 202185 200932 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550279.1 protein_id gnl|my_center|LOCUS_01420 203684 202191 gene locus_tag LOCUS_01430 203684 202191 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205128.1 protein_id gnl|my_center|LOCUS_01430 204402 203764 gene locus_tag LOCUS_01440 204402 203764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 204538 205902 gene locus_tag LOCUS_01450 gene tig 204538 205902 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919830.1 protein_id gnl|my_center|LOCUS_01450 205928 206542 gene locus_tag LOCUS_01460 gene clpP 205928 206542 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081059.1 protein_id gnl|my_center|LOCUS_01460 206650 207942 gene locus_tag LOCUS_01470 gene clpX 206650 207942 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087924.1 protein_id gnl|my_center|LOCUS_01470 209076 208009 gene locus_tag LOCUS_01480 209076 208009 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942836.1 protein_id gnl|my_center|LOCUS_01480 209124 209849 gene locus_tag LOCUS_01490 gene hisA 209124 209849 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461460.1 protein_id gnl|my_center|LOCUS_01490 210641 209865 gene locus_tag LOCUS_01500 210641 209865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 212026 210638 gene locus_tag LOCUS_01510 gene lpdA 212026 210638 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227834.1 protein_id gnl|my_center|LOCUS_01510 213537 212080 gene locus_tag LOCUS_01520 213537 212080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 214927 213551 gene locus_tag LOCUS_01530 214927 213551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 216144 214924 gene locus_tag LOCUS_01540 216144 214924 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019809.1 protein_id gnl|my_center|LOCUS_01540 217007 216147 gene locus_tag LOCUS_01550 217007 216147 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_01550 218505 217018 gene locus_tag LOCUS_01560 218505 217018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 219635 218502 gene locus_tag LOCUS_01570 219635 218502 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331373.1 protein_id gnl|my_center|LOCUS_01570 220201 219632 gene locus_tag LOCUS_01580 gene wcaF 220201 219632 CDS product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097875.1 protein_id gnl|my_center|LOCUS_01580 221399 220242 gene locus_tag LOCUS_01590 221399 220242 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727419.1 protein_id gnl|my_center|LOCUS_01590 222604 221396 gene locus_tag LOCUS_01600 222604 221396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 224157 222601 gene locus_tag LOCUS_01610 224157 222601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 225282 224185 gene locus_tag LOCUS_01620 225282 224185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 225734 225273 gene locus_tag LOCUS_01630 225734 225273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 226782 225739 gene locus_tag LOCUS_01640 226782 225739 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057430.1 protein_id gnl|my_center|LOCUS_01640 228458 226800 gene locus_tag LOCUS_01650 228458 226800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 229438 228455 gene locus_tag LOCUS_01660 229438 228455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 230688 229435 gene locus_tag LOCUS_01670 230688 229435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 231953 230685 gene locus_tag LOCUS_01680 231953 230685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 232900 231950 gene locus_tag LOCUS_01690 232900 231950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01690 233661 232897 gene locus_tag LOCUS_01700 233661 232897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 234725 233706 gene locus_tag LOCUS_01710 234725 233706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 235516 234722 gene locus_tag LOCUS_01720 235516 234722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 236570 235557 gene locus_tag LOCUS_01730 236570 235557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 237490 236567 gene locus_tag LOCUS_01740 237490 236567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 238787 237507 gene locus_tag LOCUS_01750 238787 237507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 239356 238787 gene locus_tag LOCUS_01760 239356 238787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 240079 239360 gene locus_tag LOCUS_01770 240079 239360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 240774 240085 gene locus_tag LOCUS_01780 240774 240085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 240670 241017 gene locus_tag LOCUS_01790 240670 241017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 241951 241211 gene locus_tag LOCUS_01800 241951 241211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 242884 241958 gene locus_tag LOCUS_01810 242884 241958 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058149.1 protein_id gnl|my_center|LOCUS_01810 243729 242881 gene locus_tag LOCUS_01820 243729 242881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 244397 243732 gene locus_tag LOCUS_01830 244397 243732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 245638 244403 gene locus_tag LOCUS_01840 245638 244403 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942151.1 protein_id gnl|my_center|LOCUS_01840 246491 245640 gene locus_tag LOCUS_01850 246491 245640 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942150.1 protein_id gnl|my_center|LOCUS_01850 249334 246512 gene locus_tag LOCUS_01860 249334 246512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 250234 249695 gene locus_tag LOCUS_01870 250234 249695 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_01870 250315 251226 gene locus_tag LOCUS_01880 250315 251226 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902154.1 protein_id gnl|my_center|LOCUS_01880 251293 251601 gene locus_tag LOCUS_01890 251293 251601 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008797059.1 protein_id gnl|my_center|LOCUS_01890 251627 252292 gene locus_tag LOCUS_01900 gene recR 251627 252292 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228798.1 protein_id gnl|my_center|LOCUS_01900 252372 252446 gene locus_tag LOCUS_t00050 252372 252446 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 252471 252701 gene locus_tag LOCUS_01910 252471 252701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 254940 253003 gene locus_tag LOCUS_01920 gene dxs 254940 253003 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942408.1 protein_id gnl|my_center|LOCUS_01920 255243 254965 gene locus_tag LOCUS_01930 255243 254965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 255357 256601 gene locus_tag LOCUS_01940 255357 256601 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813306.1 protein_id gnl|my_center|LOCUS_01940 256627 257535 gene locus_tag LOCUS_01950 256627 257535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 258047 257559 gene locus_tag LOCUS_01960 gene coaD 258047 257559 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704185.1 protein_id gnl|my_center|LOCUS_01960 258181 258777 gene locus_tag LOCUS_01970 gene pgsA 258181 258777 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889106.1 protein_id gnl|my_center|LOCUS_01970 258809 259324 gene locus_tag LOCUS_01980 258809 259324 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937834.1 protein_id gnl|my_center|LOCUS_01980 259942 259451 gene locus_tag LOCUS_01990 259942 259451 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546650.1 protein_id gnl|my_center|LOCUS_01990 260375 259947 gene locus_tag LOCUS_02000 gene aroQ 260375 259947 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757082.1 protein_id gnl|my_center|LOCUS_02000 261242 260481 gene locus_tag LOCUS_02010 261242 260481 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480305.1 protein_id gnl|my_center|LOCUS_02010 261351 261863 gene locus_tag LOCUS_02020 261351 261863 CDS product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439693.1 protein_id gnl|my_center|LOCUS_02020 261886 262446 gene locus_tag LOCUS_02030 261886 262446 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403273.1 protein_id gnl|my_center|LOCUS_02030 264475 262613 gene locus_tag LOCUS_02040 264475 262613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 268251 264589 gene locus_tag LOCUS_02050 268251 264589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 269567 268536 gene locus_tag LOCUS_02060 269567 268536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 269740 269814 gene locus_tag LOCUS_t00060 269740 269814 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 271304 269883 gene locus_tag LOCUS_02070 271304 269883 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_02070 272432 271503 gene locus_tag LOCUS_02080 272432 271503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 272678 274429 gene locus_tag LOCUS_02090 272678 274429 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838626.1 protein_id gnl|my_center|LOCUS_02090 274573 275964 gene locus_tag LOCUS_02100 274573 275964 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767667.1 protein_id gnl|my_center|LOCUS_02100 276071 277375 gene locus_tag LOCUS_02110 276071 277375 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767670.1 protein_id gnl|my_center|LOCUS_02110 277541 278944 gene locus_tag LOCUS_02120 277541 278944 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118042.1 protein_id gnl|my_center|LOCUS_02120 279007 280992 gene locus_tag LOCUS_02130 279007 280992 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117861.1 protein_id gnl|my_center|LOCUS_02130 281266 281066 gene locus_tag LOCUS_02140 281266 281066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 281283 282059 gene locus_tag LOCUS_02150 281283 282059 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964510.1 protein_id gnl|my_center|LOCUS_02150 282059 282676 gene locus_tag LOCUS_02160 282059 282676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 283908 282865 gene locus_tag LOCUS_02170 283908 282865 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_02170 285640 283979 gene locus_tag LOCUS_02180 285640 283979 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584095.1 protein_id gnl|my_center|LOCUS_02180 286754 285837 gene locus_tag LOCUS_02190 286754 285837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 286796 287986 gene locus_tag LOCUS_02200 gene hemW 286796 287986 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_02200 287983 288891 gene locus_tag LOCUS_02210 287983 288891 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869257.1 protein_id gnl|my_center|LOCUS_02210 288888 289385 gene locus_tag LOCUS_02220 288888 289385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 289457 290446 gene locus_tag LOCUS_02230 289457 290446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 290608 291762 gene locus_tag LOCUS_02240 290608 291762 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444490.1 protein_id gnl|my_center|LOCUS_02240 295105 291971 gene locus_tag LOCUS_02250 295105 291971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 295547 295173 gene locus_tag LOCUS_02260 295547 295173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 296028 295564 gene locus_tag LOCUS_02270 296028 295564 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_02270 296140 298377 gene locus_tag LOCUS_02280 gene priA 296140 298377 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_02280 298488 299633 gene locus_tag LOCUS_02290 298488 299633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 300135 299737 gene locus_tag LOCUS_02300 300135 299737 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943273.1 protein_id gnl|my_center|LOCUS_02300 301502 300261 gene locus_tag LOCUS_02310 301502 300261 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140349.1 protein_id gnl|my_center|LOCUS_02310 302767 301511 gene locus_tag LOCUS_02320 302767 301511 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_02320 302942 304396 gene locus_tag LOCUS_02330 gene mpl 302942 304396 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933145.1 protein_id gnl|my_center|LOCUS_02330 304444 304743 gene locus_tag LOCUS_02340 304444 304743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 306574 304751 gene locus_tag LOCUS_02350 306574 304751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 306692 308230 gene locus_tag LOCUS_02360 306692 308230 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_02360 308309 309688 gene locus_tag LOCUS_02370 308309 309688 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_02370 309783 310196 gene locus_tag LOCUS_02380 309783 310196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 310367 311497 gene locus_tag LOCUS_02390 310367 311497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 311514 312914 gene locus_tag LOCUS_02400 311514 312914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 313023 314975 gene locus_tag LOCUS_02410 313023 314975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 315141 317126 gene locus_tag LOCUS_02420 315141 317126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 317149 317619 gene locus_tag LOCUS_02430 317149 317619 CDS product YiiD C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387426.1 protein_id gnl|my_center|LOCUS_02430 318043 317606 gene locus_tag LOCUS_02440 gene tsaE 318043 317606 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393647.1 protein_id gnl|my_center|LOCUS_02440 318998 318051 gene locus_tag LOCUS_02450 gene thiL 318998 318051 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_02450 319952 319107 gene locus_tag LOCUS_02460 319952 319107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 321301 320006 gene locus_tag LOCUS_02470 321301 320006 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_02470 322305 321361 gene locus_tag LOCUS_02480 322305 321361 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583924.1 protein_id gnl|my_center|LOCUS_02480 322873 322325 gene locus_tag LOCUS_02490 gene pyrR 322873 322325 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977338.1 protein_id gnl|my_center|LOCUS_02490 323169 323552 gene locus_tag LOCUS_02500 323169 323552 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583004.1 protein_id gnl|my_center|LOCUS_02500 323596 324510 gene locus_tag LOCUS_02510 323596 324510 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121967.1 protein_id gnl|my_center|LOCUS_02510 324507 326063 gene locus_tag LOCUS_02520 324507 326063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 326060 327655 gene locus_tag LOCUS_02530 326060 327655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 328443 327652 gene locus_tag LOCUS_02540 328443 327652 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223881.1 protein_id gnl|my_center|LOCUS_02540 329222 328449 gene locus_tag LOCUS_02550 329222 328449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 329719 329219 gene locus_tag LOCUS_02560 329719 329219 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405207.1 protein_id gnl|my_center|LOCUS_02560 330108 329611 gene locus_tag LOCUS_02570 330108 329611 CDS product DUF2165 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209941.1 protein_id gnl|my_center|LOCUS_02570 331606 330308 gene locus_tag LOCUS_02580 331606 330308 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531129.1 protein_id gnl|my_center|LOCUS_02580 331714 333162 gene locus_tag LOCUS_02590 331714 333162 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531130.1 protein_id gnl|my_center|LOCUS_02590 333179 333946 gene locus_tag LOCUS_02600 333179 333946 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530913.1 protein_id gnl|my_center|LOCUS_02600 333954 334742 gene locus_tag LOCUS_02610 333954 334742 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531128.1 protein_id gnl|my_center|LOCUS_02610 334745 335782 gene locus_tag LOCUS_02620 334745 335782 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920485.1 protein_id gnl|my_center|LOCUS_02620 335833 338331 gene locus_tag LOCUS_02630 335833 338331 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920510.1 protein_id gnl|my_center|LOCUS_02630 339650 338697 gene locus_tag LOCUS_02640 339650 338697 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182921959.1 protein_id gnl|my_center|LOCUS_02640 340566 339706 gene locus_tag LOCUS_02650 340566 339706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 344050 341231 gene locus_tag LOCUS_02660 344050 341231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 344233 347433 gene locus_tag LOCUS_02670 344233 347433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 351872 347646 gene locus_tag LOCUS_02680 351872 347646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 353294 352350 gene locus_tag LOCUS_02690 353294 352350 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921651.1 protein_id gnl|my_center|LOCUS_02690 355059 353374 gene locus_tag LOCUS_02700 355059 353374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 356471 355161 gene locus_tag LOCUS_02710 356471 355161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 357469 356828 gene locus_tag LOCUS_02720 357469 356828 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183791.1 protein_id gnl|my_center|LOCUS_02720 358597 357938 gene locus_tag LOCUS_02730 358597 357938 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 protein_id gnl|my_center|LOCUS_02730 361972 358787 gene locus_tag LOCUS_02740 361972 358787 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942256.1 protein_id gnl|my_center|LOCUS_02740 363189 361969 gene locus_tag LOCUS_02750 363189 361969 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942255.1 protein_id gnl|my_center|LOCUS_02750 363434 365023 gene locus_tag LOCUS_02760 gene serA 363434 365023 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_02760 365040 365672 gene locus_tag LOCUS_02770 gene plsY 365040 365672 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016461.1 protein_id gnl|my_center|LOCUS_02770 365669 366991 gene locus_tag LOCUS_02780 365669 366991 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813074.1 protein_id gnl|my_center|LOCUS_02780 367103 368317 gene locus_tag LOCUS_02790 367103 368317 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545682.1 protein_id gnl|my_center|LOCUS_02790 368407 369771 gene locus_tag LOCUS_02800 gene thrC 368407 369771 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153458433.1 protein_id gnl|my_center|LOCUS_02800 370698 369886 gene locus_tag LOCUS_02810 370698 369886 CDS product phosphatidylinositol-specific phospholipase C/glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027645.1 protein_id gnl|my_center|LOCUS_02810 372238 370706 gene locus_tag LOCUS_02820 372238 370706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 373044 372247 gene locus_tag LOCUS_02830 373044 372247 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815129.1 protein_id gnl|my_center|LOCUS_02830 376460 373224 gene locus_tag LOCUS_02840 376460 373224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 376635 377702 gene locus_tag LOCUS_02850 376635 377702 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975000.1 protein_id gnl|my_center|LOCUS_02850 379748 377745 gene locus_tag LOCUS_02860 379748 377745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 381364 379745 gene locus_tag LOCUS_02870 381364 379745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107132.1 protein_id gnl|my_center|LOCUS_02870 385020 381589 gene locus_tag LOCUS_02880 385020 381589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 385183 386745 gene locus_tag LOCUS_02890 gene cimA 385183 386745 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880180.1 protein_id gnl|my_center|LOCUS_02890 387789 386905 gene locus_tag LOCUS_02900 387789 386905 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125281.1 protein_id gnl|my_center|LOCUS_02900 387788 388165 gene locus_tag LOCUS_02910 387788 388165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 388173 388862 gene locus_tag LOCUS_02920 388173 388862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 388859 390028 gene locus_tag LOCUS_02930 388859 390028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 390090 391661 gene locus_tag LOCUS_02940 gene murJ 390090 391661 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941832.1 protein_id gnl|my_center|LOCUS_02940 391658 392632 gene locus_tag LOCUS_02950 391658 392632 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266539.1 protein_id gnl|my_center|LOCUS_02950 392702 392989 gene locus_tag LOCUS_02960 392702 392989 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084925.1 protein_id gnl|my_center|LOCUS_02960 393066 394142 gene locus_tag LOCUS_02970 393066 394142 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942021.1 protein_id gnl|my_center|LOCUS_02970 394168 394821 gene locus_tag LOCUS_02980 394168 394821 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058035.1 protein_id gnl|my_center|LOCUS_02980 395562 394972 gene locus_tag LOCUS_02990 395562 394972 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035528.1 protein_id gnl|my_center|LOCUS_02990 395604 396611 gene locus_tag LOCUS_03000 395604 396611 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644533.1 protein_id gnl|my_center|LOCUS_03000 396683 397753 gene locus_tag LOCUS_03010 396683 397753 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_03010 398520 397852 gene locus_tag LOCUS_03020 398520 397852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 400502 398676 gene locus_tag LOCUS_03030 gene typA 400502 398676 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058116.1 protein_id gnl|my_center|LOCUS_03030 400736 402481 gene locus_tag LOCUS_03040 400736 402481 CDS product bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113330.1 protein_id gnl|my_center|LOCUS_03040 402478 403776 gene locus_tag LOCUS_03050 402478 403776 CDS product phosphatase PAP2/dual specificity phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895624.1 protein_id gnl|my_center|LOCUS_03050 403844 405109 gene locus_tag LOCUS_03060 403844 405109 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031081.1 protein_id gnl|my_center|LOCUS_03060 405901 405272 gene locus_tag LOCUS_03070 405901 405272 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104477.1 protein_id gnl|my_center|LOCUS_03070 407058 406117 gene locus_tag LOCUS_03080 407058 406117 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089962.1 protein_id gnl|my_center|LOCUS_03080 407885 407277 gene locus_tag LOCUS_03090 407885 407277 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105553.1 protein_id gnl|my_center|LOCUS_03090 408896 407907 gene locus_tag LOCUS_03100 408896 407907 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615678.1 protein_id gnl|my_center|LOCUS_03100 409969 412677 gene locus_tag LOCUS_03110 gene hrpB 409969 412677 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074767.1 protein_id gnl|my_center|LOCUS_03110 414394 412799 gene locus_tag LOCUS_03120 414394 412799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 414513 416177 gene locus_tag LOCUS_03130 414513 416177 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054402.1 protein_id gnl|my_center|LOCUS_03130 416928 416191 gene locus_tag LOCUS_03140 416928 416191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 417094 418296 gene locus_tag LOCUS_03150 gene uxuA 417094 418296 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241977.1 protein_id gnl|my_center|LOCUS_03150 418320 421226 gene locus_tag LOCUS_03160 418320 421226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 422864 421317 gene locus_tag LOCUS_03170 422864 421317 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_03170 423601 422939 gene locus_tag LOCUS_03180 423601 422939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 424997 423711 gene locus_tag LOCUS_03190 gene eno 424997 423711 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785741.1 protein_id gnl|my_center|LOCUS_03190 426129 425104 gene locus_tag LOCUS_03200 426129 425104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 426252 426683 gene locus_tag LOCUS_03210 426252 426683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 426683 427066 gene locus_tag LOCUS_03220 426683 427066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 433190 427206 gene locus_tag LOCUS_03230 gene uvrA 433190 427206 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039164.1 protein_id gnl|my_center|LOCUS_03230 434153 433389 gene locus_tag LOCUS_03240 434153 433389 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118937.1 protein_id gnl|my_center|LOCUS_03240 435276 434167 gene locus_tag LOCUS_03250 435276 434167 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211860579.1 protein_id gnl|my_center|LOCUS_03250 435318 435743 gene locus_tag LOCUS_03260 435318 435743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 435877 437283 gene locus_tag LOCUS_03270 gene lpdA 435877 437283 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919599.1 protein_id gnl|my_center|LOCUS_03270 439184 437430 gene locus_tag LOCUS_03280 439184 437430 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326733.1 protein_id gnl|my_center|LOCUS_03280 440078 439290 gene locus_tag LOCUS_03290 440078 439290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 440259 441125 gene locus_tag LOCUS_03300 gene ilvE 440259 441125 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_03300 441319 441828 gene locus_tag LOCUS_03310 441319 441828 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421255.1 protein_id gnl|my_center|LOCUS_03310 441833 442933 gene locus_tag LOCUS_03320 441833 442933 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391708.1 protein_id gnl|my_center|LOCUS_03320 442974 445487 gene locus_tag LOCUS_03330 442974 445487 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 protein_id gnl|my_center|LOCUS_03330 445617 447416 gene locus_tag LOCUS_03340 445617 447416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 448320 447439 gene locus_tag LOCUS_03350 448320 447439 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161532938.1 protein_id gnl|my_center|LOCUS_03350 452162 448317 gene locus_tag LOCUS_03360 452162 448317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 453164 452244 gene locus_tag LOCUS_03370 453164 452244 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204927.1 protein_id gnl|my_center|LOCUS_03370 453340 454752 gene locus_tag LOCUS_03380 gene leuC 453340 454752 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173294.1 protein_id gnl|my_center|LOCUS_03380 454795 455397 gene locus_tag LOCUS_03390 gene leuD 454795 455397 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228533.1 protein_id gnl|my_center|LOCUS_03390 455517 456086 gene locus_tag LOCUS_03400 455517 456086 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881300.1 protein_id gnl|my_center|LOCUS_03400 456086 456484 gene locus_tag LOCUS_03410 456086 456484 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317468.1 protein_id gnl|my_center|LOCUS_03410 456838 457524 gene locus_tag LOCUS_03420 456838 457524 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823061.1 protein_id gnl|my_center|LOCUS_03420 457833 457555 gene locus_tag LOCUS_03430 457833 457555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 458908 458006 gene locus_tag LOCUS_03440 458908 458006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 460030 458993 gene locus_tag LOCUS_03450 460030 458993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 460242 460664 gene locus_tag LOCUS_03460 460242 460664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 460734 462212 gene locus_tag LOCUS_03470 460734 462212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 463000 462431 gene locus_tag LOCUS_03480 463000 462431 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082850.1 protein_id gnl|my_center|LOCUS_03480 464704 463031 gene locus_tag LOCUS_03490 464704 463031 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143151.1 protein_id gnl|my_center|LOCUS_03490 464789 465718 gene locus_tag LOCUS_03500 464789 465718 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015920871.1 protein_id gnl|my_center|LOCUS_03500 465775 466959 gene locus_tag LOCUS_03510 465775 466959 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929520.1 protein_id gnl|my_center|LOCUS_03510 467055 467438 gene locus_tag LOCUS_03520 467055 467438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 467897 467646 gene locus_tag LOCUS_03530 467897 467646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 468635 468015 gene locus_tag LOCUS_03540 gene lexA 468635 468015 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942262.1 protein_id gnl|my_center|LOCUS_03540 470431 468722 gene locus_tag LOCUS_03550 470431 468722 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940935.1 protein_id gnl|my_center|LOCUS_03550 471101 470529 gene locus_tag LOCUS_03560 471101 470529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 472069 471122 gene locus_tag LOCUS_03570 472069 471122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 472942 472217 gene locus_tag LOCUS_03580 gene aqpZ 472942 472217 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071520.1 protein_id gnl|my_center|LOCUS_03580 475209 473263 gene locus_tag LOCUS_03590 gene speA 475209 473263 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057644.1 protein_id gnl|my_center|LOCUS_03590 475416 475772 gene locus_tag LOCUS_03600 gene yajC 475416 475772 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037519.1 protein_id gnl|my_center|LOCUS_03600 475870 478419 gene locus_tag LOCUS_03610 gene secD 475870 478419 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172795.1 protein_id gnl|my_center|LOCUS_03610 478521 480245 gene locus_tag LOCUS_03620 gene recJ 478521 480245 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_03620 480626 481444 gene locus_tag LOCUS_03630 480626 481444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 482416 481475 gene locus_tag LOCUS_03640 482416 481475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 486248 482409 gene locus_tag LOCUS_03650 486248 482409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 486312 489287 gene locus_tag LOCUS_03660 486312 489287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 489319 489984 gene locus_tag LOCUS_03670 489319 489984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 491640 490012 gene locus_tag LOCUS_03680 491640 490012 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920680.1 protein_id gnl|my_center|LOCUS_03680 492336 491728 gene locus_tag LOCUS_03690 492336 491728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 496661 492366 gene locus_tag LOCUS_03700 496661 492366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 496933 498255 gene locus_tag LOCUS_03710 gene lat 496933 498255 CDS product L-lysine 6-transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403564.1 protein_id gnl|my_center|LOCUS_03710 498406 498330 gene locus_tag LOCUS_t00070 498406 498330 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 502674 498508 gene locus_tag LOCUS_03720 502674 498508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 503990 502740 gene locus_tag LOCUS_03730 503990 502740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008670900.1 protein_id gnl|my_center|LOCUS_03730 504427 504047 gene locus_tag LOCUS_03740 504427 504047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 506391 504562 gene locus_tag LOCUS_03750 506391 504562 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118144.1 protein_id gnl|my_center|LOCUS_03750 506390 506887 gene locus_tag LOCUS_03760 506390 506887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 507316 506942 gene locus_tag LOCUS_03770 507316 506942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 507578 508234 gene locus_tag LOCUS_03780 507578 508234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 508231 509070 gene locus_tag LOCUS_03790 508231 509070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 509196 510581 gene locus_tag LOCUS_03800 gene gltX 509196 510581 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_03800 511804 510764 gene locus_tag LOCUS_03810 511804 510764 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 protein_id gnl|my_center|LOCUS_03810 512755 511931 gene locus_tag LOCUS_03820 512755 511931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 514078 513437 gene locus_tag LOCUS_03830 gene thrH 514078 513437 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267421.1 protein_id gnl|my_center|LOCUS_03830 515017 514346 gene locus_tag LOCUS_03840 515017 514346 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940907.1 protein_id gnl|my_center|LOCUS_03840 516860 515064 gene locus_tag LOCUS_03850 516860 515064 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087605.1 protein_id gnl|my_center|LOCUS_03850 516971 517045 gene locus_tag LOCUS_t00080 516971 517045 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 517829 517161 gene locus_tag LOCUS_03860 517829 517161 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171830.1 protein_id gnl|my_center|LOCUS_03860 518073 517918 gene locus_tag LOCUS_03870 518073 517918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 518421 518101 gene locus_tag LOCUS_03880 518421 518101 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226991.1 protein_id gnl|my_center|LOCUS_03880 518531 518725 gene locus_tag LOCUS_03890 518531 518725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 518828 519304 gene locus_tag LOCUS_03900 gene smpB 518828 519304 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942353.1 protein_id gnl|my_center|LOCUS_03900 519748 519329 gene locus_tag LOCUS_03910 519748 519329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 519846 520319 gene locus_tag LOCUS_03920 gene trmL 519846 520319 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393380.1 protein_id gnl|my_center|LOCUS_03920 521454 520471 gene locus_tag LOCUS_03930 521454 520471 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_03930 522443 521469 gene locus_tag LOCUS_03940 522443 521469 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144109.1 protein_id gnl|my_center|LOCUS_03940 524397 522478 gene locus_tag LOCUS_03950 524397 522478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 524499 525464 gene locus_tag LOCUS_03960 gene waaC 524499 525464 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_03960 525543 526814 gene locus_tag LOCUS_03970 gene serS 525543 526814 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404592.1 protein_id gnl|my_center|LOCUS_03970 526861 527898 gene locus_tag LOCUS_03980 526861 527898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 527946 529952 gene locus_tag LOCUS_03990 gene ftsH 527946 529952 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443940.1 protein_id gnl|my_center|LOCUS_03990 530936 530319 gene locus_tag LOCUS_04000 530936 530319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 531208 532047 gene locus_tag LOCUS_04010 531208 532047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 532132 533733 gene locus_tag LOCUS_04020 532132 533733 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158257889.1 protein_id gnl|my_center|LOCUS_04020 533799 535859 gene locus_tag LOCUS_04030 533799 535859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 535856 536659 gene locus_tag LOCUS_04040 535856 536659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 538454 536901 gene locus_tag LOCUS_04050 538454 536901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 540021 538606 gene locus_tag LOCUS_04060 gene rimO 540021 538606 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198793.1 protein_id gnl|my_center|LOCUS_04060 540377 540907 gene locus_tag LOCUS_04070 540377 540907 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389192.1 protein_id gnl|my_center|LOCUS_04070 540913 542013 gene locus_tag LOCUS_04080 540913 542013 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147971.1 protein_id gnl|my_center|LOCUS_04080 542284 542021 gene locus_tag LOCUS_04090 542284 542021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 542271 545627 gene locus_tag LOCUS_04100 542271 545627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 545658 547031 gene locus_tag LOCUS_04110 545658 547031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 547112 548479 gene locus_tag LOCUS_04120 547112 548479 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118126.1 protein_id gnl|my_center|LOCUS_04120 548778 550283 gene locus_tag LOCUS_04130 548778 550283 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195202377.1 protein_id gnl|my_center|LOCUS_04130 550365 553589 gene locus_tag LOCUS_04140 550365 553589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 553593 555068 gene locus_tag LOCUS_04150 553593 555068 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326676.1 protein_id gnl|my_center|LOCUS_04150 555097 555798 gene locus_tag LOCUS_04160 555097 555798 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_04160 557178 556156 gene locus_tag LOCUS_04170 557178 556156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 558442 557237 gene locus_tag LOCUS_04180 558442 557237 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268774.1 protein_id gnl|my_center|LOCUS_04180 560142 558631 gene locus_tag LOCUS_04190 560142 558631 CDS product lipase maturation factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977913.1 protein_id gnl|my_center|LOCUS_04190 561494 560529 gene locus_tag LOCUS_04200 561494 560529 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082923.1 protein_id gnl|my_center|LOCUS_04200 562677 561604 gene locus_tag LOCUS_04210 562677 561604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 563831 562986 gene locus_tag LOCUS_04220 563831 562986 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975348.1 protein_id gnl|my_center|LOCUS_04220 564014 564304 gene locus_tag LOCUS_04230 564014 564304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 564378 564926 gene locus_tag LOCUS_04240 564378 564926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 564949 565749 gene locus_tag LOCUS_04250 564949 565749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04250 565746 566843 gene locus_tag LOCUS_04260 565746 566843 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202611.1 protein_id gnl|my_center|LOCUS_04260 566833 568461 gene locus_tag LOCUS_04270 gene aepX 566833 568461 CDS product phosphoenolpyruvate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525540.1 protein_id gnl|my_center|LOCUS_04270 568660 569814 gene locus_tag LOCUS_04280 gene aepY 568660 569814 CDS product phosphonopyruvate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530031.1 protein_id gnl|my_center|LOCUS_04280 570824 569832 gene locus_tag LOCUS_04290 570824 569832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 570928 571128 gene locus_tag LOCUS_04300 570928 571128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 571244 572593 gene locus_tag LOCUS_04310 571244 572593 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082946.1 protein_id gnl|my_center|LOCUS_04310 572677 575247 gene locus_tag LOCUS_04320 572677 575247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 575621 575142 gene locus_tag LOCUS_04330 575621 575142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 575605 575985 gene locus_tag LOCUS_04340 575605 575985 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881606.1 protein_id gnl|my_center|LOCUS_04340 576448 576050 gene locus_tag LOCUS_04350 gene dtd 576448 576050 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256355.1 protein_id gnl|my_center|LOCUS_04350 576374 576736 gene locus_tag LOCUS_04360 576374 576736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 577939 576752 gene locus_tag LOCUS_04370 577939 576752 CDS product CBU_0270 family Dot/Icm type IV secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957471.1 protein_id gnl|my_center|LOCUS_04370 579107 578004 gene locus_tag LOCUS_04380 579107 578004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 579799 579104 gene locus_tag LOCUS_04390 579799 579104 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259574.1 protein_id gnl|my_center|LOCUS_04390 581609 579993 gene locus_tag LOCUS_04400 581609 579993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 583123 581606 gene locus_tag LOCUS_04410 583123 581606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 583260 583892 gene locus_tag LOCUS_04420 583260 583892 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918109.1 protein_id gnl|my_center|LOCUS_04420 584982 584122 gene locus_tag LOCUS_04430 gene dapF 584982 584122 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583145.1 protein_id gnl|my_center|LOCUS_04430 585767 585090 gene locus_tag LOCUS_04440 585767 585090 CDS product DUF4336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504113.1 protein_id gnl|my_center|LOCUS_04440 587277 585793 gene locus_tag LOCUS_04450 587277 585793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332558.1 protein_id gnl|my_center|LOCUS_04450 587482 589302 gene locus_tag LOCUS_04460 gene sppA 587482 589302 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962568.1 protein_id gnl|my_center|LOCUS_04460 589302 589847 gene locus_tag LOCUS_04470 gene sufT 589302 589847 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_04470 591132 590041 gene locus_tag LOCUS_04480 591132 590041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 591683 591138 gene locus_tag LOCUS_04490 591683 591138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 592670 591822 gene locus_tag LOCUS_04500 gene lpxI 592670 591822 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389473.1 protein_id gnl|my_center|LOCUS_04500 594946 592787 gene locus_tag LOCUS_04510 594946 592787 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918053.1 protein_id gnl|my_center|LOCUS_04510 595599 594958 gene locus_tag LOCUS_04520 595599 594958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 596790 595606 gene locus_tag LOCUS_04530 596790 595606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 597781 596807 gene locus_tag LOCUS_04540 597781 596807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 600437 597870 gene locus_tag LOCUS_04550 gene leuS 600437 597870 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009461.1 protein_id gnl|my_center|LOCUS_04550 600543 601811 gene locus_tag LOCUS_04560 600543 601811 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_04560 601808 603205 gene locus_tag LOCUS_04570 601808 603205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 603863 603369 gene locus_tag LOCUS_04580 603863 603369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 604451 604017 gene locus_tag LOCUS_04590 604451 604017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 605059 604448 gene locus_tag LOCUS_04600 605059 604448 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_04600 605219 605815 gene locus_tag LOCUS_04610 605219 605815 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942332.1 protein_id gnl|my_center|LOCUS_04610 605823 606791 gene locus_tag LOCUS_04620 605823 606791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 606788 608299 gene locus_tag LOCUS_04630 606788 608299 CDS product glucan biosynthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925635.1 protein_id gnl|my_center|LOCUS_04630 608296 608910 gene locus_tag LOCUS_04640 608296 608910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 608922 611072 gene locus_tag LOCUS_04650 gene mdoH 608922 611072 CDS product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103448.1 protein_id gnl|my_center|LOCUS_04650 611467 611096 gene locus_tag LOCUS_04660 611467 611096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 613267 611561 gene locus_tag LOCUS_04670 613267 611561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 613445 613248 gene locus_tag LOCUS_04680 613445 613248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 613838 613452 gene locus_tag LOCUS_04690 613838 613452 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868673.1 protein_id gnl|my_center|LOCUS_04690 614992 613835 gene locus_tag LOCUS_04700 614992 613835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 615223 615861 gene locus_tag LOCUS_04710 615223 615861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 616098 617246 gene locus_tag LOCUS_04720 gene metK 616098 617246 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680429.1 protein_id gnl|my_center|LOCUS_04720 617289 618713 gene locus_tag LOCUS_04730 gene ahcY 617289 618713 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035988.1 protein_id gnl|my_center|LOCUS_04730 620322 618838 gene locus_tag LOCUS_04740 620322 618838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 621728 620376 gene locus_tag LOCUS_04750 621728 620376 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528915.1 protein_id gnl|my_center|LOCUS_04750 624492 621784 gene locus_tag LOCUS_04760 624492 621784 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943442.1 protein_id gnl|my_center|LOCUS_04760 624380 624727 gene locus_tag LOCUS_04770 624380 624727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 624724 625704 gene locus_tag LOCUS_04780 gene fmt 624724 625704 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114642.1 protein_id gnl|my_center|LOCUS_04780 626670 625861 gene locus_tag LOCUS_04790 626670 625861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 627840 626887 gene locus_tag LOCUS_04800 627840 626887 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966989.1 protein_id gnl|my_center|LOCUS_04800 628415 627846 gene locus_tag LOCUS_04810 628415 627846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 628616 629848 gene locus_tag LOCUS_04820 628616 629848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 629942 630496 gene locus_tag LOCUS_04830 629942 630496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 631043 630648 gene locus_tag LOCUS_04840 631043 630648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 634295 631113 gene locus_tag LOCUS_04850 634295 631113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 635098 634358 gene locus_tag LOCUS_04860 635098 634358 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_04860 636018 642074 gene locus_tag LOCUS_04870 636018 642074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 642434 646042 gene locus_tag LOCUS_04880 gene nifJ 642434 646042 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257946.1 protein_id gnl|my_center|LOCUS_04880 646039 647031 gene locus_tag LOCUS_04890 646039 647031 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_04890 647037 648521 gene locus_tag LOCUS_04900 647037 648521 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921433.1 protein_id gnl|my_center|LOCUS_04900 648664 650295 gene locus_tag LOCUS_04910 648664 650295 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117896.1 protein_id gnl|my_center|LOCUS_04910 653355 650380 gene locus_tag LOCUS_04920 653355 650380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 655353 653713 gene locus_tag LOCUS_04930 655353 653713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 656585 655455 gene locus_tag LOCUS_04940 656585 655455 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900904.1 protein_id gnl|my_center|LOCUS_04940 658546 657077 gene locus_tag LOCUS_04950 658546 657077 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257845.1 protein_id gnl|my_center|LOCUS_04950 660057 658543 gene locus_tag LOCUS_04960 660057 658543 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257846.1 protein_id gnl|my_center|LOCUS_04960 661589 660054 gene locus_tag LOCUS_04970 661589 660054 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257847.1 protein_id gnl|my_center|LOCUS_04970 663601 661586 gene locus_tag LOCUS_04980 gene nuoL 663601 661586 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257848.1 protein_id gnl|my_center|LOCUS_04980 663926 663609 gene locus_tag LOCUS_04990 gene nuoK 663926 663609 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257849.1 protein_id gnl|my_center|LOCUS_04990 664450 663923 gene locus_tag LOCUS_05000 664450 663923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 665789 664554 gene locus_tag LOCUS_05010 gene nuoH 665789 664554 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257851.1 protein_id gnl|my_center|LOCUS_05010 666466 665786 gene locus_tag LOCUS_05020 666466 665786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05020 667758 666595 gene locus_tag LOCUS_05030 667758 666595 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257853.1 protein_id gnl|my_center|LOCUS_05030 668435 667755 gene locus_tag LOCUS_05040 668435 667755 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257854.1 protein_id gnl|my_center|LOCUS_05040 669097 668444 gene locus_tag LOCUS_05050 669097 668444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 669476 669105 gene locus_tag LOCUS_05060 gene ndhC 669476 669105 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257856.1 protein_id gnl|my_center|LOCUS_05060 670564 669719 gene locus_tag LOCUS_05070 670564 669719 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615834.1 protein_id gnl|my_center|LOCUS_05070 671292 670561 gene locus_tag LOCUS_05080 671292 670561 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174100.1 protein_id gnl|my_center|LOCUS_05080 672761 671289 gene locus_tag LOCUS_05090 672761 671289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 673372 672836 gene locus_tag LOCUS_05100 673372 672836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 673525 674415 gene locus_tag LOCUS_05110 673525 674415 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521379.1 protein_id gnl|my_center|LOCUS_05110 674514 675824 gene locus_tag LOCUS_05120 674514 675824 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640554.1 protein_id gnl|my_center|LOCUS_05120 676650 676000 gene locus_tag LOCUS_05130 676650 676000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 678241 676838 gene locus_tag LOCUS_05140 678241 676838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 678855 678391 gene locus_tag LOCUS_05150 678855 678391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 679571 679104 gene locus_tag LOCUS_05160 679571 679104 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528492.1 protein_id gnl|my_center|LOCUS_05160 681474 680044 gene locus_tag LOCUS_05170 681474 680044 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 protein_id gnl|my_center|LOCUS_05170 684259 681488 gene locus_tag LOCUS_05180 684259 681488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 684548 685510 gene locus_tag LOCUS_05190 684548 685510 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121884.1 protein_id gnl|my_center|LOCUS_05190 685479 687581 gene locus_tag LOCUS_05200 685479 687581 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107563.1 protein_id gnl|my_center|LOCUS_05200 687883 687599 gene locus_tag LOCUS_05210 687883 687599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 690252 687895 gene locus_tag LOCUS_05220 690252 687895 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918342.1 protein_id gnl|my_center|LOCUS_05220 692171 690306 gene locus_tag LOCUS_05230 692171 690306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 692963 692256 gene locus_tag LOCUS_05240 692963 692256 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_05240 693741 693040 gene locus_tag LOCUS_05250 693741 693040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 695126 693744 gene locus_tag LOCUS_05260 695126 693744 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919394.1 protein_id gnl|my_center|LOCUS_05260 696562 695123 gene locus_tag LOCUS_05270 696562 695123 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143098.1 protein_id gnl|my_center|LOCUS_05270 698565 696574 gene locus_tag LOCUS_05280 698565 696574 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919649.1 protein_id gnl|my_center|LOCUS_05280 699063 698695 gene locus_tag LOCUS_05290 699063 698695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 699281 700213 gene locus_tag LOCUS_05300 699281 700213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 700308 703415 gene locus_tag LOCUS_05310 700308 703415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 704771 703695 gene locus_tag LOCUS_05320 704771 703695 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922962.1 protein_id gnl|my_center|LOCUS_05320 707395 705005 gene locus_tag LOCUS_05330 707395 705005 CDS product PA14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122548.1 protein_id gnl|my_center|LOCUS_05330 708726 707488 gene locus_tag LOCUS_05340 708726 707488 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035678.1 protein_id gnl|my_center|LOCUS_05340 711081 708940 gene locus_tag LOCUS_05350 711081 708940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 712513 711167 gene locus_tag LOCUS_05360 712513 711167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 713654 712578 gene locus_tag LOCUS_05370 713654 712578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 716431 713654 gene locus_tag LOCUS_05380 716431 713654 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404755.1 protein_id gnl|my_center|LOCUS_05380 719389 716534 gene locus_tag LOCUS_05390 719389 716534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 720386 719433 gene locus_tag LOCUS_05400 720386 719433 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112643.1 protein_id gnl|my_center|LOCUS_05400 720922 720392 gene locus_tag LOCUS_05410 720922 720392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 721037 723562 gene locus_tag LOCUS_05420 721037 723562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 724267 723569 gene locus_tag LOCUS_05430 724267 723569 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462033.1 protein_id gnl|my_center|LOCUS_05430 724555 724364 gene locus_tag LOCUS_05440 724555 724364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 725327 724659 gene locus_tag LOCUS_05450 725327 724659 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257162.1 protein_id gnl|my_center|LOCUS_05450 725977 725375 gene locus_tag LOCUS_05460 725977 725375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 725967 726836 gene locus_tag LOCUS_05470 725967 726836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 727080 726847 gene locus_tag LOCUS_05480 727080 726847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 727846 727148 gene locus_tag LOCUS_05490 727846 727148 CDS product DUF2293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921987.1 protein_id gnl|my_center|LOCUS_05490 728116 727910 gene locus_tag LOCUS_05500 728116 727910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 728256 728600 gene locus_tag LOCUS_05510 728256 728600 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226523.1 protein_id gnl|my_center|LOCUS_05510 728790 729521 gene locus_tag LOCUS_05520 728790 729521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155662648.1 protein_id gnl|my_center|LOCUS_05520 729879 729562 gene locus_tag LOCUS_05530 729879 729562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 730664 730095 gene locus_tag LOCUS_05540 730664 730095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 730882 731802 gene locus_tag LOCUS_05550 730882 731802 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237475.1 protein_id gnl|my_center|LOCUS_05550 731787 732776 gene locus_tag LOCUS_05560 731787 732776 CDS product putative carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368708.1 protein_id gnl|my_center|LOCUS_05560 732809 736240 gene locus_tag LOCUS_05570 732809 736240 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615995.1 protein_id gnl|my_center|LOCUS_05570 737677 736262 gene locus_tag LOCUS_05580 737677 736262 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982271.1 protein_id gnl|my_center|LOCUS_05580 737815 738978 gene locus_tag LOCUS_05590 737815 738978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 739262 739819 gene locus_tag LOCUS_05600 739262 739819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 739821 740738 gene locus_tag LOCUS_05610 739821 740738 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626423.1 protein_id gnl|my_center|LOCUS_05610 740758 741870 gene locus_tag LOCUS_05620 740758 741870 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876334.1 protein_id gnl|my_center|LOCUS_05620 741863 742546 gene locus_tag LOCUS_05630 gene lolD 741863 742546 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033714.1 protein_id gnl|my_center|LOCUS_05630 742543 743784 gene locus_tag LOCUS_05640 742543 743784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 743781 744185 gene locus_tag LOCUS_05650 743781 744185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 744178 746052 gene locus_tag LOCUS_05660 744178 746052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 746049 746717 gene locus_tag LOCUS_05670 gene qseB 746049 746717 CDS product quorum sensing response regulator transcription factor QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098725.1 protein_id gnl|my_center|LOCUS_05670 746714 748066 gene locus_tag LOCUS_05680 746714 748066 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392644.1 protein_id gnl|my_center|LOCUS_05680 748262 748744 gene locus_tag LOCUS_05690 748262 748744 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284399.1 protein_id gnl|my_center|LOCUS_05690 751018 748763 gene locus_tag LOCUS_05700 751018 748763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 752638 751205 gene locus_tag LOCUS_05710 752638 751205 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120624.1 protein_id gnl|my_center|LOCUS_05710 754500 752707 gene locus_tag LOCUS_05720 754500 752707 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671072.1 protein_id gnl|my_center|LOCUS_05720 754641 756122 gene locus_tag LOCUS_05730 754641 756122 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120799.1 protein_id gnl|my_center|LOCUS_05730 756134 757597 gene locus_tag LOCUS_05740 756134 757597 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120117.1 protein_id gnl|my_center|LOCUS_05740 757795 759216 gene locus_tag LOCUS_05750 757795 759216 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788605.1 protein_id gnl|my_center|LOCUS_05750 760820 759393 gene locus_tag LOCUS_05760 760820 759393 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922487.1 protein_id gnl|my_center|LOCUS_05760 762337 760820 gene locus_tag LOCUS_05770 762337 760820 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051073366.1 protein_id gnl|my_center|LOCUS_05770 763370 762465 gene locus_tag LOCUS_05780 763370 762465 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098699.1 protein_id gnl|my_center|LOCUS_05780 764947 763619 gene locus_tag LOCUS_05790 764947 763619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 767757 764959 gene locus_tag LOCUS_05800 767757 764959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 768737 767781 gene locus_tag LOCUS_05810 768737 767781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 769282 768734 gene locus_tag LOCUS_05820 769282 768734 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331069.1 protein_id gnl|my_center|LOCUS_05820 770052 769366 gene locus_tag LOCUS_05830 770052 769366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091213.1 protein_id gnl|my_center|LOCUS_05830 772975 770210 gene locus_tag LOCUS_05840 772975 770210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 773209 774834 gene locus_tag LOCUS_05850 773209 774834 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920663.1 protein_id gnl|my_center|LOCUS_05850 774891 776219 gene locus_tag LOCUS_05860 774891 776219 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035351.1 protein_id gnl|my_center|LOCUS_05860 776231 777865 gene locus_tag LOCUS_05870 776231 777865 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920663.1 protein_id gnl|my_center|LOCUS_05870 777906 778529 gene locus_tag LOCUS_05880 777906 778529 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920665.1 protein_id gnl|my_center|LOCUS_05880 778621 779628 gene locus_tag LOCUS_05890 778621 779628 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035349.1 protein_id gnl|my_center|LOCUS_05890 779635 780570 gene locus_tag LOCUS_05900 779635 780570 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035348.1 protein_id gnl|my_center|LOCUS_05900 780579 781808 gene locus_tag LOCUS_05910 780579 781808 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035347.1 protein_id gnl|my_center|LOCUS_05910 781805 784027 gene locus_tag LOCUS_05920 781805 784027 CDS product DUF4175 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275117.1 protein_id gnl|my_center|LOCUS_05920 784024 785757 gene locus_tag LOCUS_05930 784024 785757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 785840 787051 gene locus_tag LOCUS_05940 785840 787051 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116062060.1 protein_id gnl|my_center|LOCUS_05940 787894 787067 gene locus_tag LOCUS_05950 787894 787067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 788777 787923 gene locus_tag LOCUS_05960 788777 787923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05960 788848 789147 gene locus_tag LOCUS_05970 788848 789147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 789207 790631 gene locus_tag LOCUS_05980 789207 790631 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_05980 790687 792636 gene locus_tag LOCUS_05990 790687 792636 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767964.1 protein_id gnl|my_center|LOCUS_05990 793045 794361 gene locus_tag LOCUS_06000 793045 794361 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118525.1 protein_id gnl|my_center|LOCUS_06000 795153 794440 gene locus_tag LOCUS_06010 795153 794440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 795274 795822 gene locus_tag LOCUS_06020 795274 795822 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143573.1 protein_id gnl|my_center|LOCUS_06020 795842 796180 gene locus_tag LOCUS_06030 795842 796180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 796204 796812 gene locus_tag LOCUS_06040 796204 796812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 796844 798268 gene locus_tag LOCUS_06050 796844 798268 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_06050 798318 800105 gene locus_tag LOCUS_06060 798318 800105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 800162 801337 gene locus_tag LOCUS_06070 800162 801337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 801363 803534 gene locus_tag LOCUS_06080 gene vpsO 801363 803534 CDS product exopolysaccharide regulatory tyrosine autokinase VpsO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_06080 803677 803752 gene locus_tag LOCUS_t00090 803677 803752 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 805034 803970 gene locus_tag LOCUS_06090 805034 803970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 805231 806022 gene locus_tag LOCUS_06100 805231 806022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 806019 808910 gene locus_tag LOCUS_06110 806019 808910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 808907 811288 gene locus_tag LOCUS_06120 808907 811288 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055503.1 protein_id gnl|my_center|LOCUS_06120 811285 814242 gene locus_tag LOCUS_06130 811285 814242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 814290 817466 gene locus_tag LOCUS_06140 814290 817466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 817483 818817 gene locus_tag LOCUS_06150 817483 818817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 818947 821277 gene locus_tag LOCUS_06160 818947 821277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 821301 824165 gene locus_tag LOCUS_06170 821301 824165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 824311 826590 gene locus_tag LOCUS_06180 824311 826590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 826770 827450 gene locus_tag LOCUS_06190 826770 827450 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_06190 827548 828513 gene locus_tag LOCUS_06200 gene trpS 827548 828513 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016366.1 protein_id gnl|my_center|LOCUS_06200 829279 828620 gene locus_tag LOCUS_06210 829279 828620 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_06210 829950 829276 gene locus_tag LOCUS_06220 gene cmk 829950 829276 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027958.1 protein_id gnl|my_center|LOCUS_06220 831302 829947 gene locus_tag LOCUS_06230 gene aroA 831302 829947 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229519.1 protein_id gnl|my_center|LOCUS_06230 831412 833595 gene locus_tag LOCUS_06240 831412 833595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 833671 833745 gene locus_tag LOCUS_t00100 833671 833745 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 833988 835220 gene locus_tag LOCUS_06250 gene nusA 833988 835220 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942231.1 protein_id gnl|my_center|LOCUS_06250 835254 837866 gene locus_tag LOCUS_06260 835254 837866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 837950 838312 gene locus_tag LOCUS_06270 837950 838312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 838321 839331 gene locus_tag LOCUS_06280 838321 839331 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_06280 839334 840059 gene locus_tag LOCUS_06290 839334 840059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06290 840112 841047 gene locus_tag LOCUS_06300 840112 841047 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064039.1 protein_id gnl|my_center|LOCUS_06300 841103 841179 gene locus_tag LOCUS_t00110 841103 841179 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 841233 842894 gene locus_tag LOCUS_06310 gene recN 841233 842894 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393016.1 protein_id gnl|my_center|LOCUS_06310 845052 843082 gene locus_tag LOCUS_06320 845052 843082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 846227 845049 gene locus_tag LOCUS_06330 846227 845049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 846477 847832 gene locus_tag LOCUS_06340 846477 847832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 847935 849617 gene locus_tag LOCUS_06350 gene pxpB 847935 849617 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228353.1 protein_id gnl|my_center|LOCUS_06350 849614 850351 gene locus_tag LOCUS_06360 gene pxpA 849614 850351 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935993.1 protein_id gnl|my_center|LOCUS_06360 850348 851028 gene locus_tag LOCUS_06370 850348 851028 CDS product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239801.1 protein_id gnl|my_center|LOCUS_06370 851025 851978 gene locus_tag LOCUS_06380 851025 851978 CDS product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021671.1 protein_id gnl|my_center|LOCUS_06380 851978 852613 gene locus_tag LOCUS_06390 gene pcp 851978 852613 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704765.1 protein_id gnl|my_center|LOCUS_06390 853658 852636 gene locus_tag LOCUS_06400 853658 852636 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658378.1 protein_id gnl|my_center|LOCUS_06400 853775 854893 gene locus_tag LOCUS_06410 gene prfA 853775 854893 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943725.1 protein_id gnl|my_center|LOCUS_06410 854895 855746 gene locus_tag LOCUS_06420 gene prmC 854895 855746 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933153.1 protein_id gnl|my_center|LOCUS_06420 857993 855798 gene locus_tag LOCUS_06430 857993 855798 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329904.1 protein_id gnl|my_center|LOCUS_06430 858968 858051 gene locus_tag LOCUS_06440 858968 858051 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933874.1 protein_id gnl|my_center|LOCUS_06440 859106 859342 gene locus_tag LOCUS_06450 859106 859342 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764038.1 protein_id gnl|my_center|LOCUS_06450 859529 861358 gene locus_tag LOCUS_06460 859529 861358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 861410 863461 gene locus_tag LOCUS_06470 861410 863461 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888294.1 protein_id gnl|my_center|LOCUS_06470 863513 863968 gene locus_tag LOCUS_06480 863513 863968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 864776 863991 gene locus_tag LOCUS_06490 864776 863991 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973947.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06490 864873 866021 gene locus_tag LOCUS_06500 864873 866021 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257480.1 protein_id gnl|my_center|LOCUS_06500 866216 866905 gene locus_tag LOCUS_06510 866216 866905 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583790.1 protein_id gnl|my_center|LOCUS_06510 867854 867039 gene locus_tag LOCUS_06520 867854 867039 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455384.1 protein_id gnl|my_center|LOCUS_06520 868106 869815 gene locus_tag LOCUS_06530 868106 869815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 869866 870561 gene locus_tag LOCUS_06540 869866 870561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 870561 871715 gene locus_tag LOCUS_06550 870561 871715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 872705 871938 gene locus_tag LOCUS_06560 872705 871938 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930584.1 protein_id gnl|my_center|LOCUS_06560 872892 873752 gene locus_tag LOCUS_06570 gene hisG 872892 873752 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_06570 873846 874724 gene locus_tag LOCUS_06580 873846 874724 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909400.1 protein_id gnl|my_center|LOCUS_06580 874727 875083 gene locus_tag LOCUS_06590 874727 875083 CDS product DUF3088 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084105.1 protein_id gnl|my_center|LOCUS_06590 875080 876132 gene locus_tag LOCUS_06600 875080 876132 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259146.1 protein_id gnl|my_center|LOCUS_06600 876167 876631 gene locus_tag LOCUS_06610 876167 876631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 876961 878619 gene locus_tag LOCUS_06620 gene rpsA 876961 878619 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882963.1 protein_id gnl|my_center|LOCUS_06620 880366 878822 gene locus_tag LOCUS_06630 880366 878822 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056381.1 protein_id gnl|my_center|LOCUS_06630 881257 880580 gene locus_tag LOCUS_06640 881257 880580 CDS product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082973.1 protein_id gnl|my_center|LOCUS_06640 881553 881326 gene locus_tag LOCUS_06650 881553 881326 CDS product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082243.1 protein_id gnl|my_center|LOCUS_06650 882644 881550 gene locus_tag LOCUS_06660 882644 881550 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_06660 882753 883481 gene locus_tag LOCUS_06670 882753 883481 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_06670 884531 883503 gene locus_tag LOCUS_06680 884531 883503 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970115.1 protein_id gnl|my_center|LOCUS_06680 884630 885466 gene locus_tag LOCUS_06690 884630 885466 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820280.1 protein_id gnl|my_center|LOCUS_06690 886670 885630 gene locus_tag LOCUS_06700 886670 885630 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227260.1 protein_id gnl|my_center|LOCUS_06700 886795 887658 gene locus_tag LOCUS_06710 886795 887658 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_06710 888458 887844 gene locus_tag LOCUS_06720 888458 887844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 889377 888499 gene locus_tag LOCUS_06730 889377 888499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 892250 889401 gene locus_tag LOCUS_06740 gene ileS 892250 889401 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943758.1 protein_id gnl|my_center|LOCUS_06740 893726 892365 gene locus_tag LOCUS_06750 gene hemG 893726 892365 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403969.1 protein_id gnl|my_center|LOCUS_06750 894774 893743 gene locus_tag LOCUS_06760 gene hemE 894774 893743 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444333.1 protein_id gnl|my_center|LOCUS_06760 895774 894863 gene locus_tag LOCUS_06770 gene hemF 895774 894863 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097311.1 protein_id gnl|my_center|LOCUS_06770 897179 895923 gene locus_tag LOCUS_06780 897179 895923 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728740.1 protein_id gnl|my_center|LOCUS_06780 897266 898300 gene locus_tag LOCUS_06790 897266 898300 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920485.1 protein_id gnl|my_center|LOCUS_06790 898350 898808 gene locus_tag LOCUS_06800 898350 898808 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419733.1 protein_id gnl|my_center|LOCUS_06800 900346 898976 gene locus_tag LOCUS_06810 gene argA 900346 898976 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702691.1 protein_id gnl|my_center|LOCUS_06810 901006 900392 gene locus_tag LOCUS_06820 901006 900392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 901111 902883 gene locus_tag LOCUS_06830 901111 902883 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938640.1 protein_id gnl|my_center|LOCUS_06830 903081 903380 gene locus_tag LOCUS_06840 gene clpS 903081 903380 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776026.1 protein_id gnl|my_center|LOCUS_06840 903367 903828 gene locus_tag LOCUS_06850 903367 903828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 904323 904661 gene locus_tag LOCUS_06860 904323 904661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 904678 906879 gene locus_tag LOCUS_06870 904678 906879 CDS product DNA polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943858.1 protein_id gnl|my_center|LOCUS_06870 907614 906892 gene locus_tag LOCUS_06880 907614 906892 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839974.1 protein_id gnl|my_center|LOCUS_06880 910615 907586 gene locus_tag LOCUS_06890 910615 907586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 910508 910801 gene locus_tag LOCUS_06900 910508 910801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 911572 910841 gene locus_tag LOCUS_06910 911572 910841 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327171.1 protein_id gnl|my_center|LOCUS_06910 913047 911581 gene locus_tag LOCUS_06920 913047 911581 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922492.1 protein_id gnl|my_center|LOCUS_06920 915500 913044 gene locus_tag LOCUS_06930 915500 913044 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615954.1 protein_id gnl|my_center|LOCUS_06930 915896 917953 gene locus_tag LOCUS_06940 915896 917953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 917919 918848 gene locus_tag LOCUS_06950 917919 918848 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942288.1 protein_id gnl|my_center|LOCUS_06950 920322 918979 gene locus_tag LOCUS_06960 gene ffh 920322 918979 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938141.1 protein_id gnl|my_center|LOCUS_06960 920877 920401 gene locus_tag LOCUS_06970 920877 920401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 920989 921477 gene locus_tag LOCUS_06980 920989 921477 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968070.1 protein_id gnl|my_center|LOCUS_06980 921496 922686 gene locus_tag LOCUS_06990 921496 922686 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968069.1 protein_id gnl|my_center|LOCUS_06990 922756 924255 gene locus_tag LOCUS_07000 gene der 922756 924255 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_07000 924392 927832 gene locus_tag LOCUS_07010 924392 927832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 928564 927839 gene locus_tag LOCUS_07020 928564 927839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123273.1 protein_id gnl|my_center|LOCUS_07020 930039 928561 gene locus_tag LOCUS_07030 930039 928561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 931418 930048 gene locus_tag LOCUS_07040 931418 930048 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922251.1 protein_id gnl|my_center|LOCUS_07040 933156 931483 gene locus_tag LOCUS_07050 933156 931483 CDS product YHYH protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146593883.1 protein_id gnl|my_center|LOCUS_07050 933302 933985 gene locus_tag LOCUS_07060 933302 933985 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976672.1 protein_id gnl|my_center|LOCUS_07060 933982 935466 gene locus_tag LOCUS_07070 933982 935466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 936506 935427 gene locus_tag LOCUS_07080 936506 935427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 936564 937463 gene locus_tag LOCUS_07090 936564 937463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 937510 938283 gene locus_tag LOCUS_07100 937510 938283 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258270.1 protein_id gnl|my_center|LOCUS_07100 939269 938292 gene locus_tag LOCUS_07110 939269 938292 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836209.1 protein_id gnl|my_center|LOCUS_07110 939394 940392 gene locus_tag LOCUS_07120 939394 940392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 940389 941483 gene locus_tag LOCUS_07130 gene thrC 940389 941483 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061193.1 protein_id gnl|my_center|LOCUS_07130 942321 941542 gene locus_tag LOCUS_07140 942321 941542 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806957.1 protein_id gnl|my_center|LOCUS_07140 942483 943559 gene locus_tag LOCUS_07150 942483 943559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 943556 944788 gene locus_tag LOCUS_07160 943556 944788 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791093.1 protein_id gnl|my_center|LOCUS_07160 946058 944799 gene locus_tag LOCUS_07170 946058 944799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 946206 947933 gene locus_tag LOCUS_07180 946206 947933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 948187 951180 gene locus_tag LOCUS_07190 948187 951180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 951212 953413 gene locus_tag LOCUS_07200 951212 953413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 953410 955134 gene locus_tag LOCUS_07210 953410 955134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 955146 956489 gene locus_tag LOCUS_07220 gene hemL 955146 956489 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258457.1 protein_id gnl|my_center|LOCUS_07220 956501 958015 gene locus_tag LOCUS_07230 956501 958015 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530716.1 protein_id gnl|my_center|LOCUS_07230 958012 958401 gene locus_tag LOCUS_07240 958012 958401 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356039.1 protein_id gnl|my_center|LOCUS_07240 958408 959211 gene locus_tag LOCUS_07250 958408 959211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 960577 959288 gene locus_tag LOCUS_07260 960577 959288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 963554 960606 gene locus_tag LOCUS_07270 963554 960606 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920555.1 protein_id gnl|my_center|LOCUS_07270 963662 964687 gene locus_tag LOCUS_07280 963662 964687 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522216.1 protein_id gnl|my_center|LOCUS_07280 964841 965815 gene locus_tag LOCUS_07290 964841 965815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 966494 965799 gene locus_tag LOCUS_07300 gene udk 966494 965799 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172663.1 protein_id gnl|my_center|LOCUS_07300 966761 967396 gene locus_tag LOCUS_07310 966761 967396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 970261 967517 gene locus_tag LOCUS_07320 970261 967517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 970862 970317 gene locus_tag LOCUS_07330 970862 970317 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_07330 971026 971469 gene locus_tag LOCUS_07340 971026 971469 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809130.1 protein_id gnl|my_center|LOCUS_07340 971526 972728 gene locus_tag LOCUS_07350 971526 972728 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858471.1 protein_id gnl|my_center|LOCUS_07350 972918 973574 gene locus_tag LOCUS_07360 972918 973574 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088434.1 protein_id gnl|my_center|LOCUS_07360 973571 975169 gene locus_tag LOCUS_07370 973571 975169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 975166 976293 gene locus_tag LOCUS_07380 975166 976293 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 protein_id gnl|my_center|LOCUS_07380 977077 976538 gene locus_tag LOCUS_07390 977077 976538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 977246 977785 gene locus_tag LOCUS_07400 977246 977785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 977896 978444 gene locus_tag LOCUS_07410 977896 978444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 978441 979208 gene locus_tag LOCUS_07420 978441 979208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 980252 979227 gene locus_tag LOCUS_07430 980252 979227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 981417 980464 gene locus_tag LOCUS_07440 981417 980464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 982283 981477 gene locus_tag LOCUS_07450 982283 981477 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921816.1 protein_id gnl|my_center|LOCUS_07450 982419 983342 gene locus_tag LOCUS_07460 982419 983342 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529017.1 protein_id gnl|my_center|LOCUS_07460 983403 984005 gene locus_tag LOCUS_07470 983403 984005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 984875 984018 gene locus_tag LOCUS_07480 984875 984018 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170580.1 protein_id gnl|my_center|LOCUS_07480 985033 985434 gene locus_tag LOCUS_07490 985033 985434 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976104.1 protein_id gnl|my_center|LOCUS_07490 985518 986975 gene locus_tag LOCUS_07500 985518 986975 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228459.1 protein_id gnl|my_center|LOCUS_07500 987872 987021 gene locus_tag LOCUS_07510 987872 987021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 988597 987869 gene locus_tag LOCUS_07520 988597 987869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 990331 988619 gene locus_tag LOCUS_07530 990331 988619 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446174.1 protein_id gnl|my_center|LOCUS_07530 991198 990383 gene locus_tag LOCUS_07540 991198 990383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 994467 991384 gene locus_tag LOCUS_07550 994467 991384 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704584.1 protein_id gnl|my_center|LOCUS_07550 994717 996243 gene locus_tag LOCUS_07560 994717 996243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 996243 996686 gene locus_tag LOCUS_07570 996243 996686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 996683 996880 gene locus_tag LOCUS_07580 996683 996880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 996864 998591 gene locus_tag LOCUS_07590 gene pilB 996864 998591 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546881.1 protein_id gnl|my_center|LOCUS_07590 999259 998720 gene locus_tag LOCUS_07600 999259 998720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 999660 999256 gene locus_tag LOCUS_07610 999660 999256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 999933 1001687 gene locus_tag LOCUS_07620 999933 1001687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 1002327 1001749 gene locus_tag LOCUS_07630 1002327 1001749 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173510041.1 protein_id gnl|my_center|LOCUS_07630 1002433 1003035 gene locus_tag LOCUS_07640 1002433 1003035 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703862.1 protein_id gnl|my_center|LOCUS_07640 1003032 1003568 gene locus_tag LOCUS_07650 1003032 1003568 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071599.1 protein_id gnl|my_center|LOCUS_07650 1003636 1004184 gene locus_tag LOCUS_07660 1003636 1004184 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922248.1 protein_id gnl|my_center|LOCUS_07660 1004234 1004596 gene locus_tag LOCUS_07670 1004234 1004596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 1004683 1006068 gene locus_tag LOCUS_07680 1004683 1006068 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817206.1 protein_id gnl|my_center|LOCUS_07680 1009230 1006189 gene locus_tag LOCUS_07690 1009230 1006189 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057218.1 protein_id gnl|my_center|LOCUS_07690 1009701 1009555 gene locus_tag LOCUS_07700 1009701 1009555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 1014208 1010036 gene locus_tag LOCUS_07710 1014208 1010036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 1015552 1014389 gene locus_tag LOCUS_07720 1015552 1014389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 1017720 1015600 gene locus_tag LOCUS_07730 1017720 1015600 CDS product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421589.1 protein_id gnl|my_center|LOCUS_07730 1017601 1018362 gene locus_tag LOCUS_07740 1017601 1018362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 1020722 1018494 gene locus_tag LOCUS_07750 1020722 1018494 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225341.1 protein_id gnl|my_center|LOCUS_07750 1020895 1022061 gene locus_tag LOCUS_07760 gene pelA 1020895 1022061 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764019.1 protein_id gnl|my_center|LOCUS_07760 1022176 1022727 gene locus_tag LOCUS_07770 1022176 1022727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 1022791 1024074 gene locus_tag LOCUS_07780 1022791 1024074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 1026079 1024226 gene locus_tag LOCUS_07790 gene glmS 1026079 1024226 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328387.1 protein_id gnl|my_center|LOCUS_07790 1027097 1026162 gene locus_tag LOCUS_07800 1027097 1026162 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093339.1 protein_id gnl|my_center|LOCUS_07800 1027192 1028484 gene locus_tag LOCUS_07810 1027192 1028484 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674820.1 protein_id gnl|my_center|LOCUS_07810 1029508 1028525 gene locus_tag LOCUS_07820 1029508 1028525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 1030446 1029562 gene locus_tag LOCUS_07830 1030446 1029562 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028000663.1 protein_id gnl|my_center|LOCUS_07830 1031316 1030492 gene locus_tag LOCUS_07840 1031316 1030492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 1031440 1031829 gene locus_tag LOCUS_07850 gene rbsD 1031440 1031829 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116568.1 protein_id gnl|my_center|LOCUS_07850 1031901 1032692 gene locus_tag LOCUS_07860 1031901 1032692 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332279.1 protein_id gnl|my_center|LOCUS_07860 1032779 1033153 gene locus_tag LOCUS_07870 1032779 1033153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 1033247 1034164 gene locus_tag LOCUS_07880 1033247 1034164 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057878.1 protein_id gnl|my_center|LOCUS_07880 1035466 1034288 gene locus_tag LOCUS_07890 gene moeB 1035466 1034288 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_07890 1035543 1035980 gene locus_tag LOCUS_07900 gene ruvX 1035543 1035980 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058162.1 protein_id gnl|my_center|LOCUS_07900 1036042 1036845 gene locus_tag LOCUS_07910 gene truA 1036042 1036845 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943506.1 protein_id gnl|my_center|LOCUS_07910 1036859 1037617 gene locus_tag LOCUS_07920 1036859 1037617 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_07920 1037622 1038488 gene locus_tag LOCUS_07930 gene accD 1037622 1038488 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_07930 1038514 1039788 gene locus_tag LOCUS_07940 1038514 1039788 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227872.1 protein_id gnl|my_center|LOCUS_07940 1041447 1039891 gene locus_tag LOCUS_07950 1041447 1039891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 1041587 1043842 gene locus_tag LOCUS_07960 1041587 1043842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 1043839 1045185 gene locus_tag LOCUS_07970 1043839 1045185 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117989.1 protein_id gnl|my_center|LOCUS_07970 1045182 1046690 gene locus_tag LOCUS_07980 1045182 1046690 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099258810.1 protein_id gnl|my_center|LOCUS_07980 1047846 1046842 gene locus_tag LOCUS_07990 gene yhaM 1047846 1046842 CDS product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726638.1 protein_id gnl|my_center|LOCUS_07990 1048430 1047855 gene locus_tag LOCUS_08000 1048430 1047855 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706500.1 protein_id gnl|my_center|LOCUS_08000 1049100 1048441 gene locus_tag LOCUS_08010 1049100 1048441 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080979.1 protein_id gnl|my_center|LOCUS_08010 1049153 1049809 gene locus_tag LOCUS_08020 1049153 1049809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 1050729 1049968 gene locus_tag LOCUS_08030 gene hisF 1050729 1049968 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943716.1 protein_id gnl|my_center|LOCUS_08030 1051121 1050783 gene locus_tag LOCUS_08040 1051121 1050783 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_08040 1053007 1051247 gene locus_tag LOCUS_08050 1053007 1051247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 1054393 1053158 gene locus_tag LOCUS_08060 gene rho 1054393 1053158 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330229.1 protein_id gnl|my_center|LOCUS_08060 1054520 1056454 gene locus_tag LOCUS_08070 gene acs 1054520 1056454 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228545.1 protein_id gnl|my_center|LOCUS_08070 1056577 1057287 gene locus_tag LOCUS_08080 1056577 1057287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 1057299 1058063 gene locus_tag LOCUS_08090 1057299 1058063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 1058144 1058821 gene locus_tag LOCUS_08100 1058144 1058821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 1058825 1059445 gene locus_tag LOCUS_08110 1058825 1059445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 1059466 1060584 gene locus_tag LOCUS_08120 1059466 1060584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 1060821 1063949 gene locus_tag LOCUS_08130 1060821 1063949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 1063946 1064647 gene locus_tag LOCUS_08140 1063946 1064647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 1064830 1064756 gene locus_tag LOCUS_t00120 1064830 1064756 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1065662 1064922 gene locus_tag LOCUS_08150 1065662 1064922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 1066201 1065890 gene locus_tag LOCUS_08160 1066201 1065890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 1066924 1066205 gene locus_tag LOCUS_08170 1066924 1066205 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_08170 1069031 1066956 gene locus_tag LOCUS_08180 1069031 1066956 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_08180 1069237 1071477 gene locus_tag LOCUS_08190 gene pfeT 1069237 1071477 CDS product metal-transporting ATPase PfeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245873.1 protein_id gnl|my_center|LOCUS_08190 1071535 1072002 gene locus_tag LOCUS_08200 1071535 1072002 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194406.1 protein_id gnl|my_center|LOCUS_08200 1072717 1072163 gene locus_tag LOCUS_08210 1072717 1072163 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_08210 1072701 1073735 gene locus_tag LOCUS_08220 1072701 1073735 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460383.1 protein_id gnl|my_center|LOCUS_08220 1073912 1073985 gene locus_tag LOCUS_t00130 1073912 1073985 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1074121 1074591 gene locus_tag LOCUS_08230 gene ilvN 1074121 1074591 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942555.1 protein_id gnl|my_center|LOCUS_08230 1074645 1075673 gene locus_tag LOCUS_08240 gene ilvC 1074645 1075673 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880791.1 protein_id gnl|my_center|LOCUS_08240 1075747 1076604 gene locus_tag LOCUS_08250 gene hemC 1075747 1076604 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970392.1 protein_id gnl|my_center|LOCUS_08250 1076601 1077389 gene locus_tag LOCUS_08260 1076601 1077389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 1077472 1078566 gene locus_tag LOCUS_08270 1077472 1078566 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_08270 1078603 1079256 gene locus_tag LOCUS_08280 1078603 1079256 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339435.1 protein_id gnl|my_center|LOCUS_08280 1079796 1079266 gene locus_tag LOCUS_08290 1079796 1079266 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_08290 1081217 1079793 gene locus_tag LOCUS_08300 1081217 1079793 CDS product DNA-3-methyladenine glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391104.1 protein_id gnl|my_center|LOCUS_08300 1082537 1081293 gene locus_tag LOCUS_08310 1082537 1081293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 1082926 1082555 gene locus_tag LOCUS_08320 1082926 1082555 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259291.1 protein_id gnl|my_center|LOCUS_08320 1082981 1083430 gene locus_tag LOCUS_08330 1082981 1083430 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071501.1 protein_id gnl|my_center|LOCUS_08330 1085611 1083611 gene locus_tag LOCUS_08340 1085611 1083611 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005669465.1 protein_id gnl|my_center|LOCUS_08340 1085868 1086554 gene locus_tag LOCUS_08350 1085868 1086554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 1088604 1086988 gene locus_tag LOCUS_08360 1088604 1086988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 1090033 1088678 gene locus_tag LOCUS_08370 1090033 1088678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 1090845 1090039 gene locus_tag LOCUS_08380 1090845 1090039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 1092036 1090933 gene locus_tag LOCUS_08390 gene ychF 1092036 1090933 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815179.1 protein_id gnl|my_center|LOCUS_08390 1092142 1092399 gene locus_tag LOCUS_08400 1092142 1092399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 1092510 1093184 gene locus_tag LOCUS_08410 gene trmD 1092510 1093184 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941307.1 protein_id gnl|my_center|LOCUS_08410 1093195 1093623 gene locus_tag LOCUS_08420 gene rplS 1093195 1093623 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564764.1 protein_id gnl|my_center|LOCUS_08420 1093770 1095758 gene locus_tag LOCUS_08430 gene tkt 1093770 1095758 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301211.1 protein_id gnl|my_center|LOCUS_08430 1095911 1096492 gene locus_tag LOCUS_08440 gene yetL 1095911 1096492 CDS product transcriptional regulator YetL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233796.1 protein_id gnl|my_center|LOCUS_08440 1096533 1097651 gene locus_tag LOCUS_08450 1096533 1097651 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943408.1 protein_id gnl|my_center|LOCUS_08450 1097757 1100864 gene locus_tag LOCUS_08460 1097757 1100864 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943409.1 protein_id gnl|my_center|LOCUS_08460 1100889 1102265 gene locus_tag LOCUS_08470 1100889 1102265 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928699.1 protein_id gnl|my_center|LOCUS_08470 1102341 1105277 gene locus_tag LOCUS_08480 1102341 1105277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 1105338 1106342 gene locus_tag LOCUS_08490 1105338 1106342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 1106339 1107010 gene locus_tag LOCUS_08500 1106339 1107010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 1107174 1109408 gene locus_tag LOCUS_08510 1107174 1109408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 1111268 1109676 gene locus_tag LOCUS_08520 gene guaB 1111268 1109676 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081543.1 protein_id gnl|my_center|LOCUS_08520 1111405 1112475 gene locus_tag LOCUS_08530 1111405 1112475 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057016.1 protein_id gnl|my_center|LOCUS_08530 1112457 1113683 gene locus_tag LOCUS_08540 1112457 1113683 CDS product 2-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920832.1 protein_id gnl|my_center|LOCUS_08540 1113714 1115483 gene locus_tag LOCUS_08550 gene polX 1113714 1115483 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957611.1 protein_id gnl|my_center|LOCUS_08550 1115564 1118272 gene locus_tag LOCUS_08560 1115564 1118272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 1118452 1119324 gene locus_tag LOCUS_08570 1118452 1119324 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_08570 1119324 1121864 gene locus_tag LOCUS_08580 1119324 1121864 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384833.1 protein_id gnl|my_center|LOCUS_08580 1121895 1122041 gene locus_tag LOCUS_08590 1121895 1122041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 1122038 1123765 gene locus_tag LOCUS_08600 1122038 1123765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 1123882 1124526 gene locus_tag LOCUS_08610 1123882 1124526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 1124510 1125244 gene locus_tag LOCUS_08620 1124510 1125244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 1125279 1126409 gene locus_tag LOCUS_08630 gene bshA 1125279 1126409 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768305.1 protein_id gnl|my_center|LOCUS_08630 1126894 1127685 gene locus_tag LOCUS_08640 1126894 1127685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 1129923 1127944 gene locus_tag LOCUS_08650 1129923 1127944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 1131663 1130374 gene locus_tag LOCUS_08660 1131663 1130374 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874322.1 protein_id gnl|my_center|LOCUS_08660 1132788 1131811 gene locus_tag LOCUS_08670 1132788 1131811 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_08670 1134006 1132909 gene locus_tag LOCUS_08680 gene pdhA 1134006 1132909 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328145.1 protein_id gnl|my_center|LOCUS_08680 1134743 1134231 gene locus_tag LOCUS_08690 1134743 1134231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 1135027 1135647 gene locus_tag LOCUS_08700 1135027 1135647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 1135794 1137500 gene locus_tag LOCUS_08710 1135794 1137500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 1137505 1138614 gene locus_tag LOCUS_08720 1137505 1138614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 1138617 1139498 gene locus_tag LOCUS_08730 1138617 1139498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 1139545 1142328 gene locus_tag LOCUS_08740 1139545 1142328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 1142339 1149337 gene locus_tag LOCUS_08750 1142339 1149337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 1149473 1150399 gene locus_tag LOCUS_08760 1149473 1150399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 1151508 1150498 gene locus_tag LOCUS_08770 1151508 1150498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 1152575 1151505 gene locus_tag LOCUS_08780 1152575 1151505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 1154075 1152579 gene locus_tag LOCUS_08790 1154075 1152579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 1154943 1154086 gene locus_tag LOCUS_08800 1154943 1154086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 1155139 1155792 gene locus_tag LOCUS_08810 1155139 1155792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 1156238 1155846 gene locus_tag LOCUS_08820 1156238 1155846 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941946.1 protein_id gnl|my_center|LOCUS_08820 1156634 1157425 gene locus_tag LOCUS_08830 1156634 1157425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 1158998 1157451 gene locus_tag LOCUS_08840 1158998 1157451 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_08840 1159884 1159015 gene locus_tag LOCUS_08850 1159884 1159015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 1160016 1160609 gene locus_tag LOCUS_08860 gene coaE 1160016 1160609 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056742.1 protein_id gnl|my_center|LOCUS_08860 1160675 1162822 gene locus_tag LOCUS_08870 1160675 1162822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 1162838 1164604 gene locus_tag LOCUS_08880 1162838 1164604 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922562.1 protein_id gnl|my_center|LOCUS_08880 1164642 1165724 gene locus_tag LOCUS_08890 1164642 1165724 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329383.1 protein_id gnl|my_center|LOCUS_08890 1165759 1167465 gene locus_tag LOCUS_08900 1165759 1167465 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332509.1 protein_id gnl|my_center|LOCUS_08900 1167471 1168652 gene locus_tag LOCUS_08910 1167471 1168652 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_08910 1168666 1169790 gene locus_tag LOCUS_08920 1168666 1169790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08920 1170939 1169863 gene locus_tag LOCUS_08930 1170939 1169863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 1172690 1171209 gene locus_tag LOCUS_08940 gene trpE 1172690 1171209 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_08940 1174262 1172787 gene locus_tag LOCUS_08950 1174262 1172787 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121087.1 protein_id gnl|my_center|LOCUS_08950 1174442 1175476 gene locus_tag LOCUS_08960 1174442 1175476 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_08960 1175473 1176255 gene locus_tag LOCUS_08970 1175473 1176255 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123954.1 protein_id gnl|my_center|LOCUS_08970 1176272 1177201 gene locus_tag LOCUS_08980 1176272 1177201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 1178692 1177280 gene locus_tag LOCUS_08990 1178692 1177280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 1179541 1178696 gene locus_tag LOCUS_09000 1179541 1178696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 1179583 1182558 gene locus_tag LOCUS_09010 1179583 1182558 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 protein_id gnl|my_center|LOCUS_09010 1182630 1184042 gene locus_tag LOCUS_09020 1182630 1184042 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_09020 1184039 1185370 gene locus_tag LOCUS_09030 1184039 1185370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223273.1 protein_id gnl|my_center|LOCUS_09030 1185797 1185417 gene locus_tag LOCUS_09040 1185797 1185417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 1187338 1185794 gene locus_tag LOCUS_09050 1187338 1185794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 1187791 1187339 gene locus_tag LOCUS_09060 1187791 1187339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 1189964 1188054 gene locus_tag LOCUS_09070 1189964 1188054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 1190943 1190017 gene locus_tag LOCUS_09080 1190943 1190017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 1191081 1192967 gene locus_tag LOCUS_09090 1191081 1192967 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_09090 1193418 1194500 gene locus_tag LOCUS_09100 gene pseB 1193418 1194500 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073154.1 protein_id gnl|my_center|LOCUS_09100 1194548 1195774 gene locus_tag LOCUS_09110 gene pseC 1194548 1195774 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869432.1 protein_id gnl|my_center|LOCUS_09110 1195774 1196487 gene locus_tag LOCUS_09120 gene pseF 1195774 1196487 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867757.1 protein_id gnl|my_center|LOCUS_09120 1196484 1198223 gene locus_tag LOCUS_09130 1196484 1198223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 1198220 1198963 gene locus_tag LOCUS_09140 1198220 1198963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 1198982 1200037 gene locus_tag LOCUS_09150 gene pseI 1198982 1200037 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965486.1 protein_id gnl|my_center|LOCUS_09150 1200044 1200712 gene locus_tag LOCUS_09160 1200044 1200712 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975612.1 protein_id gnl|my_center|LOCUS_09160 1200745 1201497 gene locus_tag LOCUS_09170 1200745 1201497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 1201806 1207061 gene locus_tag LOCUS_09180 1201806 1207061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 1207058 1208131 gene locus_tag LOCUS_09190 1207058 1208131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 1210117 1208144 gene locus_tag LOCUS_09200 1210117 1208144 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_09200 1211244 1210432 gene locus_tag LOCUS_09210 1211244 1210432 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_09210 1212410 1211595 gene locus_tag LOCUS_09220 1212410 1211595 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965501.1 protein_id gnl|my_center|LOCUS_09220 1212662 1214383 gene locus_tag LOCUS_09230 1212662 1214383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 1214383 1215099 gene locus_tag LOCUS_09240 1214383 1215099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 1215197 1215481 gene locus_tag LOCUS_09250 1215197 1215481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 1215492 1215914 gene locus_tag LOCUS_09260 gene fliS 1215492 1215914 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050477.1 protein_id gnl|my_center|LOCUS_09260 1215947 1216285 gene locus_tag LOCUS_09270 1215947 1216285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 1216840 1216430 gene locus_tag LOCUS_09280 1216840 1216430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 1216922 1217368 gene locus_tag LOCUS_09290 1216922 1217368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 1217479 1218960 gene locus_tag LOCUS_09300 1217479 1218960 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_09300 1219111 1219668 gene locus_tag LOCUS_09310 1219111 1219668 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941072.1 protein_id gnl|my_center|LOCUS_09310 1219685 1220851 gene locus_tag LOCUS_09320 1219685 1220851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 1221064 1222314 gene locus_tag LOCUS_09330 1221064 1222314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 1224108 1222357 gene locus_tag LOCUS_09340 1224108 1222357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 1224311 1224649 gene locus_tag LOCUS_09350 1224311 1224649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1224699 1226690 gene locus_tag LOCUS_09360 1224699 1226690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 1227568 1226747 gene locus_tag LOCUS_09370 gene lgt 1227568 1226747 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704636.1 protein_id gnl|my_center|LOCUS_09370 1227677 1228777 gene locus_tag LOCUS_09380 gene gcvT 1227677 1228777 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393443.1 protein_id gnl|my_center|LOCUS_09380 1228844 1229227 gene locus_tag LOCUS_09390 gene gcvH 1228844 1229227 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195879.1 protein_id gnl|my_center|LOCUS_09390 1229356 1230543 gene locus_tag LOCUS_09400 1229356 1230543 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784707.1 protein_id gnl|my_center|LOCUS_09400 1230561 1233716 gene locus_tag LOCUS_09410 1230561 1233716 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040502.1 protein_id gnl|my_center|LOCUS_09410 1235352 1233826 gene locus_tag LOCUS_09420 1235352 1233826 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767327.1 protein_id gnl|my_center|LOCUS_09420 1236849 1235419 gene locus_tag LOCUS_09430 1236849 1235419 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121615.1 protein_id gnl|my_center|LOCUS_09430 1237844 1236870 gene locus_tag LOCUS_09440 1237844 1236870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 1238814 1237936 gene locus_tag LOCUS_09450 1238814 1237936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 1238982 1240508 gene locus_tag LOCUS_09460 1238982 1240508 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442661.1 protein_id gnl|my_center|LOCUS_09460 1242035 1240542 gene locus_tag LOCUS_09470 1242035 1240542 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114170.1 protein_id gnl|my_center|LOCUS_09470 1243128 1242067 gene locus_tag LOCUS_09480 1243128 1242067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 1244047 1243136 gene locus_tag LOCUS_09490 gene iolE 1244047 1243136 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098251.1 protein_id gnl|my_center|LOCUS_09490 1245941 1244073 gene locus_tag LOCUS_09500 gene iolD 1245941 1244073 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 protein_id gnl|my_center|LOCUS_09500 1246780 1245938 gene locus_tag LOCUS_09510 1246780 1245938 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900828.1 protein_id gnl|my_center|LOCUS_09510 1247369 1247016 gene locus_tag LOCUS_09520 1247369 1247016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 1247260 1247712 gene locus_tag LOCUS_09530 1247260 1247712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09530 1247902 1248945 gene locus_tag LOCUS_09540 1247902 1248945 CDS product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230820.1 protein_id gnl|my_center|LOCUS_09540 1249050 1250045 gene locus_tag LOCUS_09550 1249050 1250045 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227893.1 protein_id gnl|my_center|LOCUS_09550 1250186 1251769 gene locus_tag LOCUS_09560 1250186 1251769 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028557.1 protein_id gnl|my_center|LOCUS_09560 1251766 1252713 gene locus_tag LOCUS_09570 gene rbsC 1251766 1252713 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706157.1 protein_id gnl|my_center|LOCUS_09570 1252734 1253687 gene locus_tag LOCUS_09580 gene alsB 1252734 1253687 CDS product D-allose transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046187.1 protein_id gnl|my_center|LOCUS_09580 1253726 1254730 gene locus_tag LOCUS_09590 gene iolX 1253726 1254730 CDS product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244942.1 protein_id gnl|my_center|LOCUS_09590 1256384 1254783 gene locus_tag LOCUS_09600 1256384 1254783 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_09600 1259225 1256496 gene locus_tag LOCUS_09610 1259225 1256496 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122437.1 protein_id gnl|my_center|LOCUS_09610 1260844 1259225 gene locus_tag LOCUS_09620 1260844 1259225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 1262144 1260858 gene locus_tag LOCUS_09630 1262144 1260858 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124070.1 protein_id gnl|my_center|LOCUS_09630 1265256 1262257 gene locus_tag LOCUS_09640 1265256 1262257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 1265374 1266276 gene locus_tag LOCUS_09650 1265374 1266276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 1268452 1266308 gene locus_tag LOCUS_09660 1268452 1266308 CDS product DUF5722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061473288.1 protein_id gnl|my_center|LOCUS_09660 1271539 1268615 gene locus_tag LOCUS_09670 1271539 1268615 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275340.1 protein_id gnl|my_center|LOCUS_09670 1273049 1272432 gene locus_tag LOCUS_09680 1273049 1272432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 1273387 1273046 gene locus_tag LOCUS_09690 1273387 1273046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 1273850 1273392 gene locus_tag LOCUS_09700 1273850 1273392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 1274398 1274156 gene locus_tag LOCUS_09710 1274398 1274156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 1275270 1274395 gene locus_tag LOCUS_09720 1275270 1274395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 1275692 1275267 gene locus_tag LOCUS_09730 1275692 1275267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 1276177 1275689 gene locus_tag LOCUS_09740 1276177 1275689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 1276802 1276299 gene locus_tag LOCUS_09750 1276802 1276299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 1277125 1276814 gene locus_tag LOCUS_09760 1277125 1276814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227944.1 protein_id gnl|my_center|LOCUS_09760 1277679 1277122 gene locus_tag LOCUS_09770 1277679 1277122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1277879 1277676 gene locus_tag LOCUS_09780 1277879 1277676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 1278052 1277876 gene locus_tag LOCUS_09790 1278052 1277876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 1278216 1278049 gene locus_tag LOCUS_09800 1278216 1278049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 1278434 1278213 gene locus_tag LOCUS_09810 1278434 1278213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 1278799 1278431 gene locus_tag LOCUS_09820 1278799 1278431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 1279086 1278796 gene locus_tag LOCUS_09830 1279086 1278796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 1280248 1279100 gene locus_tag LOCUS_09840 1280248 1279100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 1282415 1280292 gene locus_tag LOCUS_09850 1282415 1280292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 1283261 1282425 gene locus_tag LOCUS_09860 1283261 1282425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 1283581 1283258 gene locus_tag LOCUS_09870 1283581 1283258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 1283626 1284105 gene locus_tag LOCUS_09880 1283626 1284105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 1284333 1284118 gene locus_tag LOCUS_09890 1284333 1284118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 1284535 1284326 gene locus_tag LOCUS_09900 1284535 1284326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 1284583 1285242 gene locus_tag LOCUS_09910 1284583 1285242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 1285290 1285523 gene locus_tag LOCUS_09920 1285290 1285523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 1285699 1285935 gene locus_tag LOCUS_09930 1285699 1285935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 1285948 1286388 gene locus_tag LOCUS_09940 1285948 1286388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 1286503 1286718 gene locus_tag LOCUS_09950 1286503 1286718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 1286715 1287137 gene locus_tag LOCUS_09960 1286715 1287137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 1287134 1287385 gene locus_tag LOCUS_09970 1287134 1287385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 1287621 1288172 gene locus_tag LOCUS_09980 1287621 1288172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 1288169 1290313 gene locus_tag LOCUS_09990 1288169 1290313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 1290316 1291848 gene locus_tag LOCUS_10000 1290316 1291848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 1292013 1293071 gene locus_tag LOCUS_10010 1292013 1293071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 1293139 1293648 gene locus_tag LOCUS_10020 1293139 1293648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 1293713 1294705 gene locus_tag LOCUS_10030 1293713 1294705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 1294778 1295236 gene locus_tag LOCUS_10040 1294778 1295236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 1295239 1295589 gene locus_tag LOCUS_10050 1295239 1295589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 1295586 1295780 gene locus_tag LOCUS_10060 1295586 1295780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 1295777 1297357 gene locus_tag LOCUS_10070 1295777 1297357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 1297367 1297849 gene locus_tag LOCUS_10080 1297367 1297849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 1297851 1298012 gene locus_tag LOCUS_10090 1297851 1298012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 1298009 1299151 gene locus_tag LOCUS_10100 1298009 1299151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 1299151 1299849 gene locus_tag LOCUS_10110 1299151 1299849 CDS product formyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087445.1 protein_id gnl|my_center|LOCUS_10110 1299846 1300646 gene locus_tag LOCUS_10120 1299846 1300646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 1300643 1301311 gene locus_tag LOCUS_10130 1300643 1301311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 1301308 1301850 gene locus_tag LOCUS_10140 1301308 1301850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 1301884 1302423 gene locus_tag LOCUS_10150 1301884 1302423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 1302449 1303282 gene locus_tag LOCUS_10160 1302449 1303282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 1303292 1304833 gene locus_tag LOCUS_10170 1303292 1304833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 1304851 1305345 gene locus_tag LOCUS_10180 1304851 1305345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 1305352 1305849 gene locus_tag LOCUS_10190 1305352 1305849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1306082 1308745 gene locus_tag LOCUS_10200 1306082 1308745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 1308745 1310547 gene locus_tag LOCUS_10210 1308745 1310547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 1310648 1311133 gene locus_tag LOCUS_10220 1310648 1311133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 1311130 1314486 gene locus_tag LOCUS_10230 1311130 1314486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 1314489 1314728 gene locus_tag LOCUS_10240 1314489 1314728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 1314909 1314820 gene locus_tag LOCUS_t00140 1314909 1314820 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1315339 1314986 gene locus_tag LOCUS_10250 1315339 1314986 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388255.1 protein_id gnl|my_center|LOCUS_10250 1316224 1315442 gene locus_tag LOCUS_10260 1316224 1315442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 1317835 1316333 gene locus_tag LOCUS_10270 1317835 1316333 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669321.1 protein_id gnl|my_center|LOCUS_10270 1319577 1317841 gene locus_tag LOCUS_10280 1319577 1317841 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841352.1 protein_id gnl|my_center|LOCUS_10280 1319662 1319958 gene locus_tag LOCUS_10290 1319662 1319958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 1320058 1320987 gene locus_tag LOCUS_10300 1320058 1320987 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332819.1 protein_id gnl|my_center|LOCUS_10300 1322279 1321173 gene locus_tag LOCUS_10310 1322279 1321173 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_10310 1323272 1322445 gene locus_tag LOCUS_10320 1323272 1322445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 1323367 1323972 gene locus_tag LOCUS_10330 1323367 1323972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 1323969 1324889 gene locus_tag LOCUS_10340 1323969 1324889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 1324974 1326494 gene locus_tag LOCUS_10350 gene xylB 1324974 1326494 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267678.1 protein_id gnl|my_center|LOCUS_10350 1330413 1326817 gene locus_tag LOCUS_10360 1330413 1326817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 1331837 1330686 gene locus_tag LOCUS_10370 1331837 1330686 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921852.1 protein_id gnl|my_center|LOCUS_10370 1333157 1331892 gene locus_tag LOCUS_10380 1333157 1331892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 1333500 1334663 gene locus_tag LOCUS_10390 1333500 1334663 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 protein_id gnl|my_center|LOCUS_10390 1334823 1336196 gene locus_tag LOCUS_10400 1334823 1336196 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229277.1 protein_id gnl|my_center|LOCUS_10400 1338537 1336351 gene locus_tag LOCUS_10410 1338537 1336351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 1338627 1339082 gene locus_tag LOCUS_10420 1338627 1339082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1339387 1340928 gene locus_tag LOCUS_10430 gene zwf 1339387 1340928 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_10430 1341152 1340850 gene locus_tag LOCUS_10440 1341152 1340850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 1341100 1342086 gene locus_tag LOCUS_10450 1341100 1342086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 1342147 1342671 gene locus_tag LOCUS_10460 1342147 1342671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 1342724 1344181 gene locus_tag LOCUS_10470 1342724 1344181 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048639.1 protein_id gnl|my_center|LOCUS_10470 1344187 1347111 gene locus_tag LOCUS_10480 1344187 1347111 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 protein_id gnl|my_center|LOCUS_10480 1348674 1347394 gene locus_tag LOCUS_10490 gene tyrS 1348674 1347394 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168626.1 protein_id gnl|my_center|LOCUS_10490 1348863 1349336 gene locus_tag LOCUS_10500 1348863 1349336 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224001.1 protein_id gnl|my_center|LOCUS_10500 1349420 1352107 gene locus_tag LOCUS_10510 gene acnA 1349420 1352107 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187807.1 protein_id gnl|my_center|LOCUS_10510 1352278 1352799 gene locus_tag LOCUS_10520 1352278 1352799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 1352866 1353066 gene locus_tag LOCUS_10530 1352866 1353066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1353038 1354261 gene locus_tag LOCUS_10540 gene trpB 1353038 1354261 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880421.1 protein_id gnl|my_center|LOCUS_10540 1354486 1355583 gene locus_tag LOCUS_10550 1354486 1355583 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_10550 1356044 1356826 gene locus_tag LOCUS_10560 1356044 1356826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1357119 1356916 gene locus_tag LOCUS_10570 1357119 1356916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 1357453 1359891 gene locus_tag LOCUS_10580 1357453 1359891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 1361687 1360422 gene locus_tag LOCUS_10590 1361687 1360422 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123104.1 protein_id gnl|my_center|LOCUS_10590 1361611 1361793 gene locus_tag LOCUS_10600 1361611 1361793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 1361931 1363463 gene locus_tag LOCUS_10610 1361931 1363463 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123371.1 protein_id gnl|my_center|LOCUS_10610 1366900 1363613 gene locus_tag LOCUS_10620 1366900 1363613 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922034.1 protein_id gnl|my_center|LOCUS_10620 1367738 1367067 gene locus_tag LOCUS_10630 1367738 1367067 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118407.1 protein_id gnl|my_center|LOCUS_10630 1368279 1367758 gene locus_tag LOCUS_10640 1368279 1367758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 1368842 1368318 gene locus_tag LOCUS_10650 1368842 1368318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 1370314 1369010 gene locus_tag LOCUS_10660 1370314 1369010 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_10660 1371500 1370433 gene locus_tag LOCUS_10670 1371500 1370433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 1372800 1371658 gene locus_tag LOCUS_10680 1372800 1371658 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_10680 1374381 1372948 gene locus_tag LOCUS_10690 1374381 1372948 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922220.1 protein_id gnl|my_center|LOCUS_10690 1375555 1374482 gene locus_tag LOCUS_10700 1375555 1374482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922219.1 protein_id gnl|my_center|LOCUS_10700 1377069 1375552 gene locus_tag LOCUS_10710 1377069 1375552 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119651.1 protein_id gnl|my_center|LOCUS_10710 1377424 1377182 gene locus_tag LOCUS_10720 1377424 1377182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 1378982 1377432 gene locus_tag LOCUS_10730 1378982 1377432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 1381323 1379047 gene locus_tag LOCUS_10740 1381323 1379047 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615857.1 protein_id gnl|my_center|LOCUS_10740 1383532 1381394 gene locus_tag LOCUS_10750 1383532 1381394 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656800.1 protein_id gnl|my_center|LOCUS_10750 1385076 1383709 gene locus_tag LOCUS_10760 1385076 1383709 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117743.1 protein_id gnl|my_center|LOCUS_10760 1386419 1385157 gene locus_tag LOCUS_10770 1386419 1385157 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921592.1 protein_id gnl|my_center|LOCUS_10770 1387846 1386455 gene locus_tag LOCUS_10780 1387846 1386455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 1389108 1387843 gene locus_tag LOCUS_10790 1389108 1387843 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616082.1 protein_id gnl|my_center|LOCUS_10790 1389278 1390507 gene locus_tag LOCUS_10800 1389278 1390507 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118167.1 protein_id gnl|my_center|LOCUS_10800 1390603 1391847 gene locus_tag LOCUS_10810 1390603 1391847 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_10810 1392413 1391820 gene locus_tag LOCUS_10820 1392413 1391820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 1393886 1392600 gene locus_tag LOCUS_10830 1393886 1392600 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494076.1 protein_id gnl|my_center|LOCUS_10830 1395160 1393883 gene locus_tag LOCUS_10840 1395160 1393883 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921592.1 protein_id gnl|my_center|LOCUS_10840 1395380 1396762 gene locus_tag LOCUS_10850 1395380 1396762 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120362.1 protein_id gnl|my_center|LOCUS_10850 1396794 1398071 gene locus_tag LOCUS_10860 1396794 1398071 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262540.1 protein_id gnl|my_center|LOCUS_10860 1399033 1398404 gene locus_tag LOCUS_10870 1399033 1398404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 1399215 1400123 gene locus_tag LOCUS_10880 1399215 1400123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 1400303 1402057 gene locus_tag LOCUS_10890 1400303 1402057 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104008.1 protein_id gnl|my_center|LOCUS_10890 1402143 1403618 gene locus_tag LOCUS_10900 1402143 1403618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 1404655 1403759 gene locus_tag LOCUS_10910 1404655 1403759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 1404859 1406034 gene locus_tag LOCUS_10920 1404859 1406034 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399531.1 protein_id gnl|my_center|LOCUS_10920 1407167 1406085 gene locus_tag LOCUS_10930 1407167 1406085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 1407296 1407580 gene locus_tag LOCUS_10940 1407296 1407580 CDS product DUF6172 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275192.1 protein_id gnl|my_center|LOCUS_10940 1408010 1407684 gene locus_tag LOCUS_10950 1408010 1407684 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185161.1 protein_id gnl|my_center|LOCUS_10950 1408145 1409227 gene locus_tag LOCUS_10960 1408145 1409227 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330337.1 protein_id gnl|my_center|LOCUS_10960 1410125 1409250 gene locus_tag LOCUS_10970 1410125 1409250 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921514.1 protein_id gnl|my_center|LOCUS_10970 1410351 1413887 gene locus_tag LOCUS_10980 1410351 1413887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 1414030 1415952 gene locus_tag LOCUS_10990 1414030 1415952 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_10990 1418102 1416048 gene locus_tag LOCUS_11000 1418102 1416048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 1421511 1418362 gene locus_tag LOCUS_11010 1421511 1418362 CDS product DUF5060 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922984.1 protein_id gnl|my_center|LOCUS_11010 1422936 1421518 gene locus_tag LOCUS_11020 1422936 1421518 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119546.1 protein_id gnl|my_center|LOCUS_11020 1423330 1422929 gene locus_tag LOCUS_11030 1423330 1422929 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119547.1 protein_id gnl|my_center|LOCUS_11030 1424444 1423347 gene locus_tag LOCUS_11040 1424444 1423347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1425601 1424513 gene locus_tag LOCUS_11050 1425601 1424513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 1427057 1425765 gene locus_tag LOCUS_11060 1427057 1425765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 1430058 1427071 gene locus_tag LOCUS_11070 1430058 1427071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 1433385 1430185 gene locus_tag LOCUS_11080 1433385 1430185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 1434469 1433408 gene locus_tag LOCUS_11090 1434469 1433408 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119543.1 protein_id gnl|my_center|LOCUS_11090 1435728 1434469 gene locus_tag LOCUS_11100 1435728 1434469 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615837.1 protein_id gnl|my_center|LOCUS_11100 1436420 1435755 gene locus_tag LOCUS_11110 1436420 1435755 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119544.1 protein_id gnl|my_center|LOCUS_11110 1437258 1436521 gene locus_tag LOCUS_11120 1437258 1436521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 1438334 1437255 gene locus_tag LOCUS_11130 1438334 1437255 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119542.1 protein_id gnl|my_center|LOCUS_11130 1438679 1438377 gene locus_tag LOCUS_11140 1438679 1438377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1439262 1438996 gene locus_tag LOCUS_11150 1439262 1438996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1439677 1439910 gene locus_tag LOCUS_11160 1439677 1439910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 1441946 1439931 gene locus_tag LOCUS_11170 1441946 1439931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 1443942 1441960 gene locus_tag LOCUS_11180 1443942 1441960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1446911 1444554 gene locus_tag LOCUS_11190 1446911 1444554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 1450419 1446964 gene locus_tag LOCUS_11200 1450419 1446964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 1452094 1450511 gene locus_tag LOCUS_11210 1452094 1450511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 1453527 1452100 gene locus_tag LOCUS_11220 1453527 1452100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 1456180 1453673 gene locus_tag LOCUS_11230 1456180 1453673 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922964.1 protein_id gnl|my_center|LOCUS_11230 1457532 1456216 gene locus_tag LOCUS_11240 1457532 1456216 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922300.1 protein_id gnl|my_center|LOCUS_11240 1458553 1457600 gene locus_tag LOCUS_11250 1458553 1457600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 1459113 1458550 gene locus_tag LOCUS_11260 1459113 1458550 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331069.1 protein_id gnl|my_center|LOCUS_11260 1459882 1459553 gene locus_tag LOCUS_11270 1459882 1459553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 1459906 1461090 gene locus_tag LOCUS_11280 1459906 1461090 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324978.1 protein_id gnl|my_center|LOCUS_11280 1461151 1461627 gene locus_tag LOCUS_11290 1461151 1461627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1461840 1461749 gene locus_tag LOCUS_t00150 1461840 1461749 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1462635 1461961 gene locus_tag LOCUS_11300 1462635 1461961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1462797 1463048 gene locus_tag LOCUS_11310 1462797 1463048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 1463053 1463943 gene locus_tag LOCUS_11320 1463053 1463943 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325468.1 protein_id gnl|my_center|LOCUS_11320 1463940 1464782 gene locus_tag LOCUS_11330 1463940 1464782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 1464772 1465548 gene locus_tag LOCUS_11340 1464772 1465548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 1465640 1466308 gene locus_tag LOCUS_11350 1465640 1466308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 1466298 1467197 gene locus_tag LOCUS_11360 1466298 1467197 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902772.1 protein_id gnl|my_center|LOCUS_11360 1467608 1467279 gene locus_tag LOCUS_11370 gene trxA 1467608 1467279 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280776.1 protein_id gnl|my_center|LOCUS_11370 1467760 1467614 gene locus_tag LOCUS_11380 1467760 1467614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 1468050 1467778 gene locus_tag LOCUS_11390 1468050 1467778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 1469030 1468047 gene locus_tag LOCUS_11400 1469030 1468047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 1470464 1469256 gene locus_tag LOCUS_11410 1470464 1469256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 1472559 1470478 gene locus_tag LOCUS_11420 1472559 1470478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1473904 1472630 gene locus_tag LOCUS_11430 1473904 1472630 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257936.1 protein_id gnl|my_center|LOCUS_11430 1474086 1475498 gene locus_tag LOCUS_11440 1474086 1475498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 1475544 1477583 gene locus_tag LOCUS_11450 gene uvrB 1475544 1477583 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_11450 1478325 1477741 gene locus_tag LOCUS_11460 gene hpt 1478325 1477741 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257905.1 protein_id gnl|my_center|LOCUS_11460 1478450 1479523 gene locus_tag LOCUS_11470 1478450 1479523 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257553.1 protein_id gnl|my_center|LOCUS_11470 1479520 1481136 gene locus_tag LOCUS_11480 1479520 1481136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 1481616 1481158 gene locus_tag LOCUS_11490 1481616 1481158 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071234.1 protein_id gnl|my_center|LOCUS_11490 1482305 1481640 gene locus_tag LOCUS_11500 gene rpe 1482305 1481640 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992061.1 protein_id gnl|my_center|LOCUS_11500 1482901 1482386 gene locus_tag LOCUS_11510 1482901 1482386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 1483995 1482937 gene locus_tag LOCUS_11520 1483995 1482937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 1484999 1484007 gene locus_tag LOCUS_11530 1484999 1484007 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_11530 1486148 1485090 gene locus_tag LOCUS_11540 gene plsX 1486148 1485090 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_11540 1486358 1486179 gene locus_tag LOCUS_11550 gene rpmF 1486358 1486179 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008834724.1 protein_id gnl|my_center|LOCUS_11550 1487483 1486473 gene locus_tag LOCUS_11560 1487483 1486473 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116515.1 protein_id gnl|my_center|LOCUS_11560 1487888 1487628 gene locus_tag LOCUS_11570 1487888 1487628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1487823 1488668 gene locus_tag LOCUS_11580 1487823 1488668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1488665 1490005 gene locus_tag LOCUS_11590 gene glmM 1488665 1490005 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222643.1 protein_id gnl|my_center|LOCUS_11590 1490073 1491470 gene locus_tag LOCUS_11600 1490073 1491470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 1491695 1492774 gene locus_tag LOCUS_11610 1491695 1492774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 1493627 1492758 gene locus_tag LOCUS_11620 1493627 1492758 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196257.1 protein_id gnl|my_center|LOCUS_11620 1495332 1493638 gene locus_tag LOCUS_11630 1495332 1493638 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819869.1 protein_id gnl|my_center|LOCUS_11630 1495446 1496234 gene locus_tag LOCUS_11640 1495446 1496234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 1496251 1497483 gene locus_tag LOCUS_11650 1496251 1497483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 1498155 1497490 gene locus_tag LOCUS_11660 gene mntR 1498155 1497490 CDS product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728504.1 protein_id gnl|my_center|LOCUS_11660 1498240 1499154 gene locus_tag LOCUS_11670 gene yfeA 1498240 1499154 CDS product iron/manganese ABC transporter substrate-binding protein YfeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170110.1 protein_id gnl|my_center|LOCUS_11670 1499172 1500095 gene locus_tag LOCUS_11680 1499172 1500095 CDS product manganese/iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970361.1 protein_id gnl|my_center|LOCUS_11680 1500095 1500961 gene locus_tag LOCUS_11690 gene yfeC 1500095 1500961 CDS product iron/manganese ABC transporter permease subunit YfeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211844.1 protein_id gnl|my_center|LOCUS_11690 1500958 1501833 gene locus_tag LOCUS_11700 1500958 1501833 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058215.1 protein_id gnl|my_center|LOCUS_11700 1502023 1504635 gene locus_tag LOCUS_11710 1502023 1504635 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615806.1 protein_id gnl|my_center|LOCUS_11710 1504632 1505507 gene locus_tag LOCUS_11720 1504632 1505507 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260625.1 protein_id gnl|my_center|LOCUS_11720 1505587 1506555 gene locus_tag LOCUS_11730 1505587 1506555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 1506579 1507646 gene locus_tag LOCUS_11740 1506579 1507646 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327063.1 protein_id gnl|my_center|LOCUS_11740 1507716 1508672 gene locus_tag LOCUS_11750 1507716 1508672 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922127.1 protein_id gnl|my_center|LOCUS_11750 1508669 1510789 gene locus_tag LOCUS_11760 1508669 1510789 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121743.1 protein_id gnl|my_center|LOCUS_11760 1510786 1514754 gene locus_tag LOCUS_11770 1510786 1514754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121744.1 protein_id gnl|my_center|LOCUS_11770 1514807 1517221 gene locus_tag LOCUS_11780 1514807 1517221 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121745.1 protein_id gnl|my_center|LOCUS_11780 1517218 1518198 gene locus_tag LOCUS_11790 1517218 1518198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061227.1 protein_id gnl|my_center|LOCUS_11790 1518289 1519212 gene locus_tag LOCUS_11800 1518289 1519212 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920127.1 protein_id gnl|my_center|LOCUS_11800 1519311 1521110 gene locus_tag LOCUS_11810 1519311 1521110 CDS product adenine deaminase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085949.1 protein_id gnl|my_center|LOCUS_11810 1521316 1523787 gene locus_tag LOCUS_11820 1521316 1523787 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206762.1 protein_id gnl|my_center|LOCUS_11820 1523972 1525324 gene locus_tag LOCUS_11830 1523972 1525324 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790376.1 protein_id gnl|my_center|LOCUS_11830 1526989 1525652 gene locus_tag LOCUS_11840 1526989 1525652 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392746.1 protein_id gnl|my_center|LOCUS_11840 1527075 1527959 gene locus_tag LOCUS_11850 1527075 1527959 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929890.1 protein_id gnl|my_center|LOCUS_11850 1528146 1528871 gene locus_tag LOCUS_11860 1528146 1528871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918209.1 protein_id gnl|my_center|LOCUS_11860 1528921 1531167 gene locus_tag LOCUS_11870 gene glgB 1528921 1531167 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_11870 1531854 1531186 gene locus_tag LOCUS_11880 1531854 1531186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 1531988 1532656 gene locus_tag LOCUS_11890 1531988 1532656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 1533156 1532665 gene locus_tag LOCUS_11900 1533156 1532665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 1533263 1534162 gene locus_tag LOCUS_11910 1533263 1534162 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681790.1 protein_id gnl|my_center|LOCUS_11910 1534211 1535068 gene locus_tag LOCUS_11920 1534211 1535068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 1535132 1535833 gene locus_tag LOCUS_11930 1535132 1535833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 1536419 1535916 gene locus_tag LOCUS_11940 1536419 1535916 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941344.1 protein_id gnl|my_center|LOCUS_11940 1536558 1538741 gene locus_tag LOCUS_11950 1536558 1538741 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940968.1 protein_id gnl|my_center|LOCUS_11950 1538800 1539672 gene locus_tag LOCUS_11960 1538800 1539672 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869527.1 protein_id gnl|my_center|LOCUS_11960 1539794 1541065 gene locus_tag LOCUS_11970 1539794 1541065 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922308.1 protein_id gnl|my_center|LOCUS_11970 1541612 1541091 gene locus_tag LOCUS_11980 1541612 1541091 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868668.1 protein_id gnl|my_center|LOCUS_11980 1543114 1541795 gene locus_tag LOCUS_11990 1543114 1541795 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102481.1 protein_id gnl|my_center|LOCUS_11990 1544277 1543111 gene locus_tag LOCUS_12000 1544277 1543111 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389160.1 protein_id gnl|my_center|LOCUS_12000 1545102 1544281 gene locus_tag LOCUS_12010 1545102 1544281 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941804.1 protein_id gnl|my_center|LOCUS_12010 1545335 1545721 gene locus_tag LOCUS_12020 gene flgB 1545335 1545721 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392289.1 protein_id gnl|my_center|LOCUS_12020 1545746 1546162 gene locus_tag LOCUS_12030 gene flgC 1545746 1546162 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 protein_id gnl|my_center|LOCUS_12030 1546178 1546516 gene locus_tag LOCUS_12040 gene fliE 1546178 1546516 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941077.1 protein_id gnl|my_center|LOCUS_12040 1546602 1548239 gene locus_tag LOCUS_12050 1546602 1548239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 1548247 1549266 gene locus_tag LOCUS_12060 gene fliG 1548247 1549266 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082903.1 protein_id gnl|my_center|LOCUS_12060 1549274 1549855 gene locus_tag LOCUS_12070 1549274 1549855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 1549852 1551174 gene locus_tag LOCUS_12080 gene fliI 1549852 1551174 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392295.1 protein_id gnl|my_center|LOCUS_12080 1551171 1551632 gene locus_tag LOCUS_12090 1551171 1551632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 1551629 1552234 gene locus_tag LOCUS_12100 1551629 1552234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 1552296 1554416 gene locus_tag LOCUS_12110 1552296 1554416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 1554425 1554898 gene locus_tag LOCUS_12120 1554425 1554898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 1554919 1555794 gene locus_tag LOCUS_12130 gene flgG 1554919 1555794 CDS product flagellar basal body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231968.1 protein_id gnl|my_center|LOCUS_12130 1555876 1556496 gene locus_tag LOCUS_12140 1555876 1556496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 1556539 1557591 gene locus_tag LOCUS_12150 gene fliM 1556539 1557591 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763575.1 protein_id gnl|my_center|LOCUS_12150 1557560 1557823 gene locus_tag LOCUS_12160 1557560 1557823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12160 1557820 1558218 gene locus_tag LOCUS_12170 1557820 1558218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 1558215 1559066 gene locus_tag LOCUS_12180 gene fliP 1558215 1559066 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_12180 1559089 1559358 gene locus_tag LOCUS_12190 gene fliQ 1559089 1559358 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083053.1 protein_id gnl|my_center|LOCUS_12190 1559390 1560142 gene locus_tag LOCUS_12200 gene fliR 1559390 1560142 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405298.1 protein_id gnl|my_center|LOCUS_12200 1560379 1561482 gene locus_tag LOCUS_12210 1560379 1561482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 1561486 1563684 gene locus_tag LOCUS_12220 gene flhA 1561486 1563684 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943681.1 protein_id gnl|my_center|LOCUS_12220 1563693 1564778 gene locus_tag LOCUS_12230 1563693 1564778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 1564785 1565012 gene locus_tag LOCUS_12240 1564785 1565012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 1565031 1565825 gene locus_tag LOCUS_12250 1565031 1565825 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873529.1 protein_id gnl|my_center|LOCUS_12250 1565946 1566809 gene locus_tag LOCUS_12260 gene motA 1565946 1566809 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546161.1 protein_id gnl|my_center|LOCUS_12260 1566913 1567743 gene locus_tag LOCUS_12270 gene motB 1566913 1567743 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817154.1 protein_id gnl|my_center|LOCUS_12270 1567740 1567985 gene locus_tag LOCUS_12280 1567740 1567985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 1568277 1569026 gene locus_tag LOCUS_12290 gene flgG 1568277 1569026 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880505.1 protein_id gnl|my_center|LOCUS_12290 1569157 1569939 gene locus_tag LOCUS_12300 gene flgG 1569157 1569939 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943676.1 protein_id gnl|my_center|LOCUS_12300 1569939 1570667 gene locus_tag LOCUS_12310 1569939 1570667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 1570639 1571313 gene locus_tag LOCUS_12320 1570639 1571313 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943674.1 protein_id gnl|my_center|LOCUS_12320 1571371 1572489 gene locus_tag LOCUS_12330 1571371 1572489 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_12330 1572489 1572875 gene locus_tag LOCUS_12340 1572489 1572875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 1572872 1573369 gene locus_tag LOCUS_12350 1572872 1573369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 1573409 1574821 gene locus_tag LOCUS_12360 gene flgK 1573409 1574821 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943669.1 protein_id gnl|my_center|LOCUS_12360 1574834 1575730 gene locus_tag LOCUS_12370 gene flgL 1574834 1575730 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943668.1 protein_id gnl|my_center|LOCUS_12370 1575781 1576248 gene locus_tag LOCUS_12380 gene fliW 1575781 1576248 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156273801.1 protein_id gnl|my_center|LOCUS_12380 1576259 1576513 gene locus_tag LOCUS_12390 gene csrA 1576259 1576513 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392271.1 protein_id gnl|my_center|LOCUS_12390 1576579 1577457 gene locus_tag LOCUS_12400 1576579 1577457 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965501.1 protein_id gnl|my_center|LOCUS_12400 1577641 1578864 gene locus_tag LOCUS_12410 1577641 1578864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1579027 1580286 gene locus_tag LOCUS_12420 1579027 1580286 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_12420 1584399 1580314 gene locus_tag LOCUS_12430 1584399 1580314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 1587113 1584414 gene locus_tag LOCUS_12440 gene alaS 1587113 1584414 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931860.1 protein_id gnl|my_center|LOCUS_12440 1587257 1590721 gene locus_tag LOCUS_12450 1587257 1590721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 1590718 1591164 gene locus_tag LOCUS_12460 1590718 1591164 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061215.1 protein_id gnl|my_center|LOCUS_12460 1591161 1594232 gene locus_tag LOCUS_12470 1591161 1594232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 1595513 1594314 gene locus_tag LOCUS_12480 gene leuB 1595513 1594314 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132138.1 protein_id gnl|my_center|LOCUS_12480 1595493 1596137 gene locus_tag LOCUS_12490 1595493 1596137 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065967.1 protein_id gnl|my_center|LOCUS_12490 1596151 1597284 gene locus_tag LOCUS_12500 gene ribD 1596151 1597284 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_12500 1597349 1599130 gene locus_tag LOCUS_12510 1597349 1599130 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122444.1 protein_id gnl|my_center|LOCUS_12510 1600825 1599584 gene locus_tag LOCUS_12520 1600825 1599584 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082803.1 protein_id gnl|my_center|LOCUS_12520 1601201 1600830 gene locus_tag LOCUS_12530 1601201 1600830 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089353.1 protein_id gnl|my_center|LOCUS_12530 1602424 1601621 gene locus_tag LOCUS_12540 1602424 1601621 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257265.1 protein_id gnl|my_center|LOCUS_12540 1603533 1602541 gene locus_tag LOCUS_12550 gene galE 1603533 1602541 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615363.1 protein_id gnl|my_center|LOCUS_12550 1603593 1604840 gene locus_tag LOCUS_12560 1603593 1604840 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325817.1 protein_id gnl|my_center|LOCUS_12560 1604855 1605118 gene locus_tag LOCUS_12570 1604855 1605118 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921431.1 protein_id gnl|my_center|LOCUS_12570 1605396 1606856 gene locus_tag LOCUS_12580 1605396 1606856 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118443.1 protein_id gnl|my_center|LOCUS_12580 1606882 1607745 gene locus_tag LOCUS_12590 1606882 1607745 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921962.1 protein_id gnl|my_center|LOCUS_12590 1607937 1609397 gene locus_tag LOCUS_12600 1607937 1609397 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921402.1 protein_id gnl|my_center|LOCUS_12600 1609394 1609849 gene locus_tag LOCUS_12610 gene fabZ 1609394 1609849 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212142.1 protein_id gnl|my_center|LOCUS_12610 1609873 1610685 gene locus_tag LOCUS_12620 1609873 1610685 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121724.1 protein_id gnl|my_center|LOCUS_12620 1610698 1611723 gene locus_tag LOCUS_12630 1610698 1611723 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922567.1 protein_id gnl|my_center|LOCUS_12630 1611717 1612619 gene locus_tag LOCUS_12640 1611717 1612619 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259370.1 protein_id gnl|my_center|LOCUS_12640 1614353 1612731 gene locus_tag LOCUS_12650 gene malQ 1614353 1612731 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056555.1 protein_id gnl|my_center|LOCUS_12650 1615943 1614672 gene locus_tag LOCUS_12660 1615943 1614672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 1617775 1615976 gene locus_tag LOCUS_12670 gene lepA 1617775 1615976 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816487.1 protein_id gnl|my_center|LOCUS_12670 1618695 1617781 gene locus_tag LOCUS_12680 gene fabD 1618695 1617781 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793967.1 protein_id gnl|my_center|LOCUS_12680 1619752 1618742 gene locus_tag LOCUS_12690 1619752 1618742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 1620866 1619763 gene locus_tag LOCUS_12700 1620866 1619763 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880449.1 protein_id gnl|my_center|LOCUS_12700 1620935 1621819 gene locus_tag LOCUS_12710 gene dapA 1620935 1621819 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940835.1 protein_id gnl|my_center|LOCUS_12710 1621828 1622559 gene locus_tag LOCUS_12720 gene dapB 1621828 1622559 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940836.1 protein_id gnl|my_center|LOCUS_12720 1622559 1623161 gene locus_tag LOCUS_12730 gene ruvA 1622559 1623161 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086122.1 protein_id gnl|my_center|LOCUS_12730 1623944 1623213 gene locus_tag LOCUS_12740 1623944 1623213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 1624543 1623941 gene locus_tag LOCUS_12750 gene rpoE 1624543 1623941 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_12750 1624706 1624780 gene locus_tag LOCUS_t00160 1624706 1624780 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1624801 1625448 gene locus_tag LOCUS_12760 1624801 1625448 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_12760 1625532 1626116 gene locus_tag LOCUS_12770 gene pal 1625532 1626116 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932322.1 protein_id gnl|my_center|LOCUS_12770 1627585 1626212 gene locus_tag LOCUS_12780 1627585 1626212 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227990.1 protein_id gnl|my_center|LOCUS_12780 1629262 1627703 gene locus_tag LOCUS_12790 gene purH 1629262 1627703 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909162.1 protein_id gnl|my_center|LOCUS_12790 1629368 1629751 gene locus_tag LOCUS_12800 gene apaG 1629368 1629751 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186878.1 protein_id gnl|my_center|LOCUS_12800 1629832 1631190 gene locus_tag LOCUS_12810 1629832 1631190 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404676.1 protein_id gnl|my_center|LOCUS_12810 1632189 1631392 gene locus_tag LOCUS_12820 1632189 1631392 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037421.1 protein_id gnl|my_center|LOCUS_12820 1632772 1632218 gene locus_tag LOCUS_12830 1632772 1632218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 1632922 1633965 gene locus_tag LOCUS_12840 1632922 1633965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 1634250 1635329 gene locus_tag LOCUS_12850 1634250 1635329 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259286.1 protein_id gnl|my_center|LOCUS_12850 1636274 1635342 gene locus_tag LOCUS_12860 1636274 1635342 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791099.1 protein_id gnl|my_center|LOCUS_12860 1637448 1636291 gene locus_tag LOCUS_12870 1637448 1636291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 1640575 1637486 gene locus_tag LOCUS_12880 1640575 1637486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 1641878 1640706 gene locus_tag LOCUS_12890 gene dinB 1641878 1640706 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_12890 1642352 1643083 gene locus_tag LOCUS_12900 1642352 1643083 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364547.1 protein_id gnl|my_center|LOCUS_12900 1644176 1643250 gene locus_tag LOCUS_12910 1644176 1643250 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385340.1 protein_id gnl|my_center|LOCUS_12910 1645106 1644180 gene locus_tag LOCUS_12920 1645106 1644180 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053070.1 protein_id gnl|my_center|LOCUS_12920 1645312 1646811 gene locus_tag LOCUS_12930 1645312 1646811 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803973.1 protein_id gnl|my_center|LOCUS_12930 1649877 1646896 gene locus_tag LOCUS_12940 gene uvrA 1649877 1646896 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014319.1 protein_id gnl|my_center|LOCUS_12940 1650081 1652051 gene locus_tag LOCUS_12950 1650081 1652051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 1652102 1653466 gene locus_tag LOCUS_12960 1652102 1653466 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072546.1 protein_id gnl|my_center|LOCUS_12960 1653606 1654583 gene locus_tag LOCUS_12970 1653606 1654583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1654594 1656936 gene locus_tag LOCUS_12980 1654594 1656936 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 protein_id gnl|my_center|LOCUS_12980 1658454 1657033 gene locus_tag LOCUS_12990 1658454 1657033 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384821.1 protein_id gnl|my_center|LOCUS_12990 1658662 1660245 gene locus_tag LOCUS_13000 1658662 1660245 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941965.1 protein_id gnl|my_center|LOCUS_13000 1660390 1661136 gene locus_tag LOCUS_13010 1660390 1661136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 1661141 1661305 gene locus_tag LOCUS_13020 1661141 1661305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 1661527 1662240 gene locus_tag LOCUS_13030 gene rsmI 1661527 1662240 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948680.1 protein_id gnl|my_center|LOCUS_13030 1662278 1663225 gene locus_tag LOCUS_13040 1662278 1663225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 1664522 1663497 gene locus_tag LOCUS_13050 1664522 1663497 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090071.1 protein_id gnl|my_center|LOCUS_13050 1665513 1664533 gene locus_tag LOCUS_13060 1665513 1664533 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270038.1 protein_id gnl|my_center|LOCUS_13060 1666735 1665611 gene locus_tag LOCUS_13070 1666735 1665611 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 protein_id gnl|my_center|LOCUS_13070 1668100 1666898 gene locus_tag LOCUS_13080 gene lpxK 1668100 1666898 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_13080 1668172 1669257 gene locus_tag LOCUS_13090 1668172 1669257 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943872.1 protein_id gnl|my_center|LOCUS_13090 1669596 1670726 gene locus_tag LOCUS_13100 1669596 1670726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 1670842 1673640 gene locus_tag LOCUS_13110 1670842 1673640 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525850.1 protein_id gnl|my_center|LOCUS_13110 1673738 1674877 gene locus_tag LOCUS_13120 1673738 1674877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1675092 1676042 gene locus_tag LOCUS_13130 gene fba 1675092 1676042 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582459.1 protein_id gnl|my_center|LOCUS_13130 1676720 1676268 gene locus_tag LOCUS_13140 1676720 1676268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 1676622 1677167 gene locus_tag LOCUS_13150 1676622 1677167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 1678151 1677318 gene locus_tag LOCUS_13160 gene menB 1678151 1677318 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058289.1 protein_id gnl|my_center|LOCUS_13160 1678294 1680180 gene locus_tag LOCUS_13170 1678294 1680180 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927144.1 protein_id gnl|my_center|LOCUS_13170 1682191 1680458 gene locus_tag LOCUS_13180 gene menD 1682191 1680458 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055985.1 protein_id gnl|my_center|LOCUS_13180 1683631 1682204 gene locus_tag LOCUS_13190 1683631 1682204 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_13190 1685216 1683663 gene locus_tag LOCUS_13200 gene metG 1685216 1683663 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545288.1 protein_id gnl|my_center|LOCUS_13200 1685355 1686407 gene locus_tag LOCUS_13210 1685355 1686407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 1686404 1687063 gene locus_tag LOCUS_13220 1686404 1687063 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_13220 1687180 1688319 gene locus_tag LOCUS_13230 1687180 1688319 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720964.1 protein_id gnl|my_center|LOCUS_13230 1688319 1688675 gene locus_tag LOCUS_13240 1688319 1688675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 1691808 1688713 gene locus_tag LOCUS_13250 1691808 1688713 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404755.1 protein_id gnl|my_center|LOCUS_13250 1691959 1694682 gene locus_tag LOCUS_13260 1691959 1694682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 1694679 1697237 gene locus_tag LOCUS_13270 1694679 1697237 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146858.1 protein_id gnl|my_center|LOCUS_13270 1697269 1697955 gene locus_tag LOCUS_13280 gene pdeM 1697269 1697955 CDS product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919907.1 protein_id gnl|my_center|LOCUS_13280 1697952 1698758 gene locus_tag LOCUS_13290 1697952 1698758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 1698736 1699620 gene locus_tag LOCUS_13300 1698736 1699620 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226116.1 protein_id gnl|my_center|LOCUS_13300 1700134 1699529 gene locus_tag LOCUS_13310 1700134 1699529 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207579.1 protein_id gnl|my_center|LOCUS_13310 1700162 1701583 gene locus_tag LOCUS_13320 1700162 1701583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 1701580 1702500 gene locus_tag LOCUS_13330 gene pfkB 1701580 1702500 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226343.1 protein_id gnl|my_center|LOCUS_13330 1702548 1702862 gene locus_tag LOCUS_13340 gene rplU 1702548 1702862 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083252.1 protein_id gnl|my_center|LOCUS_13340 1702876 1703121 gene locus_tag LOCUS_13350 gene rpmA 1702876 1703121 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194025.1 protein_id gnl|my_center|LOCUS_13350 1703237 1703590 gene locus_tag LOCUS_13360 1703237 1703590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 1703750 1704421 gene locus_tag LOCUS_13370 1703750 1704421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 1705517 1704432 gene locus_tag LOCUS_13380 gene pheA 1705517 1704432 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_13380 1706419 1705514 gene locus_tag LOCUS_13390 1706419 1705514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 1706556 1708172 gene locus_tag LOCUS_13400 1706556 1708172 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144112.1 protein_id gnl|my_center|LOCUS_13400 1708305 1708664 gene locus_tag LOCUS_13410 1708305 1708664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 1708661 1709965 gene locus_tag LOCUS_13420 1708661 1709965 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_13420 1710234 1711934 gene locus_tag LOCUS_13430 gene ilvD 1710234 1711934 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502719.1 protein_id gnl|my_center|LOCUS_13430 1712777 1712148 gene locus_tag LOCUS_13440 gene rdgB 1712777 1712148 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921833.1 protein_id gnl|my_center|LOCUS_13440 1713585 1712806 gene locus_tag LOCUS_13450 1713585 1712806 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327171.1 protein_id gnl|my_center|LOCUS_13450 1715212 1713629 gene locus_tag LOCUS_13460 1715212 1713629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 1715271 1716053 gene locus_tag LOCUS_13470 1715271 1716053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 1716208 1716133 gene locus_tag LOCUS_t00170 1716208 1716133 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1717223 1716267 gene locus_tag LOCUS_13480 1717223 1716267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 1717671 1717240 gene locus_tag LOCUS_13490 gene tolR 1717671 1717240 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390003.1 protein_id gnl|my_center|LOCUS_13490 1718453 1717680 gene locus_tag LOCUS_13500 gene tolQ 1718453 1717680 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940358.1 protein_id gnl|my_center|LOCUS_13500 1718546 1719655 gene locus_tag LOCUS_13510 1718546 1719655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 1719674 1720321 gene locus_tag LOCUS_13520 gene tmk 1719674 1720321 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942869.1 protein_id gnl|my_center|LOCUS_13520 1720368 1721336 gene locus_tag LOCUS_13530 1720368 1721336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 1722418 1721762 gene locus_tag LOCUS_13540 1722418 1721762 CDS product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839853.1 protein_id gnl|my_center|LOCUS_13540 1724223 1722421 gene locus_tag LOCUS_13550 1724223 1722421 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_13550 1725168 1724320 gene locus_tag LOCUS_13560 1725168 1724320 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 protein_id gnl|my_center|LOCUS_13560 1725183 1727741 gene locus_tag LOCUS_13570 gene mutS 1725183 1727741 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121304.1 protein_id gnl|my_center|LOCUS_13570 1728273 1727854 gene locus_tag LOCUS_13580 1728273 1727854 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417916.1 protein_id gnl|my_center|LOCUS_13580 1728616 1728275 gene locus_tag LOCUS_13590 1728616 1728275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1729684 1728635 gene locus_tag LOCUS_13600 gene aroF 1729684 1728635 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545770.1 protein_id gnl|my_center|LOCUS_13600 1730489 1729728 gene locus_tag LOCUS_13610 1730489 1729728 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073014.1 protein_id gnl|my_center|LOCUS_13610 1731633 1730509 gene locus_tag LOCUS_13620 1731633 1730509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 1732240 1731668 gene locus_tag LOCUS_13630 1732240 1731668 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392072.1 protein_id gnl|my_center|LOCUS_13630 1733579 1732269 gene locus_tag LOCUS_13640 1733579 1732269 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926801.1 protein_id gnl|my_center|LOCUS_13640 1733687 1735354 gene locus_tag LOCUS_13650 1733687 1735354 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142581.1 protein_id gnl|my_center|LOCUS_13650 1735395 1735787 gene locus_tag LOCUS_13660 1735395 1735787 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922104.1 protein_id gnl|my_center|LOCUS_13660 1735839 1737122 gene locus_tag LOCUS_13670 gene hemL 1735839 1737122 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527562.1 protein_id gnl|my_center|LOCUS_13670 1737344 1739131 gene locus_tag LOCUS_13680 1737344 1739131 CDS product SpoIVB peptidase S55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869562.1 protein_id gnl|my_center|LOCUS_13680 1739355 1741628 gene locus_tag LOCUS_13690 1739355 1741628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 1741700 1742737 gene locus_tag LOCUS_13700 1741700 1742737 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583128.1 protein_id gnl|my_center|LOCUS_13700 1743824 1742853 gene locus_tag LOCUS_13710 gene xerC 1743824 1742853 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_13710 1744527 1743847 gene locus_tag LOCUS_13720 1744527 1743847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 1744619 1745416 gene locus_tag LOCUS_13730 gene trpC 1744619 1745416 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919765.1 protein_id gnl|my_center|LOCUS_13730 1745464 1745886 gene locus_tag LOCUS_13740 1745464 1745886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 1745890 1746738 gene locus_tag LOCUS_13750 gene rsmA 1745890 1746738 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975667.1 protein_id gnl|my_center|LOCUS_13750 1746777 1747454 gene locus_tag LOCUS_13760 1746777 1747454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 1747451 1748170 gene locus_tag LOCUS_13770 1747451 1748170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 1748167 1748706 gene locus_tag LOCUS_13780 1748167 1748706 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193331.1 protein_id gnl|my_center|LOCUS_13780 1748997 1752068 gene locus_tag LOCUS_13790 1748997 1752068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 1752245 1755676 gene locus_tag LOCUS_13800 1752245 1755676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 1758733 1755998 gene locus_tag LOCUS_13810 1758733 1755998 CDS product DUF6250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764390.1 protein_id gnl|my_center|LOCUS_13810 1758971 1762435 gene locus_tag LOCUS_13820 1758971 1762435 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943065.1 protein_id gnl|my_center|LOCUS_13820 1764618 1762804 gene locus_tag LOCUS_13830 1764618 1762804 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921615.1 protein_id gnl|my_center|LOCUS_13830 1766084 1764615 gene locus_tag LOCUS_13840 1766084 1764615 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922285.1 protein_id gnl|my_center|LOCUS_13840 1768699 1766156 gene locus_tag LOCUS_13850 1768699 1766156 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615954.1 protein_id gnl|my_center|LOCUS_13850 1769838 1768837 gene locus_tag LOCUS_13860 1769838 1768837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 1771247 1769898 gene locus_tag LOCUS_13870 1771247 1769898 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303078.1 protein_id gnl|my_center|LOCUS_13870 1771350 1772294 gene locus_tag LOCUS_13880 1771350 1772294 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122544.1 protein_id gnl|my_center|LOCUS_13880 1773856 1772417 gene locus_tag LOCUS_13890 1773856 1772417 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326676.1 protein_id gnl|my_center|LOCUS_13890 1777032 1773874 gene locus_tag LOCUS_13900 1777032 1773874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 1777084 1777848 gene locus_tag LOCUS_13910 1777084 1777848 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118984.1 protein_id gnl|my_center|LOCUS_13910 1778263 1777865 gene locus_tag LOCUS_13920 1778263 1777865 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792700.1 protein_id gnl|my_center|LOCUS_13920 1779827 1778256 gene locus_tag LOCUS_13930 1779827 1778256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 1780296 1779886 gene locus_tag LOCUS_13940 1780296 1779886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 1781549 1780332 gene locus_tag LOCUS_13950 1781549 1780332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 1782515 1781754 gene locus_tag LOCUS_13960 1782515 1781754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 1784464 1782512 gene locus_tag LOCUS_13970 1784464 1782512 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927141.1 protein_id gnl|my_center|LOCUS_13970 1784907 1784482 gene locus_tag LOCUS_13980 1784907 1784482 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038533.1 protein_id gnl|my_center|LOCUS_13980 1786992 1784974 gene locus_tag LOCUS_13990 1786992 1784974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1790630 1787019 gene locus_tag LOCUS_14000 1790630 1787019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 1791241 1790633 gene locus_tag LOCUS_14010 1791241 1790633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 1793189 1791243 gene locus_tag LOCUS_14020 1793189 1791243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 1793344 1794669 gene locus_tag LOCUS_14030 1793344 1794669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 1794687 1796939 gene locus_tag LOCUS_14040 1794687 1796939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 1798313 1797009 gene locus_tag LOCUS_14050 1798313 1797009 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_14050 1798908 1798333 gene locus_tag LOCUS_14060 1798908 1798333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 1799061 1802033 gene locus_tag LOCUS_14070 1799061 1802033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 1802252 1803535 gene locus_tag LOCUS_14080 1802252 1803535 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921673.1 protein_id gnl|my_center|LOCUS_14080 1803765 1805849 gene locus_tag LOCUS_14090 1803765 1805849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 1805870 1806490 gene locus_tag LOCUS_14100 1805870 1806490 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_14100 1806766 1809795 gene locus_tag LOCUS_14110 1806766 1809795 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072483.1 protein_id gnl|my_center|LOCUS_14110 1812098 1810167 gene locus_tag LOCUS_14120 1812098 1810167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 1812318 1812728 gene locus_tag LOCUS_14130 1812318 1812728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 1812778 1813464 gene locus_tag LOCUS_14140 1812778 1813464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 >Feature sequence02 1751 192 gene locus_tag LOCUS_14150 1751 192 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958458.1 protein_id gnl|my_center|LOCUS_14150 2439 1768 gene locus_tag LOCUS_14160 2439 1768 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794222.1 protein_id gnl|my_center|LOCUS_14160 2791 2579 gene locus_tag LOCUS_14170 2791 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 3384 4481 gene locus_tag LOCUS_14180 3384 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 6082 4619 gene locus_tag LOCUS_14190 6082 4619 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324175.1 protein_id gnl|my_center|LOCUS_14190 9327 6475 gene locus_tag LOCUS_14200 9327 6475 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205537.1 protein_id gnl|my_center|LOCUS_14200 11357 9468 gene locus_tag LOCUS_14210 11357 9468 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539133.1 protein_id gnl|my_center|LOCUS_14210 11861 11364 gene locus_tag LOCUS_14220 11861 11364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 11961 12422 gene locus_tag LOCUS_14230 11961 12422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 14425 12584 gene locus_tag LOCUS_14240 14425 12584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 15450 14425 gene locus_tag LOCUS_14250 15450 14425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 16523 15447 gene locus_tag LOCUS_14260 16523 15447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 18054 16573 gene locus_tag LOCUS_14270 18054 16573 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_14270 19947 18361 gene locus_tag LOCUS_14280 19947 18361 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123574.1 protein_id gnl|my_center|LOCUS_14280 22966 19997 gene locus_tag LOCUS_14290 22966 19997 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123573.1 protein_id gnl|my_center|LOCUS_14290 24727 23219 gene locus_tag LOCUS_14300 24727 23219 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203533.1 protein_id gnl|my_center|LOCUS_14300 24838 26073 gene locus_tag LOCUS_14310 24838 26073 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221317.1 protein_id gnl|my_center|LOCUS_14310 26070 28763 gene locus_tag LOCUS_14320 26070 28763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 30548 28926 gene locus_tag LOCUS_14330 30548 28926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 31694 30663 gene locus_tag LOCUS_14340 31694 30663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211410235.1 protein_id gnl|my_center|LOCUS_14340 31791 32738 gene locus_tag LOCUS_14350 31791 32738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 32961 34970 gene locus_tag LOCUS_14360 32961 34970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 35380 36678 gene locus_tag LOCUS_14370 35380 36678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 36709 40827 gene locus_tag LOCUS_14380 36709 40827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 40824 44078 gene locus_tag LOCUS_14390 40824 44078 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140268.1 protein_id gnl|my_center|LOCUS_14390 44149 44874 gene locus_tag LOCUS_14400 44149 44874 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120859.1 protein_id gnl|my_center|LOCUS_14400 44888 46285 gene locus_tag LOCUS_14410 44888 46285 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_14410 46413 48065 gene locus_tag LOCUS_14420 46413 48065 CDS product fatty acid CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259368.1 protein_id gnl|my_center|LOCUS_14420 48960 48307 gene locus_tag LOCUS_14430 48960 48307 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029436.1 protein_id gnl|my_center|LOCUS_14430 50099 49098 gene locus_tag LOCUS_14440 50099 49098 CDS product type II asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209612390.1 protein_id gnl|my_center|LOCUS_14440 50274 51620 gene locus_tag LOCUS_14450 50274 51620 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_14450 51859 51602 gene locus_tag LOCUS_14460 51859 51602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 51750 54863 gene locus_tag LOCUS_14470 51750 54863 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921281.1 protein_id gnl|my_center|LOCUS_14470 54935 56380 gene locus_tag LOCUS_14480 54935 56380 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329353.1 protein_id gnl|my_center|LOCUS_14480 57530 56484 gene locus_tag LOCUS_14490 57530 56484 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389193.1 protein_id gnl|my_center|LOCUS_14490 58078 57527 gene locus_tag LOCUS_14500 58078 57527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 58235 61429 gene locus_tag LOCUS_14510 58235 61429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 61576 62484 gene locus_tag LOCUS_14520 61576 62484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812972.1 protein_id gnl|my_center|LOCUS_14520 62956 62705 gene locus_tag LOCUS_14530 62956 62705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 62888 63778 gene locus_tag LOCUS_14540 62888 63778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 63936 65561 gene locus_tag LOCUS_14550 63936 65561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 65623 66501 gene locus_tag LOCUS_14560 65623 66501 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_14560 67267 66533 gene locus_tag LOCUS_14570 67267 66533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 67627 67310 gene locus_tag LOCUS_14580 67627 67310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 67527 70631 gene locus_tag LOCUS_14590 67527 70631 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918997.1 protein_id gnl|my_center|LOCUS_14590 72049 70790 gene locus_tag LOCUS_14600 72049 70790 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791093.1 protein_id gnl|my_center|LOCUS_14600 73038 72046 gene locus_tag LOCUS_14610 73038 72046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 73979 73035 gene locus_tag LOCUS_14620 73979 73035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 74021 75286 gene locus_tag LOCUS_14630 74021 75286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 75306 76139 gene locus_tag LOCUS_14640 75306 76139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 76136 78073 gene locus_tag LOCUS_14650 76136 78073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 78118 79206 gene locus_tag LOCUS_14660 gene nahK 78118 79206 CDS product N-acetylhexosamine 1-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068766.1 protein_id gnl|my_center|LOCUS_14660 79203 80069 gene locus_tag LOCUS_14670 79203 80069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 81461 80211 gene locus_tag LOCUS_14680 81461 80211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 81569 82336 gene locus_tag LOCUS_14690 81569 82336 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971598.1 protein_id gnl|my_center|LOCUS_14690 82422 83360 gene locus_tag LOCUS_14700 82422 83360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 83961 83446 gene locus_tag LOCUS_14710 83961 83446 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978712.1 protein_id gnl|my_center|LOCUS_14710 84135 84365 gene locus_tag LOCUS_14720 84135 84365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 84322 85554 gene locus_tag LOCUS_14730 84322 85554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 85804 91641 gene locus_tag LOCUS_14740 85804 91641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 91789 92988 gene locus_tag LOCUS_14750 91789 92988 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975709.1 protein_id gnl|my_center|LOCUS_14750 94610 93072 gene locus_tag LOCUS_14760 94610 93072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 94765 94607 gene locus_tag LOCUS_14770 94765 94607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 94725 96002 gene locus_tag LOCUS_14780 94725 96002 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_14780 97533 96022 gene locus_tag LOCUS_14790 97533 96022 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 protein_id gnl|my_center|LOCUS_14790 97627 98967 gene locus_tag LOCUS_14800 97627 98967 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_14800 98964 99950 gene locus_tag LOCUS_14810 98964 99950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 100770 100120 gene locus_tag LOCUS_14820 100770 100120 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113463.1 protein_id gnl|my_center|LOCUS_14820 100901 101911 gene locus_tag LOCUS_14830 100901 101911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 101937 103250 gene locus_tag LOCUS_14840 101937 103250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 103924 103337 gene locus_tag LOCUS_14850 103924 103337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 106767 103930 gene locus_tag LOCUS_14860 106767 103930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 107975 106764 gene locus_tag LOCUS_14870 107975 106764 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228803.1 protein_id gnl|my_center|LOCUS_14870 108222 109619 gene locus_tag LOCUS_14880 108222 109619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 109625 110701 gene locus_tag LOCUS_14890 109625 110701 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184633.1 protein_id gnl|my_center|LOCUS_14890 111881 110802 gene locus_tag LOCUS_14900 gene rlmN 111881 110802 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258793.1 protein_id gnl|my_center|LOCUS_14900 113370 111958 gene locus_tag LOCUS_14910 113370 111958 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107138.1 protein_id gnl|my_center|LOCUS_14910 113662 114276 gene locus_tag LOCUS_14920 113662 114276 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545352.1 protein_id gnl|my_center|LOCUS_14920 114304 116643 gene locus_tag LOCUS_14930 114304 116643 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028088.1 protein_id gnl|my_center|LOCUS_14930 116708 117316 gene locus_tag LOCUS_14940 116708 117316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 117491 117877 gene locus_tag LOCUS_14950 117491 117877 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785756.1 protein_id gnl|my_center|LOCUS_14950 117952 118365 gene locus_tag LOCUS_14960 gene fadM 117952 118365 CDS product long-chain acyl-CoA thioesterase FadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194543.1 protein_id gnl|my_center|LOCUS_14960 118671 119036 gene locus_tag LOCUS_14970 118671 119036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 119232 120464 gene locus_tag LOCUS_14980 119232 120464 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197309.1 protein_id gnl|my_center|LOCUS_14980 120671 121207 gene locus_tag LOCUS_14990 120671 121207 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002761477.1 protein_id gnl|my_center|LOCUS_14990 122209 121238 gene locus_tag LOCUS_15000 122209 121238 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208809.1 protein_id gnl|my_center|LOCUS_15000 122278 122754 gene locus_tag LOCUS_15010 122278 122754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 122869 123669 gene locus_tag LOCUS_15020 122869 123669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 124577 123663 gene locus_tag LOCUS_15030 gene rarD 124577 123663 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038990.1 protein_id gnl|my_center|LOCUS_15030 124897 124637 gene locus_tag LOCUS_15040 124897 124637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 124985 126601 gene locus_tag LOCUS_15050 124985 126601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 130664 126777 gene locus_tag LOCUS_15060 130664 126777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 132025 130757 gene locus_tag LOCUS_15070 132025 130757 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807926.1 protein_id gnl|my_center|LOCUS_15070 132136 133092 gene locus_tag LOCUS_15080 132136 133092 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929529.1 protein_id gnl|my_center|LOCUS_15080 133613 133194 gene locus_tag LOCUS_15090 133613 133194 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939712.1 protein_id gnl|my_center|LOCUS_15090 134098 133649 gene locus_tag LOCUS_15100 134098 133649 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546682.1 protein_id gnl|my_center|LOCUS_15100 134309 135478 gene locus_tag LOCUS_15110 134309 135478 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706898.1 protein_id gnl|my_center|LOCUS_15110 135977 135570 gene locus_tag LOCUS_15120 135977 135570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 137138 136041 gene locus_tag LOCUS_15130 137138 136041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 137261 139675 gene locus_tag LOCUS_15140 137261 139675 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928490.1 protein_id gnl|my_center|LOCUS_15140 139835 141976 gene locus_tag LOCUS_15150 139835 141976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 143760 141970 gene locus_tag LOCUS_15160 gene ggt 143760 141970 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388138.1 protein_id gnl|my_center|LOCUS_15160 143898 146561 gene locus_tag LOCUS_15170 143898 146561 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275530.1 protein_id gnl|my_center|LOCUS_15170 146666 148081 gene locus_tag LOCUS_15180 146666 148081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 148141 148926 gene locus_tag LOCUS_15190 148141 148926 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143164.1 protein_id gnl|my_center|LOCUS_15190 150669 149200 gene locus_tag LOCUS_15200 150669 149200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 152327 151071 gene locus_tag LOCUS_15210 152327 151071 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738818.1 protein_id gnl|my_center|LOCUS_15210 152612 153820 gene locus_tag LOCUS_15220 152612 153820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 153858 154415 gene locus_tag LOCUS_15230 153858 154415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 154464 155999 gene locus_tag LOCUS_15240 154464 155999 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930332.1 protein_id gnl|my_center|LOCUS_15240 156921 156019 gene locus_tag LOCUS_15250 156921 156019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 157071 158615 gene locus_tag LOCUS_15260 157071 158615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 161817 158701 gene locus_tag LOCUS_15270 161817 158701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 163458 162073 gene locus_tag LOCUS_15280 163458 162073 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201992.1 protein_id gnl|my_center|LOCUS_15280 166920 163849 gene locus_tag LOCUS_15290 166920 163849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 168071 167289 gene locus_tag LOCUS_15300 168071 167289 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970553.1 protein_id gnl|my_center|LOCUS_15300 169471 168377 gene locus_tag LOCUS_15310 169471 168377 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257668.1 protein_id gnl|my_center|LOCUS_15310 170577 169660 gene locus_tag LOCUS_15320 170577 169660 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921650.1 protein_id gnl|my_center|LOCUS_15320 170711 172333 gene locus_tag LOCUS_15330 170711 172333 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615419.1 protein_id gnl|my_center|LOCUS_15330 173344 172439 gene locus_tag LOCUS_15340 173344 172439 CDS product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216362.1 protein_id gnl|my_center|LOCUS_15340 174737 173451 gene locus_tag LOCUS_15350 174737 173451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 174891 176759 gene locus_tag LOCUS_15360 174891 176759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 176768 178807 gene locus_tag LOCUS_15370 176768 178807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 178826 179077 gene locus_tag LOCUS_15380 178826 179077 CDS product DUF1653 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229500.1 protein_id gnl|my_center|LOCUS_15380 179099 180256 gene locus_tag LOCUS_15390 179099 180256 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391945.1 protein_id gnl|my_center|LOCUS_15390 180470 181639 gene locus_tag LOCUS_15400 180470 181639 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256557.1 protein_id gnl|my_center|LOCUS_15400 181636 182298 gene locus_tag LOCUS_15410 181636 182298 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256556.1 protein_id gnl|my_center|LOCUS_15410 182491 184905 gene locus_tag LOCUS_15420 182491 184905 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142422.1 protein_id gnl|my_center|LOCUS_15420 184913 185680 gene locus_tag LOCUS_15430 184913 185680 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941827.1 protein_id gnl|my_center|LOCUS_15430 185760 186788 gene locus_tag LOCUS_15440 185760 186788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 186997 188007 gene locus_tag LOCUS_15450 186997 188007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 188625 188158 gene locus_tag LOCUS_15460 188625 188158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 189499 188699 gene locus_tag LOCUS_15470 189499 188699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838431.1 protein_id gnl|my_center|LOCUS_15470 189553 190005 gene locus_tag LOCUS_15480 189553 190005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 191091 190081 gene locus_tag LOCUS_15490 191091 190081 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036518.1 protein_id gnl|my_center|LOCUS_15490 191937 191137 gene locus_tag LOCUS_15500 191937 191137 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036519.1 protein_id gnl|my_center|LOCUS_15500 192455 191934 gene locus_tag LOCUS_15510 192455 191934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 192847 192452 gene locus_tag LOCUS_15520 192847 192452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 194282 192975 gene locus_tag LOCUS_15530 194282 192975 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942966.1 protein_id gnl|my_center|LOCUS_15530 195356 194301 gene locus_tag LOCUS_15540 195356 194301 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388482.1 protein_id gnl|my_center|LOCUS_15540 196683 195367 gene locus_tag LOCUS_15550 196683 195367 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942964.1 protein_id gnl|my_center|LOCUS_15550 198177 197056 gene locus_tag LOCUS_15560 198177 197056 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036524.1 protein_id gnl|my_center|LOCUS_15560 198790 199191 gene locus_tag LOCUS_15570 198790 199191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 200346 199579 gene locus_tag LOCUS_15580 200346 199579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 200452 201525 gene locus_tag LOCUS_15590 200452 201525 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859886.1 protein_id gnl|my_center|LOCUS_15590 202517 201483 gene locus_tag LOCUS_15600 202517 201483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 203641 202535 gene locus_tag LOCUS_15610 203641 202535 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119520.1 protein_id gnl|my_center|LOCUS_15610 204792 203653 gene locus_tag LOCUS_15620 gene devC 204792 203653 CDS product ABC transporter permease DevC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141427.1 protein_id gnl|my_center|LOCUS_15620 205926 204796 gene locus_tag LOCUS_15630 gene devC 205926 204796 CDS product ABC transporter permease DevC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141427.1 protein_id gnl|my_center|LOCUS_15630 206872 205949 gene locus_tag LOCUS_15640 206872 205949 CDS product ABC exporter membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141428.1 protein_id gnl|my_center|LOCUS_15640 208403 206862 gene locus_tag LOCUS_15650 208403 206862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 209355 208474 gene locus_tag LOCUS_15660 209355 208474 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122211.1 protein_id gnl|my_center|LOCUS_15660 210397 209468 gene locus_tag LOCUS_15670 210397 209468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 210537 211508 gene locus_tag LOCUS_15680 210537 211508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 213153 211396 gene locus_tag LOCUS_15690 213153 211396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 214819 213206 gene locus_tag LOCUS_15700 214819 213206 CDS product cyclic peptide export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057486.1 protein_id gnl|my_center|LOCUS_15700 214917 216086 gene locus_tag LOCUS_15710 214917 216086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 216083 216829 gene locus_tag LOCUS_15720 216083 216829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 216898 219498 gene locus_tag LOCUS_15730 216898 219498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 221338 219860 gene locus_tag LOCUS_15740 gene pap 221338 219860 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941390.1 protein_id gnl|my_center|LOCUS_15740 221720 222508 gene locus_tag LOCUS_15750 221720 222508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 223790 222600 gene locus_tag LOCUS_15760 223790 222600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 225332 223797 gene locus_tag LOCUS_15770 225332 223797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 225331 226299 gene locus_tag LOCUS_15780 225331 226299 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889019.1 protein_id gnl|my_center|LOCUS_15780 227922 226462 gene locus_tag LOCUS_15790 227922 226462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 228734 227919 gene locus_tag LOCUS_15800 228734 227919 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739343.1 protein_id gnl|my_center|LOCUS_15800 229632 228781 gene locus_tag LOCUS_15810 229632 228781 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015839.1 protein_id gnl|my_center|LOCUS_15810 231791 229671 gene locus_tag LOCUS_15820 231791 229671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 232809 231919 gene locus_tag LOCUS_15830 232809 231919 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941995.1 protein_id gnl|my_center|LOCUS_15830 232775 233191 gene locus_tag LOCUS_15840 232775 233191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 233259 233894 gene locus_tag LOCUS_15850 233259 233894 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112465.1 protein_id gnl|my_center|LOCUS_15850 234014 234970 gene locus_tag LOCUS_15860 234014 234970 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086031.1 protein_id gnl|my_center|LOCUS_15860 235123 235743 gene locus_tag LOCUS_15870 gene wrbA 235123 235743 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941470.1 protein_id gnl|my_center|LOCUS_15870 235827 236789 gene locus_tag LOCUS_15880 235827 236789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 238562 236862 gene locus_tag LOCUS_15890 238562 236862 CDS product beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100342827.1 protein_id gnl|my_center|LOCUS_15890 238661 240910 gene locus_tag LOCUS_15900 238661 240910 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920015.1 protein_id gnl|my_center|LOCUS_15900 240991 243129 gene locus_tag LOCUS_15910 240991 243129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 243141 244559 gene locus_tag LOCUS_15920 243141 244559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 246791 244572 gene locus_tag LOCUS_15930 246791 244572 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839960.1 protein_id gnl|my_center|LOCUS_15930 248018 247377 gene locus_tag LOCUS_15940 248018 247377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 249505 248618 gene locus_tag LOCUS_15950 249505 248618 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331327.1 protein_id gnl|my_center|LOCUS_15950 250547 249558 gene locus_tag LOCUS_15960 250547 249558 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171047034.1 protein_id gnl|my_center|LOCUS_15960 252165 250669 gene locus_tag LOCUS_15970 252165 250669 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063893.1 protein_id gnl|my_center|LOCUS_15970 253029 252169 gene locus_tag LOCUS_15980 253029 252169 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627865.1 protein_id gnl|my_center|LOCUS_15980 254333 253026 gene locus_tag LOCUS_15990 254333 253026 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883303.1 protein_id gnl|my_center|LOCUS_15990 255703 254330 gene locus_tag LOCUS_16000 255703 254330 CDS product sn-glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066917.1 protein_id gnl|my_center|LOCUS_16000 256662 255700 gene locus_tag LOCUS_16010 256662 255700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 257642 256659 gene locus_tag LOCUS_16020 257642 256659 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188534.1 protein_id gnl|my_center|LOCUS_16020 258525 257698 gene locus_tag LOCUS_16030 258525 257698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 258767 262150 gene locus_tag LOCUS_16040 258767 262150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 262525 264246 gene locus_tag LOCUS_16050 262525 264246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 264252 265805 gene locus_tag LOCUS_16060 264252 265805 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922507.1 protein_id gnl|my_center|LOCUS_16060 265802 267193 gene locus_tag LOCUS_16070 265802 267193 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_16070 267222 268667 gene locus_tag LOCUS_16080 267222 268667 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922487.1 protein_id gnl|my_center|LOCUS_16080 268696 269817 gene locus_tag LOCUS_16090 268696 269817 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040096.1 protein_id gnl|my_center|LOCUS_16090 270431 276544 gene locus_tag LOCUS_16100 270431 276544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 276824 278896 gene locus_tag LOCUS_16110 gene cstA 276824 278896 CDS product carbon starvation protein CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047792095.1 protein_id gnl|my_center|LOCUS_16110 279563 278916 gene locus_tag LOCUS_16120 279563 278916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 279556 279897 gene locus_tag LOCUS_16130 279556 279897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 279902 280708 gene locus_tag LOCUS_16140 279902 280708 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326598.1 protein_id gnl|my_center|LOCUS_16140 280718 281890 gene locus_tag LOCUS_16150 gene eboE 280718 281890 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_16150 281901 282629 gene locus_tag LOCUS_16160 281901 282629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 284338 282779 gene locus_tag LOCUS_16170 284338 282779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974902.1 protein_id gnl|my_center|LOCUS_16170 285617 284364 gene locus_tag LOCUS_16180 gene fabB 285617 284364 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_16180 285989 285624 gene locus_tag LOCUS_16190 285989 285624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 286636 285986 gene locus_tag LOCUS_16200 286636 285986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 286719 287966 gene locus_tag LOCUS_16210 286719 287966 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_16210 288836 288117 gene locus_tag LOCUS_16220 288836 288117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 288935 290062 gene locus_tag LOCUS_16230 288935 290062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667978.1 protein_id gnl|my_center|LOCUS_16230 290059 290976 gene locus_tag LOCUS_16240 290059 290976 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055221127.1 protein_id gnl|my_center|LOCUS_16240 292003 290948 gene locus_tag LOCUS_16250 292003 290948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 292907 292068 gene locus_tag LOCUS_16260 292907 292068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 293469 292933 gene locus_tag LOCUS_16270 293469 292933 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225958345.1 protein_id gnl|my_center|LOCUS_16270 293410 293718 gene locus_tag LOCUS_16280 293410 293718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 293744 294670 gene locus_tag LOCUS_16290 293744 294670 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838741.1 protein_id gnl|my_center|LOCUS_16290 294795 295364 gene locus_tag LOCUS_16300 294795 295364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 298397 295371 gene locus_tag LOCUS_16310 298397 295371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 299103 298462 gene locus_tag LOCUS_16320 299103 298462 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121917.1 protein_id gnl|my_center|LOCUS_16320 299211 300656 gene locus_tag LOCUS_16330 299211 300656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 300763 301764 gene locus_tag LOCUS_16340 300763 301764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 301774 305637 gene locus_tag LOCUS_16350 301774 305637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 306858 305776 gene locus_tag LOCUS_16360 306858 305776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 308212 306929 gene locus_tag LOCUS_16370 gene kynU 308212 306929 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276276.1 protein_id gnl|my_center|LOCUS_16370 308316 310142 gene locus_tag LOCUS_16380 308316 310142 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073230.1 protein_id gnl|my_center|LOCUS_16380 310255 310509 gene locus_tag LOCUS_16390 310255 310509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 310519 311742 gene locus_tag LOCUS_16400 310519 311742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 311739 312218 gene locus_tag LOCUS_16410 311739 312218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 314517 312367 gene locus_tag LOCUS_16420 314517 312367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 316429 314537 gene locus_tag LOCUS_16430 316429 314537 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975395.1 protein_id gnl|my_center|LOCUS_16430 317581 316571 gene locus_tag LOCUS_16440 317581 316571 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972764.1 protein_id gnl|my_center|LOCUS_16440 318687 317584 gene locus_tag LOCUS_16450 318687 317584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 320477 318720 gene locus_tag LOCUS_16460 320477 318720 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482859.1 protein_id gnl|my_center|LOCUS_16460 321640 320594 gene locus_tag LOCUS_16470 321640 320594 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976055.1 protein_id gnl|my_center|LOCUS_16470 322958 321699 gene locus_tag LOCUS_16480 322958 321699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 327810 323005 gene locus_tag LOCUS_16490 327810 323005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 328235 330748 gene locus_tag LOCUS_16500 328235 330748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 330897 330814 gene locus_tag LOCUS_t00180 330897 330814 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 331052 331603 gene locus_tag LOCUS_16510 gene nadD 331052 331603 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460892.1 protein_id gnl|my_center|LOCUS_16510 331600 332058 gene locus_tag LOCUS_16520 gene rsfS 331600 332058 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921947.1 protein_id gnl|my_center|LOCUS_16520 332250 332603 gene locus_tag LOCUS_16530 332250 332603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 332772 333125 gene locus_tag LOCUS_16540 332772 333125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 333212 335107 gene locus_tag LOCUS_16550 333212 335107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 335124 336926 gene locus_tag LOCUS_16560 335124 336926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 338928 336913 gene locus_tag LOCUS_16570 338928 336913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 340970 338928 gene locus_tag LOCUS_16580 340970 338928 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225853.1 protein_id gnl|my_center|LOCUS_16580 340909 341769 gene locus_tag LOCUS_16590 340909 341769 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523383.1 protein_id gnl|my_center|LOCUS_16590 344028 341785 gene locus_tag LOCUS_16600 344028 341785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 345040 344021 gene locus_tag LOCUS_16610 345040 344021 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256245.1 protein_id gnl|my_center|LOCUS_16610 346592 345051 gene locus_tag LOCUS_16620 346592 345051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 348273 346582 gene locus_tag LOCUS_16630 348273 346582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 351386 348270 gene locus_tag LOCUS_16640 351386 348270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 352177 351488 gene locus_tag LOCUS_16650 352177 351488 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_16650 353255 352242 gene locus_tag LOCUS_16660 353255 352242 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256245.1 protein_id gnl|my_center|LOCUS_16660 354478 353255 gene locus_tag LOCUS_16670 354478 353255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 355662 354481 gene locus_tag LOCUS_16680 355662 354481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 356555 355668 gene locus_tag LOCUS_16690 356555 355668 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943148.1 protein_id gnl|my_center|LOCUS_16690 358267 356555 gene locus_tag LOCUS_16700 358267 356555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 360012 358264 gene locus_tag LOCUS_16710 360012 358264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 360937 360017 gene locus_tag LOCUS_16720 360937 360017 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941296.1 protein_id gnl|my_center|LOCUS_16720 362007 360934 gene locus_tag LOCUS_16730 362007 360934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064737.1 protein_id gnl|my_center|LOCUS_16730 362813 362004 gene locus_tag LOCUS_16740 362813 362004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 363586 362810 gene locus_tag LOCUS_16750 363586 362810 CDS product AglZ/HisF2 family acetamidino modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113421.1 protein_id gnl|my_center|LOCUS_16750 364203 363589 gene locus_tag LOCUS_16760 gene hisH 364203 363589 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113422.1 protein_id gnl|my_center|LOCUS_16760 365339 364200 gene locus_tag LOCUS_16770 365339 364200 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929975.1 protein_id gnl|my_center|LOCUS_16770 366520 365345 gene locus_tag LOCUS_16780 366520 365345 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119728.1 protein_id gnl|my_center|LOCUS_16780 367752 366517 gene locus_tag LOCUS_16790 367752 366517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 368855 367749 gene locus_tag LOCUS_16800 368855 367749 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007341012.1 protein_id gnl|my_center|LOCUS_16800 369575 368910 gene locus_tag LOCUS_16810 369575 368910 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_16810 370597 369578 gene locus_tag LOCUS_16820 370597 369578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16820 371898 370594 gene locus_tag LOCUS_16830 371898 370594 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427766.1 protein_id gnl|my_center|LOCUS_16830 372725 372003 gene locus_tag LOCUS_16840 372725 372003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 372765 373670 gene locus_tag LOCUS_16850 372765 373670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 375242 373830 gene locus_tag LOCUS_16860 375242 373830 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910880.1 protein_id gnl|my_center|LOCUS_16860 377700 375253 gene locus_tag LOCUS_16870 377700 375253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 377800 378501 gene locus_tag LOCUS_16880 377800 378501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 378513 379778 gene locus_tag LOCUS_16890 gene xseA 378513 379778 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113813.1 protein_id gnl|my_center|LOCUS_16890 379892 382285 gene locus_tag LOCUS_16900 379892 382285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 382369 382740 gene locus_tag LOCUS_16910 382369 382740 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121435.1 protein_id gnl|my_center|LOCUS_16910 384747 382873 gene locus_tag LOCUS_16920 384747 382873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 385346 384744 gene locus_tag LOCUS_16930 385346 384744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 386596 385343 gene locus_tag LOCUS_16940 386596 385343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 386964 388073 gene locus_tag LOCUS_16950 386964 388073 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042596355.1 protein_id gnl|my_center|LOCUS_16950 388406 389452 gene locus_tag LOCUS_16960 388406 389452 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640182.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16960 390476 389595 gene locus_tag LOCUS_16970 390476 389595 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407851.1 protein_id gnl|my_center|LOCUS_16970 393031 390479 gene locus_tag LOCUS_16980 393031 390479 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105233.1 protein_id gnl|my_center|LOCUS_16980 396559 393158 gene locus_tag LOCUS_16990 396559 393158 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205417.1 protein_id gnl|my_center|LOCUS_16990 396808 397485 gene locus_tag LOCUS_17000 396808 397485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 400575 397858 gene locus_tag LOCUS_17010 400575 397858 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032613447.1 protein_id gnl|my_center|LOCUS_17010 402014 400608 gene locus_tag LOCUS_17020 402014 400608 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261780.1 protein_id gnl|my_center|LOCUS_17020 403168 402173 gene locus_tag LOCUS_17030 403168 402173 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035548.1 protein_id gnl|my_center|LOCUS_17030 403255 403764 gene locus_tag LOCUS_17040 403255 403764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 404061 404399 gene locus_tag LOCUS_17050 404061 404399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 405643 404474 gene locus_tag LOCUS_17060 405643 404474 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839857.1 protein_id gnl|my_center|LOCUS_17060 406832 405750 gene locus_tag LOCUS_17070 406832 405750 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100168880.1 protein_id gnl|my_center|LOCUS_17070 407979 406939 gene locus_tag LOCUS_17080 407979 406939 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_17080 408170 409027 gene locus_tag LOCUS_17090 408170 409027 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972698.1 protein_id gnl|my_center|LOCUS_17090 409113 409664 gene locus_tag LOCUS_17100 409113 409664 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337019.1 protein_id gnl|my_center|LOCUS_17100 409657 410643 gene locus_tag LOCUS_17110 409657 410643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 411388 410786 gene locus_tag LOCUS_17120 411388 410786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 413331 411712 gene locus_tag LOCUS_17130 413331 411712 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140950.1 protein_id gnl|my_center|LOCUS_17130 414774 413377 gene locus_tag LOCUS_17140 gene asnS 414774 413377 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937318.1 protein_id gnl|my_center|LOCUS_17140 414942 416354 gene locus_tag LOCUS_17150 414942 416354 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706890.1 protein_id gnl|my_center|LOCUS_17150 417273 416512 gene locus_tag LOCUS_17160 417273 416512 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404765.1 protein_id gnl|my_center|LOCUS_17160 418629 417427 gene locus_tag LOCUS_17170 418629 417427 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942826.1 protein_id gnl|my_center|LOCUS_17170 421286 418626 gene locus_tag LOCUS_17180 421286 418626 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404082.1 protein_id gnl|my_center|LOCUS_17180 422177 421500 gene locus_tag LOCUS_17190 422177 421500 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038986.1 protein_id gnl|my_center|LOCUS_17190 422309 422986 gene locus_tag LOCUS_17200 422309 422986 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120140.1 protein_id gnl|my_center|LOCUS_17200 422983 424188 gene locus_tag LOCUS_17210 422983 424188 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327631.1 protein_id gnl|my_center|LOCUS_17210 425348 424245 gene locus_tag LOCUS_17220 425348 424245 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223573.1 protein_id gnl|my_center|LOCUS_17220 425569 426120 gene locus_tag LOCUS_17230 425569 426120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 426778 426323 gene locus_tag LOCUS_17240 426778 426323 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_17240 426841 427833 gene locus_tag LOCUS_17250 426841 427833 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409725.1 protein_id gnl|my_center|LOCUS_17250 428661 427957 gene locus_tag LOCUS_17260 428661 427957 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212344658.1 protein_id gnl|my_center|LOCUS_17260 428773 430059 gene locus_tag LOCUS_17270 gene dctA 428773 430059 CDS product C4-dicarboxylate transporter DctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082442.1 protein_id gnl|my_center|LOCUS_17270 430150 433338 gene locus_tag LOCUS_17280 430150 433338 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265653.1 protein_id gnl|my_center|LOCUS_17280 433623 433390 gene locus_tag LOCUS_17290 433623 433390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 433696 435522 gene locus_tag LOCUS_17300 433696 435522 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_17300 435617 436486 gene locus_tag LOCUS_17310 435617 436486 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032609424.1 protein_id gnl|my_center|LOCUS_17310 436553 437404 gene locus_tag LOCUS_17320 436553 437404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 437554 438360 gene locus_tag LOCUS_17330 437554 438360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 438471 439304 gene locus_tag LOCUS_17340 438471 439304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 439621 440013 gene locus_tag LOCUS_17350 439621 440013 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071713.1 protein_id gnl|my_center|LOCUS_17350 440135 441562 gene locus_tag LOCUS_17360 440135 441562 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038505.1 protein_id gnl|my_center|LOCUS_17360 444404 441687 gene locus_tag LOCUS_17370 444404 441687 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206610.1 protein_id gnl|my_center|LOCUS_17370 445082 444567 gene locus_tag LOCUS_17380 445082 444567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 447355 445355 gene locus_tag LOCUS_17390 447355 445355 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810859.1 protein_id gnl|my_center|LOCUS_17390 447240 447557 gene locus_tag LOCUS_17400 447240 447557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 450343 447623 gene locus_tag LOCUS_17410 450343 447623 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206610.1 protein_id gnl|my_center|LOCUS_17410 451371 450778 gene locus_tag LOCUS_17420 451371 450778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 454380 451495 gene locus_tag LOCUS_17430 454380 451495 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275339.1 protein_id gnl|my_center|LOCUS_17430 457579 454601 gene locus_tag LOCUS_17440 457579 454601 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919497.1 protein_id gnl|my_center|LOCUS_17440 457811 458800 gene locus_tag LOCUS_17450 457811 458800 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 protein_id gnl|my_center|LOCUS_17450 458793 459455 gene locus_tag LOCUS_17460 458793 459455 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256910.1 protein_id gnl|my_center|LOCUS_17460 460748 459612 gene locus_tag LOCUS_17470 gene purK 460748 459612 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733237.1 protein_id gnl|my_center|LOCUS_17470 461371 460847 gene locus_tag LOCUS_17480 gene purE 461371 460847 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 protein_id gnl|my_center|LOCUS_17480 463621 461498 gene locus_tag LOCUS_17490 463621 461498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 464104 463634 gene locus_tag LOCUS_17500 464104 463634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 464691 464110 gene locus_tag LOCUS_17510 464691 464110 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393839.1 protein_id gnl|my_center|LOCUS_17510 464998 466650 gene locus_tag LOCUS_17520 464998 466650 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_17520 466762 468006 gene locus_tag LOCUS_17530 466762 468006 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385749.1 protein_id gnl|my_center|LOCUS_17530 470169 468013 gene locus_tag LOCUS_17540 470169 468013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 470371 474144 gene locus_tag LOCUS_17550 470371 474144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 475824 474379 gene locus_tag LOCUS_17560 475824 474379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 476852 475833 gene locus_tag LOCUS_17570 476852 475833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 476775 477101 gene locus_tag LOCUS_17580 476775 477101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 477261 477899 gene locus_tag LOCUS_17590 477261 477899 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141682.1 protein_id gnl|my_center|LOCUS_17590 478501 478199 gene locus_tag LOCUS_17600 478501 478199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 478385 480292 gene locus_tag LOCUS_17610 gene ligA 478385 480292 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931538.1 protein_id gnl|my_center|LOCUS_17610 480498 482345 gene locus_tag LOCUS_17620 480498 482345 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530985.1 protein_id gnl|my_center|LOCUS_17620 482474 484378 gene locus_tag LOCUS_17630 482474 484378 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921322.1 protein_id gnl|my_center|LOCUS_17630 485349 484504 gene locus_tag LOCUS_17640 485349 484504 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201854.1 protein_id gnl|my_center|LOCUS_17640 485531 488107 gene locus_tag LOCUS_17650 485531 488107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 488125 489489 gene locus_tag LOCUS_17660 488125 489489 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121153.1 protein_id gnl|my_center|LOCUS_17660 491143 489635 gene locus_tag LOCUS_17670 491143 489635 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 protein_id gnl|my_center|LOCUS_17670 492521 491259 gene locus_tag LOCUS_17680 492521 491259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 493016 492531 gene locus_tag LOCUS_17690 493016 492531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 493107 493949 gene locus_tag LOCUS_17700 493107 493949 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102692.1 protein_id gnl|my_center|LOCUS_17700 495142 493952 gene locus_tag LOCUS_17710 495142 493952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 496263 495139 gene locus_tag LOCUS_17720 496263 495139 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084987.1 protein_id gnl|my_center|LOCUS_17720 496670 496263 gene locus_tag LOCUS_17730 496670 496263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 496994 496680 gene locus_tag LOCUS_17740 496994 496680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 498232 497276 gene locus_tag LOCUS_17750 498232 497276 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776891.1 protein_id gnl|my_center|LOCUS_17750 499575 498334 gene locus_tag LOCUS_17760 499575 498334 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444040.1 protein_id gnl|my_center|LOCUS_17760 499801 500457 gene locus_tag LOCUS_17770 499801 500457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 500471 500800 gene locus_tag LOCUS_17780 500471 500800 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122463.1 protein_id gnl|my_center|LOCUS_17780 501001 501687 gene locus_tag LOCUS_17790 501001 501687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 501684 502583 gene locus_tag LOCUS_17800 501684 502583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 504486 502657 gene locus_tag LOCUS_17810 504486 502657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 506317 504872 gene locus_tag LOCUS_17820 506317 504872 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090039.1 protein_id gnl|my_center|LOCUS_17820 506957 506541 gene locus_tag LOCUS_17830 506957 506541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 508444 507353 gene locus_tag LOCUS_17840 508444 507353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 510406 509012 gene locus_tag LOCUS_17850 510406 509012 CDS product polysaccharide lyase 6 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029032.1 protein_id gnl|my_center|LOCUS_17850 512525 510519 gene locus_tag LOCUS_17860 512525 510519 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921992.1 protein_id gnl|my_center|LOCUS_17860 513201 512854 gene locus_tag LOCUS_17870 513201 512854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 515383 513407 gene locus_tag LOCUS_17880 515383 513407 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921992.1 protein_id gnl|my_center|LOCUS_17880 516278 515430 gene locus_tag LOCUS_17890 516278 515430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 516417 517280 gene locus_tag LOCUS_17900 516417 517280 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051321041.1 protein_id gnl|my_center|LOCUS_17900 517427 517876 gene locus_tag LOCUS_17910 517427 517876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 517941 522320 gene locus_tag LOCUS_17920 517941 522320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 522482 523711 gene locus_tag LOCUS_17930 522482 523711 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_17930 524099 523764 gene locus_tag LOCUS_17940 524099 523764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 524257 524919 gene locus_tag LOCUS_17950 524257 524919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 525414 525049 gene locus_tag LOCUS_17960 525414 525049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 526583 525432 gene locus_tag LOCUS_17970 526583 525432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 527195 526596 gene locus_tag LOCUS_17980 527195 526596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 528187 527387 gene locus_tag LOCUS_17990 528187 527387 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527204.1 protein_id gnl|my_center|LOCUS_17990 528273 529895 gene locus_tag LOCUS_18000 528273 529895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 529956 531461 gene locus_tag LOCUS_18010 529956 531461 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615932.1 protein_id gnl|my_center|LOCUS_18010 531517 532656 gene locus_tag LOCUS_18020 531517 532656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976170.1 protein_id gnl|my_center|LOCUS_18020 535506 533095 gene locus_tag LOCUS_18030 535506 533095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 536402 535512 gene locus_tag LOCUS_18040 536402 535512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 536647 537081 gene locus_tag LOCUS_18050 536647 537081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 537191 538063 gene locus_tag LOCUS_18060 537191 538063 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087082.1 protein_id gnl|my_center|LOCUS_18060 538135 539544 gene locus_tag LOCUS_18070 538135 539544 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122824.1 protein_id gnl|my_center|LOCUS_18070 540628 539918 gene locus_tag LOCUS_18080 540628 539918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 541237 540845 gene locus_tag LOCUS_18090 541237 540845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 541910 541251 gene locus_tag LOCUS_18100 541910 541251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 542231 543040 gene locus_tag LOCUS_18110 542231 543040 CDS product IS1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081285673.1 protein_id gnl|my_center|LOCUS_18110 543037 543339 gene locus_tag LOCUS_18120 543037 543339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 544040 543348 gene locus_tag LOCUS_18130 544040 543348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 544449 544123 gene locus_tag LOCUS_18140 544449 544123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 544592 545527 gene locus_tag LOCUS_18150 544592 545527 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327302.1 protein_id gnl|my_center|LOCUS_18150 545524 546999 gene locus_tag LOCUS_18160 545524 546999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 547038 547682 gene locus_tag LOCUS_18170 547038 547682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 548325 547837 gene locus_tag LOCUS_18180 548325 547837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 548537 549835 gene locus_tag LOCUS_18190 548537 549835 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919501.1 protein_id gnl|my_center|LOCUS_18190 550842 550024 gene locus_tag LOCUS_18200 550842 550024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 551405 550839 gene locus_tag LOCUS_18210 551405 550839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 552972 551599 gene locus_tag LOCUS_18220 552972 551599 CDS product glucarate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731063.1 protein_id gnl|my_center|LOCUS_18220 552971 553195 gene locus_tag LOCUS_18230 552971 553195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 553192 554199 gene locus_tag LOCUS_18240 553192 554199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 556510 554237 gene locus_tag LOCUS_18250 556510 554237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 557209 556514 gene locus_tag LOCUS_18260 557209 556514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 557772 557215 gene locus_tag LOCUS_18270 557772 557215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 558209 557796 gene locus_tag LOCUS_18280 558209 557796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 559237 558206 gene locus_tag LOCUS_18290 559237 558206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 560710 559385 gene locus_tag LOCUS_18300 560710 559385 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143713.1 protein_id gnl|my_center|LOCUS_18300 560776 561390 gene locus_tag LOCUS_18310 560776 561390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 562139 561498 gene locus_tag LOCUS_18320 562139 561498 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976284.1 protein_id gnl|my_center|LOCUS_18320 562723 562196 gene locus_tag LOCUS_18330 562723 562196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 562770 566822 gene locus_tag LOCUS_18340 gene hrpA 562770 566822 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105494.1 protein_id gnl|my_center|LOCUS_18340 566923 568917 gene locus_tag LOCUS_18350 566923 568917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 569054 569431 gene locus_tag LOCUS_18360 569054 569431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 569492 570298 gene locus_tag LOCUS_18370 569492 570298 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921905.1 protein_id gnl|my_center|LOCUS_18370 571136 570357 gene locus_tag LOCUS_18380 571136 570357 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805182.1 protein_id gnl|my_center|LOCUS_18380 571239 572735 gene locus_tag LOCUS_18390 571239 572735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 572751 573110 gene locus_tag LOCUS_18400 572751 573110 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001971937.1 protein_id gnl|my_center|LOCUS_18400 573194 573451 gene locus_tag LOCUS_18410 573194 573451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 573763 574677 gene locus_tag LOCUS_18420 573763 574677 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098074942.1 protein_id gnl|my_center|LOCUS_18420 574783 575751 gene locus_tag LOCUS_18430 574783 575751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 577303 575777 gene locus_tag LOCUS_18440 577303 575777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 577480 578994 gene locus_tag LOCUS_18450 577480 578994 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889049.1 protein_id gnl|my_center|LOCUS_18450 579012 579821 gene locus_tag LOCUS_18460 579012 579821 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097114.1 protein_id gnl|my_center|LOCUS_18460 580385 580086 gene locus_tag LOCUS_18470 580385 580086 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812598.1 protein_id gnl|my_center|LOCUS_18470 580465 581211 gene locus_tag LOCUS_18480 gene kdsB 580465 581211 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_18480 582498 581326 gene locus_tag LOCUS_18490 gene carA 582498 581326 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660544.1 protein_id gnl|my_center|LOCUS_18490 582666 583871 gene locus_tag LOCUS_18500 582666 583871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 587327 584175 gene locus_tag LOCUS_18510 587327 584175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 587577 589304 gene locus_tag LOCUS_18520 587577 589304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 589570 591684 gene locus_tag LOCUS_18530 589570 591684 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072660.1 protein_id gnl|my_center|LOCUS_18530 591746 592339 gene locus_tag LOCUS_18540 591746 592339 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020479965.1 protein_id gnl|my_center|LOCUS_18540 593857 592373 gene locus_tag LOCUS_18550 593857 592373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 594030 595424 gene locus_tag LOCUS_18560 594030 595424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 595430 598636 gene locus_tag LOCUS_18570 595430 598636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 598670 601147 gene locus_tag LOCUS_18580 598670 601147 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839793.1 protein_id gnl|my_center|LOCUS_18580 601632 601315 gene locus_tag LOCUS_18590 601632 601315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 604497 601744 gene locus_tag LOCUS_18600 604497 601744 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929460.1 protein_id gnl|my_center|LOCUS_18600 607412 604524 gene locus_tag LOCUS_18610 607412 604524 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705867.1 protein_id gnl|my_center|LOCUS_18610 607551 607979 gene locus_tag LOCUS_18620 gene rplM 607551 607979 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421107.1 protein_id gnl|my_center|LOCUS_18620 607993 608397 gene locus_tag LOCUS_18630 gene rpsI 607993 608397 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546072.1 protein_id gnl|my_center|LOCUS_18630 608514 608765 gene locus_tag LOCUS_18640 608514 608765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 609645 608830 gene locus_tag LOCUS_18650 609645 608830 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889570.1 protein_id gnl|my_center|LOCUS_18650 610291 609671 gene locus_tag LOCUS_18660 gene ureG 610291 609671 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095530.1 protein_id gnl|my_center|LOCUS_18660 610995 610399 gene locus_tag LOCUS_18670 610995 610399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 611545 611084 gene locus_tag LOCUS_18680 gene ureE 611545 611084 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889573.1 protein_id gnl|my_center|LOCUS_18680 613427 611652 gene locus_tag LOCUS_18690 gene ureC 613427 611652 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186033.1 protein_id gnl|my_center|LOCUS_18690 613868 613512 gene locus_tag LOCUS_18700 613868 613512 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056185.1 protein_id gnl|my_center|LOCUS_18700 614286 613984 gene locus_tag LOCUS_18710 614286 613984 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857708.1 protein_id gnl|my_center|LOCUS_18710 615219 614443 gene locus_tag LOCUS_18720 gene urtE 615219 614443 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938472.1 protein_id gnl|my_center|LOCUS_18720 616110 615334 gene locus_tag LOCUS_18730 gene urtD 616110 615334 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056965.1 protein_id gnl|my_center|LOCUS_18730 617285 616179 gene locus_tag LOCUS_18740 gene urtC 617285 616179 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244009.1 protein_id gnl|my_center|LOCUS_18740 619052 617289 gene locus_tag LOCUS_18750 gene urtB 619052 617289 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105141.1 protein_id gnl|my_center|LOCUS_18750 620441 619185 gene locus_tag LOCUS_18760 gene urtA 620441 619185 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269025.1 protein_id gnl|my_center|LOCUS_18760 621605 620634 gene locus_tag LOCUS_18770 621605 620634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 621910 622707 gene locus_tag LOCUS_18780 621910 622707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 622858 623880 gene locus_tag LOCUS_18790 gene argC 622858 623880 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943503.1 protein_id gnl|my_center|LOCUS_18790 625325 624009 gene locus_tag LOCUS_18800 gene argJ 625325 624009 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338759.1 protein_id gnl|my_center|LOCUS_18800 625519 626400 gene locus_tag LOCUS_18810 gene argB 625519 626400 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_18810 626582 627811 gene locus_tag LOCUS_18820 626582 627811 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_18820 627983 628939 gene locus_tag LOCUS_18830 gene argF 627983 628939 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_18830 630209 629187 gene locus_tag LOCUS_18840 630209 629187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 631257 630451 gene locus_tag LOCUS_18850 631257 630451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 634364 631443 gene locus_tag LOCUS_18860 gene gcvP 634364 631443 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140250.1 protein_id gnl|my_center|LOCUS_18860 634514 635185 gene locus_tag LOCUS_18870 gene nth 634514 635185 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778932.1 protein_id gnl|my_center|LOCUS_18870 635391 635467 gene locus_tag LOCUS_t00190 635391 635467 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 636230 635514 gene locus_tag LOCUS_18880 636230 635514 CDS product DUF1223 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195184.1 protein_id gnl|my_center|LOCUS_18880 636398 638275 gene locus_tag LOCUS_18890 636398 638275 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_18890 638392 639387 gene locus_tag LOCUS_18900 638392 639387 CDS product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109103.1 protein_id gnl|my_center|LOCUS_18900 640666 639437 gene locus_tag LOCUS_18910 640666 639437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 642110 640686 gene locus_tag LOCUS_18920 642110 640686 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444920.1 protein_id gnl|my_center|LOCUS_18920 643736 642132 gene locus_tag LOCUS_18930 643736 642132 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921597.1 protein_id gnl|my_center|LOCUS_18930 643812 646850 gene locus_tag LOCUS_18940 643812 646850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 646958 647737 gene locus_tag LOCUS_18950 646958 647737 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399111.1 protein_id gnl|my_center|LOCUS_18950 647824 648726 gene locus_tag LOCUS_18960 647824 648726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 649013 648762 gene locus_tag LOCUS_18970 649013 648762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 651111 649045 gene locus_tag LOCUS_18980 651111 649045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 652310 651261 gene locus_tag LOCUS_18990 652310 651261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 653299 652394 gene locus_tag LOCUS_19000 653299 652394 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919502.1 protein_id gnl|my_center|LOCUS_19000 653592 654356 gene locus_tag LOCUS_19010 653592 654356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 654415 654633 gene locus_tag LOCUS_19020 654415 654633 CDS product DUF2835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110339.1 protein_id gnl|my_center|LOCUS_19020 654866 654660 gene locus_tag LOCUS_19030 654866 654660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 656101 655004 gene locus_tag LOCUS_19040 656101 655004 CDS product peptidylglycine monooxygenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663621.1 protein_id gnl|my_center|LOCUS_19040 659347 656240 gene locus_tag LOCUS_19050 659347 656240 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918997.1 protein_id gnl|my_center|LOCUS_19050 660760 659522 gene locus_tag LOCUS_19060 660760 659522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 660881 662422 gene locus_tag LOCUS_19070 gene guaA 660881 662422 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_19070 662481 663242 gene locus_tag LOCUS_19080 662481 663242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 663401 664696 gene locus_tag LOCUS_19090 gene hisD 663401 664696 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970966.1 protein_id gnl|my_center|LOCUS_19090 664767 665894 gene locus_tag LOCUS_19100 gene hisC 664767 665894 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943720.1 protein_id gnl|my_center|LOCUS_19100 665864 666463 gene locus_tag LOCUS_19110 gene hisB 665864 666463 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_19110 666552 667259 gene locus_tag LOCUS_19120 gene hisH 666552 667259 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333911.1 protein_id gnl|my_center|LOCUS_19120 667442 668740 gene locus_tag LOCUS_19130 667442 668740 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326127.1 protein_id gnl|my_center|LOCUS_19130 669570 668806 gene locus_tag LOCUS_19140 669570 668806 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841479.1 protein_id gnl|my_center|LOCUS_19140 669698 670105 gene locus_tag LOCUS_19150 gene acpS 669698 670105 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873555.1 protein_id gnl|my_center|LOCUS_19150 670118 670759 gene locus_tag LOCUS_19160 670118 670759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 670756 672255 gene locus_tag LOCUS_19170 670756 672255 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_19170 672245 673396 gene locus_tag LOCUS_19180 gene dprA 672245 673396 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_19180 673886 673551 gene locus_tag LOCUS_19190 673886 673551 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_19190 674631 673993 gene locus_tag LOCUS_19200 674631 673993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 675488 674976 gene locus_tag LOCUS_19210 675488 674976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 675963 675496 gene locus_tag LOCUS_19220 gene nrdR 675963 675496 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259262.1 protein_id gnl|my_center|LOCUS_19220 676541 675975 gene locus_tag LOCUS_19230 676541 675975 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_19230 676724 677869 gene locus_tag LOCUS_19240 gene tgt 676724 677869 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_19240 677968 678891 gene locus_tag LOCUS_19250 677968 678891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 678888 679826 gene locus_tag LOCUS_19260 678888 679826 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257881.1 protein_id gnl|my_center|LOCUS_19260 679845 682283 gene locus_tag LOCUS_19270 679845 682283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 682338 683267 gene locus_tag LOCUS_19280 682338 683267 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545566.1 protein_id gnl|my_center|LOCUS_19280 684629 683493 gene locus_tag LOCUS_19290 684629 683493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 684864 687884 gene locus_tag LOCUS_19300 gene secA 684864 687884 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932908.1 protein_id gnl|my_center|LOCUS_19300 689385 688018 gene locus_tag LOCUS_19310 689385 688018 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142192546.1 protein_id gnl|my_center|LOCUS_19310 689878 689432 gene locus_tag LOCUS_19320 689878 689432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 690050 690697 gene locus_tag LOCUS_19330 690050 690697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 691133 690765 gene locus_tag LOCUS_19340 691133 690765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 691651 691316 gene locus_tag LOCUS_19350 691651 691316 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224339.1 protein_id gnl|my_center|LOCUS_19350 694691 691965 gene locus_tag LOCUS_19360 694691 691965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19360 695799 694717 gene locus_tag LOCUS_19370 695799 694717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19370 696265 698121 gene locus_tag LOCUS_19380 696265 698121 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203862.1 protein_id gnl|my_center|LOCUS_19380 698348 698854 gene locus_tag LOCUS_19390 698348 698854 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940808.1 protein_id gnl|my_center|LOCUS_19390 698904 700307 gene locus_tag LOCUS_19400 698904 700307 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227115.1 protein_id gnl|my_center|LOCUS_19400 701080 700358 gene locus_tag LOCUS_19410 701080 700358 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140947.1 protein_id gnl|my_center|LOCUS_19410 701249 702064 gene locus_tag LOCUS_19420 gene rhlP 701249 702064 CDS product rhombotarget lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072488.1 protein_id gnl|my_center|LOCUS_19420 702043 702705 gene locus_tag LOCUS_19430 702043 702705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 705532 702794 gene locus_tag LOCUS_19440 705532 702794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 708446 705636 gene locus_tag LOCUS_19450 708446 705636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 711430 708482 gene locus_tag LOCUS_19460 711430 708482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 714543 711535 gene locus_tag LOCUS_19470 714543 711535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 717544 714566 gene locus_tag LOCUS_19480 717544 714566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 718515 717769 gene locus_tag LOCUS_19490 718515 717769 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334461.1 protein_id gnl|my_center|LOCUS_19490 723887 718707 gene locus_tag LOCUS_19500 723887 718707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 723778 724119 gene locus_tag LOCUS_19510 723778 724119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 725547 724243 gene locus_tag LOCUS_19520 725547 724243 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_19520 726595 725558 gene locus_tag LOCUS_19530 726595 725558 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_19530 728119 726752 gene locus_tag LOCUS_19540 728119 726752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328450.1 protein_id gnl|my_center|LOCUS_19540 728994 728224 gene locus_tag LOCUS_19550 728994 728224 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118984.1 protein_id gnl|my_center|LOCUS_19550 730890 729121 gene locus_tag LOCUS_19560 730890 729121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 732019 730883 gene locus_tag LOCUS_19570 732019 730883 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085074.1 protein_id gnl|my_center|LOCUS_19570 734009 732168 gene locus_tag LOCUS_19580 gene recQ 734009 732168 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941564.1 protein_id gnl|my_center|LOCUS_19580 734099 734980 gene locus_tag LOCUS_19590 734099 734980 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245396.1 protein_id gnl|my_center|LOCUS_19590 735045 736421 gene locus_tag LOCUS_19600 735045 736421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 737292 736513 gene locus_tag LOCUS_19610 737292 736513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 738735 737599 gene locus_tag LOCUS_19620 738735 737599 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531089.1 protein_id gnl|my_center|LOCUS_19620 738947 742135 gene locus_tag LOCUS_19630 738947 742135 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037631.1 protein_id gnl|my_center|LOCUS_19630 742514 749917 gene locus_tag LOCUS_19640 742514 749917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 751727 750306 gene locus_tag LOCUS_19650 751727 750306 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120435.1 protein_id gnl|my_center|LOCUS_19650 754353 751963 gene locus_tag LOCUS_19660 754353 751963 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391071.1 protein_id gnl|my_center|LOCUS_19660 755050 754355 gene locus_tag LOCUS_19670 755050 754355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 755305 755087 gene locus_tag LOCUS_19680 755305 755087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 756729 755302 gene locus_tag LOCUS_19690 gene ccoG 756729 755302 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120871.1 protein_id gnl|my_center|LOCUS_19690 757339 756764 gene locus_tag LOCUS_19700 757339 756764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 757511 757326 gene locus_tag LOCUS_19710 757511 757326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 759850 757523 gene locus_tag LOCUS_19720 gene ccoN 759850 757523 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_19720 760204 759968 gene locus_tag LOCUS_19730 760204 759968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 760487 760272 gene locus_tag LOCUS_19740 760487 760272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 761542 760577 gene locus_tag LOCUS_19750 761542 760577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 761793 761563 gene locus_tag LOCUS_19760 761793 761563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 761680 762909 gene locus_tag LOCUS_19770 761680 762909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 762906 763349 gene locus_tag LOCUS_19780 762906 763349 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566213.1 protein_id gnl|my_center|LOCUS_19780 763355 764413 gene locus_tag LOCUS_19790 763355 764413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19790 764410 765114 gene locus_tag LOCUS_19800 764410 765114 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_19800 765206 765697 gene locus_tag LOCUS_19810 765206 765697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 767271 765952 gene locus_tag LOCUS_19820 767271 765952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121732.1 protein_id gnl|my_center|LOCUS_19820 768308 767334 gene locus_tag LOCUS_19830 768308 767334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 769628 768327 gene locus_tag LOCUS_19840 769628 768327 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931723.1 protein_id gnl|my_center|LOCUS_19840 769817 770608 gene locus_tag LOCUS_19850 769817 770608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 770636 772060 gene locus_tag LOCUS_19860 gene hemG 770636 772060 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403969.1 protein_id gnl|my_center|LOCUS_19860 773776 772118 gene locus_tag LOCUS_19870 gene sulP 773776 772118 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926914.1 protein_id gnl|my_center|LOCUS_19870 774410 773856 gene locus_tag LOCUS_19880 774410 773856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 774904 774407 gene locus_tag LOCUS_19890 774904 774407 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403299.1 protein_id gnl|my_center|LOCUS_19890 776576 774933 gene locus_tag LOCUS_19900 776576 774933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19900 776946 776755 gene locus_tag LOCUS_19910 776946 776755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 778435 777032 gene locus_tag LOCUS_19920 gene hemN 778435 777032 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938468.1 protein_id gnl|my_center|LOCUS_19920 778598 780274 gene locus_tag LOCUS_19930 778598 780274 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089209.1 protein_id gnl|my_center|LOCUS_19930 780886 780476 gene locus_tag LOCUS_19940 780886 780476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 782870 781002 gene locus_tag LOCUS_19950 782870 781002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19950 784108 782867 gene locus_tag LOCUS_19960 784108 782867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19960 784440 784105 gene locus_tag LOCUS_19970 784440 784105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 784327 784665 gene locus_tag LOCUS_19980 784327 784665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 784767 786263 gene locus_tag LOCUS_19990 784767 786263 CDS product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943871.1 protein_id gnl|my_center|LOCUS_19990 786779 786498 gene locus_tag LOCUS_20000 786779 786498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 786962 789082 gene locus_tag LOCUS_20010 786962 789082 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940947.1 protein_id gnl|my_center|LOCUS_20010 789479 790258 gene locus_tag LOCUS_20020 789479 790258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 790295 792463 gene locus_tag LOCUS_20030 790295 792463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 792738 795965 gene locus_tag LOCUS_20040 792738 795965 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918879.1 protein_id gnl|my_center|LOCUS_20040 796183 799356 gene locus_tag LOCUS_20050 796183 799356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 799616 801985 gene locus_tag LOCUS_20060 799616 801985 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_20060 802898 802128 gene locus_tag LOCUS_20070 802898 802128 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_20070 805128 803047 gene locus_tag LOCUS_20080 805128 803047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 805237 805491 gene locus_tag LOCUS_20090 805237 805491 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162015947.1 protein_id gnl|my_center|LOCUS_20090 805547 807235 gene locus_tag LOCUS_20100 gene ettA 805547 807235 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_20100 807448 810228 gene locus_tag LOCUS_20110 807448 810228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 810153 810437 gene locus_tag LOCUS_20120 810153 810437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 810499 811146 gene locus_tag LOCUS_20130 810499 811146 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392490.1 protein_id gnl|my_center|LOCUS_20130 811272 811985 gene locus_tag LOCUS_20140 811272 811985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 812066 812671 gene locus_tag LOCUS_20150 812066 812671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 813061 812867 gene locus_tag LOCUS_20160 813061 812867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 813341 813141 gene locus_tag LOCUS_20170 813341 813141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 813585 815177 gene locus_tag LOCUS_20180 813585 815177 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921665.1 protein_id gnl|my_center|LOCUS_20180 815790 815380 gene locus_tag LOCUS_20190 815790 815380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 816125 816499 gene locus_tag LOCUS_20200 816125 816499 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329333.1 protein_id gnl|my_center|LOCUS_20200 817080 816634 gene locus_tag LOCUS_20210 817080 816634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 817315 817094 gene locus_tag LOCUS_20220 817315 817094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 817314 817799 gene locus_tag LOCUS_20230 817314 817799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 818874 817813 gene locus_tag LOCUS_20240 818874 817813 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941130.1 protein_id gnl|my_center|LOCUS_20240 820043 818871 gene locus_tag LOCUS_20250 820043 818871 CDS product DUF898 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941131.1 protein_id gnl|my_center|LOCUS_20250 820616 820086 gene locus_tag LOCUS_20260 gene mog 820616 820086 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070478.1 protein_id gnl|my_center|LOCUS_20260 821452 820613 gene locus_tag LOCUS_20270 gene gluQRS 821452 820613 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922628.1 protein_id gnl|my_center|LOCUS_20270 821512 822093 gene locus_tag LOCUS_20280 821512 822093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 822191 822727 gene locus_tag LOCUS_20290 822191 822727 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108825999.1 protein_id gnl|my_center|LOCUS_20290 825223 822746 gene locus_tag LOCUS_20300 825223 822746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 827136 825226 gene locus_tag LOCUS_20310 827136 825226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 828203 827133 gene locus_tag LOCUS_20320 828203 827133 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_20320 829132 828209 gene locus_tag LOCUS_20330 829132 828209 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421555.1 protein_id gnl|my_center|LOCUS_20330 830127 829165 gene locus_tag LOCUS_20340 830127 829165 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330234.1 protein_id gnl|my_center|LOCUS_20340 830250 830642 gene locus_tag LOCUS_20350 830250 830642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 833859 830746 gene locus_tag LOCUS_20360 833859 830746 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918997.1 protein_id gnl|my_center|LOCUS_20360 836468 834240 gene locus_tag LOCUS_20370 836468 834240 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919006.1 protein_id gnl|my_center|LOCUS_20370 837374 836541 gene locus_tag LOCUS_20380 837374 836541 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_20380 838186 837440 gene locus_tag LOCUS_20390 838186 837440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 839063 838356 gene locus_tag LOCUS_20400 839063 838356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 840304 839084 gene locus_tag LOCUS_20410 840304 839084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 841886 840345 gene locus_tag LOCUS_20420 841886 840345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 843889 842714 gene locus_tag LOCUS_20430 843889 842714 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776294.1 protein_id gnl|my_center|LOCUS_20430 844133 845284 gene locus_tag LOCUS_20440 844133 845284 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085770.1 protein_id gnl|my_center|LOCUS_20440 847850 847506 gene locus_tag LOCUS_20450 847850 847506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 847737 848492 gene locus_tag LOCUS_20460 847737 848492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 848471 850249 gene locus_tag LOCUS_20470 848471 850249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 850252 851109 gene locus_tag LOCUS_20480 850252 851109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 852072 851089 gene locus_tag LOCUS_20490 852072 851089 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327241.1 protein_id gnl|my_center|LOCUS_20490 855038 852126 gene locus_tag LOCUS_20500 855038 852126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 855986 855093 gene locus_tag LOCUS_20510 855986 855093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 857246 856122 gene locus_tag LOCUS_20520 857246 856122 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_20520 860277 857329 gene locus_tag LOCUS_20530 860277 857329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 860467 861678 gene locus_tag LOCUS_20540 860467 861678 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324978.1 protein_id gnl|my_center|LOCUS_20540 861729 862301 gene locus_tag LOCUS_20550 861729 862301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 863206 862427 gene locus_tag LOCUS_20560 gene surE 863206 862427 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037201557.1 protein_id gnl|my_center|LOCUS_20560 865542 863332 gene locus_tag LOCUS_20570 gene pnp 865542 863332 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_20570 866145 865876 gene locus_tag LOCUS_20580 gene rpsO 866145 865876 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229392.1 protein_id gnl|my_center|LOCUS_20580 867042 866617 gene locus_tag LOCUS_20590 867042 866617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 867852 867052 gene locus_tag LOCUS_20600 867852 867052 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_20600 868802 867864 gene locus_tag LOCUS_20610 868802 867864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20610 869038 869748 gene locus_tag LOCUS_20620 869038 869748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 869956 870903 gene locus_tag LOCUS_20630 869956 870903 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124073.1 protein_id gnl|my_center|LOCUS_20630 871876 871151 gene locus_tag LOCUS_20640 871876 871151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 874514 872334 gene locus_tag LOCUS_20650 874514 872334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 876134 874920 gene locus_tag LOCUS_20660 876134 874920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 877746 876463 gene locus_tag LOCUS_20670 877746 876463 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921586.1 protein_id gnl|my_center|LOCUS_20670 879144 878563 gene locus_tag LOCUS_20680 879144 878563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 880684 879668 gene locus_tag LOCUS_20690 880684 879668 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532810.1 protein_id gnl|my_center|LOCUS_20690 882584 880839 gene locus_tag LOCUS_20700 gene msbA 882584 880839 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_20700 883653 882742 gene locus_tag LOCUS_20710 883653 882742 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144110.1 protein_id gnl|my_center|LOCUS_20710 884577 883657 gene locus_tag LOCUS_20720 gene oppB 884577 883657 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706429.1 protein_id gnl|my_center|LOCUS_20720 886396 884747 gene locus_tag LOCUS_20730 886396 884747 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144112.1 protein_id gnl|my_center|LOCUS_20730 886541 887278 gene locus_tag LOCUS_20740 886541 887278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 888942 887428 gene locus_tag LOCUS_20750 888942 887428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 890875 889130 gene locus_tag LOCUS_20760 gene rng 890875 889130 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_20760 892243 890969 gene locus_tag LOCUS_20770 gene rodA 892243 890969 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460900.1 protein_id gnl|my_center|LOCUS_20770 893784 892240 gene locus_tag LOCUS_20780 893784 892240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 893878 895254 gene locus_tag LOCUS_20790 893878 895254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 895251 896396 gene locus_tag LOCUS_20800 895251 896396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 896393 897379 gene locus_tag LOCUS_20810 896393 897379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 898199 897330 gene locus_tag LOCUS_20820 898199 897330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 898909 898211 gene locus_tag LOCUS_20830 898909 898211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 899026 900123 gene locus_tag LOCUS_20840 899026 900123 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255994.1 protein_id gnl|my_center|LOCUS_20840 900120 901772 gene locus_tag LOCUS_20850 900120 901772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 901853 903469 gene locus_tag LOCUS_20860 gene rny 901853 903469 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965122.1 protein_id gnl|my_center|LOCUS_20860 903567 903989 gene locus_tag LOCUS_20870 gene queF 903567 903989 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_20870 904995 904189 gene locus_tag LOCUS_20880 gene hisN 904995 904189 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090456.1 protein_id gnl|my_center|LOCUS_20880 905145 906959 gene locus_tag LOCUS_20890 905145 906959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 910119 907231 gene locus_tag LOCUS_20900 910119 907231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 910309 910974 gene locus_tag LOCUS_20910 910309 910974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 911100 911678 gene locus_tag LOCUS_20920 911100 911678 CDS product redoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165447214.1 protein_id gnl|my_center|LOCUS_20920 911698 912240 gene locus_tag LOCUS_20930 gene sigH 911698 912240 CDS product sigma-70 family RNA polymerase sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893296.1 protein_id gnl|my_center|LOCUS_20930 912237 912959 gene locus_tag LOCUS_20940 912237 912959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 913749 912979 gene locus_tag LOCUS_20950 913749 912979 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920874.1 protein_id gnl|my_center|LOCUS_20950 913854 915662 gene locus_tag LOCUS_20960 913854 915662 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120247.1 protein_id gnl|my_center|LOCUS_20960 915826 916851 gene locus_tag LOCUS_20970 915826 916851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 917196 917831 gene locus_tag LOCUS_20980 917196 917831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 919328 917913 gene locus_tag LOCUS_20990 919328 917913 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_20990 920096 919443 gene locus_tag LOCUS_21000 920096 919443 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245030.1 protein_id gnl|my_center|LOCUS_21000 920702 920154 gene locus_tag LOCUS_21010 920702 920154 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_21010 921933 920710 gene locus_tag LOCUS_21020 921933 920710 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275517.1 protein_id gnl|my_center|LOCUS_21020 922082 923641 gene locus_tag LOCUS_21030 922082 923641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 923733 925199 gene locus_tag LOCUS_21040 923733 925199 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227986.1 protein_id gnl|my_center|LOCUS_21040 925251 926339 gene locus_tag LOCUS_21050 925251 926339 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227985.1 protein_id gnl|my_center|LOCUS_21050 926356 927630 gene locus_tag LOCUS_21060 926356 927630 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812443.1 protein_id gnl|my_center|LOCUS_21060 927627 928103 gene locus_tag LOCUS_21070 927627 928103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 930405 928483 gene locus_tag LOCUS_21080 930405 928483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 932098 930458 gene locus_tag LOCUS_21090 932098 930458 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090268.1 protein_id gnl|my_center|LOCUS_21090 933758 932343 gene locus_tag LOCUS_21100 933758 932343 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_21100 933842 935725 gene locus_tag LOCUS_21110 gene pepF 933842 935725 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903691.1 protein_id gnl|my_center|LOCUS_21110 937055 936087 gene locus_tag LOCUS_21120 gene corA 937055 936087 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259376.1 protein_id gnl|my_center|LOCUS_21120 937697 937227 gene locus_tag LOCUS_21130 937697 937227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 937839 938447 gene locus_tag LOCUS_21140 937839 938447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 <939845 938808 gene locus_tag LOCUS_21150 <939845 938808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021593.1:DNA gyrase subunit A >Feature sequence03 <1 955 gene locus_tag LOCUS_21160 <1 955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259320.1:cysteine desulfurase 3958 1094 gene locus_tag LOCUS_21170 3958 1094 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920490.1 protein_id gnl|my_center|LOCUS_21170 5436 4036 gene locus_tag LOCUS_21180 5436 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 5602 7845 gene locus_tag LOCUS_21190 5602 7845 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122605.1 protein_id gnl|my_center|LOCUS_21190 7958 9532 gene locus_tag LOCUS_21200 7958 9532 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727481.1 protein_id gnl|my_center|LOCUS_21200 9850 9557 gene locus_tag LOCUS_21210 9850 9557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 10174 11514 gene locus_tag LOCUS_21220 10174 11514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 11582 12130 gene locus_tag LOCUS_21230 11582 12130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 12123 13064 gene locus_tag LOCUS_21240 12123 13064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 13123 13704 gene locus_tag LOCUS_21250 13123 13704 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202253.1 protein_id gnl|my_center|LOCUS_21250 14896 13742 gene locus_tag LOCUS_21260 14896 13742 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_21260 15812 14952 gene locus_tag LOCUS_21270 15812 14952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 15886 16875 gene locus_tag LOCUS_21280 15886 16875 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_21280 16934 18187 gene locus_tag LOCUS_21290 16934 18187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 18283 19932 gene locus_tag LOCUS_21300 gene fumA 18283 19932 CDS product class I fumarate hydratase FumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209418.1 protein_id gnl|my_center|LOCUS_21300 20456 20052 gene locus_tag LOCUS_21310 20456 20052 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174926.1 protein_id gnl|my_center|LOCUS_21310 21390 20533 gene locus_tag LOCUS_21320 21390 20533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 22037 21387 gene locus_tag LOCUS_21330 gene rpoE 22037 21387 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036461.1 protein_id gnl|my_center|LOCUS_21330 23137 22109 gene locus_tag LOCUS_21340 23137 22109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 23267 23878 gene locus_tag LOCUS_21350 23267 23878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 30892 24017 gene locus_tag LOCUS_21360 30892 24017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 32710 30932 gene locus_tag LOCUS_21370 32710 30932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 33236 32712 gene locus_tag LOCUS_21380 33236 32712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 33790 33233 gene locus_tag LOCUS_21390 33790 33233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 34419 33790 gene locus_tag LOCUS_21400 34419 33790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 35443 34391 gene locus_tag LOCUS_21410 35443 34391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 39130 36002 gene locus_tag LOCUS_21420 39130 36002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 41969 39123 gene locus_tag LOCUS_21430 41969 39123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 42081 43685 gene locus_tag LOCUS_21440 42081 43685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 44040 43780 gene locus_tag LOCUS_21450 44040 43780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 44227 44898 gene locus_tag LOCUS_21460 44227 44898 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_21460 45013 45519 gene locus_tag LOCUS_21470 45013 45519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 45509 46060 gene locus_tag LOCUS_21480 45509 46060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 46117 47541 gene locus_tag LOCUS_21490 46117 47541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 47649 48251 gene locus_tag LOCUS_21500 47649 48251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 48260 49039 gene locus_tag LOCUS_21510 48260 49039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 49043 51679 gene locus_tag LOCUS_21520 49043 51679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 52330 56088 gene locus_tag LOCUS_21530 52330 56088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 55573 55483 gene locus_tag LOCUS_t00200 55573 55483 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 56118 59201 gene locus_tag LOCUS_21540 56118 59201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 59360 60199 gene locus_tag LOCUS_21550 59360 60199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 60624 64532 gene locus_tag LOCUS_21560 60624 64532 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113014.1 protein_id gnl|my_center|LOCUS_21560 66614 64704 gene locus_tag LOCUS_21570 66614 64704 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582947.1 protein_id gnl|my_center|LOCUS_21570 68880 66826 gene locus_tag LOCUS_21580 68880 66826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 68976 70493 gene locus_tag LOCUS_21590 68976 70493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 70528 71271 gene locus_tag LOCUS_21600 70528 71271 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932310.1 protein_id gnl|my_center|LOCUS_21600 72575 71520 gene locus_tag LOCUS_21610 72575 71520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 73585 72581 gene locus_tag LOCUS_21620 73585 72581 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103695.1 protein_id gnl|my_center|LOCUS_21620 74817 73582 gene locus_tag LOCUS_21630 74817 73582 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202923.1 protein_id gnl|my_center|LOCUS_21630 75269 74814 gene locus_tag LOCUS_21640 75269 74814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 76390 75266 gene locus_tag LOCUS_21650 gene wecB 76390 75266 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261049.1 protein_id gnl|my_center|LOCUS_21650 77550 76423 gene locus_tag LOCUS_21660 77550 76423 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261048.1 protein_id gnl|my_center|LOCUS_21660 78597 77575 gene locus_tag LOCUS_21670 78597 77575 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202260.1 protein_id gnl|my_center|LOCUS_21670 79942 78626 gene locus_tag LOCUS_21680 79942 78626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 80502 79939 gene locus_tag LOCUS_21690 80502 79939 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259619.1 protein_id gnl|my_center|LOCUS_21690 81468 80542 gene locus_tag LOCUS_21700 81468 80542 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937387.1 protein_id gnl|my_center|LOCUS_21700 82401 81502 gene locus_tag LOCUS_21710 82401 81502 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561952.1 protein_id gnl|my_center|LOCUS_21710 83410 82430 gene locus_tag LOCUS_21720 83410 82430 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937387.1 protein_id gnl|my_center|LOCUS_21720 83883 83410 gene locus_tag LOCUS_21730 83883 83410 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937385.1 protein_id gnl|my_center|LOCUS_21730 84980 83880 gene locus_tag LOCUS_21740 gene rfbG 84980 83880 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937384.1 protein_id gnl|my_center|LOCUS_21740 85767 84994 gene locus_tag LOCUS_21750 gene rfbF 85767 84994 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859505.1 protein_id gnl|my_center|LOCUS_21750 86901 85771 gene locus_tag LOCUS_21760 86901 85771 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937386.1 protein_id gnl|my_center|LOCUS_21760 88012 86966 gene locus_tag LOCUS_21770 88012 86966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679047.1 protein_id gnl|my_center|LOCUS_21770 89313 88012 gene locus_tag LOCUS_21780 89313 88012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 89783 89310 gene locus_tag LOCUS_21790 89783 89310 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939583.1 protein_id gnl|my_center|LOCUS_21790 90722 89805 gene locus_tag LOCUS_21800 90722 89805 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937646.1 protein_id gnl|my_center|LOCUS_21800 91808 90741 gene locus_tag LOCUS_21810 gene aroB 91808 90741 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391488.1 protein_id gnl|my_center|LOCUS_21810 92508 91801 gene locus_tag LOCUS_21820 gene fabG 92508 91801 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065092.1 protein_id gnl|my_center|LOCUS_21820 93614 92523 gene locus_tag LOCUS_21830 93614 92523 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734411.1 protein_id gnl|my_center|LOCUS_21830 94378 93611 gene locus_tag LOCUS_21840 gene kdsB 94378 93611 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848238.1 protein_id gnl|my_center|LOCUS_21840 95364 94375 gene locus_tag LOCUS_21850 95364 94375 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661932.1 protein_id gnl|my_center|LOCUS_21850 96225 95371 gene locus_tag LOCUS_21860 96225 95371 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937650.1 protein_id gnl|my_center|LOCUS_21860 96776 96276 gene locus_tag LOCUS_21870 96776 96276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 98280 96790 gene locus_tag LOCUS_21880 gene hfsF 98280 96790 CDS product polysaccharide biosynthesis protein HsfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920284.1 protein_id gnl|my_center|LOCUS_21880 99425 98277 gene locus_tag LOCUS_21890 99425 98277 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057184.1 protein_id gnl|my_center|LOCUS_21890 99828 99415 gene locus_tag LOCUS_21900 99828 99415 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057183.1 protein_id gnl|my_center|LOCUS_21900 100406 99825 gene locus_tag LOCUS_21910 100406 99825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21910 101179 100403 gene locus_tag LOCUS_21920 101179 100403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 101730 101221 gene locus_tag LOCUS_21930 101730 101221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 102382 102029 gene locus_tag LOCUS_21940 102382 102029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 103054 102410 gene locus_tag LOCUS_21950 gene eda 103054 102410 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_21950 103147 103231 gene locus_tag LOCUS_t00210 103147 103231 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 103575 104339 gene locus_tag LOCUS_21960 103575 104339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 105756 104635 gene locus_tag LOCUS_21970 gene aroC 105756 104635 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_21970 105963 108077 gene locus_tag LOCUS_21980 gene gspD 105963 108077 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213605796.1 protein_id gnl|my_center|LOCUS_21980 108074 109891 gene locus_tag LOCUS_21990 108074 109891 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615922.1 protein_id gnl|my_center|LOCUS_21990 109962 111245 gene locus_tag LOCUS_22000 109962 111245 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_22000 113248 111452 gene locus_tag LOCUS_22010 113248 111452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 114606 113353 gene locus_tag LOCUS_22020 114606 113353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 116357 114603 gene locus_tag LOCUS_22030 116357 114603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 116989 116354 gene locus_tag LOCUS_22040 116989 116354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 117663 116986 gene locus_tag LOCUS_22050 117663 116986 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_22050 118001 117765 gene locus_tag LOCUS_22060 118001 117765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 118514 118005 gene locus_tag LOCUS_22070 118514 118005 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932750.1 protein_id gnl|my_center|LOCUS_22070 119490 118498 gene locus_tag LOCUS_22080 119490 118498 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932752.1 protein_id gnl|my_center|LOCUS_22080 120666 119509 gene locus_tag LOCUS_22090 120666 119509 CDS product DUF3570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072166.1 protein_id gnl|my_center|LOCUS_22090 121356 120817 gene locus_tag LOCUS_22100 121356 120817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 122516 121353 gene locus_tag LOCUS_22110 122516 121353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 123637 122522 gene locus_tag LOCUS_22120 123637 122522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 124383 123697 gene locus_tag LOCUS_22130 124383 123697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 124886 124380 gene locus_tag LOCUS_22140 124886 124380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 125470 124883 gene locus_tag LOCUS_22150 125470 124883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 126023 125526 gene locus_tag LOCUS_22160 gene xcpT 126023 125526 CDS product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 protein_id gnl|my_center|LOCUS_22160 126715 126110 gene locus_tag LOCUS_22170 126715 126110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 128209 126761 gene locus_tag LOCUS_22180 128209 126761 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480302.1 protein_id gnl|my_center|LOCUS_22180 131469 128224 gene locus_tag LOCUS_22190 131469 128224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 132862 131630 gene locus_tag LOCUS_22200 132862 131630 CDS product pyrophosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922349.1 protein_id gnl|my_center|LOCUS_22200 133018 132943 gene locus_tag LOCUS_t00220 133018 132943 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 133119 133313 gene locus_tag LOCUS_22210 133119 133313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 133376 134368 gene locus_tag LOCUS_22220 133376 134368 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388203.1 protein_id gnl|my_center|LOCUS_22220 136618 134387 gene locus_tag LOCUS_22230 gene vpsO 136618 134387 CDS product exopolysaccharide regulatory tyrosine autokinase VpsO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_22230 137094 136639 gene locus_tag LOCUS_22240 137094 136639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 138506 137355 gene locus_tag LOCUS_22250 138506 137355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 139930 138842 gene locus_tag LOCUS_22260 gene hisC 139930 138842 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_22260 139984 141135 gene locus_tag LOCUS_22270 139984 141135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 141781 141149 gene locus_tag LOCUS_22280 141781 141149 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117887.1 protein_id gnl|my_center|LOCUS_22280 141907 142791 gene locus_tag LOCUS_22290 141907 142791 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037249854.1 protein_id gnl|my_center|LOCUS_22290 144489 142840 gene locus_tag LOCUS_22300 144489 142840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22300 144992 144591 gene locus_tag LOCUS_22310 144992 144591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 145103 146551 gene locus_tag LOCUS_22320 145103 146551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 146557 146817 gene locus_tag LOCUS_22330 146557 146817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 146820 147896 gene locus_tag LOCUS_22340 146820 147896 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_22340 149319 147904 gene locus_tag LOCUS_22350 149319 147904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 150653 149316 gene locus_tag LOCUS_22360 150653 149316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 151128 150706 gene locus_tag LOCUS_22370 151128 150706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 151279 151758 gene locus_tag LOCUS_22380 151279 151758 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089251.1 protein_id gnl|my_center|LOCUS_22380 151751 154726 gene locus_tag LOCUS_22390 151751 154726 CDS product M14 family zinc carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041976239.1 protein_id gnl|my_center|LOCUS_22390 154842 155180 gene locus_tag LOCUS_22400 154842 155180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 155837 155193 gene locus_tag LOCUS_22410 155837 155193 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772817.1 protein_id gnl|my_center|LOCUS_22410 156027 157508 gene locus_tag LOCUS_22420 156027 157508 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531053.1 protein_id gnl|my_center|LOCUS_22420 157600 158244 gene locus_tag LOCUS_22430 157600 158244 CDS product 4-vinyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799489.1 protein_id gnl|my_center|LOCUS_22430 158252 158467 gene locus_tag LOCUS_22440 158252 158467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 158479 159126 gene locus_tag LOCUS_22450 158479 159126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 159134 159751 gene locus_tag LOCUS_22460 159134 159751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 160316 159735 gene locus_tag LOCUS_22470 160316 159735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 160485 161927 gene locus_tag LOCUS_22480 160485 161927 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 protein_id gnl|my_center|LOCUS_22480 161948 162880 gene locus_tag LOCUS_22490 gene yedA 161948 162880 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268946.1 protein_id gnl|my_center|LOCUS_22490 162890 163333 gene locus_tag LOCUS_22500 162890 163333 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259124.1 protein_id gnl|my_center|LOCUS_22500 165538 163340 gene locus_tag LOCUS_22510 165538 163340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 166070 165603 gene locus_tag LOCUS_22520 166070 165603 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390043.1 protein_id gnl|my_center|LOCUS_22520 167031 166135 gene locus_tag LOCUS_22530 167031 166135 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 protein_id gnl|my_center|LOCUS_22530 168167 167106 gene locus_tag LOCUS_22540 gene rlmN 168167 167106 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922584.1 protein_id gnl|my_center|LOCUS_22540 169845 168232 gene locus_tag LOCUS_22550 169845 168232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 169938 172055 gene locus_tag LOCUS_22560 169938 172055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 172276 172452 gene locus_tag LOCUS_22570 172276 172452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 173906 172380 gene locus_tag LOCUS_22580 173906 172380 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037254759.1 protein_id gnl|my_center|LOCUS_22580 174051 175511 gene locus_tag LOCUS_22590 174051 175511 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146578646.1 protein_id gnl|my_center|LOCUS_22590 178482 175678 gene locus_tag LOCUS_22600 gene rapA 178482 175678 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704808.1 protein_id gnl|my_center|LOCUS_22600 179111 179614 gene locus_tag LOCUS_22610 179111 179614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 179628 180005 gene locus_tag LOCUS_22620 179628 180005 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971114.1 protein_id gnl|my_center|LOCUS_22620 180618 180013 gene locus_tag LOCUS_22630 180618 180013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 180617 181387 gene locus_tag LOCUS_22640 180617 181387 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_22640 184867 181415 gene locus_tag LOCUS_22650 184867 181415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 186257 185244 gene locus_tag LOCUS_22660 186257 185244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 187388 186261 gene locus_tag LOCUS_22670 187388 186261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 188215 187385 gene locus_tag LOCUS_22680 188215 187385 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969246.1 protein_id gnl|my_center|LOCUS_22680 188987 188229 gene locus_tag LOCUS_22690 188987 188229 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975619.1 protein_id gnl|my_center|LOCUS_22690 189595 189053 gene locus_tag LOCUS_22700 189595 189053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 189677 190144 gene locus_tag LOCUS_22710 189677 190144 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_22710 191062 190160 gene locus_tag LOCUS_22720 191062 190160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 191813 191157 gene locus_tag LOCUS_22730 191813 191157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 192823 191981 gene locus_tag LOCUS_22740 192823 191981 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_22740 192953 193273 gene locus_tag LOCUS_22750 192953 193273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 193277 195100 gene locus_tag LOCUS_22760 193277 195100 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222087.1 protein_id gnl|my_center|LOCUS_22760 196285 195245 gene locus_tag LOCUS_22770 196285 195245 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426955.1 protein_id gnl|my_center|LOCUS_22770 197765 196461 gene locus_tag LOCUS_22780 gene lysA 197765 196461 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383406.1 protein_id gnl|my_center|LOCUS_22780 197852 198106 gene locus_tag LOCUS_22790 197852 198106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 198284 199111 gene locus_tag LOCUS_22800 198284 199111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 199187 200722 gene locus_tag LOCUS_22810 199187 200722 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868784.1 protein_id gnl|my_center|LOCUS_22810 200917 202452 gene locus_tag LOCUS_22820 200917 202452 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262003.1 protein_id gnl|my_center|LOCUS_22820 203377 202565 gene locus_tag LOCUS_22830 203377 202565 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364422.1 protein_id gnl|my_center|LOCUS_22830 205342 203420 gene locus_tag LOCUS_22840 205342 203420 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050920.1 protein_id gnl|my_center|LOCUS_22840 206118 205354 gene locus_tag LOCUS_22850 206118 205354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_22850 207522 206257 gene locus_tag LOCUS_22860 207522 206257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 208141 207560 gene locus_tag LOCUS_22870 208141 207560 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808789.1 protein_id gnl|my_center|LOCUS_22870 208739 208212 gene locus_tag LOCUS_22880 208739 208212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 209034 209588 gene locus_tag LOCUS_22890 209034 209588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 209585 210610 gene locus_tag LOCUS_22900 209585 210610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 210718 213396 gene locus_tag LOCUS_22910 210718 213396 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530098.1 protein_id gnl|my_center|LOCUS_22910 213557 213481 gene locus_tag LOCUS_t00230 213557 213481 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 213674 216196 gene locus_tag LOCUS_22920 213674 216196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 216375 217235 gene locus_tag LOCUS_22930 216375 217235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 218257 217523 gene locus_tag LOCUS_22940 218257 217523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 219231 218368 gene locus_tag LOCUS_22950 gene purU 219231 218368 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524116.1 protein_id gnl|my_center|LOCUS_22950 220306 219293 gene locus_tag LOCUS_22960 220306 219293 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257832.1 protein_id gnl|my_center|LOCUS_22960 223656 220414 gene locus_tag LOCUS_22970 gene carB 223656 220414 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930366.1 protein_id gnl|my_center|LOCUS_22970 223812 224663 gene locus_tag LOCUS_22980 223812 224663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 224660 226279 gene locus_tag LOCUS_22990 224660 226279 CDS product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088947.1 protein_id gnl|my_center|LOCUS_22990 227702 226446 gene locus_tag LOCUS_23000 gene zraR 227702 226446 CDS product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148522.1 protein_id gnl|my_center|LOCUS_23000 228954 227776 gene locus_tag LOCUS_23010 228954 227776 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_23010 230429 229044 gene locus_tag LOCUS_23020 230429 229044 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922507.1 protein_id gnl|my_center|LOCUS_23020 232198 230552 gene locus_tag LOCUS_23030 232198 230552 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804211.1 protein_id gnl|my_center|LOCUS_23030 233784 232195 gene locus_tag LOCUS_23040 233784 232195 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108775.1 protein_id gnl|my_center|LOCUS_23040 237279 233809 gene locus_tag LOCUS_23050 237279 233809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 237437 238270 gene locus_tag LOCUS_23060 237437 238270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 238390 238317 gene locus_tag LOCUS_t00240 238390 238317 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 238862 238431 gene locus_tag LOCUS_23070 238862 238431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 239416 238859 gene locus_tag LOCUS_23080 239416 238859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 239475 240215 gene locus_tag LOCUS_23090 239475 240215 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680775.1 protein_id gnl|my_center|LOCUS_23090 240888 240199 gene locus_tag LOCUS_23100 gene rsmD 240888 240199 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532356.1 protein_id gnl|my_center|LOCUS_23100 240939 241955 gene locus_tag LOCUS_23110 240939 241955 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106059.1 protein_id gnl|my_center|LOCUS_23110 242207 243733 gene locus_tag LOCUS_23120 242207 243733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942546.1 protein_id gnl|my_center|LOCUS_23120 243735 244487 gene locus_tag LOCUS_23130 243735 244487 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942545.1 protein_id gnl|my_center|LOCUS_23130 244489 245301 gene locus_tag LOCUS_23140 244489 245301 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914047.1 protein_id gnl|my_center|LOCUS_23140 245304 246296 gene locus_tag LOCUS_23150 245304 246296 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229370.1 protein_id gnl|my_center|LOCUS_23150 247756 246527 gene locus_tag LOCUS_23160 247756 246527 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227831.1 protein_id gnl|my_center|LOCUS_23160 248570 247938 gene locus_tag LOCUS_23170 248570 247938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 248935 249432 gene locus_tag LOCUS_23180 248935 249432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 251210 249495 gene locus_tag LOCUS_23190 251210 249495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 251352 252098 gene locus_tag LOCUS_23200 251352 252098 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947167.1 protein_id gnl|my_center|LOCUS_23200 254435 252111 gene locus_tag LOCUS_23210 254435 252111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 254570 255991 gene locus_tag LOCUS_23220 254570 255991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 256168 256668 gene locus_tag LOCUS_23230 256168 256668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 256869 258674 gene locus_tag LOCUS_23240 256869 258674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 259426 258815 gene locus_tag LOCUS_23250 259426 258815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 261714 259423 gene locus_tag LOCUS_23260 261714 259423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 263140 261755 gene locus_tag LOCUS_23270 263140 261755 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061914.1 protein_id gnl|my_center|LOCUS_23270 263915 263151 gene locus_tag LOCUS_23280 263915 263151 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150234528.1 protein_id gnl|my_center|LOCUS_23280 264319 264074 gene locus_tag LOCUS_23290 264319 264074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 264218 265675 gene locus_tag LOCUS_23300 264218 265675 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258145.1 protein_id gnl|my_center|LOCUS_23300 265859 266458 gene locus_tag LOCUS_23310 265859 266458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 266465 267259 gene locus_tag LOCUS_23320 266465 267259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 267339 267836 gene locus_tag LOCUS_23330 267339 267836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 267874 268395 gene locus_tag LOCUS_23340 267874 268395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 268461 269747 gene locus_tag LOCUS_23350 268461 269747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 271955 269739 gene locus_tag LOCUS_23360 271955 269739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 276584 272163 gene locus_tag LOCUS_23370 276584 272163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 278093 276705 gene locus_tag LOCUS_23380 278093 276705 CDS product BNR-4 repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921364.1 protein_id gnl|my_center|LOCUS_23380 279447 278173 gene locus_tag LOCUS_23390 279447 278173 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921673.1 protein_id gnl|my_center|LOCUS_23390 283303 279593 gene locus_tag LOCUS_23400 283303 279593 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119561.1 protein_id gnl|my_center|LOCUS_23400 284474 283530 gene locus_tag LOCUS_23410 284474 283530 CDS product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943321.1 protein_id gnl|my_center|LOCUS_23410 286312 284471 gene locus_tag LOCUS_23420 286312 284471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 288710 286518 gene locus_tag LOCUS_23430 288710 286518 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258146.1 protein_id gnl|my_center|LOCUS_23430 289626 288841 gene locus_tag LOCUS_23440 289626 288841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 289720 290478 gene locus_tag LOCUS_23450 289720 290478 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118937.1 protein_id gnl|my_center|LOCUS_23450 291570 290728 gene locus_tag LOCUS_23460 gene panC 291570 290728 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_23460 291707 292930 gene locus_tag LOCUS_23470 291707 292930 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_23470 293155 293946 gene locus_tag LOCUS_23480 293155 293946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 294739 294098 gene locus_tag LOCUS_23490 294739 294098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 295772 294771 gene locus_tag LOCUS_23500 295772 294771 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454833.1 protein_id gnl|my_center|LOCUS_23500 296626 295820 gene locus_tag LOCUS_23510 296626 295820 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403122.1 protein_id gnl|my_center|LOCUS_23510 297748 296630 gene locus_tag LOCUS_23520 297748 296630 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403123.1 protein_id gnl|my_center|LOCUS_23520 297814 298458 gene locus_tag LOCUS_23530 297814 298458 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140258.1 protein_id gnl|my_center|LOCUS_23530 299027 298575 gene locus_tag LOCUS_23540 299027 298575 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926892.1 protein_id gnl|my_center|LOCUS_23540 299269 301629 gene locus_tag LOCUS_23550 299269 301629 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256716.1 protein_id gnl|my_center|LOCUS_23550 301975 302994 gene locus_tag LOCUS_23560 301975 302994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 303191 304651 gene locus_tag LOCUS_23570 303191 304651 CDS product PhoPQ-activated protein PqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038065.1 protein_id gnl|my_center|LOCUS_23570 305722 304664 gene locus_tag LOCUS_23580 305722 304664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 307020 305755 gene locus_tag LOCUS_23590 307020 305755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 308701 307217 gene locus_tag LOCUS_23600 308701 307217 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921302.1 protein_id gnl|my_center|LOCUS_23600 312015 308890 gene locus_tag LOCUS_23610 312015 308890 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121858.1 protein_id gnl|my_center|LOCUS_23610 314503 312224 gene locus_tag LOCUS_23620 314503 312224 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922898.1 protein_id gnl|my_center|LOCUS_23620 317007 314578 gene locus_tag LOCUS_23630 317007 314578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099150691.1 protein_id gnl|my_center|LOCUS_23630 318214 317156 gene locus_tag LOCUS_23640 318214 317156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 320639 318360 gene locus_tag LOCUS_23650 320639 318360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 322498 320657 gene locus_tag LOCUS_23660 322498 320657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 323253 322570 gene locus_tag LOCUS_23670 323253 322570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 324353 323253 gene locus_tag LOCUS_23680 324353 323253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 327343 324386 gene locus_tag LOCUS_23690 327343 324386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 329691 327373 gene locus_tag LOCUS_23700 329691 327373 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065177.1 protein_id gnl|my_center|LOCUS_23700 329761 330846 gene locus_tag LOCUS_23710 329761 330846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 333904 330824 gene locus_tag LOCUS_23720 333904 330824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 334135 336417 gene locus_tag LOCUS_23730 334135 336417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 336430 337854 gene locus_tag LOCUS_23740 336430 337854 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921851.1 protein_id gnl|my_center|LOCUS_23740 337851 339095 gene locus_tag LOCUS_23750 337851 339095 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_23750 339966 339358 gene locus_tag LOCUS_23760 339966 339358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 340185 341318 gene locus_tag LOCUS_23770 340185 341318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 342279 341377 gene locus_tag LOCUS_23780 342279 341377 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008670430.1 protein_id gnl|my_center|LOCUS_23780 342553 343137 gene locus_tag LOCUS_23790 342553 343137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 344371 343181 gene locus_tag LOCUS_23800 344371 343181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 345935 344463 gene locus_tag LOCUS_23810 345935 344463 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122596.1 protein_id gnl|my_center|LOCUS_23810 349331 346113 gene locus_tag LOCUS_23820 349331 346113 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122595.1 protein_id gnl|my_center|LOCUS_23820 350968 349328 gene locus_tag LOCUS_23830 350968 349328 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118026.1 protein_id gnl|my_center|LOCUS_23830 351939 351145 gene locus_tag LOCUS_23840 351939 351145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 352115 353332 gene locus_tag LOCUS_23850 352115 353332 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_23850 354205 353480 gene locus_tag LOCUS_23860 354205 353480 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 protein_id gnl|my_center|LOCUS_23860 355452 354202 gene locus_tag LOCUS_23870 355452 354202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 356945 355449 gene locus_tag LOCUS_23880 356945 355449 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258814.1 protein_id gnl|my_center|LOCUS_23880 358282 357281 gene locus_tag LOCUS_23890 358282 357281 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_23890 362033 358482 gene locus_tag LOCUS_23900 362033 358482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 363211 362132 gene locus_tag LOCUS_23910 363211 362132 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918866.1 protein_id gnl|my_center|LOCUS_23910 363836 363222 gene locus_tag LOCUS_23920 363836 363222 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389192.1 protein_id gnl|my_center|LOCUS_23920 364946 363888 gene locus_tag LOCUS_23930 364946 363888 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533500.1 protein_id gnl|my_center|LOCUS_23930 365397 365095 gene locus_tag LOCUS_23940 365397 365095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 366397 365408 gene locus_tag LOCUS_23950 366397 365408 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 protein_id gnl|my_center|LOCUS_23950 367815 366466 gene locus_tag LOCUS_23960 367815 366466 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897902.1 protein_id gnl|my_center|LOCUS_23960 367715 367939 gene locus_tag LOCUS_23970 367715 367939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 369048 367900 gene locus_tag LOCUS_23980 369048 367900 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_23980 370001 369084 gene locus_tag LOCUS_23990 370001 369084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 370924 370088 gene locus_tag LOCUS_24000 370924 370088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 371070 372659 gene locus_tag LOCUS_24010 371070 372659 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767560.1 protein_id gnl|my_center|LOCUS_24010 373630 373037 gene locus_tag LOCUS_24020 373630 373037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 374672 373773 gene locus_tag LOCUS_24030 374672 373773 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329773.1 protein_id gnl|my_center|LOCUS_24030 374762 375481 gene locus_tag LOCUS_24040 374762 375481 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256816.1 protein_id gnl|my_center|LOCUS_24040 375478 376428 gene locus_tag LOCUS_24050 375478 376428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 376552 377577 gene locus_tag LOCUS_24060 376552 377577 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_24060 377642 378553 gene locus_tag LOCUS_24070 377642 378553 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_24070 379705 378701 gene locus_tag LOCUS_24080 379705 378701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 380859 379702 gene locus_tag LOCUS_24090 gene galK 380859 379702 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707767.1 protein_id gnl|my_center|LOCUS_24090 381230 380955 gene locus_tag LOCUS_24100 381230 380955 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931854.1 protein_id gnl|my_center|LOCUS_24100 381527 381294 gene locus_tag LOCUS_24110 381527 381294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 382420 381524 gene locus_tag LOCUS_24120 382420 381524 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479587.1 protein_id gnl|my_center|LOCUS_24120 382737 383792 gene locus_tag LOCUS_24130 382737 383792 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057409.1 protein_id gnl|my_center|LOCUS_24130 384335 383970 gene locus_tag LOCUS_24140 384335 383970 CDS product DUF4260 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088113.1 protein_id gnl|my_center|LOCUS_24140 387411 384292 gene locus_tag LOCUS_24150 387411 384292 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920956.1 protein_id gnl|my_center|LOCUS_24150 388478 387408 gene locus_tag LOCUS_24160 388478 387408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 389889 388483 gene locus_tag LOCUS_24170 389889 388483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 390616 389945 gene locus_tag LOCUS_24180 390616 389945 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840010.1 protein_id gnl|my_center|LOCUS_24180 390757 391740 gene locus_tag LOCUS_24190 390757 391740 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119517.1 protein_id gnl|my_center|LOCUS_24190 392967 391828 gene locus_tag LOCUS_24200 392967 391828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 393072 393770 gene locus_tag LOCUS_24210 393072 393770 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640345.1 protein_id gnl|my_center|LOCUS_24210 393830 394141 gene locus_tag LOCUS_24220 393830 394141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 396109 394289 gene locus_tag LOCUS_24230 396109 394289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 396457 397536 gene locus_tag LOCUS_24240 gene rsgA 396457 397536 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143435.1 protein_id gnl|my_center|LOCUS_24240 397652 401464 gene locus_tag LOCUS_24250 397652 401464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 401461 402366 gene locus_tag LOCUS_24260 401461 402366 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969806.1 protein_id gnl|my_center|LOCUS_24260 402456 405296 gene locus_tag LOCUS_24270 402456 405296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 405662 407785 gene locus_tag LOCUS_24280 405662 407785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 408011 410182 gene locus_tag LOCUS_24290 408011 410182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 410516 410229 gene locus_tag LOCUS_24300 410516 410229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 410588 411583 gene locus_tag LOCUS_24310 410588 411583 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_24310 411580 412086 gene locus_tag LOCUS_24320 411580 412086 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577036.1 protein_id gnl|my_center|LOCUS_24320 412088 413380 gene locus_tag LOCUS_24330 412088 413380 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 protein_id gnl|my_center|LOCUS_24330 414301 413606 gene locus_tag LOCUS_24340 414301 413606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 414581 415300 gene locus_tag LOCUS_24350 414581 415300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 415748 415455 gene locus_tag LOCUS_24360 415748 415455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 416079 420593 gene locus_tag LOCUS_24370 416079 420593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 420840 421223 gene locus_tag LOCUS_24380 420840 421223 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721618.1 protein_id gnl|my_center|LOCUS_24380 421635 421312 gene locus_tag LOCUS_24390 421635 421312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 421580 424306 gene locus_tag LOCUS_24400 421580 424306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 424773 425128 gene locus_tag LOCUS_tm00010 424773 425128 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 426360 425368 gene locus_tag LOCUS_24410 426360 425368 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963224.1 protein_id gnl|my_center|LOCUS_24410 427381 426344 gene locus_tag LOCUS_24420 427381 426344 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963223.1 protein_id gnl|my_center|LOCUS_24420 427745 428704 gene locus_tag LOCUS_24430 427745 428704 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045033.1 protein_id gnl|my_center|LOCUS_24430 429127 428732 gene locus_tag LOCUS_24440 429127 428732 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943110.1 protein_id gnl|my_center|LOCUS_24440 429394 429140 gene locus_tag LOCUS_24450 429394 429140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 429683 432067 gene locus_tag LOCUS_24460 429683 432067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 432533 432327 gene locus_tag LOCUS_24470 432533 432327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 432784 432530 gene locus_tag LOCUS_24480 432784 432530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 433060 433833 gene locus_tag LOCUS_24490 433060 433833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 433998 435395 gene locus_tag LOCUS_24500 gene yjjJ 433998 435395 CDS product type II toxin-antitoxin system HipA family toxin YjjJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035780.1 protein_id gnl|my_center|LOCUS_24500 435946 436524 gene locus_tag LOCUS_24510 435946 436524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 436835 438217 gene locus_tag LOCUS_24520 436835 438217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 439297 438518 gene locus_tag LOCUS_24530 439297 438518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 439885 439391 gene locus_tag LOCUS_24540 439885 439391 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165023455.1 protein_id gnl|my_center|LOCUS_24540 440285 441403 gene locus_tag LOCUS_24550 440285 441403 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766598.1 protein_id gnl|my_center|LOCUS_24550 444840 441619 gene locus_tag LOCUS_24560 444840 441619 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063897.1 protein_id gnl|my_center|LOCUS_24560 446428 444941 gene locus_tag LOCUS_24570 446428 444941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 447084 446443 gene locus_tag LOCUS_24580 447084 446443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 447326 448048 gene locus_tag LOCUS_24590 447326 448048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 448131 449207 gene locus_tag LOCUS_24600 gene pelA 448131 449207 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764019.1 protein_id gnl|my_center|LOCUS_24600 450040 449264 gene locus_tag LOCUS_24610 450040 449264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940985.1 protein_id gnl|my_center|LOCUS_24610 450116 450919 gene locus_tag LOCUS_24620 450116 450919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 451430 450939 gene locus_tag LOCUS_24630 451430 450939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 452397 451447 gene locus_tag LOCUS_24640 452397 451447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 453245 452394 gene locus_tag LOCUS_24650 453245 452394 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444160.1 protein_id gnl|my_center|LOCUS_24650 453637 453326 gene locus_tag LOCUS_24660 453637 453326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 455624 453789 gene locus_tag LOCUS_24670 455624 453789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 455742 457838 gene locus_tag LOCUS_24680 455742 457838 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640158.1 protein_id gnl|my_center|LOCUS_24680 458098 459090 gene locus_tag LOCUS_24690 gene msrP 458098 459090 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406704.1 protein_id gnl|my_center|LOCUS_24690 459158 459790 gene locus_tag LOCUS_24700 459158 459790 CDS product sulfoxide reductase heme-binding subunit YedZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388352.1 protein_id gnl|my_center|LOCUS_24700 461329 459887 gene locus_tag LOCUS_24710 gene uxaC 461329 459887 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_24710 463244 461400 gene locus_tag LOCUS_24720 463244 461400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 463416 465794 gene locus_tag LOCUS_24730 463416 465794 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939521.1 protein_id gnl|my_center|LOCUS_24730 465943 466338 gene locus_tag LOCUS_24740 465943 466338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 467338 466559 gene locus_tag LOCUS_24750 467338 466559 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941989.1 protein_id gnl|my_center|LOCUS_24750 468421 467465 gene locus_tag LOCUS_24760 468421 467465 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326973.1 protein_id gnl|my_center|LOCUS_24760 469870 468587 gene locus_tag LOCUS_24770 469870 468587 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_24770 470406 470017 gene locus_tag LOCUS_24780 470406 470017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 470556 471287 gene locus_tag LOCUS_24790 470556 471287 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118321.1 protein_id gnl|my_center|LOCUS_24790 471316 473115 gene locus_tag LOCUS_24800 471316 473115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 473204 473584 gene locus_tag LOCUS_24810 473204 473584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 473683 474357 gene locus_tag LOCUS_24820 473683 474357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 474368 474784 gene locus_tag LOCUS_24830 474368 474784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 475716 475201 gene locus_tag LOCUS_24840 475716 475201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 476306 475713 gene locus_tag LOCUS_24850 476306 475713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 477080 476325 gene locus_tag LOCUS_24860 477080 476325 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989811.1 protein_id gnl|my_center|LOCUS_24860 477220 478209 gene locus_tag LOCUS_24870 477220 478209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 478400 479836 gene locus_tag LOCUS_24880 478400 479836 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910561.1 protein_id gnl|my_center|LOCUS_24880 480145 480414 gene locus_tag LOCUS_24890 480145 480414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 480486 481409 gene locus_tag LOCUS_24900 480486 481409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 481406 482785 gene locus_tag LOCUS_24910 481406 482785 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921850.1 protein_id gnl|my_center|LOCUS_24910 482803 483933 gene locus_tag LOCUS_24920 482803 483933 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226897.1 protein_id gnl|my_center|LOCUS_24920 485358 484024 gene locus_tag LOCUS_24930 485358 484024 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039816.1 protein_id gnl|my_center|LOCUS_24930 485504 485920 gene locus_tag LOCUS_24940 485504 485920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 486684 485980 gene locus_tag LOCUS_24950 486684 485980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 487745 486891 gene locus_tag LOCUS_24960 487745 486891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 488233 487790 gene locus_tag LOCUS_24970 488233 487790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 489463 488270 gene locus_tag LOCUS_24980 489463 488270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 490161 489529 gene locus_tag LOCUS_24990 490161 489529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 490848 490261 gene locus_tag LOCUS_25000 490848 490261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 490996 492501 gene locus_tag LOCUS_25010 gene glpK 490996 492501 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943390.1 protein_id gnl|my_center|LOCUS_25010 492563 496855 gene locus_tag LOCUS_25020 492563 496855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 496924 498396 gene locus_tag LOCUS_25030 496924 498396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 498458 499426 gene locus_tag LOCUS_25040 498458 499426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 500517 499699 gene locus_tag LOCUS_25050 500517 499699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 500670 500999 gene locus_tag LOCUS_25060 500670 500999 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941982.1 protein_id gnl|my_center|LOCUS_25060 501071 502081 gene locus_tag LOCUS_25070 501071 502081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 502078 503238 gene locus_tag LOCUS_25080 502078 503238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 503270 503845 gene locus_tag LOCUS_25090 503270 503845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 504879 504064 gene locus_tag LOCUS_25100 504879 504064 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968304.1 protein_id gnl|my_center|LOCUS_25100 505434 504901 gene locus_tag LOCUS_25110 505434 504901 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970759.1 protein_id gnl|my_center|LOCUS_25110 506138 505539 gene locus_tag LOCUS_25120 506138 505539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 506589 506152 gene locus_tag LOCUS_25130 506589 506152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 506633 507958 gene locus_tag LOCUS_25140 gene dinB 506633 507958 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940720.1 protein_id gnl|my_center|LOCUS_25140 508260 509498 gene locus_tag LOCUS_25150 508260 509498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 509505 513365 gene locus_tag LOCUS_25160 509505 513365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 513377 514594 gene locus_tag LOCUS_25170 513377 514594 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027323.1 protein_id gnl|my_center|LOCUS_25170 514720 517890 gene locus_tag LOCUS_25180 514720 517890 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838099.1 protein_id gnl|my_center|LOCUS_25180 518166 521372 gene locus_tag LOCUS_25190 518166 521372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 521429 523150 gene locus_tag LOCUS_25200 gene ggt 521429 523150 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038421.1 protein_id gnl|my_center|LOCUS_25200 523306 523476 gene locus_tag LOCUS_25210 523306 523476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 523785 523492 gene locus_tag LOCUS_25220 523785 523492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 525104 523674 gene locus_tag LOCUS_25230 525104 523674 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037711.1 protein_id gnl|my_center|LOCUS_25230 525132 525269 gene locus_tag LOCUS_25240 gene rpmH 525132 525269 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100258.1 protein_id gnl|my_center|LOCUS_25240 525332 525697 gene locus_tag LOCUS_25250 525332 525697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 525694 526041 gene locus_tag LOCUS_25260 525694 526041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 526068 527894 gene locus_tag LOCUS_25270 526068 527894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 527988 528719 gene locus_tag LOCUS_25280 527988 528719 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668967.1 protein_id gnl|my_center|LOCUS_25280 528839 530041 gene locus_tag LOCUS_25290 528839 530041 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529386.1 protein_id gnl|my_center|LOCUS_25290 530038 530643 gene locus_tag LOCUS_25300 gene metW 530038 530643 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225324.1 protein_id gnl|my_center|LOCUS_25300 530694 531095 gene locus_tag LOCUS_25310 530694 531095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 532157 531180 gene locus_tag LOCUS_25320 532157 531180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 533422 532502 gene locus_tag LOCUS_25330 gene prmB 533422 532502 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192731.1 protein_id gnl|my_center|LOCUS_25330 534379 533561 gene locus_tag LOCUS_25340 534379 533561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 535313 534456 gene locus_tag LOCUS_25350 535313 534456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 535204 535431 gene locus_tag LOCUS_25360 535204 535431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 536222 535407 gene locus_tag LOCUS_25370 gene fdhD 536222 535407 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031006.1 protein_id gnl|my_center|LOCUS_25370 536330 537343 gene locus_tag LOCUS_25380 536330 537343 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035273.1 protein_id gnl|my_center|LOCUS_25380 537517 538227 gene locus_tag LOCUS_25390 537517 538227 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257775.1 protein_id gnl|my_center|LOCUS_25390 538234 539445 gene locus_tag LOCUS_25400 gene lptF 538234 539445 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_25400 540498 539569 gene locus_tag LOCUS_25410 540498 539569 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191750.1 protein_id gnl|my_center|LOCUS_25410 541563 540502 gene locus_tag LOCUS_25420 541563 540502 CDS product bifunctional UDP-4-keto-pentose/UDP-xylose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193921.1 protein_id gnl|my_center|LOCUS_25420 542483 541575 gene locus_tag LOCUS_25430 542483 541575 CDS product formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192441.1 protein_id gnl|my_center|LOCUS_25430 543801 542494 gene locus_tag LOCUS_25440 543801 542494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 544751 543798 gene locus_tag LOCUS_25450 544751 543798 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191549.1 protein_id gnl|my_center|LOCUS_25450 545893 544748 gene locus_tag LOCUS_25460 545893 544748 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192765.1 protein_id gnl|my_center|LOCUS_25460 547598 545895 gene locus_tag LOCUS_25470 547598 545895 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869035.1 protein_id gnl|my_center|LOCUS_25470 547808 548905 gene locus_tag LOCUS_25480 547808 548905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 549018 550463 gene locus_tag LOCUS_25490 gene purB 549018 550463 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 protein_id gnl|my_center|LOCUS_25490 550546 551163 gene locus_tag LOCUS_25500 550546 551163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 551160 552545 gene locus_tag LOCUS_25510 551160 552545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 552717 553946 gene locus_tag LOCUS_25520 552717 553946 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_25520 555842 554472 gene locus_tag LOCUS_25530 555842 554472 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368546.1 protein_id gnl|my_center|LOCUS_25530 557077 555890 gene locus_tag LOCUS_25540 557077 555890 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110716881.1 protein_id gnl|my_center|LOCUS_25540 557418 558128 gene locus_tag LOCUS_25550 gene fnr 557418 558128 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194557.1 protein_id gnl|my_center|LOCUS_25550 558215 558571 gene locus_tag LOCUS_25560 558215 558571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 558575 559099 gene locus_tag LOCUS_25570 558575 559099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 559134 560429 gene locus_tag LOCUS_25580 559134 560429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060384854.1 protein_id gnl|my_center|LOCUS_25580 560426 560746 gene locus_tag LOCUS_25590 560426 560746 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229161.1 protein_id gnl|my_center|LOCUS_25590 560859 561605 gene locus_tag LOCUS_25600 560859 561605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 561685 563193 gene locus_tag LOCUS_25610 gene nirK 561685 563193 CDS product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528780.1 protein_id gnl|my_center|LOCUS_25610 563219 564043 gene locus_tag LOCUS_25620 563219 564043 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533161.1 protein_id gnl|my_center|LOCUS_25620 564040 564699 gene locus_tag LOCUS_25630 564040 564699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 565622 564723 gene locus_tag LOCUS_25640 565622 564723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 565621 568668 gene locus_tag LOCUS_25650 565621 568668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 568725 569258 gene locus_tag LOCUS_25660 568725 569258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 569753 570370 gene locus_tag LOCUS_25670 569753 570370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 570593 573517 gene locus_tag LOCUS_25680 570593 573517 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206610.1 protein_id gnl|my_center|LOCUS_25680 575212 573674 gene locus_tag LOCUS_25690 575212 573674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 575467 575315 gene locus_tag LOCUS_25700 575467 575315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 575603 576019 gene locus_tag LOCUS_25710 575603 576019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 576044 576979 gene locus_tag LOCUS_25720 576044 576979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 577124 578182 gene locus_tag LOCUS_25730 577124 578182 CDS product peptidylglycine monooxygenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663621.1 protein_id gnl|my_center|LOCUS_25730 578200 579315 gene locus_tag LOCUS_25740 578200 579315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 579813 579382 gene locus_tag LOCUS_25750 579813 579382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 581568 580153 gene locus_tag LOCUS_25760 581568 580153 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615908.1 protein_id gnl|my_center|LOCUS_25760 583118 581583 gene locus_tag LOCUS_25770 583118 581583 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121409.1 protein_id gnl|my_center|LOCUS_25770 584614 583202 gene locus_tag LOCUS_25780 584614 583202 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922160.1 protein_id gnl|my_center|LOCUS_25780 586067 584685 gene locus_tag LOCUS_25790 586067 584685 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155594933.1 protein_id gnl|my_center|LOCUS_25790 >Feature sequence04 1882 614 gene locus_tag LOCUS_25800 1882 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 3376 2054 gene locus_tag LOCUS_25810 3376 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 4431 3373 gene locus_tag LOCUS_25820 4431 3373 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083132.1 protein_id gnl|my_center|LOCUS_25820 7607 4446 gene locus_tag LOCUS_25830 7607 4446 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140878.1 protein_id gnl|my_center|LOCUS_25830 9581 7776 gene locus_tag LOCUS_25840 9581 7776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 12468 9631 gene locus_tag LOCUS_25850 12468 9631 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_25850 12913 15705 gene locus_tag LOCUS_25860 12913 15705 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072483.1 protein_id gnl|my_center|LOCUS_25860 17629 15785 gene locus_tag LOCUS_25870 17629 15785 CDS product ClcB-like voltage-gated chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192418.1 protein_id gnl|my_center|LOCUS_25870 17832 18008 gene locus_tag LOCUS_25880 17832 18008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 18054 19406 gene locus_tag LOCUS_25890 18054 19406 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140384.1 protein_id gnl|my_center|LOCUS_25890 22130 19443 gene locus_tag LOCUS_25900 22130 19443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 23556 22267 gene locus_tag LOCUS_25910 gene waaA 23556 22267 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698007.1 protein_id gnl|my_center|LOCUS_25910 23684 26512 gene locus_tag LOCUS_25920 23684 26512 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920490.1 protein_id gnl|my_center|LOCUS_25920 25764 25687 gene locus_tag LOCUS_t00250 25764 25687 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 27565 26525 gene locus_tag LOCUS_25930 27565 26525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 27693 29069 gene locus_tag LOCUS_25940 27693 29069 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940194.1 protein_id gnl|my_center|LOCUS_25940 29123 30142 gene locus_tag LOCUS_25950 29123 30142 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404488.1 protein_id gnl|my_center|LOCUS_25950 30242 33034 gene locus_tag LOCUS_25960 30242 33034 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928597.1 protein_id gnl|my_center|LOCUS_25960 33126 33200 gene locus_tag LOCUS_t00260 33126 33200 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 33284 33358 gene locus_tag LOCUS_t00270 33284 33358 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 33387 33460 gene locus_tag LOCUS_t00280 33387 33460 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 33885 34553 gene locus_tag LOCUS_25970 33885 34553 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017058.1 protein_id gnl|my_center|LOCUS_25970 34610 35041 gene locus_tag LOCUS_25980 34610 35041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 35072 35524 gene locus_tag LOCUS_25990 35072 35524 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672100.1 protein_id gnl|my_center|LOCUS_25990 35537 36190 gene locus_tag LOCUS_26000 35537 36190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 36197 37645 gene locus_tag LOCUS_26010 36197 37645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 37673 38227 gene locus_tag LOCUS_26020 37673 38227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 38251 38790 gene locus_tag LOCUS_26030 38251 38790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 39058 39134 gene locus_tag LOCUS_t00290 39058 39134 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 39986 39162 gene locus_tag LOCUS_26040 39986 39162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 40090 40665 gene locus_tag LOCUS_26050 gene pyrE 40090 40665 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393616.1 protein_id gnl|my_center|LOCUS_26050 42126 40693 gene locus_tag LOCUS_26060 42126 40693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 43132 42185 gene locus_tag LOCUS_26070 43132 42185 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814952.1 protein_id gnl|my_center|LOCUS_26070 44215 43163 gene locus_tag LOCUS_26080 gene lpxD 44215 43163 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098585.1 protein_id gnl|my_center|LOCUS_26080 44675 45919 gene locus_tag LOCUS_26090 44675 45919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 46076 46840 gene locus_tag LOCUS_26100 46076 46840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 46929 47141 gene locus_tag LOCUS_26110 46929 47141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 47557 47757 gene locus_tag LOCUS_26120 47557 47757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 47816 49288 gene locus_tag LOCUS_26130 47816 49288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 49799 50914 gene locus_tag LOCUS_26140 49799 50914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 51063 52403 gene locus_tag LOCUS_26150 51063 52403 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208502.1 protein_id gnl|my_center|LOCUS_26150 52685 53908 gene locus_tag LOCUS_26160 52685 53908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 53905 54486 gene locus_tag LOCUS_26170 53905 54486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 54483 57269 gene locus_tag LOCUS_26180 gene mksF 54483 57269 CDS product Mks condensin complex protein MksF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266671.1 protein_id gnl|my_center|LOCUS_26180 57807 57586 gene locus_tag LOCUS_26190 57807 57586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 59078 58158 gene locus_tag LOCUS_26200 59078 58158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 59126 61384 gene locus_tag LOCUS_26210 59126 61384 CDS product Z1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687775.1 protein_id gnl|my_center|LOCUS_26210 61401 63095 gene locus_tag LOCUS_26220 61401 63095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 63388 66756 gene locus_tag LOCUS_26230 63388 66756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 66768 67874 gene locus_tag LOCUS_26240 66768 67874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 67879 68925 gene locus_tag LOCUS_26250 67879 68925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 68922 70448 gene locus_tag LOCUS_26260 gene dnaK 68922 70448 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065061.1 protein_id gnl|my_center|LOCUS_26260 70453 70722 gene locus_tag LOCUS_26270 70453 70722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 70770 73877 gene locus_tag LOCUS_26280 70770 73877 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020677315.1 protein_id gnl|my_center|LOCUS_26280 73892 76732 gene locus_tag LOCUS_26290 73892 76732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 77756 80008 gene locus_tag LOCUS_26300 77756 80008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 80020 81318 gene locus_tag LOCUS_26310 80020 81318 CDS product IQ calmodulin-binding- domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368619.1 protein_id gnl|my_center|LOCUS_26310 82119 81556 gene locus_tag LOCUS_26320 82119 81556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 82813 82739 gene locus_tag LOCUS_t00300 82813 82739 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 83021 83797 gene locus_tag LOCUS_26330 83021 83797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 83861 84445 gene locus_tag LOCUS_26340 gene pth 83861 84445 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814896.1 protein_id gnl|my_center|LOCUS_26340 84442 84738 gene locus_tag LOCUS_26350 84442 84738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 84763 85242 gene locus_tag LOCUS_26360 84763 85242 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339883.1 protein_id gnl|my_center|LOCUS_26360 85354 85899 gene locus_tag LOCUS_26370 gene rplI 85354 85899 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881335.1 protein_id gnl|my_center|LOCUS_26370 86091 87479 gene locus_tag LOCUS_26380 gene dnaB 86091 87479 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546182.1 protein_id gnl|my_center|LOCUS_26380 87514 89835 gene locus_tag LOCUS_26390 gene bamA 87514 89835 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_26390 89877 90548 gene locus_tag LOCUS_26400 89877 90548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 91330 91815 gene locus_tag LOCUS_26410 91330 91815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 91907 93271 gene locus_tag LOCUS_26420 gene accC 91907 93271 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259259.1 protein_id gnl|my_center|LOCUS_26420 94516 93371 gene locus_tag LOCUS_26430 94516 93371 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142975.1 protein_id gnl|my_center|LOCUS_26430 94634 95299 gene locus_tag LOCUS_26440 gene aat 94634 95299 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814164.1 protein_id gnl|my_center|LOCUS_26440 96344 95448 gene locus_tag LOCUS_26450 96344 95448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 97155 96499 gene locus_tag LOCUS_26460 97155 96499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 98672 97296 gene locus_tag LOCUS_26470 gene creC 98672 97296 CDS product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113267.1 protein_id gnl|my_center|LOCUS_26470 99394 98669 gene locus_tag LOCUS_26480 gene creB 99394 98669 CDS product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113268.1 protein_id gnl|my_center|LOCUS_26480 99985 99407 gene locus_tag LOCUS_26490 gene purN 99985 99407 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938037.1 protein_id gnl|my_center|LOCUS_26490 100545 100003 gene locus_tag LOCUS_26500 100545 100003 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258042.1 protein_id gnl|my_center|LOCUS_26500 100564 101568 gene locus_tag LOCUS_26510 gene xylF 100564 101568 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936757.1 protein_id gnl|my_center|LOCUS_26510 101591 103123 gene locus_tag LOCUS_26520 101591 103123 CDS product xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393517.1 protein_id gnl|my_center|LOCUS_26520 103134 104279 gene locus_tag LOCUS_26530 gene gguB 103134 104279 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209589.1 protein_id gnl|my_center|LOCUS_26530 105803 104298 gene locus_tag LOCUS_26540 105803 104298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 107051 105867 gene locus_tag LOCUS_26550 gene dnaJ 107051 105867 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940712.1 protein_id gnl|my_center|LOCUS_26550 107690 107076 gene locus_tag LOCUS_26560 107690 107076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 108701 107730 gene locus_tag LOCUS_26570 108701 107730 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122560.1 protein_id gnl|my_center|LOCUS_26570 108808 111354 gene locus_tag LOCUS_26580 108808 111354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 111414 112244 gene locus_tag LOCUS_26590 111414 112244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 112990 112382 gene locus_tag LOCUS_26600 112990 112382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 114043 113039 gene locus_tag LOCUS_26610 gene floA 114043 113039 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173128.1 protein_id gnl|my_center|LOCUS_26610 114525 114040 gene locus_tag LOCUS_26620 114525 114040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 115994 114522 gene locus_tag LOCUS_26630 115994 114522 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926053.1 protein_id gnl|my_center|LOCUS_26630 116147 117067 gene locus_tag LOCUS_26640 116147 117067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526695.1 protein_id gnl|my_center|LOCUS_26640 117099 117617 gene locus_tag LOCUS_26650 117099 117617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 117622 117909 gene locus_tag LOCUS_26660 117622 117909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 117906 119147 gene locus_tag LOCUS_26670 117906 119147 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098062761.1 protein_id gnl|my_center|LOCUS_26670 119230 119445 gene locus_tag LOCUS_26680 119230 119445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 119507 120325 gene locus_tag LOCUS_26690 119507 120325 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147838.1 protein_id gnl|my_center|LOCUS_26690 120417 120959 gene locus_tag LOCUS_26700 120417 120959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 122003 120969 gene locus_tag LOCUS_26710 122003 120969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 122486 122034 gene locus_tag LOCUS_26720 122486 122034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 122994 122479 gene locus_tag LOCUS_26730 122994 122479 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229904.1 protein_id gnl|my_center|LOCUS_26730 123346 123164 gene locus_tag LOCUS_26740 123346 123164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 123453 124364 gene locus_tag LOCUS_26750 123453 124364 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612250.1 protein_id gnl|my_center|LOCUS_26750 124495 125751 gene locus_tag LOCUS_26760 124495 125751 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094632.1 protein_id gnl|my_center|LOCUS_26760 125789 128356 gene locus_tag LOCUS_26770 125789 128356 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140940.1 protein_id gnl|my_center|LOCUS_26770 128534 129754 gene locus_tag LOCUS_26780 128534 129754 CDS product nucleoside monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615753.1 protein_id gnl|my_center|LOCUS_26780 131196 129970 gene locus_tag LOCUS_26790 131196 129970 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933019.1 protein_id gnl|my_center|LOCUS_26790 132472 131225 gene locus_tag LOCUS_26800 132472 131225 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933018.1 protein_id gnl|my_center|LOCUS_26800 133406 132669 gene locus_tag LOCUS_26810 133406 132669 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439273.1 protein_id gnl|my_center|LOCUS_26810 134763 133408 gene locus_tag LOCUS_26820 134763 133408 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933016.1 protein_id gnl|my_center|LOCUS_26820 136476 135283 gene locus_tag LOCUS_26830 136476 135283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 136605 137504 gene locus_tag LOCUS_26840 136605 137504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 141177 137608 gene locus_tag LOCUS_26850 141177 137608 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663427.1 protein_id gnl|my_center|LOCUS_26850 142532 141309 gene locus_tag LOCUS_26860 142532 141309 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228423.1 protein_id gnl|my_center|LOCUS_26860 142695 143531 gene locus_tag LOCUS_26870 142695 143531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 143569 145209 gene locus_tag LOCUS_26880 143569 145209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 146390 145350 gene locus_tag LOCUS_26890 146390 145350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 146506 149640 gene locus_tag LOCUS_26900 146506 149640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 149721 151457 gene locus_tag LOCUS_26910 149721 151457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 152732 151476 gene locus_tag LOCUS_26920 152732 151476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 153949 152729 gene locus_tag LOCUS_26930 153949 152729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 154127 154405 gene locus_tag LOCUS_26940 154127 154405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 154516 156768 gene locus_tag LOCUS_26950 154516 156768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 156850 157866 gene locus_tag LOCUS_26960 156850 157866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 157901 158971 gene locus_tag LOCUS_26970 157901 158971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 159148 161739 gene locus_tag LOCUS_26980 159148 161739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 163109 162078 gene locus_tag LOCUS_26990 163109 162078 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030715.1 protein_id gnl|my_center|LOCUS_26990 165607 163112 gene locus_tag LOCUS_27000 165607 163112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27000 165711 166451 gene locus_tag LOCUS_27010 165711 166451 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_27010 166448 168583 gene locus_tag LOCUS_27020 166448 168583 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_27020 169000 168641 gene locus_tag LOCUS_27030 169000 168641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 169138 171813 gene locus_tag LOCUS_27040 169138 171813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 172072 173247 gene locus_tag LOCUS_27050 172072 173247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 173612 173313 gene locus_tag LOCUS_27060 173612 173313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 173719 174471 gene locus_tag LOCUS_27070 173719 174471 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_27070 174535 175365 gene locus_tag LOCUS_27080 174535 175365 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532378.1 protein_id gnl|my_center|LOCUS_27080 175523 177010 gene locus_tag LOCUS_27090 175523 177010 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_27090 178458 177217 gene locus_tag LOCUS_27100 178458 177217 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_27100 179516 178455 gene locus_tag LOCUS_27110 179516 178455 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056897.1 protein_id gnl|my_center|LOCUS_27110 182041 179513 gene locus_tag LOCUS_27120 182041 179513 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_27120 182603 182160 gene locus_tag LOCUS_27130 182603 182160 CDS product RbsD/FucU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705503.1 protein_id gnl|my_center|LOCUS_27130 183522 182656 gene locus_tag LOCUS_27140 183522 182656 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616090.1 protein_id gnl|my_center|LOCUS_27140 184309 183599 gene locus_tag LOCUS_27150 184309 183599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 184506 185165 gene locus_tag LOCUS_27160 184506 185165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 188577 185452 gene locus_tag LOCUS_27170 188577 185452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 188891 189523 gene locus_tag LOCUS_27180 188891 189523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 189534 191255 gene locus_tag LOCUS_27190 189534 191255 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615922.1 protein_id gnl|my_center|LOCUS_27190 191281 192573 gene locus_tag LOCUS_27200 191281 192573 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035901.1 protein_id gnl|my_center|LOCUS_27200 192584 193048 gene locus_tag LOCUS_27210 gene xcpT 192584 193048 CDS product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 protein_id gnl|my_center|LOCUS_27210 193079 193663 gene locus_tag LOCUS_27220 193079 193663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 193632 194084 gene locus_tag LOCUS_27230 193632 194084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 194084 194794 gene locus_tag LOCUS_27240 194084 194794 CDS product type II secretion system protein GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940991.1 protein_id gnl|my_center|LOCUS_27240 194791 196125 gene locus_tag LOCUS_27250 194791 196125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 196146 197522 gene locus_tag LOCUS_27260 196146 197522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 197519 198067 gene locus_tag LOCUS_27270 197519 198067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 198064 198891 gene locus_tag LOCUS_27280 198064 198891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 198888 200195 gene locus_tag LOCUS_27290 198888 200195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 200225 201403 gene locus_tag LOCUS_27300 200225 201403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 201826 203328 gene locus_tag LOCUS_27310 201826 203328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 203491 204867 gene locus_tag LOCUS_27320 203491 204867 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146518596.1 protein_id gnl|my_center|LOCUS_27320 205354 208179 gene locus_tag LOCUS_27330 205354 208179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 208304 208220 gene locus_tag LOCUS_t00310 208304 208220 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 209196 208465 gene locus_tag LOCUS_27340 209196 208465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 209654 210496 gene locus_tag LOCUS_27350 209654 210496 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106127.1 protein_id gnl|my_center|LOCUS_27350 211784 210792 gene locus_tag LOCUS_27360 211784 210792 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545989.1 protein_id gnl|my_center|LOCUS_27360 212298 211828 gene locus_tag LOCUS_27370 212298 211828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27370 213294 212422 gene locus_tag LOCUS_27380 gene kdsA 213294 212422 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879994.1 protein_id gnl|my_center|LOCUS_27380 215119 213491 gene locus_tag LOCUS_27390 215119 213491 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326169.1 protein_id gnl|my_center|LOCUS_27390 215503 215216 gene locus_tag LOCUS_27400 215503 215216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 215502 215885 gene locus_tag LOCUS_27410 215502 215885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 215894 216901 gene locus_tag LOCUS_27420 215894 216901 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797481.1 protein_id gnl|my_center|LOCUS_27420 218105 217059 gene locus_tag LOCUS_27430 218105 217059 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807890.1 protein_id gnl|my_center|LOCUS_27430 218378 221539 gene locus_tag LOCUS_27440 218378 221539 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918997.1 protein_id gnl|my_center|LOCUS_27440 222812 221667 gene locus_tag LOCUS_27450 222812 221667 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929473.1 protein_id gnl|my_center|LOCUS_27450 224445 222886 gene locus_tag LOCUS_27460 224445 222886 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144201.1 protein_id gnl|my_center|LOCUS_27460 224963 224442 gene locus_tag LOCUS_27470 224963 224442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 227183 225051 gene locus_tag LOCUS_27480 227183 225051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 227358 228275 gene locus_tag LOCUS_27490 gene lnrL 227358 228275 CDS product linearmycin resistance ATP-binding protein LnrL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244346.1 protein_id gnl|my_center|LOCUS_27490 228358 229704 gene locus_tag LOCUS_27500 228358 229704 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123325.1 protein_id gnl|my_center|LOCUS_27500 230638 229778 gene locus_tag LOCUS_27510 230638 229778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 230878 233208 gene locus_tag LOCUS_27520 230878 233208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 233318 233884 gene locus_tag LOCUS_27530 233318 233884 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921477.1 protein_id gnl|my_center|LOCUS_27530 235478 234021 gene locus_tag LOCUS_27540 235478 234021 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324175.1 protein_id gnl|my_center|LOCUS_27540 236497 235523 gene locus_tag LOCUS_27550 236497 235523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 237747 236494 gene locus_tag LOCUS_27560 237747 236494 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_27560 238646 237744 gene locus_tag LOCUS_27570 238646 237744 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942022.1 protein_id gnl|my_center|LOCUS_27570 242512 238709 gene locus_tag LOCUS_27580 242512 238709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 243308 242565 gene locus_tag LOCUS_27590 gene allE 243308 242565 CDS product (S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887795.1 protein_id gnl|my_center|LOCUS_27590 244690 243326 gene locus_tag LOCUS_27600 244690 243326 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887796.1 protein_id gnl|my_center|LOCUS_27600 245913 244687 gene locus_tag LOCUS_27610 245913 244687 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966724.1 protein_id gnl|my_center|LOCUS_27610 246261 245917 gene locus_tag LOCUS_27620 gene uraH 246261 245917 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528242.1 protein_id gnl|my_center|LOCUS_27620 246849 246337 gene locus_tag LOCUS_27630 gene uraD 246849 246337 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640536.1 protein_id gnl|my_center|LOCUS_27630 248438 246849 gene locus_tag LOCUS_27640 gene aceB 248438 246849 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258821.1 protein_id gnl|my_center|LOCUS_27640 248581 249051 gene locus_tag LOCUS_27650 248581 249051 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768302.1 protein_id gnl|my_center|LOCUS_27650 249160 250728 gene locus_tag LOCUS_27660 249160 250728 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125226.1 protein_id gnl|my_center|LOCUS_27660 250976 251632 gene locus_tag LOCUS_27670 250976 251632 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115288.1 protein_id gnl|my_center|LOCUS_27670 253720 252071 gene locus_tag LOCUS_27680 253720 252071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 254082 253717 gene locus_tag LOCUS_27690 gene crcB 254082 253717 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941171.1 protein_id gnl|my_center|LOCUS_27690 255145 254105 gene locus_tag LOCUS_27700 255145 254105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919009.1 protein_id gnl|my_center|LOCUS_27700 256386 255202 gene locus_tag LOCUS_27710 256386 255202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 257080 256400 gene locus_tag LOCUS_27720 gene infC 257080 256400 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939807.1 protein_id gnl|my_center|LOCUS_27720 257586 257176 gene locus_tag LOCUS_27730 gene iscA 257586 257176 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860659.1 protein_id gnl|my_center|LOCUS_27730 258742 257984 gene locus_tag LOCUS_27740 258742 257984 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839974.1 protein_id gnl|my_center|LOCUS_27740 261931 258752 gene locus_tag LOCUS_27750 261931 258752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 260938 260842 gene locus_tag LOCUS_t00320 260938 260842 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 263879 262011 gene locus_tag LOCUS_27760 263879 262011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 263985 265013 gene locus_tag LOCUS_27770 263985 265013 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327684.1 protein_id gnl|my_center|LOCUS_27770 265282 265593 gene locus_tag LOCUS_27780 265282 265593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 270510 265843 gene locus_tag LOCUS_27790 270510 265843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 271936 270503 gene locus_tag LOCUS_27800 271936 270503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 273041 272004 gene locus_tag LOCUS_27810 gene prfB 273041 272004 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096807630.1 protein_id gnl|my_center|LOCUS_27810 274797 273220 gene locus_tag LOCUS_27820 274797 273220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 276611 275460 gene locus_tag LOCUS_27830 276611 275460 CDS product nitric oxide synthase oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086848418.1 protein_id gnl|my_center|LOCUS_27830 277729 276608 gene locus_tag LOCUS_27840 277729 276608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 279666 277726 gene locus_tag LOCUS_27850 279666 277726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 280388 279663 gene locus_tag LOCUS_27860 280388 279663 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088434.1 protein_id gnl|my_center|LOCUS_27860 281410 280505 gene locus_tag LOCUS_27870 281410 280505 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118908.1 protein_id gnl|my_center|LOCUS_27870 282477 281443 gene locus_tag LOCUS_27880 gene gmd 282477 281443 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941289.1 protein_id gnl|my_center|LOCUS_27880 282647 283042 gene locus_tag LOCUS_27890 282647 283042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 283119 283946 gene locus_tag LOCUS_27900 283119 283946 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065332.1 protein_id gnl|my_center|LOCUS_27900 283972 284655 gene locus_tag LOCUS_27910 283972 284655 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_27910 284658 285761 gene locus_tag LOCUS_27920 284658 285761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 285808 286776 gene locus_tag LOCUS_27930 285808 286776 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976408.1 protein_id gnl|my_center|LOCUS_27930 286933 289017 gene locus_tag LOCUS_27940 286933 289017 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403904.1 protein_id gnl|my_center|LOCUS_27940 290515 289238 gene locus_tag LOCUS_27950 290515 289238 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_27950 291884 290682 gene locus_tag LOCUS_27960 291884 290682 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176146113.1 protein_id gnl|my_center|LOCUS_27960 292619 291909 gene locus_tag LOCUS_27970 292619 291909 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530243.1 protein_id gnl|my_center|LOCUS_27970 293765 292746 gene locus_tag LOCUS_27980 293765 292746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 294687 293854 gene locus_tag LOCUS_27990 294687 293854 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368409.1 protein_id gnl|my_center|LOCUS_27990 294858 294694 gene locus_tag LOCUS_28000 294858 294694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 295071 298283 gene locus_tag LOCUS_28010 295071 298283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 300119 298455 gene locus_tag LOCUS_28020 300119 298455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 301572 300175 gene locus_tag LOCUS_28030 301572 300175 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921573.1 protein_id gnl|my_center|LOCUS_28030 301775 302122 gene locus_tag LOCUS_28040 301775 302122 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223804324.1 protein_id gnl|my_center|LOCUS_28040 302367 303341 gene locus_tag LOCUS_28050 302367 303341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 306449 303393 gene locus_tag LOCUS_28060 306449 303393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 307593 306679 gene locus_tag LOCUS_28070 307593 306679 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038316.1 protein_id gnl|my_center|LOCUS_28070 308275 307799 gene locus_tag LOCUS_28080 308275 307799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 310490 308478 gene locus_tag LOCUS_28090 310490 308478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 311086 310535 gene locus_tag LOCUS_28100 gene lacC 311086 310535 CDS product lactose 3-dehydrogenase subunit gamma LacC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919508.1 protein_id gnl|my_center|LOCUS_28100 312798 311083 gene locus_tag LOCUS_28110 312798 311083 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_28110 312908 313633 gene locus_tag LOCUS_28120 312908 313633 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098345.1 protein_id gnl|my_center|LOCUS_28120 313907 316678 gene locus_tag LOCUS_28130 313907 316678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 316883 318592 gene locus_tag LOCUS_28140 316883 318592 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044930.1 protein_id gnl|my_center|LOCUS_28140 318681 319646 gene locus_tag LOCUS_28150 318681 319646 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058258.1 protein_id gnl|my_center|LOCUS_28150 323465 319659 gene locus_tag LOCUS_28160 323465 319659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 324310 323579 gene locus_tag LOCUS_28170 324310 323579 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162185826.1 protein_id gnl|my_center|LOCUS_28170 324459 326954 gene locus_tag LOCUS_28180 324459 326954 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920510.1 protein_id gnl|my_center|LOCUS_28180 328655 327267 gene locus_tag LOCUS_28190 328655 327267 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226507.1 protein_id gnl|my_center|LOCUS_28190 328755 329501 gene locus_tag LOCUS_28200 328755 329501 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256482.1 protein_id gnl|my_center|LOCUS_28200 329498 330238 gene locus_tag LOCUS_28210 329498 330238 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256332.1 protein_id gnl|my_center|LOCUS_28210 330244 331242 gene locus_tag LOCUS_28220 330244 331242 CDS product NUP-family purine nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265508.1 protein_id gnl|my_center|LOCUS_28220 331242 332375 gene locus_tag LOCUS_28230 331242 332375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 332382 333455 gene locus_tag LOCUS_28240 332382 333455 CDS product NUP-family purine nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265508.1 protein_id gnl|my_center|LOCUS_28240 333933 333508 gene locus_tag LOCUS_28250 333933 333508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 334115 333930 gene locus_tag LOCUS_28260 334115 333930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 335288 334185 gene locus_tag LOCUS_28270 335288 334185 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921016.1 protein_id gnl|my_center|LOCUS_28270 336724 335285 gene locus_tag LOCUS_28280 336724 335285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 338643 336718 gene locus_tag LOCUS_28290 338643 336718 CDS product adenine deaminase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966716.1 protein_id gnl|my_center|LOCUS_28290 339929 338658 gene locus_tag LOCUS_28300 339929 338658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 340191 342656 gene locus_tag LOCUS_28310 340191 342656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 344411 342702 gene locus_tag LOCUS_28320 344411 342702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 344828 345271 gene locus_tag LOCUS_28330 344828 345271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 346048 345347 gene locus_tag LOCUS_28340 346048 345347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 346254 347018 gene locus_tag LOCUS_28350 346254 347018 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665981.1 protein_id gnl|my_center|LOCUS_28350 347831 347034 gene locus_tag LOCUS_28360 347831 347034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 348759 348076 gene locus_tag LOCUS_28370 348759 348076 CDS product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944032.1 protein_id gnl|my_center|LOCUS_28370 349388 348780 gene locus_tag LOCUS_28380 gene yihA 349388 348780 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765852.1 protein_id gnl|my_center|LOCUS_28380 349693 349385 gene locus_tag LOCUS_28390 349693 349385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 349780 350277 gene locus_tag LOCUS_28400 349780 350277 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 protein_id gnl|my_center|LOCUS_28400 350631 350296 gene locus_tag LOCUS_28410 350631 350296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 351386 350796 gene locus_tag LOCUS_28420 351386 350796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 352288 351467 gene locus_tag LOCUS_28430 352288 351467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 354069 352399 gene locus_tag LOCUS_28440 354069 352399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 356351 354216 gene locus_tag LOCUS_28450 356351 354216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 356800 357546 gene locus_tag LOCUS_28460 356800 357546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 359141 357651 gene locus_tag LOCUS_28470 359141 357651 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261223.1 protein_id gnl|my_center|LOCUS_28470 359313 360122 gene locus_tag LOCUS_28480 359313 360122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 360258 360404 gene locus_tag LOCUS_28490 360258 360404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 361407 360556 gene locus_tag LOCUS_28500 361407 360556 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260625.1 protein_id gnl|my_center|LOCUS_28500 361971 361471 gene locus_tag LOCUS_28510 361971 361471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 362695 362078 gene locus_tag LOCUS_28520 362695 362078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 362913 365057 gene locus_tag LOCUS_28530 362913 365057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 365297 365653 gene locus_tag LOCUS_28540 365297 365653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 365796 367475 gene locus_tag LOCUS_28550 365796 367475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 368271 367513 gene locus_tag LOCUS_28560 368271 367513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 371785 368444 gene locus_tag LOCUS_28570 371785 368444 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194230.1 protein_id gnl|my_center|LOCUS_28570 373176 372091 gene locus_tag LOCUS_28580 373176 372091 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873440.1 protein_id gnl|my_center|LOCUS_28580 374506 374054 gene locus_tag LOCUS_28590 374506 374054 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932479.1 protein_id gnl|my_center|LOCUS_28590 375119 374634 gene locus_tag LOCUS_28600 375119 374634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 376210 375167 gene locus_tag LOCUS_28610 376210 375167 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258073.1 protein_id gnl|my_center|LOCUS_28610 377363 376374 gene locus_tag LOCUS_28620 377363 376374 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_28620 378791 377388 gene locus_tag LOCUS_28630 378791 377388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 379602 378862 gene locus_tag LOCUS_28640 379602 378862 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973919.1 protein_id gnl|my_center|LOCUS_28640 380150 379659 gene locus_tag LOCUS_28650 380150 379659 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842388.1 protein_id gnl|my_center|LOCUS_28650 382833 380224 gene locus_tag LOCUS_28660 382833 380224 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 protein_id gnl|my_center|LOCUS_28660 383524 382844 gene locus_tag LOCUS_28670 383524 382844 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_28670 383581 384240 gene locus_tag LOCUS_28680 383581 384240 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458621.1 protein_id gnl|my_center|LOCUS_28680 384362 385237 gene locus_tag LOCUS_28690 384362 385237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 385266 386102 gene locus_tag LOCUS_28700 385266 386102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 386092 386775 gene locus_tag LOCUS_28710 386092 386775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 386875 388560 gene locus_tag LOCUS_28720 386875 388560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 389169 388783 gene locus_tag LOCUS_28730 389169 388783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 389312 389944 gene locus_tag LOCUS_28740 389312 389944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529957.1 protein_id gnl|my_center|LOCUS_28740 390006 391322 gene locus_tag LOCUS_28750 390006 391322 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393182.1 protein_id gnl|my_center|LOCUS_28750 393874 391469 gene locus_tag LOCUS_28760 393874 391469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 394426 393884 gene locus_tag LOCUS_28770 394426 393884 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121244.1 protein_id gnl|my_center|LOCUS_28770 394544 396127 gene locus_tag LOCUS_28780 394544 396127 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705871.1 protein_id gnl|my_center|LOCUS_28780 396167 396637 gene locus_tag LOCUS_28790 396167 396637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 396634 397548 gene locus_tag LOCUS_28800 396634 397548 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902918.1 protein_id gnl|my_center|LOCUS_28800 398056 397673 gene locus_tag LOCUS_28810 398056 397673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 398161 399111 gene locus_tag LOCUS_28820 398161 399111 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401697.1 protein_id gnl|my_center|LOCUS_28820 399108 399857 gene locus_tag LOCUS_28830 399108 399857 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028029.1 protein_id gnl|my_center|LOCUS_28830 400393 400079 gene locus_tag LOCUS_28840 gene rhaM 400393 400079 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619478.1 protein_id gnl|my_center|LOCUS_28840 402292 400595 gene locus_tag LOCUS_28850 402292 400595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 404094 402289 gene locus_tag LOCUS_28860 404094 402289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 406330 404294 gene locus_tag LOCUS_28870 406330 404294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 406489 407523 gene locus_tag LOCUS_28880 406489 407523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 407583 409025 gene locus_tag LOCUS_28890 407583 409025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 409159 412482 gene locus_tag LOCUS_28900 409159 412482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 412624 412541 gene locus_tag LOCUS_t00330 412624 412541 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 414406 412784 gene locus_tag LOCUS_28910 414406 412784 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076056374.1 protein_id gnl|my_center|LOCUS_28910 415268 414360 gene locus_tag LOCUS_28920 415268 414360 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922152.1 protein_id gnl|my_center|LOCUS_28920 417738 415327 gene locus_tag LOCUS_28930 417738 415327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 420427 417818 gene locus_tag LOCUS_28940 gene clpB 420427 417818 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365367.1 protein_id gnl|my_center|LOCUS_28940 421410 420574 gene locus_tag LOCUS_28950 421410 420574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 423871 421481 gene locus_tag LOCUS_28960 423871 421481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 424406 423933 gene locus_tag LOCUS_28970 424406 423933 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392966.1 protein_id gnl|my_center|LOCUS_28970 424523 424984 gene locus_tag LOCUS_28980 424523 424984 CDS product thioesterase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932147.1 protein_id gnl|my_center|LOCUS_28980 426797 424998 gene locus_tag LOCUS_28990 426797 424998 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033190.1 protein_id gnl|my_center|LOCUS_28990 427408 427037 gene locus_tag LOCUS_29000 427408 427037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 427850 429007 gene locus_tag LOCUS_29010 427850 429007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 429166 430455 gene locus_tag LOCUS_29020 429166 430455 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809762.1 protein_id gnl|my_center|LOCUS_29020 430571 431611 gene locus_tag LOCUS_29030 gene ruvB 430571 431611 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964224.1 protein_id gnl|my_center|LOCUS_29030 431727 432512 gene locus_tag LOCUS_29040 431727 432512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 432571 434952 gene locus_tag LOCUS_29050 432571 434952 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120545.1 protein_id gnl|my_center|LOCUS_29050 434957 435475 gene locus_tag LOCUS_29060 434957 435475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 435493 436512 gene locus_tag LOCUS_29070 435493 436512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 437361 436651 gene locus_tag LOCUS_29080 437361 436651 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405499.1 protein_id gnl|my_center|LOCUS_29080 438458 437484 gene locus_tag LOCUS_29090 gene folE2 438458 437484 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722743.1 protein_id gnl|my_center|LOCUS_29090 439013 438525 gene locus_tag LOCUS_29100 439013 438525 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405497.1 protein_id gnl|my_center|LOCUS_29100 439373 440215 gene locus_tag LOCUS_29110 439373 440215 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259049.1 protein_id gnl|my_center|LOCUS_29110 440212 443529 gene locus_tag LOCUS_29120 440212 443529 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616068.1 protein_id gnl|my_center|LOCUS_29120 443645 444448 gene locus_tag LOCUS_29130 443645 444448 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883514.1 protein_id gnl|my_center|LOCUS_29130 445886 444588 gene locus_tag LOCUS_29140 445886 444588 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477599.1 protein_id gnl|my_center|LOCUS_29140 446015 447493 gene locus_tag LOCUS_29150 gene pyk 446015 447493 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834388.1 protein_id gnl|my_center|LOCUS_29150 449143 447779 gene locus_tag LOCUS_29160 449143 447779 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112637.1 protein_id gnl|my_center|LOCUS_29160 449502 449140 gene locus_tag LOCUS_29170 449502 449140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 449748 453098 gene locus_tag LOCUS_29180 449748 453098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 453119 454561 gene locus_tag LOCUS_29190 453119 454561 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920272.1 protein_id gnl|my_center|LOCUS_29190 454779 455318 gene locus_tag LOCUS_29200 454779 455318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 455445 455810 gene locus_tag LOCUS_29210 455445 455810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 455995 456393 gene locus_tag LOCUS_29220 455995 456393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 456398 457666 gene locus_tag LOCUS_29230 456398 457666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 457671 458009 gene locus_tag LOCUS_29240 457671 458009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 458014 459315 gene locus_tag LOCUS_29250 458014 459315 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941985.1 protein_id gnl|my_center|LOCUS_29250 459386 463105 gene locus_tag LOCUS_29260 459386 463105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 463334 464872 gene locus_tag LOCUS_29270 463334 464872 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117896.1 protein_id gnl|my_center|LOCUS_29270 464925 465635 gene locus_tag LOCUS_29280 464925 465635 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037253881.1 protein_id gnl|my_center|LOCUS_29280 465917 466384 gene locus_tag LOCUS_29290 465917 466384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 466488 467768 gene locus_tag LOCUS_29300 466488 467768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 467765 468904 gene locus_tag LOCUS_29310 467765 468904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 468916 472086 gene locus_tag LOCUS_29320 468916 472086 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142029.1 protein_id gnl|my_center|LOCUS_29320 472083 472598 gene locus_tag LOCUS_29330 472083 472598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 472671 473135 gene locus_tag LOCUS_29340 472671 473135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 473132 473857 gene locus_tag LOCUS_29350 473132 473857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 473923 475326 gene locus_tag LOCUS_29360 473923 475326 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140537.1 protein_id gnl|my_center|LOCUS_29360 475550 480076 gene locus_tag LOCUS_29370 475550 480076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 481205 480279 gene locus_tag LOCUS_29380 481205 480279 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335559.1 protein_id gnl|my_center|LOCUS_29380 483065 481593 gene locus_tag LOCUS_29390 483065 481593 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_29390 484701 483376 gene locus_tag LOCUS_29400 484701 483376 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120884.1 protein_id gnl|my_center|LOCUS_29400 487503 484921 gene locus_tag LOCUS_29410 487503 484921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 487657 488124 gene locus_tag LOCUS_29420 487657 488124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 488227 490539 gene locus_tag LOCUS_29430 488227 490539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 490576 491940 gene locus_tag LOCUS_29440 490576 491940 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920272.1 protein_id gnl|my_center|LOCUS_29440 492087 492830 gene locus_tag LOCUS_29450 492087 492830 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_29450 492835 495117 gene locus_tag LOCUS_29460 492835 495117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 495181 496218 gene locus_tag LOCUS_29470 495181 496218 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140538.1 protein_id gnl|my_center|LOCUS_29470 >Feature sequence05 2935 1574 gene locus_tag LOCUS_29480 2935 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 5982 2983 gene locus_tag LOCUS_29490 5982 2983 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 protein_id gnl|my_center|LOCUS_29490 8906 5985 gene locus_tag LOCUS_29500 8906 5985 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783463.1 protein_id gnl|my_center|LOCUS_29500 9061 9927 gene locus_tag LOCUS_29510 9061 9927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 9924 10841 gene locus_tag LOCUS_29520 9924 10841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 10979 12433 gene locus_tag LOCUS_29530 10979 12433 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_29530 13975 12446 gene locus_tag LOCUS_29540 13975 12446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 15081 13972 gene locus_tag LOCUS_29550 15081 13972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 17645 15078 gene locus_tag LOCUS_29560 17645 15078 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368537.1 protein_id gnl|my_center|LOCUS_29560 20798 17667 gene locus_tag LOCUS_29570 20798 17667 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104454.1 protein_id gnl|my_center|LOCUS_29570 20974 22290 gene locus_tag LOCUS_29580 gene rifK 20974 22290 CDS product 3-amino-5-hydroxybenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222557.1 protein_id gnl|my_center|LOCUS_29580 23224 22451 gene locus_tag LOCUS_29590 23224 22451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 24147 23221 gene locus_tag LOCUS_29600 24147 23221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 24341 27361 gene locus_tag LOCUS_29610 24341 27361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 27531 28589 gene locus_tag LOCUS_29620 27531 28589 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086980.1 protein_id gnl|my_center|LOCUS_29620 28603 29649 gene locus_tag LOCUS_29630 28603 29649 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121662.1 protein_id gnl|my_center|LOCUS_29630 29751 30614 gene locus_tag LOCUS_29640 29751 30614 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118333.1 protein_id gnl|my_center|LOCUS_29640 30611 31420 gene locus_tag LOCUS_29650 30611 31420 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762537.1 protein_id gnl|my_center|LOCUS_29650 32255 31581 gene locus_tag LOCUS_29660 32255 31581 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972770.1 protein_id gnl|my_center|LOCUS_29660 33469 32336 gene locus_tag LOCUS_29670 33469 32336 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974707.1 protein_id gnl|my_center|LOCUS_29670 33578 34657 gene locus_tag LOCUS_29680 33578 34657 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921628.1 protein_id gnl|my_center|LOCUS_29680 34716 36074 gene locus_tag LOCUS_29690 34716 36074 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921348.1 protein_id gnl|my_center|LOCUS_29690 37262 36135 gene locus_tag LOCUS_29700 37262 36135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 40310 37323 gene locus_tag LOCUS_29710 40310 37323 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783463.1 protein_id gnl|my_center|LOCUS_29710 40499 41902 gene locus_tag LOCUS_29720 40499 41902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 43337 41991 gene locus_tag LOCUS_29730 43337 41991 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763569.1 protein_id gnl|my_center|LOCUS_29730 46155 43447 gene locus_tag LOCUS_29740 46155 43447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 47489 46152 gene locus_tag LOCUS_29750 47489 46152 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_29750 48182 47595 gene locus_tag LOCUS_29760 48182 47595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 49188 48250 gene locus_tag LOCUS_29770 49188 48250 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507354.1 protein_id gnl|my_center|LOCUS_29770 49912 49244 gene locus_tag LOCUS_29780 49912 49244 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258926.1 protein_id gnl|my_center|LOCUS_29780 51824 49983 gene locus_tag LOCUS_29790 51824 49983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 51929 53239 gene locus_tag LOCUS_29800 gene rsmB 51929 53239 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460525.1 protein_id gnl|my_center|LOCUS_29800 54585 53368 gene locus_tag LOCUS_29810 54585 53368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 55946 54582 gene locus_tag LOCUS_29820 55946 54582 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001982317.1 protein_id gnl|my_center|LOCUS_29820 58694 55995 gene locus_tag LOCUS_29830 58694 55995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 61449 58774 gene locus_tag LOCUS_29840 61449 58774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 61575 63911 gene locus_tag LOCUS_29850 61575 63911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 64781 63930 gene locus_tag LOCUS_29860 64781 63930 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526198.1 protein_id gnl|my_center|LOCUS_29860 64855 65778 gene locus_tag LOCUS_29870 64855 65778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 65819 67141 gene locus_tag LOCUS_29880 65819 67141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 67222 68328 gene locus_tag LOCUS_29890 67222 68328 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027544.1 protein_id gnl|my_center|LOCUS_29890 68343 69197 gene locus_tag LOCUS_29900 68343 69197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 69287 70471 gene locus_tag LOCUS_29910 gene dxr 69287 70471 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921140.1 protein_id gnl|my_center|LOCUS_29910 70489 71913 gene locus_tag LOCUS_29920 gene rseP 70489 71913 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456697.1 protein_id gnl|my_center|LOCUS_29920 71966 74041 gene locus_tag LOCUS_29930 71966 74041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 74508 75899 gene locus_tag LOCUS_29940 gene dnaA 74508 75899 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242674.1 protein_id gnl|my_center|LOCUS_29940 75995 76570 gene locus_tag LOCUS_29950 75995 76570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 76603 77682 gene locus_tag LOCUS_29960 gene mnmA 76603 77682 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089522426.1 protein_id gnl|my_center|LOCUS_29960 78324 77692 gene locus_tag LOCUS_29970 78324 77692 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768796.1 protein_id gnl|my_center|LOCUS_29970 78886 78368 gene locus_tag LOCUS_29980 78886 78368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 80650 78938 gene locus_tag LOCUS_29990 80650 78938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 81151 80660 gene locus_tag LOCUS_30000 81151 80660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 82316 81276 gene locus_tag LOCUS_30010 gene obgE 82316 81276 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545625.1 protein_id gnl|my_center|LOCUS_30010 86594 82446 gene locus_tag LOCUS_30020 gene rpoC 86594 82446 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871661.1 protein_id gnl|my_center|LOCUS_30020 90426 86647 gene locus_tag LOCUS_30030 gene rpoB 90426 86647 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882731.1 protein_id gnl|my_center|LOCUS_30030 91000 90614 gene locus_tag LOCUS_30040 91000 90614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 91638 91141 gene locus_tag LOCUS_30050 gene rplJ 91638 91141 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597181.1 protein_id gnl|my_center|LOCUS_30050 92348 91650 gene locus_tag LOCUS_30060 gene rplA 92348 91650 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_30060 92910 92485 gene locus_tag LOCUS_30070 gene rplK 92910 92485 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966425.1 protein_id gnl|my_center|LOCUS_30070 93597 93019 gene locus_tag LOCUS_30080 gene nusG 93597 93019 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630512.1 protein_id gnl|my_center|LOCUS_30080 93821 93618 gene locus_tag LOCUS_30090 93821 93618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 93912 93837 gene locus_tag LOCUS_t00340 93912 93837 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 95183 93993 gene locus_tag LOCUS_30100 gene tuf 95183 93993 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933844.1 protein_id gnl|my_center|LOCUS_30100 95339 95264 gene locus_tag LOCUS_t00350 95339 95264 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 96185 95433 gene locus_tag LOCUS_30110 96185 95433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 96636 96187 gene locus_tag LOCUS_30120 96636 96187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 97338 96646 gene locus_tag LOCUS_30130 97338 96646 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537045.1 protein_id gnl|my_center|LOCUS_30130 100063 97370 gene locus_tag LOCUS_30140 100063 97370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 100186 100788 gene locus_tag LOCUS_30150 100186 100788 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_30150 100865 102838 gene locus_tag LOCUS_30160 100865 102838 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198677105.1 protein_id gnl|my_center|LOCUS_30160 103063 104526 gene locus_tag LOCUS_30170 103063 104526 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921791.1 protein_id gnl|my_center|LOCUS_30170 104531 107110 gene locus_tag LOCUS_30180 104531 107110 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921574.1 protein_id gnl|my_center|LOCUS_30180 107438 107860 gene locus_tag LOCUS_30190 107438 107860 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626602.1 protein_id gnl|my_center|LOCUS_30190 107857 108714 gene locus_tag LOCUS_30200 107857 108714 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038431207.1 protein_id gnl|my_center|LOCUS_30200 108818 109384 gene locus_tag LOCUS_30210 108818 109384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925589.1 protein_id gnl|my_center|LOCUS_30210 110243 109401 gene locus_tag LOCUS_30220 gene tcdA 110243 109401 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707894.1 protein_id gnl|my_center|LOCUS_30220 111377 110280 gene locus_tag LOCUS_30230 111377 110280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 111511 111816 gene locus_tag LOCUS_30240 111511 111816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 111816 112973 gene locus_tag LOCUS_30250 111816 112973 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486144.1 protein_id gnl|my_center|LOCUS_30250 113562 113011 gene locus_tag LOCUS_30260 113562 113011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 114169 113555 gene locus_tag LOCUS_30270 gene pnuC 114169 113555 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088340.1 protein_id gnl|my_center|LOCUS_30270 114969 114166 gene locus_tag LOCUS_30280 114969 114166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 115705 114962 gene locus_tag LOCUS_30290 115705 114962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 115852 118947 gene locus_tag LOCUS_30300 115852 118947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 118953 119690 gene locus_tag LOCUS_30310 118953 119690 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838137.1 protein_id gnl|my_center|LOCUS_30310 119797 120177 gene locus_tag LOCUS_30320 119797 120177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 121512 120187 gene locus_tag LOCUS_30330 121512 120187 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937445.1 protein_id gnl|my_center|LOCUS_30330 121394 123310 gene locus_tag LOCUS_30340 121394 123310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 124233 123361 gene locus_tag LOCUS_30350 gene rlmJ 124233 123361 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389691.1 protein_id gnl|my_center|LOCUS_30350 124762 124262 gene locus_tag LOCUS_30360 124762 124262 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964040.1 protein_id gnl|my_center|LOCUS_30360 124856 125533 gene locus_tag LOCUS_30370 124856 125533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 126978 125635 gene locus_tag LOCUS_30380 126978 125635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 127450 127076 gene locus_tag LOCUS_30390 127450 127076 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389430.1 protein_id gnl|my_center|LOCUS_30390 128591 127542 gene locus_tag LOCUS_30400 128591 127542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 128785 130698 gene locus_tag LOCUS_30410 128785 130698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 130745 132646 gene locus_tag LOCUS_30420 130745 132646 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883393.1 protein_id gnl|my_center|LOCUS_30420 132723 133109 gene locus_tag LOCUS_30430 132723 133109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 133162 133419 gene locus_tag LOCUS_30440 133162 133419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 135847 133580 gene locus_tag LOCUS_30450 135847 133580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 136332 136015 gene locus_tag LOCUS_30460 136332 136015 CDS product EthD family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029217002.1 protein_id gnl|my_center|LOCUS_30460 138552 136378 gene locus_tag LOCUS_30470 138552 136378 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940876.1 protein_id gnl|my_center|LOCUS_30470 139028 138555 gene locus_tag LOCUS_30480 139028 138555 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639856.1 protein_id gnl|my_center|LOCUS_30480 139211 140224 gene locus_tag LOCUS_30490 139211 140224 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_30490 140280 141110 gene locus_tag LOCUS_30500 140280 141110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 141127 141636 gene locus_tag LOCUS_30510 141127 141636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 141656 143620 gene locus_tag LOCUS_30520 gene mrdA 141656 143620 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_30520 145886 143655 gene locus_tag LOCUS_30530 145886 143655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 147147 145894 gene locus_tag LOCUS_30540 147147 145894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 148129 147158 gene locus_tag LOCUS_30550 148129 147158 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_30550 148238 148708 gene locus_tag LOCUS_30560 148238 148708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 149529 148831 gene locus_tag LOCUS_30570 gene mtnP 149529 148831 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250433.1 protein_id gnl|my_center|LOCUS_30570 149528 150301 gene locus_tag LOCUS_30580 149528 150301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 150314 151279 gene locus_tag LOCUS_30590 150314 151279 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109290171.1 protein_id gnl|my_center|LOCUS_30590 152284 151430 gene locus_tag LOCUS_30600 152284 151430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 152637 153056 gene locus_tag LOCUS_30610 152637 153056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 153121 154194 gene locus_tag LOCUS_30620 153121 154194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 154887 154225 gene locus_tag LOCUS_30630 154887 154225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 156143 154884 gene locus_tag LOCUS_30640 156143 154884 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103756.1 protein_id gnl|my_center|LOCUS_30640 158119 156158 gene locus_tag LOCUS_30650 158119 156158 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103757.1 protein_id gnl|my_center|LOCUS_30650 158432 159796 gene locus_tag LOCUS_30660 158432 159796 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921626.1 protein_id gnl|my_center|LOCUS_30660 160914 159973 gene locus_tag LOCUS_30670 160914 159973 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931881.1 protein_id gnl|my_center|LOCUS_30670 161046 162710 gene locus_tag LOCUS_30680 161046 162710 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120416.1 protein_id gnl|my_center|LOCUS_30680 164512 162968 gene locus_tag LOCUS_30690 164512 162968 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_30690 165537 164656 gene locus_tag LOCUS_30700 165537 164656 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978781.1 protein_id gnl|my_center|LOCUS_30700 165625 166335 gene locus_tag LOCUS_30710 165625 166335 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810926.1 protein_id gnl|my_center|LOCUS_30710 166353 166991 gene locus_tag LOCUS_30720 166353 166991 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227430.1 protein_id gnl|my_center|LOCUS_30720 167042 168733 gene locus_tag LOCUS_30730 167042 168733 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921318.1 protein_id gnl|my_center|LOCUS_30730 168739 169221 gene locus_tag LOCUS_30740 168739 169221 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403782.1 protein_id gnl|my_center|LOCUS_30740 169283 170374 gene locus_tag LOCUS_30750 169283 170374 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795082.1 protein_id gnl|my_center|LOCUS_30750 170399 171172 gene locus_tag LOCUS_30760 170399 171172 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705502.1 protein_id gnl|my_center|LOCUS_30760 171236 171574 gene locus_tag LOCUS_30770 171236 171574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 171571 172386 gene locus_tag LOCUS_30780 171571 172386 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_30780 172439 175465 gene locus_tag LOCUS_30790 172439 175465 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104454.1 protein_id gnl|my_center|LOCUS_30790 176744 175605 gene locus_tag LOCUS_30800 176744 175605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 178413 176806 gene locus_tag LOCUS_30810 178413 176806 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144112.1 protein_id gnl|my_center|LOCUS_30810 178537 179520 gene locus_tag LOCUS_30820 178537 179520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 179517 180698 gene locus_tag LOCUS_30830 179517 180698 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947432.1 protein_id gnl|my_center|LOCUS_30830 181766 180720 gene locus_tag LOCUS_30840 181766 180720 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100003378.1 protein_id gnl|my_center|LOCUS_30840 183844 181814 gene locus_tag LOCUS_30850 183844 181814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 187776 184006 gene locus_tag LOCUS_30860 187776 184006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 189639 187969 gene locus_tag LOCUS_30870 gene lnt 189639 187969 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_30870 189745 190170 gene locus_tag LOCUS_30880 189745 190170 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004309783.1 protein_id gnl|my_center|LOCUS_30880 190595 190368 gene locus_tag LOCUS_30890 190595 190368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 191225 190719 gene locus_tag LOCUS_30900 191225 190719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 192388 191387 gene locus_tag LOCUS_30910 gene rpoA 192388 191387 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569643.1 protein_id gnl|my_center|LOCUS_30910 193097 192486 gene locus_tag LOCUS_30920 gene rpsD 193097 192486 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173699.1 protein_id gnl|my_center|LOCUS_30920 193785 193135 gene locus_tag LOCUS_30930 193785 193135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 194178 193798 gene locus_tag LOCUS_30940 gene rpsM 194178 193798 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_30940 195029 194247 gene locus_tag LOCUS_30950 gene map 195029 194247 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545375.1 protein_id gnl|my_center|LOCUS_30950 195457 195026 gene locus_tag LOCUS_30960 195457 195026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 196982 195477 gene locus_tag LOCUS_30970 gene secY 196982 195477 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545307.1 protein_id gnl|my_center|LOCUS_30970 197535 197089 gene locus_tag LOCUS_30980 gene rplO 197535 197089 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766093.1 protein_id gnl|my_center|LOCUS_30980 198292 197633 gene locus_tag LOCUS_30990 198292 197633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 198667 198299 gene locus_tag LOCUS_31000 gene rplR 198667 198299 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055951.1 protein_id gnl|my_center|LOCUS_31000 199215 198679 gene locus_tag LOCUS_31010 gene rplF 199215 198679 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583360.1 protein_id gnl|my_center|LOCUS_31010 199645 199253 gene locus_tag LOCUS_31020 gene rpsH 199645 199253 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892856.1 protein_id gnl|my_center|LOCUS_31020 200011 199706 gene locus_tag LOCUS_31030 gene rpsN 200011 199706 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806919.1 protein_id gnl|my_center|LOCUS_31030 200604 200029 gene locus_tag LOCUS_31040 gene rplE 200604 200029 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081811.1 protein_id gnl|my_center|LOCUS_31040 200994 200722 gene locus_tag LOCUS_31050 200994 200722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 201361 200996 gene locus_tag LOCUS_31060 gene rplN 201361 200996 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393927.1 protein_id gnl|my_center|LOCUS_31060 201772 201395 gene locus_tag LOCUS_31070 201772 201395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 202006 201800 gene locus_tag LOCUS_31080 202006 201800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 202454 202032 gene locus_tag LOCUS_31090 gene rplP 202454 202032 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215430.1 protein_id gnl|my_center|LOCUS_31090 203128 202496 gene locus_tag LOCUS_31100 gene rpsC 203128 202496 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_31100 203483 203139 gene locus_tag LOCUS_31110 gene rplV 203483 203139 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393932.1 protein_id gnl|my_center|LOCUS_31110 203906 203568 gene locus_tag LOCUS_31120 203906 203568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 204211 203936 gene locus_tag LOCUS_31130 gene rpsS 204211 203936 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545511.1 protein_id gnl|my_center|LOCUS_31130 205096 204230 gene locus_tag LOCUS_31140 gene rplB 205096 204230 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933839.1 protein_id gnl|my_center|LOCUS_31140 205411 205130 gene locus_tag LOCUS_31150 gene rplW 205411 205130 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879929.1 protein_id gnl|my_center|LOCUS_31150 206046 205411 gene locus_tag LOCUS_31160 gene rplD 206046 205411 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055937.1 protein_id gnl|my_center|LOCUS_31160 206768 206061 gene locus_tag LOCUS_31170 gene rplC 206768 206061 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421173.1 protein_id gnl|my_center|LOCUS_31170 207225 206917 gene locus_tag LOCUS_31180 gene rpsJ 207225 206917 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390499.1 protein_id gnl|my_center|LOCUS_31180 209441 207246 gene locus_tag LOCUS_31190 gene fusA 209441 207246 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_31190 209934 209461 gene locus_tag LOCUS_31200 gene rpsG 209934 209461 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081843.1 protein_id gnl|my_center|LOCUS_31200 210342 209962 gene locus_tag LOCUS_31210 gene rpsL 210342 209962 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545079.1 protein_id gnl|my_center|LOCUS_31210 212069 210771 gene locus_tag LOCUS_31220 gene ftsZ 212069 210771 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023171980.1 protein_id gnl|my_center|LOCUS_31220 213296 212082 gene locus_tag LOCUS_31230 gene ftsA 213296 212082 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094115.1 protein_id gnl|my_center|LOCUS_31230 214281 213298 gene locus_tag LOCUS_31240 214281 213298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 215213 214278 gene locus_tag LOCUS_31250 215213 214278 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943691.1 protein_id gnl|my_center|LOCUS_31250 216187 215210 gene locus_tag LOCUS_31260 gene murB 216187 215210 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460695.1 protein_id gnl|my_center|LOCUS_31260 217323 216196 gene locus_tag LOCUS_31270 gene murG 217323 216196 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224927.1 protein_id gnl|my_center|LOCUS_31270 218462 217320 gene locus_tag LOCUS_31280 gene ftsW 218462 217320 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957396.1 protein_id gnl|my_center|LOCUS_31280 219384 218476 gene locus_tag LOCUS_31290 219384 218476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 219645 219448 gene locus_tag LOCUS_31300 219645 219448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 220763 219648 gene locus_tag LOCUS_31310 gene mraY 220763 219648 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194370.1 protein_id gnl|my_center|LOCUS_31310 222157 220757 gene locus_tag LOCUS_31320 222157 220757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 223755 222166 gene locus_tag LOCUS_31330 223755 222166 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_31330 225650 223752 gene locus_tag LOCUS_31340 225650 223752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 226114 225734 gene locus_tag LOCUS_31350 226114 225734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 227097 226159 gene locus_tag LOCUS_31360 gene rsmH 227097 226159 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110151.1 protein_id gnl|my_center|LOCUS_31360 227398 227114 gene locus_tag LOCUS_31370 227398 227114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 227870 227406 gene locus_tag LOCUS_31380 gene mraZ 227870 227406 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_31380 228137 228436 gene locus_tag LOCUS_31390 228137 228436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 228514 228981 gene locus_tag LOCUS_31400 gene hisI 228514 228981 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088269.1 protein_id gnl|my_center|LOCUS_31400 230340 229003 gene locus_tag LOCUS_31410 230340 229003 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_31410 231667 230480 gene locus_tag LOCUS_31420 231667 230480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 232486 231698 gene locus_tag LOCUS_31430 gene lpxA 232486 231698 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_31430 233816 232491 gene locus_tag LOCUS_31440 233816 232491 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933326.1 protein_id gnl|my_center|LOCUS_31440 233960 234517 gene locus_tag LOCUS_31450 gene efp 233960 234517 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931853.1 protein_id gnl|my_center|LOCUS_31450 236120 234636 gene locus_tag LOCUS_31460 236120 234636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 237426 236185 gene locus_tag LOCUS_31470 237426 236185 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039292.1 protein_id gnl|my_center|LOCUS_31470 238936 237590 gene locus_tag LOCUS_31480 238936 237590 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583823.1 protein_id gnl|my_center|LOCUS_31480 240302 239103 gene locus_tag LOCUS_31490 240302 239103 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920461.1 protein_id gnl|my_center|LOCUS_31490 240422 242182 gene locus_tag LOCUS_31500 gene argS 240422 242182 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225071.1 protein_id gnl|my_center|LOCUS_31500 242258 243007 gene locus_tag LOCUS_31510 242258 243007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 243012 244568 gene locus_tag LOCUS_31520 243012 244568 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943098.1 protein_id gnl|my_center|LOCUS_31520 244666 246342 gene locus_tag LOCUS_31530 244666 246342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 246727 248295 gene locus_tag LOCUS_31540 246727 248295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 248376 248954 gene locus_tag LOCUS_31550 248376 248954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 248993 249502 gene locus_tag LOCUS_31560 248993 249502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 249522 250289 gene locus_tag LOCUS_31570 249522 250289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 252500 250299 gene locus_tag LOCUS_31580 gene ppk1 252500 250299 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233899.1 protein_id gnl|my_center|LOCUS_31580 253287 252583 gene locus_tag LOCUS_31590 253287 252583 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975112.1 protein_id gnl|my_center|LOCUS_31590 254528 253284 gene locus_tag LOCUS_31600 254528 253284 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975247.1 protein_id gnl|my_center|LOCUS_31600 255708 254557 gene locus_tag LOCUS_31610 255708 254557 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974032.1 protein_id gnl|my_center|LOCUS_31610 257032 255671 gene locus_tag LOCUS_31620 257032 255671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 257209 258648 gene locus_tag LOCUS_31630 257209 258648 CDS product bifunctional class I SAM-dependent methyltransferase/glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929103.1 protein_id gnl|my_center|LOCUS_31630 258673 259782 gene locus_tag LOCUS_31640 258673 259782 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057184.1 protein_id gnl|my_center|LOCUS_31640 259779 260771 gene locus_tag LOCUS_31650 259779 260771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 260814 261671 gene locus_tag LOCUS_31660 260814 261671 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186421.1 protein_id gnl|my_center|LOCUS_31660 263171 261816 gene locus_tag LOCUS_31670 263171 261816 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038796350.1 protein_id gnl|my_center|LOCUS_31670 267344 263271 gene locus_tag LOCUS_31680 267344 263271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 270096 267496 gene locus_tag LOCUS_31690 270096 267496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 270334 272286 gene locus_tag LOCUS_31700 270334 272286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 272304 273350 gene locus_tag LOCUS_31710 272304 273350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 273373 276585 gene locus_tag LOCUS_31720 273373 276585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 276582 279257 gene locus_tag LOCUS_31730 276582 279257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 279312 280247 gene locus_tag LOCUS_31740 279312 280247 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256245.1 protein_id gnl|my_center|LOCUS_31740 280288 281274 gene locus_tag LOCUS_31750 280288 281274 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065995.1 protein_id gnl|my_center|LOCUS_31750 281308 281673 gene locus_tag LOCUS_31760 281308 281673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 281725 282549 gene locus_tag LOCUS_31770 281725 282549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 282975 282577 gene locus_tag LOCUS_31780 282975 282577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 285823 283016 gene locus_tag LOCUS_31790 285823 283016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 285893 286918 gene locus_tag LOCUS_31800 285893 286918 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734411.1 protein_id gnl|my_center|LOCUS_31800 286986 287969 gene locus_tag LOCUS_31810 286986 287969 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_31810 288024 288386 gene locus_tag LOCUS_31820 288024 288386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 288488 289195 gene locus_tag LOCUS_31830 288488 289195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 289364 289969 gene locus_tag LOCUS_31840 289364 289969 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957729.1 protein_id gnl|my_center|LOCUS_31840 289986 290558 gene locus_tag LOCUS_31850 289986 290558 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957728.1 protein_id gnl|my_center|LOCUS_31850 290737 291456 gene locus_tag LOCUS_31860 290737 291456 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674084.1 protein_id gnl|my_center|LOCUS_31860 291624 295703 gene locus_tag LOCUS_31870 291624 295703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 295756 296769 gene locus_tag LOCUS_31880 295756 296769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 296766 297611 gene locus_tag LOCUS_31890 296766 297611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 297613 299571 gene locus_tag LOCUS_31900 297613 299571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 299645 302734 gene locus_tag LOCUS_31910 299645 302734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 302731 303657 gene locus_tag LOCUS_31920 302731 303657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 303851 303606 gene locus_tag LOCUS_31930 303851 303606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 303862 304581 gene locus_tag LOCUS_31940 303862 304581 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_31940 304592 308074 gene locus_tag LOCUS_31950 304592 308074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 308085 309341 gene locus_tag LOCUS_31960 308085 309341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 309338 310585 gene locus_tag LOCUS_31970 309338 310585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 310667 311725 gene locus_tag LOCUS_31980 310667 311725 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121410.1 protein_id gnl|my_center|LOCUS_31980 311779 312402 gene locus_tag LOCUS_31990 311779 312402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 312407 314182 gene locus_tag LOCUS_32000 312407 314182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 314474 315112 gene locus_tag LOCUS_32010 314474 315112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 315118 316098 gene locus_tag LOCUS_32020 315118 316098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 316375 317166 gene locus_tag LOCUS_32030 316375 317166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 317238 317957 gene locus_tag LOCUS_32040 317238 317957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 318821 318144 gene locus_tag LOCUS_32050 318821 318144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 318943 320028 gene locus_tag LOCUS_32060 318943 320028 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615432.1 protein_id gnl|my_center|LOCUS_32060 320042 320797 gene locus_tag LOCUS_32070 320042 320797 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122067.1 protein_id gnl|my_center|LOCUS_32070 320955 324251 gene locus_tag LOCUS_32080 320955 324251 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037631.1 protein_id gnl|my_center|LOCUS_32080 324497 325369 gene locus_tag LOCUS_32090 324497 325369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 325410 326462 gene locus_tag LOCUS_32100 gene rfbB 325410 326462 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706044.1 protein_id gnl|my_center|LOCUS_32100 326589 327467 gene locus_tag LOCUS_32110 gene rfbA 326589 327467 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105518.1 protein_id gnl|my_center|LOCUS_32110 327520 328473 gene locus_tag LOCUS_32120 327520 328473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32120 329426 328491 gene locus_tag LOCUS_32130 329426 328491 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_32130 330372 329509 gene locus_tag LOCUS_32140 330372 329509 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257103.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32140 332790 330595 gene locus_tag LOCUS_32150 332790 330595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 333614 332850 gene locus_tag LOCUS_32160 333614 332850 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206409.1 protein_id gnl|my_center|LOCUS_32160 335813 333663 gene locus_tag LOCUS_32170 335813 333663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 335955 337601 gene locus_tag LOCUS_32180 335955 337601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 338726 337797 gene locus_tag LOCUS_32190 338726 337797 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793191.1 protein_id gnl|my_center|LOCUS_32190 340323 338734 gene locus_tag LOCUS_32200 340323 338734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 340489 342015 gene locus_tag LOCUS_32210 340489 342015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 342024 343196 gene locus_tag LOCUS_32220 342024 343196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 343273 344469 gene locus_tag LOCUS_32230 343273 344469 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205626.1 protein_id gnl|my_center|LOCUS_32230 345831 344563 gene locus_tag LOCUS_32240 345831 344563 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_32240 346417 345923 gene locus_tag LOCUS_32250 346417 345923 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437844.1 protein_id gnl|my_center|LOCUS_32250 347118 346483 gene locus_tag LOCUS_32260 347118 346483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 348377 347115 gene locus_tag LOCUS_32270 gene purD 348377 347115 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393539.1 protein_id gnl|my_center|LOCUS_32270 350526 348625 gene locus_tag LOCUS_32280 350526 348625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 352576 350669 gene locus_tag LOCUS_32290 352576 350669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 352723 353496 gene locus_tag LOCUS_32300 gene fkpA 352723 353496 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085068497.1 protein_id gnl|my_center|LOCUS_32300 354666 353602 gene locus_tag LOCUS_32310 354666 353602 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105702.1 protein_id gnl|my_center|LOCUS_32310 354724 355269 gene locus_tag LOCUS_32320 354724 355269 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_32320 355266 356471 gene locus_tag LOCUS_32330 gene queG 355266 356471 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026363808.1 protein_id gnl|my_center|LOCUS_32330 356933 356508 gene locus_tag LOCUS_32340 356933 356508 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811622.1 protein_id gnl|my_center|LOCUS_32340 358090 356930 gene locus_tag LOCUS_32350 358090 356930 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403060.1 protein_id gnl|my_center|LOCUS_32350 358489 359295 gene locus_tag LOCUS_32360 358489 359295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 359454 360716 gene locus_tag LOCUS_32370 gene fabB 359454 360716 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_32370 360721 361557 gene locus_tag LOCUS_32380 360721 361557 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113772.1 protein_id gnl|my_center|LOCUS_32380 361574 362788 gene locus_tag LOCUS_32390 361574 362788 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256547.1 protein_id gnl|my_center|LOCUS_32390 362835 364100 gene locus_tag LOCUS_32400 362835 364100 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061530.1 protein_id gnl|my_center|LOCUS_32400 364097 365152 gene locus_tag LOCUS_32410 364097 365152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 365828 365172 gene locus_tag LOCUS_32420 365828 365172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 367685 365922 gene locus_tag LOCUS_32430 gene ptsP 367685 365922 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942526.1 protein_id gnl|my_center|LOCUS_32430 368740 367793 gene locus_tag LOCUS_32440 gene ispE 368740 367793 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923490.1 protein_id gnl|my_center|LOCUS_32440 368962 368759 gene locus_tag LOCUS_32450 368962 368759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 368855 369469 gene locus_tag LOCUS_32460 gene pyrF 368855 369469 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705694.1 protein_id gnl|my_center|LOCUS_32460 369538 370221 gene locus_tag LOCUS_32470 gene ispD 369538 370221 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393964.1 protein_id gnl|my_center|LOCUS_32470 370258 370737 gene locus_tag LOCUS_32480 gene ispF 370258 370737 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367570.1 protein_id gnl|my_center|LOCUS_32480 370734 372353 gene locus_tag LOCUS_32490 370734 372353 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144112.1 protein_id gnl|my_center|LOCUS_32490 372377 373945 gene locus_tag LOCUS_32500 372377 373945 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461499.1 protein_id gnl|my_center|LOCUS_32500 374057 375625 gene locus_tag LOCUS_32510 374057 375625 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140950.1 protein_id gnl|my_center|LOCUS_32510 375702 377357 gene locus_tag LOCUS_32520 375702 377357 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_32520 377386 377889 gene locus_tag LOCUS_32530 377386 377889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 377913 378500 gene locus_tag LOCUS_32540 377913 378500 CDS product phospholipid scramblase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962725.1 protein_id gnl|my_center|LOCUS_32540 378855 383864 gene locus_tag LOCUS_32550 378855 383864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 384032 384577 gene locus_tag LOCUS_32560 384032 384577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 384668 385984 gene locus_tag LOCUS_32570 384668 385984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 386049 386294 gene locus_tag LOCUS_32580 386049 386294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 386833 386462 gene locus_tag LOCUS_32590 386833 386462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 387074 388465 gene locus_tag LOCUS_32600 387074 388465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 388520 389878 gene locus_tag LOCUS_32610 388520 389878 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_32610 393168 390025 gene locus_tag LOCUS_32620 393168 390025 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783463.1 protein_id gnl|my_center|LOCUS_32620 393289 393837 gene locus_tag LOCUS_32630 393289 393837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 394009 394968 gene locus_tag LOCUS_32640 394009 394968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 395052 396035 gene locus_tag LOCUS_32650 395052 396035 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124073.1 protein_id gnl|my_center|LOCUS_32650 397258 396113 gene locus_tag LOCUS_32660 397258 396113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 397418 400126 gene locus_tag LOCUS_32670 397418 400126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 400242 400781 gene locus_tag LOCUS_32680 400242 400781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 400778 401812 gene locus_tag LOCUS_32690 400778 401812 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389193.1 protein_id gnl|my_center|LOCUS_32690 402005 405163 gene locus_tag LOCUS_32700 402005 405163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 405174 406580 gene locus_tag LOCUS_32710 405174 406580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 407097 406837 gene locus_tag LOCUS_32720 407097 406837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 406991 409987 gene locus_tag LOCUS_32730 406991 409987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 411171 410152 gene locus_tag LOCUS_32740 411171 410152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 411289 414012 gene locus_tag LOCUS_32750 411289 414012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 414250 415704 gene locus_tag LOCUS_32760 414250 415704 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_32760 415728 417122 gene locus_tag LOCUS_32770 415728 417122 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_32770 418463 417201 gene locus_tag LOCUS_32780 418463 417201 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_32780 419122 418589 gene locus_tag LOCUS_32790 419122 418589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 419121 420551 gene locus_tag LOCUS_32800 419121 420551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 421520 420564 gene locus_tag LOCUS_32810 421520 420564 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529242.1 protein_id gnl|my_center|LOCUS_32810 422419 421664 gene locus_tag LOCUS_32820 422419 421664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 423474 422629 gene locus_tag LOCUS_32830 423474 422629 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 protein_id gnl|my_center|LOCUS_32830 424567 423476 gene locus_tag LOCUS_32840 424567 423476 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405558.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32840 425083 424679 gene locus_tag LOCUS_32850 425083 424679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 426150 425158 gene locus_tag LOCUS_32860 gene rbsK 426150 425158 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526901.1 protein_id gnl|my_center|LOCUS_32860 427517 426147 gene locus_tag LOCUS_32870 427517 426147 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921299.1 protein_id gnl|my_center|LOCUS_32870 430830 427771 gene locus_tag LOCUS_32880 430830 427771 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813379.1 protein_id gnl|my_center|LOCUS_32880 431001 432737 gene locus_tag LOCUS_32890 431001 432737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 432758 432880 gene locus_tag LOCUS_32900 432758 432880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 434446 432902 gene locus_tag LOCUS_32910 434446 432902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 436301 434676 gene locus_tag LOCUS_32920 436301 434676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 437893 436469 gene locus_tag LOCUS_32930 437893 436469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119296.1 protein_id gnl|my_center|LOCUS_32930 438816 438022 gene locus_tag LOCUS_32940 gene rlmF 438816 438022 CDS product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386375.1 protein_id gnl|my_center|LOCUS_32940 439938 439219 gene locus_tag LOCUS_32950 439938 439219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 440285 442846 gene locus_tag LOCUS_32960 440285 442846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 442892 443347 gene locus_tag LOCUS_32970 442892 443347 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_32970 >Feature sequence06 103 543 gene locus_tag LOCUS_32980 103 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 548 817 gene locus_tag LOCUS_32990 548 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 814 1260 gene locus_tag LOCUS_33000 814 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 1257 1889 gene locus_tag LOCUS_33010 1257 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 1790 2119 gene locus_tag LOCUS_33020 1790 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 2132 3331 gene locus_tag LOCUS_33030 2132 3331 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191774958.1 protein_id gnl|my_center|LOCUS_33030 3674 4606 gene locus_tag LOCUS_33040 3674 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33040 4704 5465 gene locus_tag LOCUS_33050 4704 5465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 6416 5481 gene locus_tag LOCUS_33060 6416 5481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 6804 7688 gene locus_tag LOCUS_33070 6804 7688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 9729 7798 gene locus_tag LOCUS_33080 9729 7798 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204822.1 protein_id gnl|my_center|LOCUS_33080 10222 9716 gene locus_tag LOCUS_33090 10222 9716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 10790 10197 gene locus_tag LOCUS_33100 10790 10197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936276.1 protein_id gnl|my_center|LOCUS_33100 10999 10793 gene locus_tag LOCUS_33110 10999 10793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 11447 11374 gene locus_tag LOCUS_t00360 11447 11374 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 12648 11518 gene locus_tag LOCUS_33120 12648 11518 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121679.1 protein_id gnl|my_center|LOCUS_33120 12797 13870 gene locus_tag LOCUS_33130 12797 13870 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119543.1 protein_id gnl|my_center|LOCUS_33130 14074 15018 gene locus_tag LOCUS_33140 14074 15018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 15087 15539 gene locus_tag LOCUS_33150 15087 15539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 15742 15569 gene locus_tag LOCUS_33160 15742 15569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 15698 17020 gene locus_tag LOCUS_33170 15698 17020 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921299.1 protein_id gnl|my_center|LOCUS_33170 18110 17049 gene locus_tag LOCUS_33180 18110 17049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 18971 18174 gene locus_tag LOCUS_33190 18971 18174 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331802.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33190 19421 23746 gene locus_tag LOCUS_33200 19421 23746 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792884.1 protein_id gnl|my_center|LOCUS_33200 24644 23769 gene locus_tag LOCUS_33210 24644 23769 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439562.1 protein_id gnl|my_center|LOCUS_33210 26480 24708 gene locus_tag LOCUS_33220 26480 24708 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390531.1 protein_id gnl|my_center|LOCUS_33220 26722 26486 gene locus_tag LOCUS_33230 26722 26486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 26973 27194 gene locus_tag LOCUS_33240 26973 27194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 27191 27487 gene locus_tag LOCUS_33250 gene groES 27191 27487 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918572.1 protein_id gnl|my_center|LOCUS_33250 27500 27721 gene locus_tag LOCUS_33260 27500 27721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 27941 27747 gene locus_tag LOCUS_33270 27941 27747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 29168 28098 gene locus_tag LOCUS_33280 29168 28098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 30277 29165 gene locus_tag LOCUS_33290 30277 29165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 36387 30274 gene locus_tag LOCUS_33300 36387 30274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 37374 36574 gene locus_tag LOCUS_33310 37374 36574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 37747 37430 gene locus_tag LOCUS_33320 37747 37430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 38334 38005 gene locus_tag LOCUS_33330 38334 38005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 39800 38286 gene locus_tag LOCUS_33340 39800 38286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 39792 40889 gene locus_tag LOCUS_33350 39792 40889 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263043.1 protein_id gnl|my_center|LOCUS_33350 40957 42606 gene locus_tag LOCUS_33360 40957 42606 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767764.1 protein_id gnl|my_center|LOCUS_33360 43605 42625 gene locus_tag LOCUS_33370 43605 42625 CDS product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817430.1 protein_id gnl|my_center|LOCUS_33370 43706 44482 gene locus_tag LOCUS_33380 gene pyrH 43706 44482 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965095.1 protein_id gnl|my_center|LOCUS_33380 44627 45172 gene locus_tag LOCUS_33390 gene frr 44627 45172 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056114.1 protein_id gnl|my_center|LOCUS_33390 45231 46370 gene locus_tag LOCUS_33400 gene proB 45231 46370 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_33400 46580 47962 gene locus_tag LOCUS_33410 46580 47962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 49568 48162 gene locus_tag LOCUS_33420 49568 48162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967480.1 protein_id gnl|my_center|LOCUS_33420 49816 50862 gene locus_tag LOCUS_33430 49816 50862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 52251 50875 gene locus_tag LOCUS_33440 52251 50875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 52636 52427 gene locus_tag LOCUS_33450 52636 52427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 52529 54988 gene locus_tag LOCUS_33460 52529 54988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 56542 55085 gene locus_tag LOCUS_33470 56542 55085 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943931.1 protein_id gnl|my_center|LOCUS_33470 56845 58848 gene locus_tag LOCUS_33480 56845 58848 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080037.1 protein_id gnl|my_center|LOCUS_33480 61390 59120 gene locus_tag LOCUS_33490 gene ligA 61390 59120 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114675.1 protein_id gnl|my_center|LOCUS_33490 61847 61431 gene locus_tag LOCUS_33500 61847 61431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 62634 62710 gene locus_tag LOCUS_t00370 62634 62710 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 65956 64823 gene locus_tag LOCUS_33510 65956 64823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 66168 65953 gene locus_tag LOCUS_33520 66168 65953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 66999 67784 gene locus_tag LOCUS_33530 66999 67784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 68150 69613 gene locus_tag LOCUS_33540 gene pelB 68150 69613 CDS product exopolygalacturonase PelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865120.1 protein_id gnl|my_center|LOCUS_33540 71460 70048 gene locus_tag LOCUS_33550 71460 70048 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328624.1 protein_id gnl|my_center|LOCUS_33550 74014 71525 gene locus_tag LOCUS_33560 74014 71525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 75395 74127 gene locus_tag LOCUS_33570 75395 74127 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113534.1 protein_id gnl|my_center|LOCUS_33570 75528 76022 gene locus_tag LOCUS_33580 75528 76022 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090532.1 protein_id gnl|my_center|LOCUS_33580 76069 77103 gene locus_tag LOCUS_33590 gene tdh 76069 77103 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094910.1 protein_id gnl|my_center|LOCUS_33590 77109 78299 gene locus_tag LOCUS_33600 77109 78299 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972198.1 protein_id gnl|my_center|LOCUS_33600 78302 78766 gene locus_tag LOCUS_33610 78302 78766 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816436.1 protein_id gnl|my_center|LOCUS_33610 80282 78969 gene locus_tag LOCUS_33620 gene hisS 80282 78969 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903476.1 protein_id gnl|my_center|LOCUS_33620 80715 80359 gene locus_tag LOCUS_33630 80715 80359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 80846 81544 gene locus_tag LOCUS_33640 gene ubiE 80846 81544 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228961.1 protein_id gnl|my_center|LOCUS_33640 82212 81895 gene locus_tag LOCUS_33650 gene erpA 82212 81895 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085254.1 protein_id gnl|my_center|LOCUS_33650 82328 83302 gene locus_tag LOCUS_33660 82328 83302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 83329 84846 gene locus_tag LOCUS_33670 gene rpoN 83329 84846 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391805.1 protein_id gnl|my_center|LOCUS_33670 85976 84933 gene locus_tag LOCUS_33680 gene tsaD 85976 84933 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204325.1 protein_id gnl|my_center|LOCUS_33680 87397 85973 gene locus_tag LOCUS_33690 87397 85973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 87339 88295 gene locus_tag LOCUS_33700 87339 88295 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941144.1 protein_id gnl|my_center|LOCUS_33700 88381 88611 gene locus_tag LOCUS_33710 gene rpmB 88381 88611 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124776.1 protein_id gnl|my_center|LOCUS_33710 88731 90560 gene locus_tag LOCUS_33720 88731 90560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 91807 90557 gene locus_tag LOCUS_33730 gene fabF 91807 90557 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_33730 92171 91908 gene locus_tag LOCUS_33740 gene acpP 92171 91908 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771263.1 protein_id gnl|my_center|LOCUS_33740 92960 92211 gene locus_tag LOCUS_33750 gene fabG 92960 92211 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367190.1 protein_id gnl|my_center|LOCUS_33750 94234 93059 gene locus_tag LOCUS_33760 94234 93059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 94343 95161 gene locus_tag LOCUS_33770 94343 95161 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460221.1 protein_id gnl|my_center|LOCUS_33770 95151 95996 gene locus_tag LOCUS_33780 95151 95996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 96060 96935 gene locus_tag LOCUS_33790 gene folD 96060 96935 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_33790 96974 98104 gene locus_tag LOCUS_33800 96974 98104 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546841.1 protein_id gnl|my_center|LOCUS_33800 98155 98961 gene locus_tag LOCUS_33810 gene proC 98155 98961 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140706.1 protein_id gnl|my_center|LOCUS_33810 98978 99976 gene locus_tag LOCUS_33820 gene rfaD 98978 99976 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546025.1 protein_id gnl|my_center|LOCUS_33820 100813 100154 gene locus_tag LOCUS_33830 100813 100154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 101448 100810 gene locus_tag LOCUS_33840 101448 100810 CDS product cbb3-type cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403102.1 protein_id gnl|my_center|LOCUS_33840 102872 101445 gene locus_tag LOCUS_33850 102872 101445 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403101.1 protein_id gnl|my_center|LOCUS_33850 103228 102896 gene locus_tag LOCUS_33860 103228 102896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 104498 103221 gene locus_tag LOCUS_33870 104498 103221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922553.1 protein_id gnl|my_center|LOCUS_33870 105133 104495 gene locus_tag LOCUS_33880 105133 104495 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421545.1 protein_id gnl|my_center|LOCUS_33880 105670 105137 gene locus_tag LOCUS_33890 105670 105137 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404832.1 protein_id gnl|my_center|LOCUS_33890 107110 105683 gene locus_tag LOCUS_33900 gene nrfD 107110 105683 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404833.1 protein_id gnl|my_center|LOCUS_33900 110521 107141 gene locus_tag LOCUS_33910 110521 107141 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258002.1 protein_id gnl|my_center|LOCUS_33910 111177 110518 gene locus_tag LOCUS_33920 111177 110518 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404835.1 protein_id gnl|my_center|LOCUS_33920 111764 114649 gene locus_tag LOCUS_33930 111764 114649 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104454.1 protein_id gnl|my_center|LOCUS_33930 114934 116574 gene locus_tag LOCUS_33940 114934 116574 CDS product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404756.1 protein_id gnl|my_center|LOCUS_33940 117499 116588 gene locus_tag LOCUS_33950 gene miaA 117499 116588 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256258.1 protein_id gnl|my_center|LOCUS_33950 117536 118423 gene locus_tag LOCUS_33960 117536 118423 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793782.1 protein_id gnl|my_center|LOCUS_33960 119772 118855 gene locus_tag LOCUS_33970 119772 118855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 120760 119954 gene locus_tag LOCUS_33980 gene trpA 120760 119954 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383540.1 protein_id gnl|my_center|LOCUS_33980 121784 121014 gene locus_tag LOCUS_33990 121784 121014 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393113.1 protein_id gnl|my_center|LOCUS_33990 122495 124141 gene locus_tag LOCUS_34000 122495 124141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 124262 124338 gene locus_tag LOCUS_t00380 124262 124338 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 124558 125622 gene locus_tag LOCUS_34010 124558 125622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 125625 125855 gene locus_tag LOCUS_34020 125625 125855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 126607 125903 gene locus_tag LOCUS_34030 126607 125903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 126914 126597 gene locus_tag LOCUS_34040 126914 126597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 127204 126911 gene locus_tag LOCUS_34050 127204 126911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 127211 128122 gene locus_tag LOCUS_34060 127211 128122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 128227 131112 gene locus_tag LOCUS_34070 gene mobF 128227 131112 CDS product MobF family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639975.1 protein_id gnl|my_center|LOCUS_34070 131123 131533 gene locus_tag LOCUS_34080 131123 131533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 131820 132155 gene locus_tag LOCUS_34090 131820 132155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 132152 132883 gene locus_tag LOCUS_34100 132152 132883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 132880 133473 gene locus_tag LOCUS_34110 132880 133473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 133723 133974 gene locus_tag LOCUS_34120 133723 133974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 135568 134039 gene locus_tag LOCUS_34130 135568 134039 CDS product IS66-like element ISBthe6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005805141.1 protein_id gnl|my_center|LOCUS_34130 135975 135610 gene locus_tag LOCUS_34140 gene tnpB 135975 135610 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385717.1 protein_id gnl|my_center|LOCUS_34140 136367 135987 gene locus_tag LOCUS_34150 136367 135987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 136451 136813 gene locus_tag LOCUS_34160 136451 136813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 136813 137160 gene locus_tag LOCUS_34170 136813 137160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 137201 138664 gene locus_tag LOCUS_34180 137201 138664 CDS product IS66-like element ISBthe6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005805141.1 protein_id gnl|my_center|LOCUS_34180 139103 138912 gene locus_tag LOCUS_34190 139103 138912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 151667 139242 gene locus_tag LOCUS_34200 151667 139242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 164161 151667 gene locus_tag LOCUS_34210 164161 151667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 165203 164154 gene locus_tag LOCUS_34220 165203 164154 CDS product HAD-IIIC family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084425603.1 protein_id gnl|my_center|LOCUS_34220 166320 165208 gene locus_tag LOCUS_34230 166320 165208 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947657.1 protein_id gnl|my_center|LOCUS_34230 166579 166325 gene locus_tag LOCUS_34240 166579 166325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 167446 166625 gene locus_tag LOCUS_34250 167446 166625 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226597.1 protein_id gnl|my_center|LOCUS_34250 174566 167502 gene locus_tag LOCUS_34260 174566 167502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 175893 174967 gene locus_tag LOCUS_34270 175893 174967 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972638.1 protein_id gnl|my_center|LOCUS_34270 176479 176015 gene locus_tag LOCUS_34280 176479 176015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 177274 177056 gene locus_tag LOCUS_34290 177274 177056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 177900 177343 gene locus_tag LOCUS_34300 177900 177343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 178412 180148 gene locus_tag LOCUS_34310 178412 180148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 180319 181020 gene locus_tag LOCUS_34320 180319 181020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 181100 181900 gene locus_tag LOCUS_34330 181100 181900 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067343.1 protein_id gnl|my_center|LOCUS_34330 181897 182751 gene locus_tag LOCUS_34340 181897 182751 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011669024.1 protein_id gnl|my_center|LOCUS_34340 183221 182646 gene locus_tag LOCUS_34350 183221 182646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 183159 184025 gene locus_tag LOCUS_34360 183159 184025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 184046 184714 gene locus_tag LOCUS_34370 184046 184714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 184924 185559 gene locus_tag LOCUS_34380 184924 185559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 185719 187002 gene locus_tag LOCUS_34390 185719 187002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 187053 188249 gene locus_tag LOCUS_34400 187053 188249 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887947.1 protein_id gnl|my_center|LOCUS_34400 188273 189319 gene locus_tag LOCUS_34410 188273 189319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 189328 191004 gene locus_tag LOCUS_34420 189328 191004 CDS product cyclic peptide export ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057486.1 protein_id gnl|my_center|LOCUS_34420 191670 191969 gene locus_tag LOCUS_34430 191670 191969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 193500 191974 gene locus_tag LOCUS_34440 193500 191974 CDS product IS66-like element ISBthe6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005805141.1 protein_id gnl|my_center|LOCUS_34440 193671 193501 gene locus_tag LOCUS_34450 193671 193501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 194203 193844 gene locus_tag LOCUS_34460 194203 193844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 195087 194257 gene locus_tag LOCUS_34470 195087 194257 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478343.1 protein_id gnl|my_center|LOCUS_34470 196649 195570 gene locus_tag LOCUS_34480 196649 195570 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069456631.1 protein_id gnl|my_center|LOCUS_34480 196721 197107 gene locus_tag LOCUS_34490 196721 197107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 197082 197645 gene locus_tag LOCUS_34500 197082 197645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 199602 200693 gene locus_tag LOCUS_34510 199602 200693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 200690 202657 gene locus_tag LOCUS_34520 200690 202657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 202632 203690 gene locus_tag LOCUS_34530 202632 203690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 205433 206077 gene locus_tag LOCUS_34540 205433 206077 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143952.1 protein_id gnl|my_center|LOCUS_34540 207693 206398 gene locus_tag LOCUS_34550 207693 206398 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229166.1 protein_id gnl|my_center|LOCUS_34550 208063 209034 gene locus_tag LOCUS_34560 208063 209034 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922059.1 protein_id gnl|my_center|LOCUS_34560 210731 209181 gene locus_tag LOCUS_34570 210731 209181 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_34570 211855 210821 gene locus_tag LOCUS_34580 211855 210821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 211951 215205 gene locus_tag LOCUS_34590 211951 215205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 215213 217312 gene locus_tag LOCUS_34600 215213 217312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 217350 218588 gene locus_tag LOCUS_34610 217350 218588 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118126.1 protein_id gnl|my_center|LOCUS_34610 218981 218622 gene locus_tag LOCUS_34620 218981 218622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 219480 219061 gene locus_tag LOCUS_34630 219480 219061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 220413 219481 gene locus_tag LOCUS_34640 220413 219481 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816010.1 protein_id gnl|my_center|LOCUS_34640 223851 220450 gene locus_tag LOCUS_34650 223851 220450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 226784 224031 gene locus_tag LOCUS_34660 226784 224031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 226953 228053 gene locus_tag LOCUS_34670 226953 228053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 228213 228947 gene locus_tag LOCUS_34680 228213 228947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 231082 229025 gene locus_tag LOCUS_34690 231082 229025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 231194 231778 gene locus_tag LOCUS_34700 231194 231778 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105333325.1 protein_id gnl|my_center|LOCUS_34700 231775 233178 gene locus_tag LOCUS_34710 231775 233178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 233197 236403 gene locus_tag LOCUS_34720 233197 236403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 236537 237961 gene locus_tag LOCUS_34730 236537 237961 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120393.1 protein_id gnl|my_center|LOCUS_34730 238952 238101 gene locus_tag LOCUS_34740 238952 238101 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812797.1 protein_id gnl|my_center|LOCUS_34740 240372 239125 gene locus_tag LOCUS_34750 240372 239125 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681491.1 protein_id gnl|my_center|LOCUS_34750 240784 240542 gene locus_tag LOCUS_34760 240784 240542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 241018 240929 gene locus_tag LOCUS_t00390 241018 240929 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 241523 241098 gene locus_tag LOCUS_34770 241523 241098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 242250 241657 gene locus_tag LOCUS_34780 gene tsf 242250 241657 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942565.1 protein_id gnl|my_center|LOCUS_34780 243201 242287 gene locus_tag LOCUS_34790 gene rpsB 243201 242287 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893880.1 protein_id gnl|my_center|LOCUS_34790 243441 243517 gene locus_tag LOCUS_t00400 243441 243517 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 244106 243558 gene locus_tag LOCUS_34800 244106 243558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 244267 244935 gene locus_tag LOCUS_34810 244267 244935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 245220 244942 gene locus_tag LOCUS_34820 245220 244942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 245183 245467 gene locus_tag LOCUS_34830 245183 245467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 245707 245632 gene locus_tag LOCUS_t00410 245707 245632 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 246825 245815 gene locus_tag LOCUS_34840 246825 245815 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338937.1 protein_id gnl|my_center|LOCUS_34840 247000 247416 gene locus_tag LOCUS_34850 247000 247416 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336801.1 protein_id gnl|my_center|LOCUS_34850 249174 247447 gene locus_tag LOCUS_34860 249174 247447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 249264 250127 gene locus_tag LOCUS_34870 249264 250127 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084213.1 protein_id gnl|my_center|LOCUS_34870 250202 251236 gene locus_tag LOCUS_34880 250202 251236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 251335 254502 gene locus_tag LOCUS_34890 251335 254502 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839548.1 protein_id gnl|my_center|LOCUS_34890 254495 255286 gene locus_tag LOCUS_34900 254495 255286 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839974.1 protein_id gnl|my_center|LOCUS_34900 255533 256408 gene locus_tag LOCUS_34910 255533 256408 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037253110.1 protein_id gnl|my_center|LOCUS_34910 257262 256582 gene locus_tag LOCUS_34920 257262 256582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 257577 257987 gene locus_tag LOCUS_34930 257577 257987 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327064.1 protein_id gnl|my_center|LOCUS_34930 259080 258001 gene locus_tag LOCUS_34940 259080 258001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 259219 259899 gene locus_tag LOCUS_34950 259219 259899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 259896 261008 gene locus_tag LOCUS_34960 259896 261008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 261022 261975 gene locus_tag LOCUS_34970 261022 261975 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970198.1 protein_id gnl|my_center|LOCUS_34970 264454 261992 gene locus_tag LOCUS_34980 264454 261992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 265403 264510 gene locus_tag LOCUS_34990 265403 264510 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120390.1 protein_id gnl|my_center|LOCUS_34990 266208 265438 gene locus_tag LOCUS_35000 266208 265438 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958120.1 protein_id gnl|my_center|LOCUS_35000 267259 266234 gene locus_tag LOCUS_35010 267259 266234 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921854.1 protein_id gnl|my_center|LOCUS_35010 267975 267256 gene locus_tag LOCUS_35020 267975 267256 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120388.1 protein_id gnl|my_center|LOCUS_35020 271550 268086 gene locus_tag LOCUS_35030 271550 268086 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839665.1 protein_id gnl|my_center|LOCUS_35030 272724 271618 gene locus_tag LOCUS_35040 gene purM 272724 271618 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057648.1 protein_id gnl|my_center|LOCUS_35040 274661 272754 gene locus_tag LOCUS_35050 274661 272754 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765068.1 protein_id gnl|my_center|LOCUS_35050 275034 274654 gene locus_tag LOCUS_35060 275034 274654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 274921 278922 gene locus_tag LOCUS_35070 gene purL 274921 278922 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819788.1 protein_id gnl|my_center|LOCUS_35070 279062 280708 gene locus_tag LOCUS_35080 279062 280708 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_35080 280705 281595 gene locus_tag LOCUS_35090 280705 281595 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121449.1 protein_id gnl|my_center|LOCUS_35090 283064 281673 gene locus_tag LOCUS_35100 283064 281673 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531130.1 protein_id gnl|my_center|LOCUS_35100 283175 284602 gene locus_tag LOCUS_35110 283175 284602 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799204.1 protein_id gnl|my_center|LOCUS_35110 285476 284709 gene locus_tag LOCUS_35120 285476 284709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 286911 285658 gene locus_tag LOCUS_35130 286911 285658 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258147.1 protein_id gnl|my_center|LOCUS_35130 287084 288577 gene locus_tag LOCUS_35140 287084 288577 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978049.1 protein_id gnl|my_center|LOCUS_35140 288574 289503 gene locus_tag LOCUS_35150 288574 289503 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192260.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35150 289505 290563 gene locus_tag LOCUS_35160 289505 290563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 290585 291574 gene locus_tag LOCUS_35170 gene rhaS 290585 291574 CDS product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582803.1 protein_id gnl|my_center|LOCUS_35170 291768 292514 gene locus_tag LOCUS_35180 291768 292514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 294002 292608 gene locus_tag LOCUS_35190 294002 292608 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167274874.1 protein_id gnl|my_center|LOCUS_35190 294532 294732 gene locus_tag LOCUS_35200 294532 294732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 295764 294883 gene locus_tag LOCUS_35210 295764 294883 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036722.1 protein_id gnl|my_center|LOCUS_35210 298094 295839 gene locus_tag LOCUS_35220 298094 295839 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966435.1 protein_id gnl|my_center|LOCUS_35220 298360 299085 gene locus_tag LOCUS_35230 298360 299085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 300238 299186 gene locus_tag LOCUS_35240 300238 299186 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921037.1 protein_id gnl|my_center|LOCUS_35240 301023 300451 gene locus_tag LOCUS_35250 301023 300451 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528589.1 protein_id gnl|my_center|LOCUS_35250 303841 301109 gene locus_tag LOCUS_35260 303841 301109 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933216.1 protein_id gnl|my_center|LOCUS_35260 304081 306948 gene locus_tag LOCUS_35270 304081 306948 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917903.1 protein_id gnl|my_center|LOCUS_35270 307100 307459 gene locus_tag LOCUS_35280 307100 307459 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384381.1 protein_id gnl|my_center|LOCUS_35280 307443 309257 gene locus_tag LOCUS_35290 307443 309257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 309562 309774 gene locus_tag LOCUS_35300 309562 309774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 310492 309974 gene locus_tag LOCUS_35310 310492 309974 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084789.1 protein_id gnl|my_center|LOCUS_35310 310748 314425 gene locus_tag LOCUS_35320 310748 314425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 315215 314598 gene locus_tag LOCUS_35330 315215 314598 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185693707.1 protein_id gnl|my_center|LOCUS_35330 317394 315568 gene locus_tag LOCUS_35340 317394 315568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 318312 317677 gene locus_tag LOCUS_35350 318312 317677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 321561 318316 gene locus_tag LOCUS_35360 321561 318316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 322669 321575 gene locus_tag LOCUS_35370 322669 321575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 325164 322666 gene locus_tag LOCUS_35380 325164 322666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 326386 325187 gene locus_tag LOCUS_35390 326386 325187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 329210 326559 gene locus_tag LOCUS_35400 329210 326559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 329313 329855 gene locus_tag LOCUS_35410 329313 329855 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551114.1 protein_id gnl|my_center|LOCUS_35410 330223 330429 gene locus_tag LOCUS_35420 330223 330429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 330426 332423 gene locus_tag LOCUS_35430 330426 332423 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958448.1 protein_id gnl|my_center|LOCUS_35430 332539 334683 gene locus_tag LOCUS_35440 gene rhgW 332539 334683 CDS product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886436.1 protein_id gnl|my_center|LOCUS_35440 334766 336802 gene locus_tag LOCUS_35450 gene rhgW 334766 336802 CDS product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886436.1 protein_id gnl|my_center|LOCUS_35450 336799 337305 gene locus_tag LOCUS_35460 336799 337305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 338960 337632 gene locus_tag LOCUS_35470 338960 337632 CDS product Trx7/PDZ domain-containing (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922213.1 protein_id gnl|my_center|LOCUS_35470 339040 339876 gene locus_tag LOCUS_35480 339040 339876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 340004 341170 gene locus_tag LOCUS_35490 340004 341170 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967232.1 protein_id gnl|my_center|LOCUS_35490 342906 341323 gene locus_tag LOCUS_35500 342906 341323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 343132 344961 gene locus_tag LOCUS_35510 343132 344961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 345926 345075 gene locus_tag LOCUS_35520 345926 345075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 347273 345945 gene locus_tag LOCUS_35530 347273 345945 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929074.1 protein_id gnl|my_center|LOCUS_35530 349333 347456 gene locus_tag LOCUS_35540 349333 347456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 350352 349330 gene locus_tag LOCUS_35550 350352 349330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 350397 350933 gene locus_tag LOCUS_35560 350397 350933 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008130072.1 protein_id gnl|my_center|LOCUS_35560 352237 350963 gene locus_tag LOCUS_35570 352237 350963 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058160.1 protein_id gnl|my_center|LOCUS_35570 353085 352234 gene locus_tag LOCUS_35580 353085 352234 CDS product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226278.1 protein_id gnl|my_center|LOCUS_35580 355546 353090 gene locus_tag LOCUS_35590 355546 353090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 355652 356500 gene locus_tag LOCUS_35600 355652 356500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 356648 357691 gene locus_tag LOCUS_35610 356648 357691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 357745 360834 gene locus_tag LOCUS_35620 357745 360834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 360990 361514 gene locus_tag LOCUS_35630 360990 361514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 361523 363184 gene locus_tag LOCUS_35640 361523 363184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 363232 364389 gene locus_tag LOCUS_35650 363232 364389 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978349.1 protein_id gnl|my_center|LOCUS_35650 364659 368156 gene locus_tag LOCUS_35660 364659 368156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 368268 369719 gene locus_tag LOCUS_35670 368268 369719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 370017 374942 gene locus_tag LOCUS_35680 370017 374942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 376723 375185 gene locus_tag LOCUS_35690 376723 375185 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331975.1 protein_id gnl|my_center|LOCUS_35690 379203 376729 gene locus_tag LOCUS_35700 379203 376729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 379372 380631 gene locus_tag LOCUS_35710 379372 380631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 380817 384098 gene locus_tag LOCUS_35720 380817 384098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 384371 386050 gene locus_tag LOCUS_35730 384371 386050 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973790.1 protein_id gnl|my_center|LOCUS_35730 386062 386628 gene locus_tag LOCUS_35740 386062 386628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 387719 386757 gene locus_tag LOCUS_35750 387719 386757 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118199.1 protein_id gnl|my_center|LOCUS_35750 389275 387767 gene locus_tag LOCUS_35760 389275 387767 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922314.1 protein_id gnl|my_center|LOCUS_35760 390249 389272 gene locus_tag LOCUS_35770 390249 389272 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615404.1 protein_id gnl|my_center|LOCUS_35770 390448 391239 gene locus_tag LOCUS_35780 gene elyC 390448 391239 CDS product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704890.1 protein_id gnl|my_center|LOCUS_35780 391310 391948 gene locus_tag LOCUS_35790 391310 391948 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036867.1 protein_id gnl|my_center|LOCUS_35790 392017 393084 gene locus_tag LOCUS_35800 392017 393084 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036868.1 protein_id gnl|my_center|LOCUS_35800 394747 393245 gene locus_tag LOCUS_35810 gene gatB 394747 393245 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_35810 395121 394744 gene locus_tag LOCUS_35820 395121 394744 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_35820 396644 395166 gene locus_tag LOCUS_35830 gene gatA 396644 395166 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_35830 396931 396641 gene locus_tag LOCUS_35840 gene gatC 396931 396641 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393506.1 protein_id gnl|my_center|LOCUS_35840 399395 396936 gene locus_tag LOCUS_35850 gene pheT 399395 396936 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_35850 400592 399498 gene locus_tag LOCUS_35860 gene pheS 400592 399498 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942166.1 protein_id gnl|my_center|LOCUS_35860 401052 400669 gene locus_tag LOCUS_35870 gene rplT 401052 400669 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289310.1 protein_id gnl|my_center|LOCUS_35870 401338 401144 gene locus_tag LOCUS_35880 401338 401144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 402939 401404 gene locus_tag LOCUS_35890 402939 401404 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142741014.1 protein_id gnl|my_center|LOCUS_35890 403814 402936 gene locus_tag LOCUS_35900 403814 402936 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188844.1 protein_id gnl|my_center|LOCUS_35900 405279 403846 gene locus_tag LOCUS_35910 405279 403846 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533356.1 protein_id gnl|my_center|LOCUS_35910 408515 405405 gene locus_tag LOCUS_35920 408515 405405 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265653.1 protein_id gnl|my_center|LOCUS_35920 408701 410182 gene locus_tag LOCUS_35930 408701 410182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 411941 410238 gene locus_tag LOCUS_35940 gene ggt 411941 410238 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016769.1 protein_id gnl|my_center|LOCUS_35940 415357 412046 gene locus_tag LOCUS_35950 415357 412046 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265653.1 protein_id gnl|my_center|LOCUS_35950 416014 415640 gene locus_tag LOCUS_35960 416014 415640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 417342 416020 gene locus_tag LOCUS_35970 gene fabF 417342 416020 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_35970 417999 417367 gene locus_tag LOCUS_35980 417999 417367 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112334.1 protein_id gnl|my_center|LOCUS_35980 418155 418715 gene locus_tag LOCUS_35990 418155 418715 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146469.1 protein_id gnl|my_center|LOCUS_35990 418738 419721 gene locus_tag LOCUS_36000 418738 419721 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009910187.1 protein_id gnl|my_center|LOCUS_36000 419736 422129 gene locus_tag LOCUS_36010 419736 422129 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392131.1 protein_id gnl|my_center|LOCUS_36010 422126 422641 gene locus_tag LOCUS_36020 422126 422641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 422762 423550 gene locus_tag LOCUS_36030 422762 423550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 423670 424338 gene locus_tag LOCUS_36040 423670 424338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 424352 424966 gene locus_tag LOCUS_36050 424352 424966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 424984 427542 gene locus_tag LOCUS_36060 424984 427542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 427684 431550 gene locus_tag LOCUS_36070 427684 431550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 431635 433257 gene locus_tag LOCUS_36080 431635 433257 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144112.1 protein_id gnl|my_center|LOCUS_36080 433314 435908 gene locus_tag LOCUS_36090 433314 435908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 436048 440736 gene locus_tag LOCUS_36100 436048 440736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 441348 440776 gene locus_tag LOCUS_36110 441348 440776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 441671 441562 gene locus_tag LOCUS_r00010 441671 441562 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence07 <1 2333 gene locus_tag LOCUS_36120 <1 2333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933346.1:pyruvate, phosphate dikinase 2699 2496 gene locus_tag LOCUS_36130 2699 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 4776 2830 gene locus_tag LOCUS_36140 4776 2830 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870453.1 protein_id gnl|my_center|LOCUS_36140 5058 5975 gene locus_tag LOCUS_36150 5058 5975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 6001 7239 gene locus_tag LOCUS_36160 6001 7239 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530336.1 protein_id gnl|my_center|LOCUS_36160 8807 7356 gene locus_tag LOCUS_36170 8807 7356 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123415.1 protein_id gnl|my_center|LOCUS_36170 12279 8815 gene locus_tag LOCUS_36180 12279 8815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 14797 12347 gene locus_tag LOCUS_36190 14797 12347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 15647 14829 gene locus_tag LOCUS_36200 15647 14829 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328799.1 protein_id gnl|my_center|LOCUS_36200 15882 18908 gene locus_tag LOCUS_36210 15882 18908 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404755.1 protein_id gnl|my_center|LOCUS_36210 19151 20866 gene locus_tag LOCUS_36220 19151 20866 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973686.1 protein_id gnl|my_center|LOCUS_36220 22044 21148 gene locus_tag LOCUS_36230 22044 21148 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120550.1 protein_id gnl|my_center|LOCUS_36230 23615 22170 gene locus_tag LOCUS_36240 23615 22170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_36240 23703 25091 gene locus_tag LOCUS_36250 23703 25091 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921573.1 protein_id gnl|my_center|LOCUS_36250 25283 25426 gene locus_tag LOCUS_36260 25283 25426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 25526 26776 gene locus_tag LOCUS_36270 25526 26776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 26778 26963 gene locus_tag LOCUS_36280 26778 26963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 27078 28019 gene locus_tag LOCUS_36290 27078 28019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 28098 28673 gene locus_tag LOCUS_36300 28098 28673 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036499.1 protein_id gnl|my_center|LOCUS_36300 28670 29755 gene locus_tag LOCUS_36310 28670 29755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 29844 30479 gene locus_tag LOCUS_36320 29844 30479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 30650 34102 gene locus_tag LOCUS_36330 30650 34102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037251825.1 protein_id gnl|my_center|LOCUS_36330 34286 37063 gene locus_tag LOCUS_36340 34286 37063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 38023 37331 gene locus_tag LOCUS_36350 38023 37331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 38848 38471 gene locus_tag LOCUS_36360 38848 38471 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444835.1 protein_id gnl|my_center|LOCUS_36360 39973 39002 gene locus_tag LOCUS_36370 39973 39002 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082266.1 protein_id gnl|my_center|LOCUS_36370 40070 40675 gene locus_tag LOCUS_36380 40070 40675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36380 40716 41528 gene locus_tag LOCUS_36390 gene xdhC 40716 41528 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083344.1 protein_id gnl|my_center|LOCUS_36390 41591 42241 gene locus_tag LOCUS_36400 41591 42241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 42614 42303 gene locus_tag LOCUS_36410 42614 42303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087848.1 protein_id gnl|my_center|LOCUS_36410 42713 43702 gene locus_tag LOCUS_36420 42713 43702 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942580.1 protein_id gnl|my_center|LOCUS_36420 43705 44706 gene locus_tag LOCUS_36430 43705 44706 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_36430 44703 45464 gene locus_tag LOCUS_36440 gene gldF 44703 45464 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_36440 45484 46962 gene locus_tag LOCUS_36450 45484 46962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 46984 48957 gene locus_tag LOCUS_36460 46984 48957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 49040 51898 gene locus_tag LOCUS_36470 49040 51898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 52502 51942 gene locus_tag LOCUS_36480 52502 51942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 52653 56660 gene locus_tag LOCUS_36490 52653 56660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 58303 57080 gene locus_tag LOCUS_36500 58303 57080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 58432 59640 gene locus_tag LOCUS_36510 58432 59640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 59648 60856 gene locus_tag LOCUS_36520 59648 60856 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123797.1 protein_id gnl|my_center|LOCUS_36520 61382 61053 gene locus_tag LOCUS_36530 61382 61053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 61714 61313 gene locus_tag LOCUS_36540 61714 61313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 64128 61849 gene locus_tag LOCUS_36550 64128 61849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 65295 64291 gene locus_tag LOCUS_36560 65295 64291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 65273 65464 gene locus_tag LOCUS_36570 65273 65464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 67514 65595 gene locus_tag LOCUS_36580 67514 65595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 68657 67626 gene locus_tag LOCUS_36590 68657 67626 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972309.1 protein_id gnl|my_center|LOCUS_36590 68888 69307 gene locus_tag LOCUS_36600 68888 69307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 69324 70169 gene locus_tag LOCUS_36610 69324 70169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 70183 70554 gene locus_tag LOCUS_36620 70183 70554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 71309 70899 gene locus_tag LOCUS_36630 71309 70899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 72529 71375 gene locus_tag LOCUS_36640 72529 71375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 73320 72745 gene locus_tag LOCUS_36650 73320 72745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 73658 73323 gene locus_tag LOCUS_36660 73658 73323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 74248 73655 gene locus_tag LOCUS_36670 74248 73655 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390290.1 protein_id gnl|my_center|LOCUS_36670 74579 76249 gene locus_tag LOCUS_36680 gene leuA 74579 76249 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113805.1 protein_id gnl|my_center|LOCUS_36680 77501 76464 gene locus_tag LOCUS_36690 77501 76464 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039182.1 protein_id gnl|my_center|LOCUS_36690 77629 78747 gene locus_tag LOCUS_36700 gene rlmN 77629 78747 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450540.1 protein_id gnl|my_center|LOCUS_36700 79132 81024 gene locus_tag LOCUS_36710 79132 81024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 81181 81900 gene locus_tag LOCUS_36720 81181 81900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 82030 82755 gene locus_tag LOCUS_36730 82030 82755 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_36730 82774 84672 gene locus_tag LOCUS_36740 82774 84672 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_36740 84713 85885 gene locus_tag LOCUS_36750 84713 85885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 86271 87149 gene locus_tag LOCUS_36760 gene metF 86271 87149 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880925.1 protein_id gnl|my_center|LOCUS_36760 87385 89067 gene locus_tag LOCUS_36770 87385 89067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929090.1 protein_id gnl|my_center|LOCUS_36770 89141 90211 gene locus_tag LOCUS_36780 gene hypE 89141 90211 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225638.1 protein_id gnl|my_center|LOCUS_36780 91469 90360 gene locus_tag LOCUS_36790 gene hypD 91469 90360 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_36790 91750 91466 gene locus_tag LOCUS_36800 91750 91466 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258619.1 protein_id gnl|my_center|LOCUS_36800 94067 91764 gene locus_tag LOCUS_36810 gene hypF 94067 91764 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_36810 94857 94084 gene locus_tag LOCUS_36820 gene hypB 94857 94084 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889574.1 protein_id gnl|my_center|LOCUS_36820 95204 94860 gene locus_tag LOCUS_36830 gene hypA 95204 94860 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258629.1 protein_id gnl|my_center|LOCUS_36830 95404 96570 gene locus_tag LOCUS_36840 95404 96570 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388916.1 protein_id gnl|my_center|LOCUS_36840 96567 98291 gene locus_tag LOCUS_36850 96567 98291 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012502532.1 protein_id gnl|my_center|LOCUS_36850 98306 99079 gene locus_tag LOCUS_36860 gene cybH 98306 99079 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811165.1 protein_id gnl|my_center|LOCUS_36860 99089 99607 gene locus_tag LOCUS_36870 99089 99607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 99604 100296 gene locus_tag LOCUS_36880 99604 100296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 100866 100468 gene locus_tag LOCUS_36890 100866 100468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 101111 100863 gene locus_tag LOCUS_36900 101111 100863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 101312 104131 gene locus_tag LOCUS_36910 101312 104131 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943088.1 protein_id gnl|my_center|LOCUS_36910 104243 105442 gene locus_tag LOCUS_36920 gene odhB 104243 105442 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083283.1 protein_id gnl|my_center|LOCUS_36920 105539 106927 gene locus_tag LOCUS_36930 gene lpdA 105539 106927 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972449.1 protein_id gnl|my_center|LOCUS_36930 107136 107582 gene locus_tag LOCUS_36940 107136 107582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 107807 108544 gene locus_tag LOCUS_36950 107807 108544 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083678.1 protein_id gnl|my_center|LOCUS_36950 109031 108558 gene locus_tag LOCUS_36960 109031 108558 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083677.1 protein_id gnl|my_center|LOCUS_36960 109215 110042 gene locus_tag LOCUS_36970 109215 110042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 110237 111688 gene locus_tag LOCUS_36980 110237 111688 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257880.1 protein_id gnl|my_center|LOCUS_36980 111707 112768 gene locus_tag LOCUS_36990 111707 112768 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_36990 112822 113685 gene locus_tag LOCUS_37000 112822 113685 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888626.1 protein_id gnl|my_center|LOCUS_37000 113886 114752 gene locus_tag LOCUS_37010 113886 114752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37010 114776 117007 gene locus_tag LOCUS_37020 114776 117007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37020 120866 117186 gene locus_tag LOCUS_37030 120866 117186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 120784 121587 gene locus_tag LOCUS_37040 120784 121587 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404382.1 protein_id gnl|my_center|LOCUS_37040 121667 122104 gene locus_tag LOCUS_37050 gene rpiB 121667 122104 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161952859.1 protein_id gnl|my_center|LOCUS_37050 122326 122946 gene locus_tag LOCUS_37060 122326 122946 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339004.1 protein_id gnl|my_center|LOCUS_37060 122963 123949 gene locus_tag LOCUS_37070 122963 123949 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036002.1 protein_id gnl|my_center|LOCUS_37070 123969 124649 gene locus_tag LOCUS_37080 123969 124649 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173343.1 protein_id gnl|my_center|LOCUS_37080 125094 125627 gene locus_tag LOCUS_37090 125094 125627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 125657 126019 gene locus_tag LOCUS_37100 125657 126019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 127351 126344 gene locus_tag LOCUS_37110 gene glpQ 127351 126344 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706146.1 protein_id gnl|my_center|LOCUS_37110 128739 127348 gene locus_tag LOCUS_37120 gene glpT 128739 127348 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705541.1 protein_id gnl|my_center|LOCUS_37120 129559 128741 gene locus_tag LOCUS_37130 129559 128741 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119041.1 protein_id gnl|my_center|LOCUS_37130 132849 129583 gene locus_tag LOCUS_37140 132849 129583 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265653.1 protein_id gnl|my_center|LOCUS_37140 132962 133912 gene locus_tag LOCUS_37150 132962 133912 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373366.1 protein_id gnl|my_center|LOCUS_37150 133971 136028 gene locus_tag LOCUS_37160 133971 136028 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839420.1 protein_id gnl|my_center|LOCUS_37160 136040 136768 gene locus_tag LOCUS_37170 136040 136768 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035270.1 protein_id gnl|my_center|LOCUS_37170 136765 137283 gene locus_tag LOCUS_37180 136765 137283 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689546.1 protein_id gnl|my_center|LOCUS_37180 137334 137774 gene locus_tag LOCUS_37190 137334 137774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 137873 138436 gene locus_tag LOCUS_37200 137873 138436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 138433 139170 gene locus_tag LOCUS_37210 gene lptB 138433 139170 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047473.1 protein_id gnl|my_center|LOCUS_37210 139184 140182 gene locus_tag LOCUS_37220 gene hprK 139184 140182 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062490.1 protein_id gnl|my_center|LOCUS_37220 140253 140999 gene locus_tag LOCUS_37230 140253 140999 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246039.1 protein_id gnl|my_center|LOCUS_37230 141645 141154 gene locus_tag LOCUS_37240 141645 141154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 141793 142974 gene locus_tag LOCUS_37250 gene sucC 141793 142974 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083287.1 protein_id gnl|my_center|LOCUS_37250 143104 144027 gene locus_tag LOCUS_37260 gene sucD 143104 144027 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110253.1 protein_id gnl|my_center|LOCUS_37260 145245 144127 gene locus_tag LOCUS_37270 145245 144127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 145412 147058 gene locus_tag LOCUS_37280 145412 147058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 147072 148475 gene locus_tag LOCUS_37290 147072 148475 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_37290 148487 150796 gene locus_tag LOCUS_37300 148487 150796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 153920 150822 gene locus_tag LOCUS_37310 153920 150822 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267714.1 protein_id gnl|my_center|LOCUS_37310 157021 153917 gene locus_tag LOCUS_37320 157021 153917 CDS product MdtB/MuxB family multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267713.1 protein_id gnl|my_center|LOCUS_37320 158271 157018 gene locus_tag LOCUS_37330 158271 157018 CDS product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815035.1 protein_id gnl|my_center|LOCUS_37330 159334 158417 gene locus_tag LOCUS_37340 gene pdxA 159334 158417 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337833.1 protein_id gnl|my_center|LOCUS_37340 160115 159360 gene locus_tag LOCUS_37350 gene lpxA 160115 159360 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941664.1 protein_id gnl|my_center|LOCUS_37350 160755 160120 gene locus_tag LOCUS_37360 160755 160120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 161946 160861 gene locus_tag LOCUS_37370 gene aroB 161946 160861 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920845.1 protein_id gnl|my_center|LOCUS_37370 162364 164556 gene locus_tag LOCUS_37380 162364 164556 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 protein_id gnl|my_center|LOCUS_37380 164664 166823 gene locus_tag LOCUS_37390 164664 166823 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074066.1 protein_id gnl|my_center|LOCUS_37390 166835 167995 gene locus_tag LOCUS_37400 166835 167995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 168015 169184 gene locus_tag LOCUS_37410 168015 169184 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971988.1 protein_id gnl|my_center|LOCUS_37410 169262 170458 gene locus_tag LOCUS_37420 169262 170458 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 protein_id gnl|my_center|LOCUS_37420 170494 170970 gene locus_tag LOCUS_37430 gene nrfH 170494 170970 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325128.1 protein_id gnl|my_center|LOCUS_37430 171020 172456 gene locus_tag LOCUS_37440 171020 172456 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123116.1 protein_id gnl|my_center|LOCUS_37440 172601 179596 gene locus_tag LOCUS_37450 172601 179596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 179667 184805 gene locus_tag LOCUS_37460 179667 184805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 185226 187106 gene locus_tag LOCUS_37470 185226 187106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 187112 187621 gene locus_tag LOCUS_37480 gene hutZ 187112 187621 CDS product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372763.1 protein_id gnl|my_center|LOCUS_37480 187651 188670 gene locus_tag LOCUS_37490 187651 188670 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336983.1 protein_id gnl|my_center|LOCUS_37490 189715 188600 gene locus_tag LOCUS_37500 189715 188600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 189826 190791 gene locus_tag LOCUS_37510 189826 190791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 190788 192161 gene locus_tag LOCUS_37520 190788 192161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967480.1 protein_id gnl|my_center|LOCUS_37520 192211 194667 gene locus_tag LOCUS_37530 192211 194667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 197430 194689 gene locus_tag LOCUS_37540 197430 194689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 199008 197569 gene locus_tag LOCUS_37550 199008 197569 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332236.1 protein_id gnl|my_center|LOCUS_37550 200284 199049 gene locus_tag LOCUS_37560 200284 199049 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089579.1 protein_id gnl|my_center|LOCUS_37560 203679 200299 gene locus_tag LOCUS_37570 203679 200299 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919497.1 protein_id gnl|my_center|LOCUS_37570 204667 203768 gene locus_tag LOCUS_37580 204667 203768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 205248 204670 gene locus_tag LOCUS_37590 205248 204670 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259574.1 protein_id gnl|my_center|LOCUS_37590 206530 205319 gene locus_tag LOCUS_37600 206530 205319 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324978.1 protein_id gnl|my_center|LOCUS_37600 206643 207974 gene locus_tag LOCUS_37610 gene xylA 206643 207974 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118969.1 protein_id gnl|my_center|LOCUS_37610 208099 209034 gene locus_tag LOCUS_37620 208099 209034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 210123 209164 gene locus_tag LOCUS_37630 210123 209164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 210250 211758 gene locus_tag LOCUS_37640 210250 211758 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246610.1 protein_id gnl|my_center|LOCUS_37640 211807 212124 gene locus_tag LOCUS_37650 gene sugE 211807 212124 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171053.1 protein_id gnl|my_center|LOCUS_37650 212139 212756 gene locus_tag LOCUS_37660 212139 212756 CDS product TIGR02466 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265868.1 protein_id gnl|my_center|LOCUS_37660 212767 213342 gene locus_tag LOCUS_37670 gene thpR 212767 213342 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940713.1 protein_id gnl|my_center|LOCUS_37670 213339 213596 gene locus_tag LOCUS_37680 213339 213596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 214131 213622 gene locus_tag LOCUS_37690 214131 213622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 214333 214845 gene locus_tag LOCUS_37700 gene seqA 214333 214845 CDS product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097561.1 protein_id gnl|my_center|LOCUS_37700 216119 215004 gene locus_tag LOCUS_37710 gene lptG 216119 215004 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870030.1 protein_id gnl|my_center|LOCUS_37710 216262 217389 gene locus_tag LOCUS_37720 216262 217389 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_37720 217422 218540 gene locus_tag LOCUS_37730 217422 218540 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_37730 218540 219727 gene locus_tag LOCUS_37740 218540 219727 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_37740 219724 220887 gene locus_tag LOCUS_37750 219724 220887 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_37750 220969 221319 gene locus_tag LOCUS_37760 220969 221319 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963264.1 protein_id gnl|my_center|LOCUS_37760 221446 222258 gene locus_tag LOCUS_37770 221446 222258 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897070.1 protein_id gnl|my_center|LOCUS_37770 222262 223212 gene locus_tag LOCUS_37780 222262 223212 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583299.1 protein_id gnl|my_center|LOCUS_37780 223348 224133 gene locus_tag LOCUS_37790 223348 224133 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773590.1 protein_id gnl|my_center|LOCUS_37790 224331 225038 gene locus_tag LOCUS_37800 224331 225038 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_37800 225367 228588 gene locus_tag LOCUS_37810 225367 228588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 228758 228546 gene locus_tag LOCUS_37820 228758 228546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 228897 230501 gene locus_tag LOCUS_37830 228897 230501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 230590 233166 gene locus_tag LOCUS_37840 230590 233166 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_37840 234323 233301 gene locus_tag LOCUS_37850 234323 233301 CDS product DUF1593 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008668242.1 protein_id gnl|my_center|LOCUS_37850 235756 234320 gene locus_tag LOCUS_37860 235756 234320 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_37860 235909 236790 gene locus_tag LOCUS_37870 235909 236790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 238743 236932 gene locus_tag LOCUS_37880 238743 236932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 238897 239475 gene locus_tag LOCUS_37890 gene pdxH 238897 239475 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918802.1 protein_id gnl|my_center|LOCUS_37890 239579 240871 gene locus_tag LOCUS_37900 239579 240871 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_37900 241945 240965 gene locus_tag LOCUS_37910 gene xerD 241945 240965 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390080.1 protein_id gnl|my_center|LOCUS_37910 242243 241977 gene locus_tag LOCUS_37920 gene infA 242243 241977 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029884.1 protein_id gnl|my_center|LOCUS_37920 242441 242896 gene locus_tag LOCUS_37930 gene tadA 242441 242896 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439010.1 protein_id gnl|my_center|LOCUS_37930 243068 243700 gene locus_tag LOCUS_37940 243068 243700 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339235.1 protein_id gnl|my_center|LOCUS_37940 245218 244025 gene locus_tag LOCUS_37950 245218 244025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 245292 246422 gene locus_tag LOCUS_37960 gene apbC 245292 246422 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257064.1 protein_id gnl|my_center|LOCUS_37960 246528 246773 gene locus_tag LOCUS_37970 246528 246773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 247093 246929 gene locus_tag LOCUS_37980 gene rpmG 247093 246929 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933041.1 protein_id gnl|my_center|LOCUS_37980 247887 247168 gene locus_tag LOCUS_37990 247887 247168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 248020 248922 gene locus_tag LOCUS_38000 248020 248922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 248919 249212 gene locus_tag LOCUS_38010 248919 249212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 249810 249241 gene locus_tag LOCUS_38020 249810 249241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 249706 250320 gene locus_tag LOCUS_38030 249706 250320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 251589 250396 gene locus_tag LOCUS_38040 251589 250396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 252076 251579 gene locus_tag LOCUS_38050 252076 251579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 252168 253304 gene locus_tag LOCUS_38060 252168 253304 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902891.1 protein_id gnl|my_center|LOCUS_38060 253304 254281 gene locus_tag LOCUS_38070 gene rfaE1 253304 254281 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880334.1 protein_id gnl|my_center|LOCUS_38070 254291 254818 gene locus_tag LOCUS_38080 254291 254818 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938353.1 protein_id gnl|my_center|LOCUS_38080 254826 255653 gene locus_tag LOCUS_38090 gene mutM 254826 255653 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257743.1 protein_id gnl|my_center|LOCUS_38090 255650 256429 gene locus_tag LOCUS_38100 255650 256429 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390370.1 protein_id gnl|my_center|LOCUS_38100 256426 257295 gene locus_tag LOCUS_38110 256426 257295 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_38110 257828 257574 gene locus_tag LOCUS_38120 257828 257574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 258684 257878 gene locus_tag LOCUS_38130 258684 257878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 261269 258699 gene locus_tag LOCUS_38140 261269 258699 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938723.1 protein_id gnl|my_center|LOCUS_38140 261780 261349 gene locus_tag LOCUS_38150 261780 261349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329952.1 protein_id gnl|my_center|LOCUS_38150 261917 262450 gene locus_tag LOCUS_38160 261917 262450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 263245 262517 gene locus_tag LOCUS_38170 263245 262517 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295401.1 protein_id gnl|my_center|LOCUS_38170 266666 263310 gene locus_tag LOCUS_38180 266666 263310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 266738 267661 gene locus_tag LOCUS_38190 266738 267661 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_38190 267843 268661 gene locus_tag LOCUS_38200 267843 268661 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817305.1 protein_id gnl|my_center|LOCUS_38200 268668 269114 gene locus_tag LOCUS_38210 268668 269114 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328798.1 protein_id gnl|my_center|LOCUS_38210 269135 270067 gene locus_tag LOCUS_38220 269135 270067 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921278.1 protein_id gnl|my_center|LOCUS_38220 270078 271106 gene locus_tag LOCUS_38230 270078 271106 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119735.1 protein_id gnl|my_center|LOCUS_38230 272012 271158 gene locus_tag LOCUS_38240 272012 271158 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921650.1 protein_id gnl|my_center|LOCUS_38240 272227 272850 gene locus_tag LOCUS_38250 272227 272850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 273774 273007 gene locus_tag LOCUS_38260 273774 273007 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 protein_id gnl|my_center|LOCUS_38260 275201 273771 gene locus_tag LOCUS_38270 275201 273771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 275400 280199 gene locus_tag LOCUS_38280 275400 280199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 280218 280907 gene locus_tag LOCUS_38290 280218 280907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 280988 281722 gene locus_tag LOCUS_38300 280988 281722 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776490.1 protein_id gnl|my_center|LOCUS_38300 281997 281794 gene locus_tag LOCUS_38310 281997 281794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 284115 282247 gene locus_tag LOCUS_38320 gene batA 284115 282247 CDS product autotransporter BatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550237.1 protein_id gnl|my_center|LOCUS_38320 284289 285137 gene locus_tag LOCUS_38330 284289 285137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 285134 286243 gene locus_tag LOCUS_38340 285134 286243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 290671 286436 gene locus_tag LOCUS_38350 290671 286436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 291902 290745 gene locus_tag LOCUS_38360 gene lpxB 291902 290745 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_38360 292895 291939 gene locus_tag LOCUS_38370 292895 291939 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_38370 293639 292980 gene locus_tag LOCUS_38380 293639 292980 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943050.1 protein_id gnl|my_center|LOCUS_38380 293724 294620 gene locus_tag LOCUS_38390 293724 294620 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658736.1 protein_id gnl|my_center|LOCUS_38390 294818 295411 gene locus_tag LOCUS_38400 294818 295411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 295547 296434 gene locus_tag LOCUS_38410 295547 296434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 296541 297086 gene locus_tag LOCUS_38420 296541 297086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 298483 297251 gene locus_tag LOCUS_38430 298483 297251 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016502.1 protein_id gnl|my_center|LOCUS_38430 298361 298271 gene locus_tag LOCUS_t00420 298361 298271 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 300140 298587 gene locus_tag LOCUS_38440 gene lysS 300140 298587 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242743.1 protein_id gnl|my_center|LOCUS_38440 301606 300257 gene locus_tag LOCUS_38450 301606 300257 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_38450 303345 301762 gene locus_tag LOCUS_38460 303345 301762 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442661.1 protein_id gnl|my_center|LOCUS_38460 303455 303922 gene locus_tag LOCUS_38470 303455 303922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 304005 304850 gene locus_tag LOCUS_38480 304005 304850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 304993 308109 gene locus_tag LOCUS_38490 304993 308109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 311211 308140 gene locus_tag LOCUS_38500 311211 308140 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119295.1 protein_id gnl|my_center|LOCUS_38500 315544 311246 gene locus_tag LOCUS_38510 315544 311246 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121181.1 protein_id gnl|my_center|LOCUS_38510 315861 317255 gene locus_tag LOCUS_38520 315861 317255 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616105.1 protein_id gnl|my_center|LOCUS_38520 317261 318169 gene locus_tag LOCUS_38530 317261 318169 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332337.1 protein_id gnl|my_center|LOCUS_38530 318213 319505 gene locus_tag LOCUS_38540 318213 319505 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_38540 320351 319734 gene locus_tag LOCUS_38550 320351 319734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 321651 320590 gene locus_tag LOCUS_38560 321651 320590 CDS product peptidylglycine monooxygenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663621.1 protein_id gnl|my_center|LOCUS_38560 321711 322877 gene locus_tag LOCUS_38570 321711 322877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 324474 323149 gene locus_tag LOCUS_38580 324474 323149 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986831.1 protein_id gnl|my_center|LOCUS_38580 326005 324506 gene locus_tag LOCUS_38590 326005 324506 CDS product putative Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807020.1 protein_id gnl|my_center|LOCUS_38590 327347 326133 gene locus_tag LOCUS_38600 327347 326133 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_38600 327760 327506 gene locus_tag LOCUS_38610 327760 327506 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858446.1 protein_id gnl|my_center|LOCUS_38610 328072 328854 gene locus_tag LOCUS_38620 328072 328854 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_38620 328884 329693 gene locus_tag LOCUS_38630 328884 329693 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333288.1 protein_id gnl|my_center|LOCUS_38630 329810 330607 gene locus_tag LOCUS_38640 329810 330607 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016724.1 protein_id gnl|my_center|LOCUS_38640 330604 331317 gene locus_tag LOCUS_38650 gene rnc 330604 331317 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938733.1 protein_id gnl|my_center|LOCUS_38650 331386 334766 gene locus_tag LOCUS_38660 331386 334766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 334763 335779 gene locus_tag LOCUS_38670 334763 335779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 335895 336620 gene locus_tag LOCUS_38680 gene radC 335895 336620 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203904.1 protein_id gnl|my_center|LOCUS_38680 337809 336862 gene locus_tag LOCUS_38690 337809 336862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 338046 337961 gene locus_tag LOCUS_t00430 338046 337961 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 338976 338206 gene locus_tag LOCUS_38700 338976 338206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 340386 339136 gene locus_tag LOCUS_38710 340386 339136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 341543 340497 gene locus_tag LOCUS_38720 gene gap 341543 340497 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668968.1 protein_id gnl|my_center|LOCUS_38720 344325 341854 gene locus_tag LOCUS_38730 344325 341854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 345661 344504 gene locus_tag LOCUS_38740 345661 344504 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640575.1 protein_id gnl|my_center|LOCUS_38740 348922 345767 gene locus_tag LOCUS_38750 348922 345767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 349075 350022 gene locus_tag LOCUS_38760 gene trxB 349075 350022 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405370.1 protein_id gnl|my_center|LOCUS_38760 350046 350600 gene locus_tag LOCUS_38770 350046 350600 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023254.1 protein_id gnl|my_center|LOCUS_38770 350819 352048 gene locus_tag LOCUS_38780 350819 352048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 352083 352634 gene locus_tag LOCUS_38790 352083 352634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 >Feature sequence08 2431 1376 gene locus_tag LOCUS_38800 2431 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 2991 2428 gene locus_tag LOCUS_38810 gene fpvI 2991 2428 CDS product pyoverdine signaling pathway sigma factor FpvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103620.1 protein_id gnl|my_center|LOCUS_38810 4677 3244 gene locus_tag LOCUS_38820 4677 3244 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922918.1 protein_id gnl|my_center|LOCUS_38820 7182 4684 gene locus_tag LOCUS_38830 7182 4684 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615954.1 protein_id gnl|my_center|LOCUS_38830 8725 7244 gene locus_tag LOCUS_38840 8725 7244 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921302.1 protein_id gnl|my_center|LOCUS_38840 11988 8800 gene locus_tag LOCUS_38850 11988 8800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 13362 12115 gene locus_tag LOCUS_38860 13362 12115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 14875 13367 gene locus_tag LOCUS_38870 14875 13367 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173402000.1 protein_id gnl|my_center|LOCUS_38870 15965 14895 gene locus_tag LOCUS_38880 15965 14895 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187436936.1 protein_id gnl|my_center|LOCUS_38880 17344 16100 gene locus_tag LOCUS_38890 17344 16100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 17435 18439 gene locus_tag LOCUS_38900 17435 18439 CDS product aryldialkylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584001.1 protein_id gnl|my_center|LOCUS_38900 19985 18549 gene locus_tag LOCUS_38910 19985 18549 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118042.1 protein_id gnl|my_center|LOCUS_38910 20106 21425 gene locus_tag LOCUS_38920 20106 21425 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460069.1 protein_id gnl|my_center|LOCUS_38920 21434 22993 gene locus_tag LOCUS_38930 21434 22993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 23098 24939 gene locus_tag LOCUS_38940 gene htpG 23098 24939 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460040.1 protein_id gnl|my_center|LOCUS_38940 25037 25294 gene locus_tag LOCUS_38950 25037 25294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 25269 25661 gene locus_tag LOCUS_38960 25269 25661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 26060 25686 gene locus_tag LOCUS_38970 26060 25686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 25950 27587 gene locus_tag LOCUS_38980 25950 27587 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920680.1 protein_id gnl|my_center|LOCUS_38980 27595 28254 gene locus_tag LOCUS_38990 27595 28254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 28445 28759 gene locus_tag LOCUS_39000 28445 28759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 29552 28893 gene locus_tag LOCUS_39010 29552 28893 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338989.1 protein_id gnl|my_center|LOCUS_39010 29663 30700 gene locus_tag LOCUS_39020 29663 30700 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478452.1 protein_id gnl|my_center|LOCUS_39020 31267 30839 gene locus_tag LOCUS_39030 31267 30839 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268889.1 protein_id gnl|my_center|LOCUS_39030 31360 32121 gene locus_tag LOCUS_39040 31360 32121 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729258.1 protein_id gnl|my_center|LOCUS_39040 32843 32178 gene locus_tag LOCUS_39050 32843 32178 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971475.1 protein_id gnl|my_center|LOCUS_39050 33398 33036 gene locus_tag LOCUS_39060 33398 33036 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704236.1 protein_id gnl|my_center|LOCUS_39060 33864 34247 gene locus_tag LOCUS_39070 33864 34247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 35927 34278 gene locus_tag LOCUS_39080 35927 34278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 37519 35924 gene locus_tag LOCUS_39090 37519 35924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 37669 39750 gene locus_tag LOCUS_39100 37669 39750 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074214.1 protein_id gnl|my_center|LOCUS_39100 39747 40925 gene locus_tag LOCUS_39110 39747 40925 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203529.1 protein_id gnl|my_center|LOCUS_39110 41094 44168 gene locus_tag LOCUS_39120 41094 44168 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265653.1 protein_id gnl|my_center|LOCUS_39120 45980 44388 gene locus_tag LOCUS_39130 45980 44388 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767560.1 protein_id gnl|my_center|LOCUS_39130 47089 45977 gene locus_tag LOCUS_39140 47089 45977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941754.1 protein_id gnl|my_center|LOCUS_39140 46971 47294 gene locus_tag LOCUS_39150 46971 47294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 48122 47319 gene locus_tag LOCUS_39160 48122 47319 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203172.1 protein_id gnl|my_center|LOCUS_39160 49069 48119 gene locus_tag LOCUS_39170 49069 48119 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793782.1 protein_id gnl|my_center|LOCUS_39170 50217 49066 gene locus_tag LOCUS_39180 50217 49066 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816897.1 protein_id gnl|my_center|LOCUS_39180 51377 50214 gene locus_tag LOCUS_39190 51377 50214 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085828.1 protein_id gnl|my_center|LOCUS_39190 51605 52183 gene locus_tag LOCUS_39200 51605 52183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265691.1 protein_id gnl|my_center|LOCUS_39200 53019 52267 gene locus_tag LOCUS_39210 53019 52267 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112092.1 protein_id gnl|my_center|LOCUS_39210 53942 53076 gene locus_tag LOCUS_39220 53942 53076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 54044 54913 gene locus_tag LOCUS_39230 54044 54913 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815329.1 protein_id gnl|my_center|LOCUS_39230 57340 55121 gene locus_tag LOCUS_39240 gene katG 57340 55121 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119918646.1 protein_id gnl|my_center|LOCUS_39240 57815 58810 gene locus_tag LOCUS_39250 57815 58810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 58972 61467 gene locus_tag LOCUS_39260 58972 61467 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928775.1 protein_id gnl|my_center|LOCUS_39260 62049 61495 gene locus_tag LOCUS_39270 62049 61495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39270 62597 61935 gene locus_tag LOCUS_39280 62597 61935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 62783 63682 gene locus_tag LOCUS_39290 62783 63682 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252564.1 protein_id gnl|my_center|LOCUS_39290 64981 63722 gene locus_tag LOCUS_39300 64981 63722 CDS product M14-type cytosolic carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261016.1 protein_id gnl|my_center|LOCUS_39300 65058 66230 gene locus_tag LOCUS_39310 65058 66230 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392434.1 protein_id gnl|my_center|LOCUS_39310 69423 66292 gene locus_tag LOCUS_39320 69423 66292 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404755.1 protein_id gnl|my_center|LOCUS_39320 70478 69579 gene locus_tag LOCUS_39330 70478 69579 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921853.1 protein_id gnl|my_center|LOCUS_39330 70710 71666 gene locus_tag LOCUS_39340 70710 71666 CDS product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330721.1 protein_id gnl|my_center|LOCUS_39340 71653 72372 gene locus_tag LOCUS_39350 71653 72372 CDS product DUF2291 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328278.1 protein_id gnl|my_center|LOCUS_39350 72372 73916 gene locus_tag LOCUS_39360 72372 73916 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119386.1 protein_id gnl|my_center|LOCUS_39360 73918 74898 gene locus_tag LOCUS_39370 73918 74898 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330724.1 protein_id gnl|my_center|LOCUS_39370 74898 76193 gene locus_tag LOCUS_39380 74898 76193 CDS product DUF1593 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119397.1 protein_id gnl|my_center|LOCUS_39380 76242 77558 gene locus_tag LOCUS_39390 76242 77558 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120385.1 protein_id gnl|my_center|LOCUS_39390 77599 80505 gene locus_tag LOCUS_39400 77599 80505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 80502 81980 gene locus_tag LOCUS_39410 80502 81980 CDS product DUF1593 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120384.1 protein_id gnl|my_center|LOCUS_39410 81999 83726 gene locus_tag LOCUS_39420 81999 83726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 83737 84819 gene locus_tag LOCUS_39430 gene pelA 83737 84819 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427768.1 protein_id gnl|my_center|LOCUS_39430 84828 86237 gene locus_tag LOCUS_39440 84828 86237 CDS product glycoside hydrolase family 140 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107572.1 protein_id gnl|my_center|LOCUS_39440 86251 87705 gene locus_tag LOCUS_39450 86251 87705 CDS product DUF1593 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922755.1 protein_id gnl|my_center|LOCUS_39450 87725 88570 gene locus_tag LOCUS_39460 87725 88570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 88655 90124 gene locus_tag LOCUS_39470 88655 90124 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167413.1 protein_id gnl|my_center|LOCUS_39470 90320 91159 gene locus_tag LOCUS_39480 90320 91159 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989643.1 protein_id gnl|my_center|LOCUS_39480 91156 92166 gene locus_tag LOCUS_39490 91156 92166 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080609.1 protein_id gnl|my_center|LOCUS_39490 92170 93663 gene locus_tag LOCUS_39500 gene glpK 92170 93663 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945391.1 protein_id gnl|my_center|LOCUS_39500 94166 93660 gene locus_tag LOCUS_39510 94166 93660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 95149 94211 gene locus_tag LOCUS_39520 95149 94211 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972311.1 protein_id gnl|my_center|LOCUS_39520 98964 95146 gene locus_tag LOCUS_39530 98964 95146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 99122 101389 gene locus_tag LOCUS_39540 99122 101389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 103060 101549 gene locus_tag LOCUS_39550 103060 101549 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120799.1 protein_id gnl|my_center|LOCUS_39550 106505 103092 gene locus_tag LOCUS_39560 106505 103092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 106740 107306 gene locus_tag LOCUS_39570 106740 107306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 107296 108312 gene locus_tag LOCUS_39580 107296 108312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 109935 108349 gene locus_tag LOCUS_39590 109935 108349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 110197 111468 gene locus_tag LOCUS_39600 110197 111468 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123786.1 protein_id gnl|my_center|LOCUS_39600 111494 113983 gene locus_tag LOCUS_39610 111494 113983 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616124.1 protein_id gnl|my_center|LOCUS_39610 117125 114159 gene locus_tag LOCUS_39620 117125 114159 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813379.1 protein_id gnl|my_center|LOCUS_39620 120137 117147 gene locus_tag LOCUS_39630 120137 117147 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275340.1 protein_id gnl|my_center|LOCUS_39630 120974 120291 gene locus_tag LOCUS_39640 120974 120291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 122265 120991 gene locus_tag LOCUS_39650 122265 120991 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_39650 125632 122426 gene locus_tag LOCUS_39660 125632 122426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 125644 126651 gene locus_tag LOCUS_39670 125644 126651 CDS product proton-gated ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144181.1 protein_id gnl|my_center|LOCUS_39670 127713 126682 gene locus_tag LOCUS_39680 127713 126682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 128546 127716 gene locus_tag LOCUS_39690 128546 127716 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920196.1 protein_id gnl|my_center|LOCUS_39690 128763 129062 gene locus_tag LOCUS_39700 128763 129062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 129856 129119 gene locus_tag LOCUS_39710 129856 129119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 130497 129829 gene locus_tag LOCUS_39720 gene modB 130497 129829 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367643.1 protein_id gnl|my_center|LOCUS_39720 131260 130508 gene locus_tag LOCUS_39730 gene modA 131260 130508 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031846.1 protein_id gnl|my_center|LOCUS_39730 131392 131742 gene locus_tag LOCUS_39740 131392 131742 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206717.1 protein_id gnl|my_center|LOCUS_39740 132786 132190 gene locus_tag LOCUS_39750 132786 132190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 133380 132973 gene locus_tag LOCUS_39760 133380 132973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 136524 134668 gene locus_tag LOCUS_39770 136524 134668 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895660.1 protein_id gnl|my_center|LOCUS_39770 137053 136742 gene locus_tag LOCUS_39780 137053 136742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 137375 137022 gene locus_tag LOCUS_39790 137375 137022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 137876 137547 gene locus_tag LOCUS_39800 137876 137547 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389838.1 protein_id gnl|my_center|LOCUS_39800 138351 137881 gene locus_tag LOCUS_39810 138351 137881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 138807 138385 gene locus_tag LOCUS_39820 138807 138385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 141980 138804 gene locus_tag LOCUS_39830 141980 138804 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115707.1 protein_id gnl|my_center|LOCUS_39830 142730 142020 gene locus_tag LOCUS_39840 142730 142020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 144037 142727 gene locus_tag LOCUS_39850 144037 142727 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942782.1 protein_id gnl|my_center|LOCUS_39850 147080 144711 gene locus_tag LOCUS_39860 147080 144711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 147472 147080 gene locus_tag LOCUS_39870 147472 147080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 152526 147469 gene locus_tag LOCUS_39880 152526 147469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 152729 152472 gene locus_tag LOCUS_39890 152729 152472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 153198 152791 gene locus_tag LOCUS_39900 153198 152791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 155804 153141 gene locus_tag LOCUS_39910 gene mobF 155804 153141 CDS product MobF family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639975.1 protein_id gnl|my_center|LOCUS_39910 156143 156520 gene locus_tag LOCUS_39920 156143 156520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 156537 157238 gene locus_tag LOCUS_39930 156537 157238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 157235 157720 gene locus_tag LOCUS_39940 157235 157720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 157720 159216 gene locus_tag LOCUS_39950 157720 159216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 159573 159259 gene locus_tag LOCUS_39960 159573 159259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 160601 159735 gene locus_tag LOCUS_39970 160601 159735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 160857 161318 gene locus_tag LOCUS_39980 160857 161318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 161861 161319 gene locus_tag LOCUS_39990 161861 161319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 162049 162357 gene locus_tag LOCUS_40000 162049 162357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 162422 162766 gene locus_tag LOCUS_40010 162422 162766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 162763 163227 gene locus_tag LOCUS_40020 162763 163227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 163234 163800 gene locus_tag LOCUS_40030 163234 163800 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133795409.1 protein_id gnl|my_center|LOCUS_40030 163971 164390 gene locus_tag LOCUS_40040 163971 164390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 164437 164856 gene locus_tag LOCUS_40050 164437 164856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 165023 166396 gene locus_tag LOCUS_40060 165023 166396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 166416 168428 gene locus_tag LOCUS_40070 166416 168428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 168502 171816 gene locus_tag LOCUS_40080 168502 171816 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 protein_id gnl|my_center|LOCUS_40080 172069 172305 gene locus_tag LOCUS_40090 172069 172305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 172908 172345 gene locus_tag LOCUS_40100 gene sigM 172908 172345 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284380.1 protein_id gnl|my_center|LOCUS_40100 173344 172916 gene locus_tag LOCUS_40110 173344 172916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 173686 173348 gene locus_tag LOCUS_40120 173686 173348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 173815 175086 gene locus_tag LOCUS_40130 173815 175086 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197873.1 protein_id gnl|my_center|LOCUS_40130 175136 176152 gene locus_tag LOCUS_40140 175136 176152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 176163 179360 gene locus_tag LOCUS_40150 176163 179360 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_40150 179382 179849 gene locus_tag LOCUS_40160 179382 179849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 179921 181291 gene locus_tag LOCUS_40170 179921 181291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 181322 182083 gene locus_tag LOCUS_40180 181322 182083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 182105 182593 gene locus_tag LOCUS_40190 182105 182593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 182590 183243 gene locus_tag LOCUS_40200 182590 183243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 183262 183735 gene locus_tag LOCUS_40210 183262 183735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 184288 183917 gene locus_tag LOCUS_40220 184288 183917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 185247 184435 gene locus_tag LOCUS_40230 185247 184435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 187092 185263 gene locus_tag LOCUS_40240 187092 185263 CDS product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114867.1 protein_id gnl|my_center|LOCUS_40240 188295 187273 gene locus_tag LOCUS_40250 188295 187273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 188774 188460 gene locus_tag LOCUS_40260 188774 188460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 190947 188794 gene locus_tag LOCUS_40270 190947 188794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 191284 191475 gene locus_tag LOCUS_40280 191284 191475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 192008 191586 gene locus_tag LOCUS_40290 192008 191586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 192257 194671 gene locus_tag LOCUS_40300 192257 194671 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 protein_id gnl|my_center|LOCUS_40300 195221 194682 gene locus_tag LOCUS_40310 195221 194682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 195364 195687 gene locus_tag LOCUS_40320 195364 195687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 195684 196184 gene locus_tag LOCUS_40330 195684 196184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 196162 196758 gene locus_tag LOCUS_40340 gene rpoE 196162 196758 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309371.1 protein_id gnl|my_center|LOCUS_40340 196839 197564 gene locus_tag LOCUS_40350 196839 197564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 198937 197585 gene locus_tag LOCUS_40360 198937 197585 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_40360 199608 198934 gene locus_tag LOCUS_40370 199608 198934 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943577.1 protein_id gnl|my_center|LOCUS_40370 199814 201232 gene locus_tag LOCUS_40380 199814 201232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 201229 202197 gene locus_tag LOCUS_40390 201229 202197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 202207 205350 gene locus_tag LOCUS_40400 202207 205350 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142029.1 protein_id gnl|my_center|LOCUS_40400 206197 205883 gene locus_tag LOCUS_40410 206197 205883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 206483 207040 gene locus_tag LOCUS_40420 206483 207040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 207155 207973 gene locus_tag LOCUS_40430 207155 207973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 208270 208043 gene locus_tag LOCUS_40440 208270 208043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 208346 209980 gene locus_tag LOCUS_40450 208346 209980 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943579.1 protein_id gnl|my_center|LOCUS_40450 209961 210686 gene locus_tag LOCUS_40460 209961 210686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 210683 211030 gene locus_tag LOCUS_40470 210683 211030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 212201 211299 gene locus_tag LOCUS_40480 212201 211299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 212664 212194 gene locus_tag LOCUS_40490 212664 212194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 212729 213034 gene locus_tag LOCUS_40500 212729 213034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 213051 215948 gene locus_tag LOCUS_40510 213051 215948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 215945 216142 gene locus_tag LOCUS_40520 215945 216142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 >Feature sequence09 693 1613 gene locus_tag LOCUS_40530 693 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 2695 1946 gene locus_tag LOCUS_40540 2695 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 3089 2850 gene locus_tag LOCUS_40550 3089 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 4458 3169 gene locus_tag LOCUS_40560 4458 3169 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140097.1 protein_id gnl|my_center|LOCUS_40560 7203 4555 gene locus_tag LOCUS_40570 7203 4555 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_40570 9916 7265 gene locus_tag LOCUS_40580 9916 7265 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075123474.1 protein_id gnl|my_center|LOCUS_40580 10124 11851 gene locus_tag LOCUS_40590 10124 11851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 13212 11848 gene locus_tag LOCUS_40600 13212 11848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 14205 13339 gene locus_tag LOCUS_40610 14205 13339 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615399.1 protein_id gnl|my_center|LOCUS_40610 14355 15230 gene locus_tag LOCUS_40620 14355 15230 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812339.1 protein_id gnl|my_center|LOCUS_40620 15358 16125 gene locus_tag LOCUS_40630 gene garL 15358 16125 CDS product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057715.1 protein_id gnl|my_center|LOCUS_40630 16164 17450 gene locus_tag LOCUS_40640 16164 17450 CDS product glucarate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731063.1 protein_id gnl|my_center|LOCUS_40640 17494 18267 gene locus_tag LOCUS_40650 17494 18267 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338043.1 protein_id gnl|my_center|LOCUS_40650 19434 18325 gene locus_tag LOCUS_40660 19434 18325 CDS product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104094.1 protein_id gnl|my_center|LOCUS_40660 22354 20111 gene locus_tag LOCUS_40670 22354 20111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 25659 22471 gene locus_tag LOCUS_40680 25659 22471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 25998 26486 gene locus_tag LOCUS_40690 25998 26486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 26551 26967 gene locus_tag LOCUS_40700 26551 26967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 28055 26964 gene locus_tag LOCUS_40710 28055 26964 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_40710 29258 28314 gene locus_tag LOCUS_40720 29258 28314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 31012 29294 gene locus_tag LOCUS_40730 31012 29294 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256840.1 protein_id gnl|my_center|LOCUS_40730 32629 31529 gene locus_tag LOCUS_40740 32629 31529 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121679.1 protein_id gnl|my_center|LOCUS_40740 33270 32626 gene locus_tag LOCUS_40750 33270 32626 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334933.1 protein_id gnl|my_center|LOCUS_40750 33403 34209 gene locus_tag LOCUS_40760 33403 34209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 35058 34561 gene locus_tag LOCUS_40770 35058 34561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 37235 35073 gene locus_tag LOCUS_40780 37235 35073 CDS product TIR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640232.1 protein_id gnl|my_center|LOCUS_40780 38658 37342 gene locus_tag LOCUS_40790 38658 37342 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_40790 39297 38722 gene locus_tag LOCUS_40800 39297 38722 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_40800 39793 39320 gene locus_tag LOCUS_40810 39793 39320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 39887 40651 gene locus_tag LOCUS_40820 39887 40651 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141506.1 protein_id gnl|my_center|LOCUS_40820 40706 41890 gene locus_tag LOCUS_40830 40706 41890 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679701.1 protein_id gnl|my_center|LOCUS_40830 42934 41975 gene locus_tag LOCUS_40840 42934 41975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 43857 42988 gene locus_tag LOCUS_40850 43857 42988 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199327.1 protein_id gnl|my_center|LOCUS_40850 43929 45026 gene locus_tag LOCUS_40860 43929 45026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142695.1 protein_id gnl|my_center|LOCUS_40860 45642 45103 gene locus_tag LOCUS_40870 45642 45103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 46882 45800 gene locus_tag LOCUS_40880 46882 45800 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095328.1 protein_id gnl|my_center|LOCUS_40880 47605 47033 gene locus_tag LOCUS_40890 47605 47033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 47667 49361 gene locus_tag LOCUS_40900 47667 49361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 49358 50767 gene locus_tag LOCUS_40910 49358 50767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 52748 50814 gene locus_tag LOCUS_40920 52748 50814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 52666 52947 gene locus_tag LOCUS_40930 52666 52947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 54659 52881 gene locus_tag LOCUS_40940 gene ilvB 54659 52881 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327661.1 protein_id gnl|my_center|LOCUS_40940 54885 55673 gene locus_tag LOCUS_40950 gene ymdB 54885 55673 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 protein_id gnl|my_center|LOCUS_40950 56806 55826 gene locus_tag LOCUS_40960 56806 55826 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_40960 57275 56916 gene locus_tag LOCUS_40970 57275 56916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 58520 57318 gene locus_tag LOCUS_40980 gene queA 58520 57318 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081288.1 protein_id gnl|my_center|LOCUS_40980 58494 58569 gene locus_tag LOCUS_t00440 58494 58569 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 61364 58617 gene locus_tag LOCUS_40990 61364 58617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 62406 61384 gene locus_tag LOCUS_41000 62406 61384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 64769 62487 gene locus_tag LOCUS_41010 64769 62487 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928490.1 protein_id gnl|my_center|LOCUS_41010 66287 64905 gene locus_tag LOCUS_41020 66287 64905 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109136.1 protein_id gnl|my_center|LOCUS_41020 67778 66414 gene locus_tag LOCUS_41030 67778 66414 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421601.1 protein_id gnl|my_center|LOCUS_41030 67916 68950 gene locus_tag LOCUS_41040 67916 68950 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027638.1 protein_id gnl|my_center|LOCUS_41040 69999 68965 gene locus_tag LOCUS_41050 69999 68965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 70440 73400 gene locus_tag LOCUS_41060 70440 73400 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838099.1 protein_id gnl|my_center|LOCUS_41060 73430 75475 gene locus_tag LOCUS_41070 73430 75475 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615420.1 protein_id gnl|my_center|LOCUS_41070 75548 76471 gene locus_tag LOCUS_41080 75548 76471 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119992.1 protein_id gnl|my_center|LOCUS_41080 76498 77733 gene locus_tag LOCUS_41090 76498 77733 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793004.1 protein_id gnl|my_center|LOCUS_41090 77751 78803 gene locus_tag LOCUS_41100 77751 78803 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038032.1 protein_id gnl|my_center|LOCUS_41100 78817 80160 gene locus_tag LOCUS_41110 78817 80160 CDS product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817455.1 protein_id gnl|my_center|LOCUS_41110 80157 81062 gene locus_tag LOCUS_41120 80157 81062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 81085 81273 gene locus_tag LOCUS_41130 81085 81273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 81882 81460 gene locus_tag LOCUS_41140 81882 81460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 82331 81882 gene locus_tag LOCUS_41150 82331 81882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068355.1 protein_id gnl|my_center|LOCUS_41150 82797 82366 gene locus_tag LOCUS_41160 82797 82366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 86274 82867 gene locus_tag LOCUS_41170 86274 82867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 87926 86547 gene locus_tag LOCUS_41180 87926 86547 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202787.1 protein_id gnl|my_center|LOCUS_41180 91048 87947 gene locus_tag LOCUS_41190 91048 87947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 93317 91233 gene locus_tag LOCUS_41200 93317 91233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 93598 93523 gene locus_tag LOCUS_t00450 93598 93523 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 96253 93947 gene locus_tag LOCUS_41210 96253 93947 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086677.1 protein_id gnl|my_center|LOCUS_41210 98254 96296 gene locus_tag LOCUS_41220 gene yagF 98254 96296 CDS product xylonate dehydratase YagF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095374.1 protein_id gnl|my_center|LOCUS_41220 99873 98362 gene locus_tag LOCUS_41230 99873 98362 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920632.1 protein_id gnl|my_center|LOCUS_41230 100706 99876 gene locus_tag LOCUS_41240 100706 99876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 101633 100836 gene locus_tag LOCUS_41250 gene fabG 101633 100836 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_41250 104120 101724 gene locus_tag LOCUS_41260 104120 101724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 106425 104422 gene locus_tag LOCUS_41270 106425 104422 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_41270 107210 106629 gene locus_tag LOCUS_41280 107210 106629 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639856.1 protein_id gnl|my_center|LOCUS_41280 107777 107247 gene locus_tag LOCUS_41290 107777 107247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 110762 108150 gene locus_tag LOCUS_41300 gene rnr 110762 108150 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942131.1 protein_id gnl|my_center|LOCUS_41300 110838 112280 gene locus_tag LOCUS_41310 gene glgA 110838 112280 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_41310 112473 113936 gene locus_tag LOCUS_41320 112473 113936 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390653.1 protein_id gnl|my_center|LOCUS_41320 113962 115524 gene locus_tag LOCUS_41330 113962 115524 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922119.1 protein_id gnl|my_center|LOCUS_41330 115521 116426 gene locus_tag LOCUS_41340 115521 116426 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870932.1 protein_id gnl|my_center|LOCUS_41340 116514 116933 gene locus_tag LOCUS_41350 gene ndk 116514 116933 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123449.1 protein_id gnl|my_center|LOCUS_41350 118185 117073 gene locus_tag LOCUS_41360 118185 117073 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082991.1 protein_id gnl|my_center|LOCUS_41360 119503 118256 gene locus_tag LOCUS_41370 119503 118256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 119789 120172 gene locus_tag LOCUS_41380 119789 120172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 120239 121057 gene locus_tag LOCUS_41390 120239 121057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 121054 121713 gene locus_tag LOCUS_41400 121054 121713 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818863.1 protein_id gnl|my_center|LOCUS_41400 121812 122129 gene locus_tag LOCUS_41410 121812 122129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 122249 123442 gene locus_tag LOCUS_41420 122249 123442 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058190.1 protein_id gnl|my_center|LOCUS_41420 123919 123512 gene locus_tag LOCUS_41430 123919 123512 CDS product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387235.1 protein_id gnl|my_center|LOCUS_41430 124058 124510 gene locus_tag LOCUS_41440 124058 124510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 124530 125819 gene locus_tag LOCUS_41450 124530 125819 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112410.1 protein_id gnl|my_center|LOCUS_41450 128470 126197 gene locus_tag LOCUS_41460 128470 126197 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068954085.1 protein_id gnl|my_center|LOCUS_41460 128559 129869 gene locus_tag LOCUS_41470 128559 129869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 132041 130047 gene locus_tag LOCUS_41480 132041 130047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 133454 132360 gene locus_tag LOCUS_41490 133454 132360 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229212.1 protein_id gnl|my_center|LOCUS_41490 134559 133579 gene locus_tag LOCUS_41500 134559 133579 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285055.1 protein_id gnl|my_center|LOCUS_41500 134691 135611 gene locus_tag LOCUS_41510 134691 135611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 135682 137118 gene locus_tag LOCUS_41520 135682 137118 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_41520 137115 139520 gene locus_tag LOCUS_41530 137115 139520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 141082 139889 gene locus_tag LOCUS_41540 141082 139889 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667343.1 protein_id gnl|my_center|LOCUS_41540 141254 145117 gene locus_tag LOCUS_41550 gene smc 141254 145117 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403652.1 protein_id gnl|my_center|LOCUS_41550 145221 145775 gene locus_tag LOCUS_41560 145221 145775 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704403.1 protein_id gnl|my_center|LOCUS_41560 146261 145905 gene locus_tag LOCUS_41570 146261 145905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 149211 146542 gene locus_tag LOCUS_41580 149211 146542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 149416 150588 gene locus_tag LOCUS_41590 149416 150588 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095328.1 protein_id gnl|my_center|LOCUS_41590 150708 152672 gene locus_tag LOCUS_41600 150708 152672 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403520.1 protein_id gnl|my_center|LOCUS_41600 152851 153693 gene locus_tag LOCUS_41610 152851 153693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 153806 154543 gene locus_tag LOCUS_41620 153806 154543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 154950 154510 gene locus_tag LOCUS_41630 154950 154510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 155189 154947 gene locus_tag LOCUS_41640 155189 154947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 155661 155254 gene locus_tag LOCUS_41650 155661 155254 CDS product DUF2809 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461503.1 protein_id gnl|my_center|LOCUS_41650 156308 155685 gene locus_tag LOCUS_41660 156308 155685 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707003.1 protein_id gnl|my_center|LOCUS_41660 158866 156425 gene locus_tag LOCUS_41670 158866 156425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 159387 158956 gene locus_tag LOCUS_41680 159387 158956 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111004.1 protein_id gnl|my_center|LOCUS_41680 159625 159398 gene locus_tag LOCUS_41690 159625 159398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 160278 159919 gene locus_tag LOCUS_41700 160278 159919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 160837 160523 gene locus_tag LOCUS_41710 160837 160523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 161273 160941 gene locus_tag LOCUS_41720 161273 160941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 162638 161397 gene locus_tag LOCUS_41730 162638 161397 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109152.1 protein_id gnl|my_center|LOCUS_41730 163982 162738 gene locus_tag LOCUS_41740 163982 162738 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_41740 164764 163985 gene locus_tag LOCUS_41750 164764 163985 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393834.1 protein_id gnl|my_center|LOCUS_41750 165924 164761 gene locus_tag LOCUS_41760 165924 164761 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546795.1 protein_id gnl|my_center|LOCUS_41760 167288 165915 gene locus_tag LOCUS_41770 167288 165915 CDS product AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268788.1 protein_id gnl|my_center|LOCUS_41770 168196 167294 gene locus_tag LOCUS_41780 168196 167294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 168545 169354 gene locus_tag LOCUS_41790 gene ompR 168545 169354 CDS product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230023.1 protein_id gnl|my_center|LOCUS_41790 169351 170658 gene locus_tag LOCUS_41800 gene amgS 169351 170658 CDS product two-component system sensor histidine kinase AmgS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096258.1 protein_id gnl|my_center|LOCUS_41800 172436 170715 gene locus_tag LOCUS_41810 172436 170715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 173267 172776 gene locus_tag LOCUS_41820 173267 172776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 173441 174457 gene locus_tag LOCUS_41830 173441 174457 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478343.1 protein_id gnl|my_center|LOCUS_41830 >Feature sequence10 431 111 gene locus_tag LOCUS_41840 431 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 789 601 gene locus_tag LOCUS_41850 789 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 709 2577 gene locus_tag LOCUS_41860 709 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 3057 2701 gene locus_tag LOCUS_41870 3057 2701 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929420.1 protein_id gnl|my_center|LOCUS_41870 3106 3336 gene locus_tag LOCUS_41880 3106 3336 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088520.1 protein_id gnl|my_center|LOCUS_41880 3472 4506 gene locus_tag LOCUS_41890 3472 4506 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941060.1 protein_id gnl|my_center|LOCUS_41890 4503 7769 gene locus_tag LOCUS_41900 4503 7769 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941062.1 protein_id gnl|my_center|LOCUS_41900 7766 8140 gene locus_tag LOCUS_41910 7766 8140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 8277 8810 gene locus_tag LOCUS_41920 8277 8810 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086306.1 protein_id gnl|my_center|LOCUS_41920 8859 9434 gene locus_tag LOCUS_41930 8859 9434 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086307.1 protein_id gnl|my_center|LOCUS_41930 9505 9699 gene locus_tag LOCUS_41940 9505 9699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 9732 10484 gene locus_tag LOCUS_41950 9732 10484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 10619 10816 gene locus_tag LOCUS_41960 10619 10816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 11030 11647 gene locus_tag LOCUS_41970 11030 11647 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941233.1 protein_id gnl|my_center|LOCUS_41970 11951 12157 gene locus_tag LOCUS_41980 11951 12157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 12126 12533 gene locus_tag LOCUS_41990 12126 12533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 12603 13637 gene locus_tag LOCUS_42000 12603 13637 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921772.1 protein_id gnl|my_center|LOCUS_42000 13634 14236 gene locus_tag LOCUS_42010 13634 14236 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064289.1 protein_id gnl|my_center|LOCUS_42010 14318 14917 gene locus_tag LOCUS_42020 14318 14917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 14914 18714 gene locus_tag LOCUS_42030 14914 18714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 19169 19675 gene locus_tag LOCUS_42040 19169 19675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 20535 19954 gene locus_tag LOCUS_42050 20535 19954 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039192.1 protein_id gnl|my_center|LOCUS_42050 20662 21192 gene locus_tag LOCUS_42060 20662 21192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 23863 21377 gene locus_tag LOCUS_42070 23863 21377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 23989 23914 gene locus_tag LOCUS_t00460 23989 23914 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 24647 24126 gene locus_tag LOCUS_42080 gene gpt 24647 24126 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175425.1 protein_id gnl|my_center|LOCUS_42080 25910 24858 gene locus_tag LOCUS_42090 25910 24858 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202993.1 protein_id gnl|my_center|LOCUS_42090 26127 26456 gene locus_tag LOCUS_42100 26127 26456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 27924 26626 gene locus_tag LOCUS_42110 27924 26626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 29022 28027 gene locus_tag LOCUS_42120 29022 28027 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123957.1 protein_id gnl|my_center|LOCUS_42120 30725 29037 gene locus_tag LOCUS_42130 30725 29037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42130 31260 30808 gene locus_tag LOCUS_42140 31260 30808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 31364 32593 gene locus_tag LOCUS_42150 31364 32593 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_42150 32590 33561 gene locus_tag LOCUS_42160 32590 33561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 35355 33700 gene locus_tag LOCUS_42170 35355 33700 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545143.1 protein_id gnl|my_center|LOCUS_42170 35553 37079 gene locus_tag LOCUS_42180 35553 37079 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337137.1 protein_id gnl|my_center|LOCUS_42180 37205 40816 gene locus_tag LOCUS_42190 37205 40816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 41030 42439 gene locus_tag LOCUS_42200 41030 42439 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_42200 42662 43159 gene locus_tag LOCUS_42210 42662 43159 CDS product DUF1643 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263212.1 protein_id gnl|my_center|LOCUS_42210 43165 43800 gene locus_tag LOCUS_42220 43165 43800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 44147 43782 gene locus_tag LOCUS_42230 44147 43782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 45009 44227 gene locus_tag LOCUS_42240 45009 44227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 46780 45254 gene locus_tag LOCUS_42250 46780 45254 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_42250 46847 48127 gene locus_tag LOCUS_42260 46847 48127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 48414 48082 gene locus_tag LOCUS_42270 48414 48082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 51870 49024 gene locus_tag LOCUS_42280 51870 49024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 52103 52912 gene locus_tag LOCUS_42290 52103 52912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 55886 53010 gene locus_tag LOCUS_42300 55886 53010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 56069 56653 gene locus_tag LOCUS_42310 56069 56653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 58352 56673 gene locus_tag LOCUS_42320 58352 56673 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707241.1 protein_id gnl|my_center|LOCUS_42320 58508 58978 gene locus_tag LOCUS_42330 58508 58978 CDS product heme-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726283.1 protein_id gnl|my_center|LOCUS_42330 58986 59528 gene locus_tag LOCUS_42340 58986 59528 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385055.1 protein_id gnl|my_center|LOCUS_42340 60630 59533 gene locus_tag LOCUS_42350 60630 59533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 60845 60988 gene locus_tag LOCUS_42360 60845 60988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 64582 61046 gene locus_tag LOCUS_42370 64582 61046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 65956 64742 gene locus_tag LOCUS_42380 65956 64742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 67734 65953 gene locus_tag LOCUS_42390 67734 65953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 68378 67731 gene locus_tag LOCUS_42400 68378 67731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 69069 68392 gene locus_tag LOCUS_42410 69069 68392 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815117.1 protein_id gnl|my_center|LOCUS_42410 70412 69174 gene locus_tag LOCUS_42420 gene ilvA 70412 69174 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_42420 71217 70462 gene locus_tag LOCUS_42430 71217 70462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 71387 71737 gene locus_tag LOCUS_42440 71387 71737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 71734 72639 gene locus_tag LOCUS_42450 gene pssA 71734 72639 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_42450 72946 74070 gene locus_tag LOCUS_42460 gene dnaN 72946 74070 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725022.1 protein_id gnl|my_center|LOCUS_42460 74162 75040 gene locus_tag LOCUS_42470 74162 75040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 75063 75881 gene locus_tag LOCUS_42480 75063 75881 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017276633.1 protein_id gnl|my_center|LOCUS_42480 77123 76107 gene locus_tag LOCUS_42490 gene moaA 77123 76107 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243488.1 protein_id gnl|my_center|LOCUS_42490 77202 78410 gene locus_tag LOCUS_42500 77202 78410 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057204.1 protein_id gnl|my_center|LOCUS_42500 78799 79275 gene locus_tag LOCUS_42510 78799 79275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 79272 79514 gene locus_tag LOCUS_42520 79272 79514 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057201.1 protein_id gnl|my_center|LOCUS_42520 79544 79999 gene locus_tag LOCUS_42530 79544 79999 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036203.1 protein_id gnl|my_center|LOCUS_42530 80220 81725 gene locus_tag LOCUS_42540 gene gndA 80220 81725 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295350.1 protein_id gnl|my_center|LOCUS_42540 81987 84032 gene locus_tag LOCUS_42550 81987 84032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 84155 84865 gene locus_tag LOCUS_42560 84155 84865 CDS product DUF1826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206288.1 protein_id gnl|my_center|LOCUS_42560 85105 86724 gene locus_tag LOCUS_42570 85105 86724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 86735 88051 gene locus_tag LOCUS_42580 86735 88051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 88048 88677 gene locus_tag LOCUS_42590 88048 88677 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971767.1 protein_id gnl|my_center|LOCUS_42590 88674 89933 gene locus_tag LOCUS_42600 88674 89933 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254437.1 protein_id gnl|my_center|LOCUS_42600 90119 92149 gene locus_tag LOCUS_42610 90119 92149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 92161 94566 gene locus_tag LOCUS_42620 92161 94566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 96037 95012 gene locus_tag LOCUS_42630 96037 95012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 96126 97364 gene locus_tag LOCUS_42640 96126 97364 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201992.1 protein_id gnl|my_center|LOCUS_42640 98762 97482 gene locus_tag LOCUS_42650 98762 97482 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784237.1 protein_id gnl|my_center|LOCUS_42650 99941 98880 gene locus_tag LOCUS_42660 99941 98880 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931784.1 protein_id gnl|my_center|LOCUS_42660 103560 100108 gene locus_tag LOCUS_42670 103560 100108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 104297 103737 gene locus_tag LOCUS_42680 104297 103737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 104884 104294 gene locus_tag LOCUS_42690 104884 104294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 106291 104894 gene locus_tag LOCUS_42700 106291 104894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 107150 106347 gene locus_tag LOCUS_42710 107150 106347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 108112 107147 gene locus_tag LOCUS_42720 108112 107147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 109098 108109 gene locus_tag LOCUS_42730 109098 108109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 110113 109082 gene locus_tag LOCUS_42740 110113 109082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 110241 111482 gene locus_tag LOCUS_42750 110241 111482 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 protein_id gnl|my_center|LOCUS_42750 111618 111935 gene locus_tag LOCUS_42760 111618 111935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 111983 112924 gene locus_tag LOCUS_42770 111983 112924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 112984 115428 gene locus_tag LOCUS_42780 112984 115428 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090828103.1 protein_id gnl|my_center|LOCUS_42780 115548 116249 gene locus_tag LOCUS_42790 115548 116249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 116365 116985 gene locus_tag LOCUS_42800 gene upp 116365 116985 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583176.1 protein_id gnl|my_center|LOCUS_42800 118872 117142 gene locus_tag LOCUS_42810 118872 117142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 120626 119142 gene locus_tag LOCUS_42820 120626 119142 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_42820 121737 120742 gene locus_tag LOCUS_42830 121737 120742 CDS product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442722.1 protein_id gnl|my_center|LOCUS_42830 122174 123274 gene locus_tag LOCUS_42840 gene recA 122174 123274 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_42840 123618 124130 gene locus_tag LOCUS_42850 123618 124130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 124483 125241 gene locus_tag LOCUS_42860 124483 125241 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445444.1 protein_id gnl|my_center|LOCUS_42860 125252 127618 gene locus_tag LOCUS_42870 125252 127618 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932893.1 protein_id gnl|my_center|LOCUS_42870 127629 128882 gene locus_tag LOCUS_42880 127629 128882 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967587.1 protein_id gnl|my_center|LOCUS_42880 129101 130459 gene locus_tag LOCUS_42890 gene mnmE 129101 130459 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393996.1 protein_id gnl|my_center|LOCUS_42890 130505 132379 gene locus_tag LOCUS_42900 gene mnmG 130505 132379 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831818.1 protein_id gnl|my_center|LOCUS_42900 132436 133044 gene locus_tag LOCUS_42910 132436 133044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 133216 134103 gene locus_tag LOCUS_42920 gene atpB 133216 134103 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142904.1 protein_id gnl|my_center|LOCUS_42920 134169 134378 gene locus_tag LOCUS_42930 134169 134378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 134443 134991 gene locus_tag LOCUS_42940 134443 134991 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908159.1 protein_id gnl|my_center|LOCUS_42940 135022 135417 gene locus_tag LOCUS_42950 135022 135417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 135463 136989 gene locus_tag LOCUS_42960 gene atpA 135463 136989 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389785.1 protein_id gnl|my_center|LOCUS_42960 137094 137975 gene locus_tag LOCUS_42970 gene atpG 137094 137975 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035800.1 protein_id gnl|my_center|LOCUS_42970 138014 139432 gene locus_tag LOCUS_42980 gene atpD 138014 139432 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056375.1 protein_id gnl|my_center|LOCUS_42980 139533 139940 gene locus_tag LOCUS_42990 139533 139940 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687159.1 protein_id gnl|my_center|LOCUS_42990 140197 140445 gene locus_tag LOCUS_43000 140197 140445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 140462 140689 gene locus_tag LOCUS_43010 140462 140689 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933404.1 protein_id gnl|my_center|LOCUS_43010 140691 142814 gene locus_tag LOCUS_43020 gene feoB 140691 142814 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065727.1 protein_id gnl|my_center|LOCUS_43020 142822 142971 gene locus_tag LOCUS_43030 142822 142971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 143052 143837 gene locus_tag LOCUS_43040 gene nagB 143052 143837 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030128.1 protein_id gnl|my_center|LOCUS_43040 145259 143970 gene locus_tag LOCUS_43050 145259 143970 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391264.1 protein_id gnl|my_center|LOCUS_43050 145801 145415 gene locus_tag LOCUS_43060 145801 145415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 146198 145836 gene locus_tag LOCUS_43070 146198 145836 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036026449.1 protein_id gnl|my_center|LOCUS_43070 147343 146303 gene locus_tag LOCUS_43080 147343 146303 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088661.1 protein_id gnl|my_center|LOCUS_43080 147514 147849 gene locus_tag LOCUS_43090 147514 147849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 147990 152639 gene locus_tag LOCUS_43100 gene gltB 147990 152639 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926853.1 protein_id gnl|my_center|LOCUS_43100 152763 154247 gene locus_tag LOCUS_43110 152763 154247 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_43110 154506 156668 gene locus_tag LOCUS_43120 154506 156668 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121033.1 protein_id gnl|my_center|LOCUS_43120 156737 162007 gene locus_tag LOCUS_43130 156737 162007 CDS product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121034.1 protein_id gnl|my_center|LOCUS_43130 162025 162774 gene locus_tag LOCUS_43140 162025 162774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 163024 163254 gene locus_tag LOCUS_43150 163024 163254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 163251 164393 gene locus_tag LOCUS_43160 gene dcm 163251 164393 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203404.1 protein_id gnl|my_center|LOCUS_43160 164390 165697 gene locus_tag LOCUS_43170 164390 165697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 165701 166141 gene locus_tag LOCUS_43180 165701 166141 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946967.1 protein_id gnl|my_center|LOCUS_43180 168674 166326 gene locus_tag LOCUS_43190 168674 166326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 168779 169795 gene locus_tag LOCUS_43200 168779 169795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 >Feature sequence11 1438 155 gene locus_tag LOCUS_43210 1438 155 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932291.1 protein_id gnl|my_center|LOCUS_43210 1606 2868 gene locus_tag LOCUS_43220 1606 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118655.1 protein_id gnl|my_center|LOCUS_43220 4191 2953 gene locus_tag LOCUS_43230 gene arsJ 4191 2953 CDS product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798948.1 protein_id gnl|my_center|LOCUS_43230 5198 4188 gene locus_tag LOCUS_43240 5198 4188 CDS product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255924.1 protein_id gnl|my_center|LOCUS_43240 5661 5266 gene locus_tag LOCUS_43250 5661 5266 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089312.1 protein_id gnl|my_center|LOCUS_43250 6180 5707 gene locus_tag LOCUS_43260 6180 5707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 6755 6240 gene locus_tag LOCUS_43270 6755 6240 CDS product DUF6428 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398911.1 protein_id gnl|my_center|LOCUS_43270 6894 9656 gene locus_tag LOCUS_43280 6894 9656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 9987 9634 gene locus_tag LOCUS_43290 9987 9634 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929326.1 protein_id gnl|my_center|LOCUS_43290 10174 10410 gene locus_tag LOCUS_43300 10174 10410 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086058.1 protein_id gnl|my_center|LOCUS_43300 10562 10777 gene locus_tag LOCUS_43310 10562 10777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 11071 11904 gene locus_tag LOCUS_43320 11071 11904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 12038 12880 gene locus_tag LOCUS_43330 12038 12880 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084260.1 protein_id gnl|my_center|LOCUS_43330 12944 13615 gene locus_tag LOCUS_43340 12944 13615 CDS product two component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175643.1 protein_id gnl|my_center|LOCUS_43340 13699 14616 gene locus_tag LOCUS_43350 13699 14616 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920359.1 protein_id gnl|my_center|LOCUS_43350 14799 15773 gene locus_tag LOCUS_43360 14799 15773 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920211.1 protein_id gnl|my_center|LOCUS_43360 16345 16160 gene locus_tag LOCUS_43370 16345 16160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 17011 16439 gene locus_tag LOCUS_43380 17011 16439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 18393 17056 gene locus_tag LOCUS_43390 18393 17056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 20006 18390 gene locus_tag LOCUS_43400 gene ggt 20006 18390 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388138.1 protein_id gnl|my_center|LOCUS_43400 20295 21050 gene locus_tag LOCUS_43410 20295 21050 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120859.1 protein_id gnl|my_center|LOCUS_43410 22324 21260 gene locus_tag LOCUS_43420 22324 21260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 23301 22321 gene locus_tag LOCUS_43430 23301 22321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 23703 23897 gene locus_tag LOCUS_43440 23703 23897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 23884 26301 gene locus_tag LOCUS_43450 23884 26301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 27656 27279 gene locus_tag LOCUS_43460 27656 27279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 28893 29426 gene locus_tag LOCUS_43470 28893 29426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 30420 31298 gene locus_tag LOCUS_43480 30420 31298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 32638 31427 gene locus_tag LOCUS_43490 32638 31427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 33015 32716 gene locus_tag LOCUS_43500 33015 32716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 33223 33032 gene locus_tag LOCUS_43510 33223 33032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 33771 33403 gene locus_tag LOCUS_43520 33771 33403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 34146 33862 gene locus_tag LOCUS_43530 34146 33862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 35191 34277 gene locus_tag LOCUS_43540 35191 34277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 36698 35223 gene locus_tag LOCUS_43550 36698 35223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 37153 36755 gene locus_tag LOCUS_43560 37153 36755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 39864 37150 gene locus_tag LOCUS_43570 39864 37150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 41127 41858 gene locus_tag LOCUS_43580 gene radC 41127 41858 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816793.1 protein_id gnl|my_center|LOCUS_43580 42489 42830 gene locus_tag LOCUS_43590 42489 42830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 43068 45803 gene locus_tag LOCUS_43600 43068 45803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43600 45824 48475 gene locus_tag LOCUS_43610 45824 48475 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087775.1 protein_id gnl|my_center|LOCUS_43610 48472 49734 gene locus_tag LOCUS_43620 48472 49734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 49731 51089 gene locus_tag LOCUS_43630 49731 51089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 51098 52795 gene locus_tag LOCUS_43640 51098 52795 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888829.1 protein_id gnl|my_center|LOCUS_43640 52955 56422 gene locus_tag LOCUS_43650 52955 56422 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087773.1 protein_id gnl|my_center|LOCUS_43650 56419 57138 gene locus_tag LOCUS_43660 56419 57138 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087772.1 protein_id gnl|my_center|LOCUS_43660 57922 57488 gene locus_tag LOCUS_43670 57922 57488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 57806 58129 gene locus_tag LOCUS_43680 57806 58129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 58797 58237 gene locus_tag LOCUS_43690 58797 58237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 59075 58794 gene locus_tag LOCUS_43700 59075 58794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 59497 59270 gene locus_tag LOCUS_43710 59497 59270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43710 59983 60753 gene locus_tag LOCUS_43720 59983 60753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 62006 60771 gene locus_tag LOCUS_43730 62006 60771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 62155 62078 gene locus_tag LOCUS_t00470 62155 62078 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 62230 63207 gene locus_tag LOCUS_43740 62230 63207 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050911213.1 protein_id gnl|my_center|LOCUS_43740 63710 63429 gene locus_tag LOCUS_43750 63710 63429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 63995 63747 gene locus_tag LOCUS_43760 63995 63747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 63910 65880 gene locus_tag LOCUS_43770 63910 65880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 65888 66142 gene locus_tag LOCUS_43780 65888 66142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 66528 66307 gene locus_tag LOCUS_43790 66528 66307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 67066 66491 gene locus_tag LOCUS_43800 67066 66491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 67034 67180 gene locus_tag LOCUS_43810 67034 67180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 69598 67436 gene locus_tag LOCUS_43820 69598 67436 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932948.1 protein_id gnl|my_center|LOCUS_43820 74755 69818 gene locus_tag LOCUS_43830 74755 69818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 75791 74889 gene locus_tag LOCUS_43840 75791 74889 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027460.1 protein_id gnl|my_center|LOCUS_43840 76878 75829 gene locus_tag LOCUS_43850 76878 75829 CDS product deoxyhypusine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_43850 77055 77969 gene locus_tag LOCUS_43860 77055 77969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 78023 79891 gene locus_tag LOCUS_43870 78023 79891 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_43870 81383 80079 gene locus_tag LOCUS_43880 81383 80079 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393758.1 protein_id gnl|my_center|LOCUS_43880 81791 81438 gene locus_tag LOCUS_43890 81791 81438 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245961.1 protein_id gnl|my_center|LOCUS_43890 82501 81788 gene locus_tag LOCUS_43900 82501 81788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907663.1 protein_id gnl|my_center|LOCUS_43900 83543 82944 gene locus_tag LOCUS_43910 83543 82944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 84905 83667 gene locus_tag LOCUS_43920 84905 83667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 85659 84919 gene locus_tag LOCUS_43930 85659 84919 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_43930 86514 85786 gene locus_tag LOCUS_43940 86514 85786 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838137.1 protein_id gnl|my_center|LOCUS_43940 87647 86511 gene locus_tag LOCUS_43950 87647 86511 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838136.1 protein_id gnl|my_center|LOCUS_43950 89115 87796 gene locus_tag LOCUS_43960 89115 87796 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265899.1 protein_id gnl|my_center|LOCUS_43960 90222 89356 gene locus_tag LOCUS_43970 90222 89356 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222792.1 protein_id gnl|my_center|LOCUS_43970 91757 90249 gene locus_tag LOCUS_43980 91757 90249 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403981.1 protein_id gnl|my_center|LOCUS_43980 92730 91786 gene locus_tag LOCUS_43990 gene deoC 92730 91786 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 protein_id gnl|my_center|LOCUS_43990 92729 93784 gene locus_tag LOCUS_44000 92729 93784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140563.1 protein_id gnl|my_center|LOCUS_44000 93936 94391 gene locus_tag LOCUS_44010 93936 94391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 95237 94548 gene locus_tag LOCUS_44020 95237 94548 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_44020 97030 95243 gene locus_tag LOCUS_44030 97030 95243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 97221 97607 gene locus_tag LOCUS_44040 97221 97607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 97716 98813 gene locus_tag LOCUS_44050 97716 98813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 100274 98838 gene locus_tag LOCUS_44060 100274 98838 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 protein_id gnl|my_center|LOCUS_44060 100390 104751 gene locus_tag LOCUS_44070 100390 104751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 104817 106049 gene locus_tag LOCUS_44080 104817 106049 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937699.1 protein_id gnl|my_center|LOCUS_44080 106127 110107 gene locus_tag LOCUS_44090 106127 110107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 110224 111168 gene locus_tag LOCUS_44100 110224 111168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 111826 111185 gene locus_tag LOCUS_44110 111826 111185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 113078 112059 gene locus_tag LOCUS_44120 113078 112059 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263039.1 protein_id gnl|my_center|LOCUS_44120 114540 113185 gene locus_tag LOCUS_44130 114540 113185 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921626.1 protein_id gnl|my_center|LOCUS_44130 116070 114829 gene locus_tag LOCUS_44140 116070 114829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 116350 118086 gene locus_tag LOCUS_44150 116350 118086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 118106 118840 gene locus_tag LOCUS_44160 118106 118840 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787685.1 protein_id gnl|my_center|LOCUS_44160 119577 123029 gene locus_tag LOCUS_44170 119577 123029 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615995.1 protein_id gnl|my_center|LOCUS_44170 123220 125901 gene locus_tag LOCUS_44180 123220 125901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44180 >Feature sequence12 472 3294 gene locus_tag LOCUS_44190 472 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 6106 3455 gene locus_tag LOCUS_44200 6106 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 6495 6659 gene locus_tag LOCUS_44210 6495 6659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 6697 8106 gene locus_tag LOCUS_44220 6697 8106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44220 9268 8201 gene locus_tag LOCUS_44230 9268 8201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 8952 9029 gene locus_tag LOCUS_t00480 8952 9029 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 9386 9766 gene locus_tag LOCUS_44240 9386 9766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 9913 10830 gene locus_tag LOCUS_44250 9913 10830 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837921.1 protein_id gnl|my_center|LOCUS_44250 10896 11252 gene locus_tag LOCUS_44260 10896 11252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 11393 13684 gene locus_tag LOCUS_44270 11393 13684 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200389.1 protein_id gnl|my_center|LOCUS_44270 13798 15204 gene locus_tag LOCUS_44280 13798 15204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037383.1 protein_id gnl|my_center|LOCUS_44280 15201 15530 gene locus_tag LOCUS_44290 15201 15530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 15811 17550 gene locus_tag LOCUS_44300 15811 17550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 18003 20369 gene locus_tag LOCUS_44310 18003 20369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 20538 22028 gene locus_tag LOCUS_44320 20538 22028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 22088 22438 gene locus_tag LOCUS_44330 22088 22438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 22548 24707 gene locus_tag LOCUS_44340 22548 24707 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101985.1 protein_id gnl|my_center|LOCUS_44340 24787 26430 gene locus_tag LOCUS_44350 24787 26430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 27375 26446 gene locus_tag LOCUS_44360 gene ftsY 27375 26446 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443981.1 protein_id gnl|my_center|LOCUS_44360 27873 27430 gene locus_tag LOCUS_44370 gene nusB 27873 27430 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942335.1 protein_id gnl|my_center|LOCUS_44370 28343 27870 gene locus_tag LOCUS_44380 gene ribH 28343 27870 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141044.1 protein_id gnl|my_center|LOCUS_44380 28995 28465 gene locus_tag LOCUS_44390 28995 28465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 29116 29760 gene locus_tag LOCUS_44400 gene can 29116 29760 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036740.1 protein_id gnl|my_center|LOCUS_44400 31223 29865 gene locus_tag LOCUS_44410 31223 29865 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121727.1 protein_id gnl|my_center|LOCUS_44410 31319 32965 gene locus_tag LOCUS_44420 31319 32965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 32949 33296 gene locus_tag LOCUS_44430 32949 33296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 34329 33556 gene locus_tag LOCUS_44440 34329 33556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 34930 34349 gene locus_tag LOCUS_44450 34930 34349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 36339 34993 gene locus_tag LOCUS_44460 36339 34993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 37950 36430 gene locus_tag LOCUS_44470 37950 36430 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460435.1 protein_id gnl|my_center|LOCUS_44470 39474 37963 gene locus_tag LOCUS_44480 39474 37963 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392501.1 protein_id gnl|my_center|LOCUS_44480 41380 39479 gene locus_tag LOCUS_44490 gene nuoL 41380 39479 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_44490 41694 41386 gene locus_tag LOCUS_44500 gene nuoK 41694 41386 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081840.1 protein_id gnl|my_center|LOCUS_44500 42206 41691 gene locus_tag LOCUS_44510 42206 41691 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258757.1 protein_id gnl|my_center|LOCUS_44510 42779 42237 gene locus_tag LOCUS_44520 42779 42237 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015646.1 protein_id gnl|my_center|LOCUS_44520 44045 42885 gene locus_tag LOCUS_44530 gene nuoH 44045 42885 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104353.1 protein_id gnl|my_center|LOCUS_44530 44271 44047 gene locus_tag LOCUS_44540 44271 44047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 45986 44283 gene locus_tag LOCUS_44550 45986 44283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 47358 46006 gene locus_tag LOCUS_44560 gene nuoF 47358 46006 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967797.1 protein_id gnl|my_center|LOCUS_44560 47867 47379 gene locus_tag LOCUS_44570 47867 47379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 49134 47890 gene locus_tag LOCUS_44580 gene nuoD 49134 47890 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_44580 49804 49154 gene locus_tag LOCUS_44590 49804 49154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 50341 49832 gene locus_tag LOCUS_44600 50341 49832 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081859.1 protein_id gnl|my_center|LOCUS_44600 50645 50734 gene locus_tag LOCUS_t00490 50645 50734 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 51778 52101 gene locus_tag LOCUS_44610 51778 52101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 52112 52879 gene locus_tag LOCUS_44620 52112 52879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 52892 53944 gene locus_tag LOCUS_44630 52892 53944 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_44630 53967 54473 gene locus_tag LOCUS_44640 53967 54473 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061729.1 protein_id gnl|my_center|LOCUS_44640 54454 55590 gene locus_tag LOCUS_44650 54454 55590 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461032.1 protein_id gnl|my_center|LOCUS_44650 55587 56618 gene locus_tag LOCUS_44660 55587 56618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 56628 58862 gene locus_tag LOCUS_44670 56628 58862 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704486.1 protein_id gnl|my_center|LOCUS_44670 58940 59896 gene locus_tag LOCUS_44680 58940 59896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 59893 61335 gene locus_tag LOCUS_44690 59893 61335 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_44690 61338 61808 gene locus_tag LOCUS_44700 gene pssD 61338 61808 CDS product PssD/Cps14F family polysaccharide biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065325.1 protein_id gnl|my_center|LOCUS_44700 61805 62326 gene locus_tag LOCUS_44710 61805 62326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 62323 62895 gene locus_tag LOCUS_44720 62323 62895 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496715.1 protein_id gnl|my_center|LOCUS_44720 62899 63837 gene locus_tag LOCUS_44730 62899 63837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 63847 64755 gene locus_tag LOCUS_44740 63847 64755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 65007 66392 gene locus_tag LOCUS_44750 65007 66392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 66502 67932 gene locus_tag LOCUS_44760 66502 67932 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931866.1 protein_id gnl|my_center|LOCUS_44760 67958 69244 gene locus_tag LOCUS_44770 67958 69244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 69308 70591 gene locus_tag LOCUS_44780 69308 70591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44780 70731 72008 gene locus_tag LOCUS_44790 70731 72008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 72061 73629 gene locus_tag LOCUS_44800 72061 73629 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476089.1 protein_id gnl|my_center|LOCUS_44800 73727 74776 gene locus_tag LOCUS_44810 73727 74776 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143696.1 protein_id gnl|my_center|LOCUS_44810 74806 75759 gene locus_tag LOCUS_44820 74806 75759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 75756 76829 gene locus_tag LOCUS_44830 75756 76829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44830 76853 78127 gene locus_tag LOCUS_44840 76853 78127 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875980.1 protein_id gnl|my_center|LOCUS_44840 78453 83762 gene locus_tag LOCUS_44850 78453 83762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 83831 85486 gene locus_tag LOCUS_44860 83831 85486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 85626 86738 gene locus_tag LOCUS_44870 85626 86738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 86822 87805 gene locus_tag LOCUS_44880 gene xrt 86822 87805 CDS product exosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176633.1 protein_id gnl|my_center|LOCUS_44880 87807 91034 gene locus_tag LOCUS_44890 87807 91034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 92362 91508 gene locus_tag LOCUS_44900 92362 91508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 93428 92490 gene locus_tag LOCUS_44910 93428 92490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 95111 94020 gene locus_tag LOCUS_44920 95111 94020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 95953 95108 gene locus_tag LOCUS_44930 95953 95108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 97252 96125 gene locus_tag LOCUS_44940 97252 96125 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462256.1 protein_id gnl|my_center|LOCUS_44940 98266 97277 gene locus_tag LOCUS_44950 98266 97277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 98405 98557 gene locus_tag LOCUS_44960 98405 98557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 98561 100396 gene locus_tag LOCUS_44970 98561 100396 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391425.1 protein_id gnl|my_center|LOCUS_44970 100405 100815 gene locus_tag LOCUS_44980 100405 100815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975330.1 protein_id gnl|my_center|LOCUS_44980 100816 101973 gene locus_tag LOCUS_44990 100816 101973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 101990 104104 gene locus_tag LOCUS_45000 gene prsK 101990 104104 CDS product PEP-CTERM system histidine kinase PrsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942586.1 protein_id gnl|my_center|LOCUS_45000 104094 105461 gene locus_tag LOCUS_45010 gene prsR 104094 105461 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942585.1 protein_id gnl|my_center|LOCUS_45010 106133 105495 gene locus_tag LOCUS_45020 106133 105495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 106397 106603 gene locus_tag LOCUS_45030 106397 106603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 106843 107466 gene locus_tag LOCUS_45040 106843 107466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 107728 108240 gene locus_tag LOCUS_45050 107728 108240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45050 108315 108770 gene locus_tag LOCUS_45060 108315 108770 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_45060 108778 110040 gene locus_tag LOCUS_45070 108778 110040 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259320.1 protein_id gnl|my_center|LOCUS_45070 >Feature sequence13 48 572 gene locus_tag LOCUS_45080 48 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 1059 2039 gene locus_tag LOCUS_45090 1059 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 3040 2483 gene locus_tag LOCUS_45100 3040 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 3231 3037 gene locus_tag LOCUS_45110 3231 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45110 3847 4398 gene locus_tag LOCUS_45120 3847 4398 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389192.1 protein_id gnl|my_center|LOCUS_45120 4395 5438 gene locus_tag LOCUS_45130 4395 5438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 5542 9399 gene locus_tag LOCUS_45140 5542 9399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45140 9507 11672 gene locus_tag LOCUS_45150 9507 11672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 12555 15860 gene locus_tag LOCUS_45160 12555 15860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45160 15924 17489 gene locus_tag LOCUS_45170 15924 17489 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921302.1 protein_id gnl|my_center|LOCUS_45170 17473 18366 gene locus_tag LOCUS_45180 17473 18366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 18387 19019 gene locus_tag LOCUS_45190 18387 19019 CDS product HAD family acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948321.1 protein_id gnl|my_center|LOCUS_45190 19628 21502 gene locus_tag LOCUS_45200 19628 21502 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937411.1 protein_id gnl|my_center|LOCUS_45200 23324 21675 gene locus_tag LOCUS_45210 23324 21675 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144112.1 protein_id gnl|my_center|LOCUS_45210 24313 23411 gene locus_tag LOCUS_45220 24313 23411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 24438 24767 gene locus_tag LOCUS_45230 24438 24767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 26908 25127 gene locus_tag LOCUS_45240 gene cysI 26908 25127 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470366.1 protein_id gnl|my_center|LOCUS_45240 27741 26905 gene locus_tag LOCUS_45250 27741 26905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45250 28547 27738 gene locus_tag LOCUS_45260 28547 27738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 28845 29519 gene locus_tag LOCUS_45270 28845 29519 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167272.1 protein_id gnl|my_center|LOCUS_45270 29558 30460 gene locus_tag LOCUS_45280 gene cysD 29558 30460 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002735002.1 protein_id gnl|my_center|LOCUS_45280 30567 31925 gene locus_tag LOCUS_45290 30567 31925 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365065.1 protein_id gnl|my_center|LOCUS_45290 31933 32346 gene locus_tag LOCUS_45300 31933 32346 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081895.1 protein_id gnl|my_center|LOCUS_45300 33449 32547 gene locus_tag LOCUS_45310 33449 32547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 35759 33501 gene locus_tag LOCUS_45320 35759 33501 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117877.1 protein_id gnl|my_center|LOCUS_45320 37531 35756 gene locus_tag LOCUS_45330 37531 35756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 39361 37586 gene locus_tag LOCUS_45340 39361 37586 CDS product sulfite reductase flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368585.1 protein_id gnl|my_center|LOCUS_45340 41217 39358 gene locus_tag LOCUS_45350 41217 39358 CDS product NirA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967420.1 protein_id gnl|my_center|LOCUS_45350 42826 41327 gene locus_tag LOCUS_45360 42826 41327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 43776 42871 gene locus_tag LOCUS_45370 43776 42871 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324929.1 protein_id gnl|my_center|LOCUS_45370 44673 43777 gene locus_tag LOCUS_45380 44673 43777 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442682.1 protein_id gnl|my_center|LOCUS_45380 45520 44684 gene locus_tag LOCUS_45390 gene ntrB 45520 44684 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705090.1 protein_id gnl|my_center|LOCUS_45390 46699 45575 gene locus_tag LOCUS_45400 46699 45575 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705089.1 protein_id gnl|my_center|LOCUS_45400 46602 46904 gene locus_tag LOCUS_45410 46602 46904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45410 47973 46873 gene locus_tag LOCUS_45420 47973 46873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45420 48032 48967 gene locus_tag LOCUS_45430 48032 48967 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943443.1 protein_id gnl|my_center|LOCUS_45430 49990 49055 gene locus_tag LOCUS_45440 49990 49055 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_45440 50178 51716 gene locus_tag LOCUS_45450 50178 51716 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948237.1 protein_id gnl|my_center|LOCUS_45450 52454 51852 gene locus_tag LOCUS_45460 52454 51852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 52587 54680 gene locus_tag LOCUS_45470 52587 54680 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117861.1 protein_id gnl|my_center|LOCUS_45470 54739 56037 gene locus_tag LOCUS_45480 54739 56037 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921626.1 protein_id gnl|my_center|LOCUS_45480 56186 57145 gene locus_tag LOCUS_45490 56186 57145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 60135 57295 gene locus_tag LOCUS_45500 60135 57295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 62273 60207 gene locus_tag LOCUS_45510 62273 60207 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921322.1 protein_id gnl|my_center|LOCUS_45510 65091 62404 gene locus_tag LOCUS_45520 65091 62404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 65279 66775 gene locus_tag LOCUS_45530 65279 66775 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921691.1 protein_id gnl|my_center|LOCUS_45530 69973 67052 gene locus_tag LOCUS_45540 69973 67052 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404755.1 protein_id gnl|my_center|LOCUS_45540 70141 71310 gene locus_tag LOCUS_45550 70141 71310 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121679.1 protein_id gnl|my_center|LOCUS_45550 71585 73927 gene locus_tag LOCUS_45560 71585 73927 CDS product DUF4962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927915.1 protein_id gnl|my_center|LOCUS_45560 75165 73942 gene locus_tag LOCUS_45570 75165 73942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 75695 78730 gene locus_tag LOCUS_45580 75695 78730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 80246 78966 gene locus_tag LOCUS_45590 80246 78966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45590 81677 80277 gene locus_tag LOCUS_45600 81677 80277 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922487.1 protein_id gnl|my_center|LOCUS_45600 83314 81908 gene locus_tag LOCUS_45610 83314 81908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 84802 83471 gene locus_tag LOCUS_45620 84802 83471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121480.1 protein_id gnl|my_center|LOCUS_45620 84923 86257 gene locus_tag LOCUS_45630 84923 86257 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147744042.1 protein_id gnl|my_center|LOCUS_45630 87737 86403 gene locus_tag LOCUS_45640 87737 86403 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_45640 87843 89282 gene locus_tag LOCUS_45650 87843 89282 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120982.1 protein_id gnl|my_center|LOCUS_45650 89303 92698 gene locus_tag LOCUS_45660 89303 92698 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120107.1 protein_id gnl|my_center|LOCUS_45660 93619 93116 gene locus_tag LOCUS_45670 93619 93116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 94464 93643 gene locus_tag LOCUS_45680 94464 93643 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182015315.1 protein_id gnl|my_center|LOCUS_45680 95380 94496 gene locus_tag LOCUS_45690 95380 94496 CDS product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836505.1 protein_id gnl|my_center|LOCUS_45690 95955 95377 gene locus_tag LOCUS_45700 95955 95377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 97029 95971 gene locus_tag LOCUS_45710 97029 95971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 >Feature sequence14 536 78 gene locus_tag LOCUS_45720 536 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 1134 694 gene locus_tag LOCUS_45730 1134 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45730 1685 2926 gene locus_tag LOCUS_45740 1685 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 3363 3001 gene locus_tag LOCUS_45750 3363 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45750 3362 3748 gene locus_tag LOCUS_45760 3362 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 4440 3745 gene locus_tag LOCUS_45770 4440 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 4735 4430 gene locus_tag LOCUS_45780 4735 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45780 5749 8721 gene locus_tag LOCUS_45790 5749 8721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45790 8778 9431 gene locus_tag LOCUS_45800 8778 9431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45800 9491 15832 gene locus_tag LOCUS_45810 9491 15832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 21220 16529 gene locus_tag LOCUS_45820 21220 16529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45820 21633 21379 gene locus_tag LOCUS_45830 21633 21379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45830 22042 21692 gene locus_tag LOCUS_45840 22042 21692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 24646 22058 gene locus_tag LOCUS_45850 gene mobF 24646 22058 CDS product MobF family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639975.1 protein_id gnl|my_center|LOCUS_45850 24933 25376 gene locus_tag LOCUS_45860 24933 25376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 25386 26087 gene locus_tag LOCUS_45870 25386 26087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 26084 26557 gene locus_tag LOCUS_45880 26084 26557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 26569 28044 gene locus_tag LOCUS_45890 26569 28044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45890 28421 28041 gene locus_tag LOCUS_45900 28421 28041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 29146 28514 gene locus_tag LOCUS_45910 29146 28514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 30067 29804 gene locus_tag LOCUS_45920 30067 29804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 31778 31041 gene locus_tag LOCUS_45930 31778 31041 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838137.1 protein_id gnl|my_center|LOCUS_45930 32899 31775 gene locus_tag LOCUS_45940 32899 31775 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838136.1 protein_id gnl|my_center|LOCUS_45940 34227 33310 gene locus_tag LOCUS_45950 34227 33310 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919953.1 protein_id gnl|my_center|LOCUS_45950 34928 34227 gene locus_tag LOCUS_45960 34928 34227 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919952.1 protein_id gnl|my_center|LOCUS_45960 36077 34947 gene locus_tag LOCUS_45970 gene devC 36077 34947 CDS product ABC transporter permease DevC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140489.1 protein_id gnl|my_center|LOCUS_45970 37056 36118 gene locus_tag LOCUS_45980 37056 36118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 41230 37688 gene locus_tag LOCUS_45990 41230 37688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 41638 43812 gene locus_tag LOCUS_46000 41638 43812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46000 44167 44739 gene locus_tag LOCUS_46010 44167 44739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 46343 45039 gene locus_tag LOCUS_46020 46343 45039 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174384.1 protein_id gnl|my_center|LOCUS_46020 46391 46636 gene locus_tag LOCUS_46030 46391 46636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46030 48104 46923 gene locus_tag LOCUS_46040 48104 46923 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918872.1 protein_id gnl|my_center|LOCUS_46040 48315 49337 gene locus_tag LOCUS_46050 48315 49337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46050 52720 49364 gene locus_tag LOCUS_46060 52720 49364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46060 53281 52727 gene locus_tag LOCUS_46070 53281 52727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46070 56557 53309 gene locus_tag LOCUS_46080 56557 53309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 57859 56624 gene locus_tag LOCUS_46090 57859 56624 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109152.1 protein_id gnl|my_center|LOCUS_46090 60206 59049 gene locus_tag LOCUS_46100 60206 59049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 60587 60219 gene locus_tag LOCUS_46110 60587 60219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 61209 60580 gene locus_tag LOCUS_46120 61209 60580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46120 62100 61243 gene locus_tag LOCUS_46130 62100 61243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 62450 63202 gene locus_tag LOCUS_46140 62450 63202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 63195 66677 gene locus_tag LOCUS_46150 63195 66677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 67025 66777 gene locus_tag LOCUS_46160 67025 66777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46160 68206 67292 gene locus_tag LOCUS_46170 68206 67292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46170 68666 68199 gene locus_tag LOCUS_46180 68666 68199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46180 68723 69010 gene locus_tag LOCUS_46190 68723 69010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46190 69013 69336 gene locus_tag LOCUS_46200 69013 69336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46200 69333 71954 gene locus_tag LOCUS_46210 69333 71954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 71932 72180 gene locus_tag LOCUS_46220 71932 72180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 72177 72989 gene locus_tag LOCUS_46230 72177 72989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 72986 73180 gene locus_tag LOCUS_46240 72986 73180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46240 73180 74133 gene locus_tag LOCUS_46250 73180 74133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 74133 74786 gene locus_tag LOCUS_46260 74133 74786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46260 74786 75571 gene locus_tag LOCUS_46270 74786 75571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 75568 76494 gene locus_tag LOCUS_46280 75568 76494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 76491 77243 gene locus_tag LOCUS_46290 76491 77243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 77246 78439 gene locus_tag LOCUS_46300 gene xcpS 77246 78439 CDS product GspF family T2SS innner membrane protein variant XcpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091376.1 protein_id gnl|my_center|LOCUS_46300 78436 79353 gene locus_tag LOCUS_46310 78436 79353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46310 79350 81608 gene locus_tag LOCUS_46320 79350 81608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 81620 82996 gene locus_tag LOCUS_46330 gene mshL 81620 82996 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261161.1 protein_id gnl|my_center|LOCUS_46330 82996 84192 gene locus_tag LOCUS_46340 82996 84192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46340 84247 85002 gene locus_tag LOCUS_46350 84247 85002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46350 85094 86209 gene locus_tag LOCUS_46360 85094 86209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46360 86206 86691 gene locus_tag LOCUS_46370 86206 86691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 86698 86949 gene locus_tag LOCUS_46380 86698 86949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46380 87025 87456 gene locus_tag LOCUS_46390 87025 87456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 87459 87728 gene locus_tag LOCUS_46400 87459 87728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 87785 88728 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggaccatccccacgcgggtggggagaac >Feature sequence15 2391 1 gene locus_tag LOCUS_46410 2391 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46410 2535 3584 gene locus_tag LOCUS_46420 2535 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46420 4633 3677 gene locus_tag LOCUS_46430 gene araH 4633 3677 CDS product arabinose ABC transporter permease AraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100205.1 protein_id gnl|my_center|LOCUS_46430 6137 4638 gene locus_tag LOCUS_46440 gene araG 6137 4638 CDS product L-arabinose ABC transporter ATP-binding protein AraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705779.1 protein_id gnl|my_center|LOCUS_46440 7218 6172 gene locus_tag LOCUS_46450 gene araF 7218 6172 CDS product arabinose ABC transporter substrate-binding protein AraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028027935.1 protein_id gnl|my_center|LOCUS_46450 7345 8484 gene locus_tag LOCUS_46460 7345 8484 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584053.1 protein_id gnl|my_center|LOCUS_46460 8481 9341 gene locus_tag LOCUS_46470 8481 9341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_46470 9348 10262 gene locus_tag LOCUS_46480 9348 10262 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584051.1 protein_id gnl|my_center|LOCUS_46480 10336 10635 gene locus_tag LOCUS_46490 10336 10635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46490 10926 11612 gene locus_tag LOCUS_46500 10926 11612 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765089.1 protein_id gnl|my_center|LOCUS_46500 11609 13078 gene locus_tag LOCUS_46510 11609 13078 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256316.1 protein_id gnl|my_center|LOCUS_46510 13068 14159 gene locus_tag LOCUS_46520 13068 14159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46520 14167 15708 gene locus_tag LOCUS_46530 14167 15708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46530 15718 18480 gene locus_tag LOCUS_46540 15718 18480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46540 18511 19053 gene locus_tag LOCUS_46550 18511 19053 CDS product heme NO-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963161.1 protein_id gnl|my_center|LOCUS_46550 19065 21653 gene locus_tag LOCUS_46560 19065 21653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 21676 21888 gene locus_tag LOCUS_46570 21676 21888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46570 22024 23571 gene locus_tag LOCUS_46580 22024 23571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 24867 23593 gene locus_tag LOCUS_46590 gene hflX 24867 23593 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_46590 26331 24904 gene locus_tag LOCUS_46600 26331 24904 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974841.1 protein_id gnl|my_center|LOCUS_46600 26995 26324 gene locus_tag LOCUS_46610 26995 26324 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_46610 28671 27145 gene locus_tag LOCUS_46620 28671 27145 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545685.1 protein_id gnl|my_center|LOCUS_46620 28777 29484 gene locus_tag LOCUS_46630 28777 29484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 30345 29554 gene locus_tag LOCUS_46640 30345 29554 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531128.1 protein_id gnl|my_center|LOCUS_46640 31124 30342 gene locus_tag LOCUS_46650 31124 30342 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384594.1 protein_id gnl|my_center|LOCUS_46650 32774 31476 gene locus_tag LOCUS_46660 32774 31476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 34119 32911 gene locus_tag LOCUS_46670 34119 32911 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_46670 34909 34133 gene locus_tag LOCUS_46680 34909 34133 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258508.1 protein_id gnl|my_center|LOCUS_46680 36512 34950 gene locus_tag LOCUS_46690 36512 34950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46690 39138 36841 gene locus_tag LOCUS_46700 39138 36841 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967888.1 protein_id gnl|my_center|LOCUS_46700 40204 39143 gene locus_tag LOCUS_46710 40204 39143 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_46710 40434 41039 gene locus_tag LOCUS_46720 40434 41039 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097831.1 protein_id gnl|my_center|LOCUS_46720 41997 41107 gene locus_tag LOCUS_46730 41997 41107 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394087.1 protein_id gnl|my_center|LOCUS_46730 43233 42289 gene locus_tag LOCUS_46740 43233 42289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 44466 43327 gene locus_tag LOCUS_46750 44466 43327 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071740.1 protein_id gnl|my_center|LOCUS_46750 48563 44655 gene locus_tag LOCUS_46760 gene dnaE 48563 44655 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_46760 48741 48938 gene locus_tag LOCUS_46770 gene rpsU 48741 48938 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882681.1 protein_id gnl|my_center|LOCUS_46770 49356 50234 gene locus_tag LOCUS_46780 49356 50234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46780 51669 50620 gene locus_tag LOCUS_46790 51669 50620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46790 51753 52757 gene locus_tag LOCUS_46800 gene rnhC 51753 52757 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871354.1 protein_id gnl|my_center|LOCUS_46800 52803 53453 gene locus_tag LOCUS_46810 52803 53453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46810 53446 54486 gene locus_tag LOCUS_46820 53446 54486 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918866.1 protein_id gnl|my_center|LOCUS_46820 54682 58098 gene locus_tag LOCUS_46830 54682 58098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46830 58209 58973 gene locus_tag LOCUS_46840 58209 58973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46840 58970 61468 gene locus_tag LOCUS_46850 58970 61468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 63209 61629 gene locus_tag LOCUS_46860 gene phoD 63209 61629 CDS product alkaline phosphatase PhoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969242.1 protein_id gnl|my_center|LOCUS_46860 63344 65038 gene locus_tag LOCUS_46870 63344 65038 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669835.1 protein_id gnl|my_center|LOCUS_46870 66514 65300 gene locus_tag LOCUS_46880 66514 65300 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112709.1 protein_id gnl|my_center|LOCUS_46880 66459 66680 gene locus_tag LOCUS_46890 66459 66680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46890 76204 67022 gene locus_tag LOCUS_46900 76204 67022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46900 <80861 76390 gene locus_tag LOCUS_46910 <80861 76390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104543246.1:autotransporter-associated beta strand repeat-containing protein >Feature sequence16 1754 1023 gene locus_tag LOCUS_46920 gene radC 1754 1023 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545736.1 protein_id gnl|my_center|LOCUS_46920 2122 2673 gene locus_tag LOCUS_46930 2122 2673 CDS product DUF6036 family nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958464.1 protein_id gnl|my_center|LOCUS_46930 2670 3209 gene locus_tag LOCUS_46940 2670 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46940 3736 3233 gene locus_tag LOCUS_46950 3736 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46950 4682 3951 gene locus_tag LOCUS_46960 4682 3951 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975248.1 protein_id gnl|my_center|LOCUS_46960 6668 5703 gene locus_tag LOCUS_46970 6668 5703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46970 7617 6754 gene locus_tag LOCUS_46980 7617 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46980 8758 7592 gene locus_tag LOCUS_46990 8758 7592 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262061.1 protein_id gnl|my_center|LOCUS_46990 8714 8998 gene locus_tag LOCUS_47000 8714 8998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47000 9359 9027 gene locus_tag LOCUS_47010 9359 9027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47010 9768 12407 gene locus_tag LOCUS_47020 9768 12407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47020 13690 12497 gene locus_tag LOCUS_47030 13690 12497 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921498.1 protein_id gnl|my_center|LOCUS_47030 15498 13894 gene locus_tag LOCUS_47040 15498 13894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47040 17068 15854 gene locus_tag LOCUS_47050 17068 15854 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_47050 19180 17225 gene locus_tag LOCUS_47060 19180 17225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47060 19061 20485 gene locus_tag LOCUS_47070 19061 20485 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_47070 20482 23232 gene locus_tag LOCUS_47080 20482 23232 CDS product DUF4962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927915.1 protein_id gnl|my_center|LOCUS_47080 25539 23788 gene locus_tag LOCUS_47090 25539 23788 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143441.1 protein_id gnl|my_center|LOCUS_47090 26930 25707 gene locus_tag LOCUS_47100 26930 25707 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616105.1 protein_id gnl|my_center|LOCUS_47100 28054 27017 gene locus_tag LOCUS_47110 28054 27017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47110 28856 28071 gene locus_tag LOCUS_47120 gene nagB 28856 28071 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030128.1 protein_id gnl|my_center|LOCUS_47120 30139 28886 gene locus_tag LOCUS_47130 30139 28886 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921573.1 protein_id gnl|my_center|LOCUS_47130 31857 30382 gene locus_tag LOCUS_47140 31857 30382 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173402023.1 protein_id gnl|my_center|LOCUS_47140 35138 31887 gene locus_tag LOCUS_47150 35138 31887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47150 36222 35209 gene locus_tag LOCUS_47160 36222 35209 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147971.1 protein_id gnl|my_center|LOCUS_47160 36923 36219 gene locus_tag LOCUS_47170 36923 36219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47170 39899 36957 gene locus_tag LOCUS_47180 39899 36957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47180 42549 40030 gene locus_tag LOCUS_47190 42549 40030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47190 45228 42721 gene locus_tag LOCUS_47200 45228 42721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47200 45549 46694 gene locus_tag LOCUS_47210 45549 46694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 46814 51130 gene locus_tag LOCUS_47220 46814 51130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47220 51464 51279 gene locus_tag LOCUS_47230 51464 51279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47230 51737 53428 gene locus_tag LOCUS_47240 51737 53428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 54127 53483 gene locus_tag LOCUS_47250 54127 53483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47250 55615 56004 gene locus_tag LOCUS_47260 55615 56004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 57038 56103 gene locus_tag LOCUS_47270 57038 56103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 57177 57383 gene locus_tag LOCUS_47280 57177 57383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 57590 60181 gene locus_tag LOCUS_47290 57590 60181 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933627.1 protein_id gnl|my_center|LOCUS_47290 60165 61658 gene locus_tag LOCUS_47300 gene casA 60165 61658 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933628.1 protein_id gnl|my_center|LOCUS_47300 61655 62203 gene locus_tag LOCUS_47310 61655 62203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 62200 62880 gene locus_tag LOCUS_47320 gene cas6e 62200 62880 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933630.1 protein_id gnl|my_center|LOCUS_47320 62922 63992 gene locus_tag LOCUS_47330 gene cas7e 62922 63992 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229114.1 protein_id gnl|my_center|LOCUS_47330 63982 64707 gene locus_tag LOCUS_47340 gene cas5e 63982 64707 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933632.1 protein_id gnl|my_center|LOCUS_47340 64732 65619 gene locus_tag LOCUS_47350 gene cas1e 64732 65619 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933633.1 protein_id gnl|my_center|LOCUS_47350 65616 65915 gene locus_tag LOCUS_47360 gene cas2e 65616 65915 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933634.1 protein_id gnl|my_center|LOCUS_47360 65965 72156 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttctccccacccgcgtggggatggtccg >Feature sequence17 679 155 gene locus_tag LOCUS_47370 679 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47370 1230 676 gene locus_tag LOCUS_47380 1230 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 1829 1227 gene locus_tag LOCUS_47390 1829 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47390 2869 1826 gene locus_tag LOCUS_47400 2869 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47400 3477 2995 gene locus_tag LOCUS_47410 3477 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47410 3931 3527 gene locus_tag LOCUS_47420 3931 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47420 4366 4605 gene locus_tag LOCUS_47430 4366 4605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47430 4692 6059 gene locus_tag LOCUS_47440 4692 6059 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793798.1 protein_id gnl|my_center|LOCUS_47440 6134 6487 gene locus_tag LOCUS_47450 6134 6487 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_47450 6560 7906 gene locus_tag LOCUS_47460 6560 7906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47460 8273 9526 gene locus_tag LOCUS_47470 8273 9526 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928727.1 protein_id gnl|my_center|LOCUS_47470 9815 10516 gene locus_tag LOCUS_47480 9815 10516 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141273.1 protein_id gnl|my_center|LOCUS_47480 10707 11840 gene locus_tag LOCUS_47490 10707 11840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 12097 14520 gene locus_tag LOCUS_47500 12097 14520 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_47500 14780 15745 gene locus_tag LOCUS_47510 14780 15745 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226896.1 protein_id gnl|my_center|LOCUS_47510 16792 15755 gene locus_tag LOCUS_47520 16792 15755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47520 16835 18196 gene locus_tag LOCUS_47530 16835 18196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47530 18352 21255 gene locus_tag LOCUS_47540 18352 21255 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275340.1 protein_id gnl|my_center|LOCUS_47540 21451 24072 gene locus_tag LOCUS_47550 21451 24072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 25045 24209 gene locus_tag LOCUS_47560 25045 24209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47560 25523 25275 gene locus_tag LOCUS_47570 25523 25275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47570 25825 28350 gene locus_tag LOCUS_47580 25825 28350 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928775.1 protein_id gnl|my_center|LOCUS_47580 28457 30880 gene locus_tag LOCUS_47590 28457 30880 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_47590 30987 33404 gene locus_tag LOCUS_47600 30987 33404 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_47600 33463 34347 gene locus_tag LOCUS_47610 33463 34347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 34419 35114 gene locus_tag LOCUS_47620 34419 35114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47620 35125 37521 gene locus_tag LOCUS_47630 35125 37521 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928775.1 protein_id gnl|my_center|LOCUS_47630 37631 40027 gene locus_tag LOCUS_47640 37631 40027 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_47640 40493 40236 gene locus_tag LOCUS_47650 40493 40236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47650 41830 40649 gene locus_tag LOCUS_47660 41830 40649 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941112.1 protein_id gnl|my_center|LOCUS_47660 42710 41838 gene locus_tag LOCUS_47670 42710 41838 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141275.1 protein_id gnl|my_center|LOCUS_47670 42979 43701 gene locus_tag LOCUS_47680 gene queC 42979 43701 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061849.1 protein_id gnl|my_center|LOCUS_47680 43744 44439 gene locus_tag LOCUS_47690 43744 44439 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921555.1 protein_id gnl|my_center|LOCUS_47690 44553 45245 gene locus_tag LOCUS_47700 44553 45245 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819224.1 protein_id gnl|my_center|LOCUS_47700 46772 45732 gene locus_tag LOCUS_47710 46772 45732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47710 46922 47833 gene locus_tag LOCUS_47720 46922 47833 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_47720 49857 48028 gene locus_tag LOCUS_47730 49857 48028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47730 50528 49947 gene locus_tag LOCUS_47740 50528 49947 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224535.1 protein_id gnl|my_center|LOCUS_47740 50573 51301 gene locus_tag LOCUS_47750 50573 51301 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804151.1 protein_id gnl|my_center|LOCUS_47750 51362 52258 gene locus_tag LOCUS_47760 51362 52258 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403152.1 protein_id gnl|my_center|LOCUS_47760 52255 53202 gene locus_tag LOCUS_47770 52255 53202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47770 53214 53702 gene locus_tag LOCUS_47780 53214 53702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47780 53699 54586 gene locus_tag LOCUS_47790 53699 54586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226805.1 protein_id gnl|my_center|LOCUS_47790 54727 55632 gene locus_tag LOCUS_47800 54727 55632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47800 56415 55774 gene locus_tag LOCUS_47810 56415 55774 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056891.1 protein_id gnl|my_center|LOCUS_47810 56571 56795 gene locus_tag LOCUS_47820 56571 56795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47820 56845 57270 gene locus_tag LOCUS_47830 56845 57270 CDS product globin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085591.1 protein_id gnl|my_center|LOCUS_47830 57434 57625 gene locus_tag LOCUS_47840 57434 57625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47840 57622 58164 gene locus_tag LOCUS_47850 57622 58164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47850 58390 63288 gene locus_tag LOCUS_47860 58390 63288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47860 63366 64436 gene locus_tag LOCUS_47870 63366 64436 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763530.1 protein_id gnl|my_center|LOCUS_47870 66089 64518 gene locus_tag LOCUS_47880 66089 64518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47880 66695 66168 gene locus_tag LOCUS_47890 66695 66168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47890 66864 67946 gene locus_tag LOCUS_47900 66864 67946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47900 67997 68401 gene locus_tag LOCUS_47910 67997 68401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47910 >Feature sequence18 239 1258 gene locus_tag LOCUS_47920 239 1258 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218938748.1 protein_id gnl|my_center|LOCUS_47920 2239 1418 gene locus_tag LOCUS_47930 2239 1418 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280345.1 protein_id gnl|my_center|LOCUS_47930 2305 3570 gene locus_tag LOCUS_47940 2305 3570 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257120.1 protein_id gnl|my_center|LOCUS_47940 3663 5888 gene locus_tag LOCUS_47950 3663 5888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680025.1 protein_id gnl|my_center|LOCUS_47950 6980 6243 gene locus_tag LOCUS_47960 6980 6243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47960 7994 7065 gene locus_tag LOCUS_47970 7994 7065 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 protein_id gnl|my_center|LOCUS_47970 8458 7991 gene locus_tag LOCUS_47980 gene sixA 8458 7991 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769602.1 protein_id gnl|my_center|LOCUS_47980 10111 8549 gene locus_tag LOCUS_47990 10111 8549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47990 10823 10188 gene locus_tag LOCUS_48000 gene pdxH 10823 10188 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403320.1 protein_id gnl|my_center|LOCUS_48000 11350 10862 gene locus_tag LOCUS_48010 11350 10862 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974912.1 protein_id gnl|my_center|LOCUS_48010 11682 11347 gene locus_tag LOCUS_48020 11682 11347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48020 11993 13036 gene locus_tag LOCUS_48030 gene nadA 11993 13036 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265876.1 protein_id gnl|my_center|LOCUS_48030 13051 13923 gene locus_tag LOCUS_48040 gene nadC 13051 13923 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_48040 13923 15479 gene locus_tag LOCUS_48050 gene nadB 13923 15479 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939096.1 protein_id gnl|my_center|LOCUS_48050 16237 15605 gene locus_tag LOCUS_48060 gene gmk 16237 15605 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938199.1 protein_id gnl|my_center|LOCUS_48060 16784 16245 gene locus_tag LOCUS_48070 16784 16245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 18208 16820 gene locus_tag LOCUS_48080 gene miaB 18208 16820 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649877.1 protein_id gnl|my_center|LOCUS_48080 18299 19774 gene locus_tag LOCUS_48090 18299 19774 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971000.1 protein_id gnl|my_center|LOCUS_48090 19826 20938 gene locus_tag LOCUS_48100 gene dusB 19826 20938 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942604.1 protein_id gnl|my_center|LOCUS_48100 20967 21650 gene locus_tag LOCUS_48110 20967 21650 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017302344.1 protein_id gnl|my_center|LOCUS_48110 22932 21799 gene locus_tag LOCUS_48120 22932 21799 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390877.1 protein_id gnl|my_center|LOCUS_48120 23863 22940 gene locus_tag LOCUS_48130 23863 22940 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088395.1 protein_id gnl|my_center|LOCUS_48130 24828 23860 gene locus_tag LOCUS_48140 24828 23860 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390879.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48140 25450 24806 gene locus_tag LOCUS_48150 25450 24806 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460044.1 protein_id gnl|my_center|LOCUS_48150 25597 26220 gene locus_tag LOCUS_48160 25597 26220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 26342 28162 gene locus_tag LOCUS_48170 26342 28162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48170 28159 30042 gene locus_tag LOCUS_48180 28159 30042 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827098.1 protein_id gnl|my_center|LOCUS_48180 30223 30453 gene locus_tag LOCUS_48190 30223 30453 CDS product SWIB complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871818.1 protein_id gnl|my_center|LOCUS_48190 30701 32410 gene locus_tag LOCUS_48200 30701 32410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48200 33582 32653 gene locus_tag LOCUS_48210 gene cysK 33582 32653 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 protein_id gnl|my_center|LOCUS_48210 33708 34235 gene locus_tag LOCUS_48220 33708 34235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48220 34248 35273 gene locus_tag LOCUS_48230 34248 35273 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039126.1 protein_id gnl|my_center|LOCUS_48230 35377 38382 gene locus_tag LOCUS_48240 35377 38382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48240 38397 40793 gene locus_tag LOCUS_48250 38397 40793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48250 40905 41474 gene locus_tag LOCUS_48260 40905 41474 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265652.1 protein_id gnl|my_center|LOCUS_48260 41471 42514 gene locus_tag LOCUS_48270 41471 42514 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389193.1 protein_id gnl|my_center|LOCUS_48270 42590 45625 gene locus_tag LOCUS_48280 42590 45625 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114864.1 protein_id gnl|my_center|LOCUS_48280 45640 46770 gene locus_tag LOCUS_48290 45640 46770 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235632064.1 protein_id gnl|my_center|LOCUS_48290 46767 47336 gene locus_tag LOCUS_48300 46767 47336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 47356 48126 gene locus_tag LOCUS_48310 47356 48126 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_48310 48193 49545 gene locus_tag LOCUS_48320 48193 49545 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871908.1 protein_id gnl|my_center|LOCUS_48320 49577 50569 gene locus_tag LOCUS_48330 49577 50569 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968596.1 protein_id gnl|my_center|LOCUS_48330 51053 53659 gene locus_tag LOCUS_48340 51053 53659 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368537.1 protein_id gnl|my_center|LOCUS_48340 >Feature sequence19 <1 636 gene locus_tag LOCUS_48350 <1 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193473.1:methyl-accepting chemotaxis protein 906 1331 gene locus_tag LOCUS_48360 906 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48360 1405 2160 gene locus_tag LOCUS_48370 gene sufC 1405 2160 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831944.1 protein_id gnl|my_center|LOCUS_48370 2190 3632 gene locus_tag LOCUS_48380 gene sufB 2190 3632 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259322.1 protein_id gnl|my_center|LOCUS_48380 3637 5061 gene locus_tag LOCUS_48390 gene sufD 3637 5061 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173864.1 protein_id gnl|my_center|LOCUS_48390 5166 5717 gene locus_tag LOCUS_48400 gene sufT 5166 5717 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770997.1 protein_id gnl|my_center|LOCUS_48400 6301 5816 gene locus_tag LOCUS_48410 6301 5816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48410 8364 6316 gene locus_tag LOCUS_48420 8364 6316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48420 9161 8364 gene locus_tag LOCUS_48430 9161 8364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48430 9525 9187 gene locus_tag LOCUS_48440 9525 9187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48440 11149 9542 gene locus_tag LOCUS_48450 11149 9542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48450 14564 11853 gene locus_tag LOCUS_48460 14564 11853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48460 15616 14570 gene locus_tag LOCUS_48470 15616 14570 CDS product DmsE family decaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071629.1 protein_id gnl|my_center|LOCUS_48470 15807 18884 gene locus_tag LOCUS_48480 15807 18884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 18905 19639 gene locus_tag LOCUS_48490 18905 19639 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839974.1 protein_id gnl|my_center|LOCUS_48490 19740 20633 gene locus_tag LOCUS_48500 19740 20633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48500 20630 22312 gene locus_tag LOCUS_48510 20630 22312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48510 22361 24292 gene locus_tag LOCUS_48520 22361 24292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 24349 32073 gene locus_tag LOCUS_48530 24349 32073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48530 32077 32598 gene locus_tag LOCUS_48540 32077 32598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48540 32613 33680 gene locus_tag LOCUS_48550 32613 33680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48550 33855 36212 gene locus_tag LOCUS_48560 33855 36212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48560 36199 36843 gene locus_tag LOCUS_48570 36199 36843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48570 36954 37691 gene locus_tag LOCUS_48580 36954 37691 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839974.1 protein_id gnl|my_center|LOCUS_48580 37737 39380 gene locus_tag LOCUS_48590 37737 39380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 39694 39350 gene locus_tag LOCUS_48600 39694 39350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48600 39578 40117 gene locus_tag LOCUS_48610 39578 40117 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141342.1 protein_id gnl|my_center|LOCUS_48610 40733 42601 gene locus_tag LOCUS_48620 gene kefC 40733 42601 CDS product glutathione-regulated potassium-efflux system protein KefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141343.1 protein_id gnl|my_center|LOCUS_48620 42678 43361 gene locus_tag LOCUS_48630 42678 43361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48630 >Feature sequence20 330 1 gene locus_tag LOCUS_48640 330 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48640 1908 379 gene locus_tag LOCUS_48650 1908 379 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037254759.1 protein_id gnl|my_center|LOCUS_48650 5114 1971 gene locus_tag LOCUS_48660 5114 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48660 7420 5144 gene locus_tag LOCUS_48670 7420 5144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48670 8793 7417 gene locus_tag LOCUS_48680 8793 7417 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118376.1 protein_id gnl|my_center|LOCUS_48680 12114 8890 gene locus_tag LOCUS_48690 12114 8890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48690 12371 14305 gene locus_tag LOCUS_48700 12371 14305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 14323 14979 gene locus_tag LOCUS_48710 14323 14979 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230184.1 protein_id gnl|my_center|LOCUS_48710 >Feature sequence21 110 4756 gene locus_tag LOCUS_48720 110 4756 CDS product ESPR-type extended signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536696.1 protein_id gnl|my_center|LOCUS_48720 4769 6169 gene locus_tag LOCUS_48730 gene mshL 4769 6169 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261161.1 protein_id gnl|my_center|LOCUS_48730 6172 7371 gene locus_tag LOCUS_48740 6172 7371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 7411 8166 gene locus_tag LOCUS_48750 7411 8166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48750 8144 9385 gene locus_tag LOCUS_48760 8144 9385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48760 >Feature sequence22 2152 950 gene locus_tag LOCUS_48770 gene hofC 2152 950 CDS product protein transport protein HofC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114107.1 protein_id gnl|my_center|LOCUS_48770 2657 2154 gene locus_tag LOCUS_48780 2657 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48780 3814 2813 gene locus_tag LOCUS_48790 3814 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48790 4611 3811 gene locus_tag LOCUS_48800 4611 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48800 5243 4587 gene locus_tag LOCUS_48810 5243 4587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48810 6307 5261 gene locus_tag LOCUS_48820 6307 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48820 6591 6307 gene locus_tag LOCUS_48830 6591 6307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48830 7397 6588 gene locus_tag LOCUS_48840 7397 6588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48840 >Feature sequence23 426 3257 gene locus_tag LOCUS_48850 426 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48850 >Feature sequence24 227 706 gene locus_tag LOCUS_48860 227 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48860 1322 1948 gene locus_tag LOCUS_48870 1322 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48870 2427 2879 gene locus_tag LOCUS_48880 2427 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48880 3030 3506 gene locus_tag LOCUS_48890 3030 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48890 3685 4077 gene locus_tag LOCUS_48900 3685 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48900