>Feature sequence001 915 64 gene locus_tag LOCUS_00010 915 64 CDS product bacteriorhodopsin-like inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140202.1 protein_id gnl|my_center|LOCUS_00010 2400 1129 gene locus_tag LOCUS_00020 2400 1129 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791093.1 protein_id gnl|my_center|LOCUS_00020 2468 4420 gene locus_tag LOCUS_00030 2468 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4938 4330 gene locus_tag LOCUS_00040 4938 4330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6152 4935 gene locus_tag LOCUS_00050 gene xylR 6152 4935 CDS product DNA-binding transcriptional regulator XylR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494484.1 protein_id gnl|my_center|LOCUS_00050 7230 6193 gene locus_tag LOCUS_00060 gene xylA 7230 6193 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730977.1 protein_id gnl|my_center|LOCUS_00060 7382 8443 gene locus_tag LOCUS_00070 7382 8443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9157 8522 gene locus_tag LOCUS_00080 9157 8522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9328 10476 gene locus_tag LOCUS_00090 gene dgoD 9328 10476 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267367.1 protein_id gnl|my_center|LOCUS_00090 12579 10519 gene locus_tag LOCUS_00100 12579 10519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 13419 12610 gene locus_tag LOCUS_00110 13419 12610 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328799.1 protein_id gnl|my_center|LOCUS_00110 14542 13526 gene locus_tag LOCUS_00120 14542 13526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 14612 16084 gene locus_tag LOCUS_00130 14612 16084 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_00130 16138 16998 gene locus_tag LOCUS_00140 16138 16998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 17139 18959 gene locus_tag LOCUS_00150 17139 18959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 21461 18981 gene locus_tag LOCUS_00160 21461 18981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 22148 21471 gene locus_tag LOCUS_00170 22148 21471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 22742 22263 gene locus_tag LOCUS_00180 22742 22263 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964154.1 protein_id gnl|my_center|LOCUS_00180 27178 22802 gene locus_tag LOCUS_00190 27178 22802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 27828 27388 gene locus_tag LOCUS_00200 27828 27388 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921681.1 protein_id gnl|my_center|LOCUS_00200 27925 31002 gene locus_tag LOCUS_00210 27925 31002 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427762.1 protein_id gnl|my_center|LOCUS_00210 31227 31628 gene locus_tag LOCUS_00220 31227 31628 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328635.1 protein_id gnl|my_center|LOCUS_00220 32266 31925 gene locus_tag LOCUS_00230 32266 31925 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552785.1 protein_id gnl|my_center|LOCUS_00230 34048 32288 gene locus_tag LOCUS_00240 34048 32288 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329990.1 protein_id gnl|my_center|LOCUS_00240 35292 34048 gene locus_tag LOCUS_00250 35292 34048 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122076.1 protein_id gnl|my_center|LOCUS_00250 36613 35312 gene locus_tag LOCUS_00260 36613 35312 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328879.1 protein_id gnl|my_center|LOCUS_00260 37179 36772 gene locus_tag LOCUS_00270 37179 36772 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080552.1 protein_id gnl|my_center|LOCUS_00270 37547 37176 gene locus_tag LOCUS_00280 37547 37176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 37660 38880 gene locus_tag LOCUS_00290 37660 38880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 39313 40374 gene locus_tag LOCUS_00300 39313 40374 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922921.1 protein_id gnl|my_center|LOCUS_00300 40633 40406 gene locus_tag LOCUS_00310 40633 40406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 42457 41042 gene locus_tag LOCUS_00320 42457 41042 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_00320 42873 43349 gene locus_tag LOCUS_00330 42873 43349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 43527 45233 gene locus_tag LOCUS_00340 gene groL 43527 45233 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615436.1 protein_id gnl|my_center|LOCUS_00340 45289 45594 gene locus_tag LOCUS_00350 gene groES 45289 45594 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330007.1 protein_id gnl|my_center|LOCUS_00350 45647 47266 gene locus_tag LOCUS_00360 gene groL 45647 47266 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330146.1 protein_id gnl|my_center|LOCUS_00360 47361 48500 gene locus_tag LOCUS_00370 gene dnaJ 47361 48500 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122091.1 protein_id gnl|my_center|LOCUS_00370 48558 49067 gene locus_tag LOCUS_00380 48558 49067 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337437.1 protein_id gnl|my_center|LOCUS_00380 49074 49361 gene locus_tag LOCUS_00390 49074 49361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 49365 49538 gene locus_tag LOCUS_00400 49365 49538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 49610 50785 gene locus_tag LOCUS_00410 49610 50785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 51168 50788 gene locus_tag LOCUS_00420 51168 50788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 >Feature sequence002 1942 185 gene locus_tag LOCUS_00430 1942 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 2144 1929 gene locus_tag LOCUS_00440 2144 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 3477 2296 gene locus_tag LOCUS_00450 3477 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 4361 3660 gene locus_tag LOCUS_00460 4361 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 5063 4428 gene locus_tag LOCUS_00470 5063 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 6420 5038 gene locus_tag LOCUS_00480 6420 5038 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015670.1 protein_id gnl|my_center|LOCUS_00480 7572 6661 gene locus_tag LOCUS_00490 7572 6661 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 protein_id gnl|my_center|LOCUS_00490 8936 7686 gene locus_tag LOCUS_00500 8936 7686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 9210 8956 gene locus_tag LOCUS_00510 9210 8956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 9811 9260 gene locus_tag LOCUS_00520 9811 9260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 15039 10990 gene locus_tag LOCUS_00530 15039 10990 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256730.1 protein_id gnl|my_center|LOCUS_00530 15743 15153 gene locus_tag LOCUS_00540 15743 15153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 16133 15747 gene locus_tag LOCUS_00550 16133 15747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 19109 16251 gene locus_tag LOCUS_00560 19109 16251 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 protein_id gnl|my_center|LOCUS_00560 24337 19106 gene locus_tag LOCUS_00570 24337 19106 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883981.1 protein_id gnl|my_center|LOCUS_00570 24764 24489 gene locus_tag LOCUS_00580 24764 24489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 25120 26532 gene locus_tag LOCUS_00590 25120 26532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 26620 30744 gene locus_tag LOCUS_00600 26620 30744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 31258 32043 gene locus_tag LOCUS_00610 31258 32043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 31985 32983 gene locus_tag LOCUS_00620 31985 32983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 33474 33268 gene locus_tag LOCUS_00630 33474 33268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 33889 33542 gene locus_tag LOCUS_00640 33889 33542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 34221 33898 gene locus_tag LOCUS_00650 34221 33898 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096894563.1 protein_id gnl|my_center|LOCUS_00650 34404 34646 gene locus_tag LOCUS_00660 34404 34646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 35586 34696 gene locus_tag LOCUS_00670 35586 34696 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024997765.1 protein_id gnl|my_center|LOCUS_00670 36401 35583 gene locus_tag LOCUS_00680 36401 35583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 38163 36478 gene locus_tag LOCUS_00690 38163 36478 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209489743.1 protein_id gnl|my_center|LOCUS_00690 38610 38209 gene locus_tag LOCUS_00700 38610 38209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 38886 39119 gene locus_tag LOCUS_00710 38886 39119 CDS product 2-oxoisovalerate dehydrogenase E1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393634.1 protein_id gnl|my_center|LOCUS_00710 39565 40188 gene locus_tag LOCUS_00720 39565 40188 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973520.1 protein_id gnl|my_center|LOCUS_00720 40303 40998 gene locus_tag LOCUS_00730 40303 40998 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173416.1 protein_id gnl|my_center|LOCUS_00730 40998 41396 gene locus_tag LOCUS_00740 40998 41396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 41407 41838 gene locus_tag LOCUS_00750 41407 41838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 43181 42072 gene locus_tag LOCUS_00760 43181 42072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 >Feature sequence003 1652 792 gene locus_tag LOCUS_00770 1652 792 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724514.1 protein_id gnl|my_center|LOCUS_00770 2809 1649 gene locus_tag LOCUS_00780 2809 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 3267 2836 gene locus_tag LOCUS_00790 3267 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 4792 3410 gene locus_tag LOCUS_00800 4792 3410 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123058.1 protein_id gnl|my_center|LOCUS_00800 6198 4789 gene locus_tag LOCUS_00810 6198 4789 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616161.1 protein_id gnl|my_center|LOCUS_00810 6733 6335 gene locus_tag LOCUS_00820 6733 6335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 6639 8588 gene locus_tag LOCUS_00830 6639 8588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 8825 9943 gene locus_tag LOCUS_00840 8825 9943 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119407.1 protein_id gnl|my_center|LOCUS_00840 9940 10512 gene locus_tag LOCUS_00850 9940 10512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 10509 12803 gene locus_tag LOCUS_00860 10509 12803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 14662 12824 gene locus_tag LOCUS_00870 14662 12824 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119344.1 protein_id gnl|my_center|LOCUS_00870 15694 14714 gene locus_tag LOCUS_00880 gene galE 15694 14714 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255969.1 protein_id gnl|my_center|LOCUS_00880 16737 15691 gene locus_tag LOCUS_00890 gene galT 16737 15691 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191497.1 protein_id gnl|my_center|LOCUS_00890 17901 16777 gene locus_tag LOCUS_00900 17901 16777 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_00900 19520 17922 gene locus_tag LOCUS_00910 19520 17922 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036949.1 protein_id gnl|my_center|LOCUS_00910 20706 19555 gene locus_tag LOCUS_00920 gene galK 20706 19555 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707767.1 protein_id gnl|my_center|LOCUS_00920 21295 20738 gene locus_tag LOCUS_00930 21295 20738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 22670 21438 gene locus_tag LOCUS_00940 22670 21438 CDS product xylose repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244935.1 protein_id gnl|my_center|LOCUS_00940 24113 22812 gene locus_tag LOCUS_00950 24113 22812 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035976.1 protein_id gnl|my_center|LOCUS_00950 24633 24139 gene locus_tag LOCUS_00960 24633 24139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 26018 24765 gene locus_tag LOCUS_00970 26018 24765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 26230 27729 gene locus_tag LOCUS_00980 26230 27729 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141122.1 protein_id gnl|my_center|LOCUS_00980 28818 27742 gene locus_tag LOCUS_00990 28818 27742 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922391.1 protein_id gnl|my_center|LOCUS_00990 32870 28824 gene locus_tag LOCUS_01000 32870 28824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 37370 32988 gene locus_tag LOCUS_01010 37370 32988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 37448 38260 gene locus_tag LOCUS_01020 37448 38260 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334178.1 protein_id gnl|my_center|LOCUS_01020 39059 38289 gene locus_tag LOCUS_01030 gene madM 39059 38289 CDS product malonate transporter subunit MadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389085.1 protein_id gnl|my_center|LOCUS_01030 39461 39087 gene locus_tag LOCUS_01040 gene madL 39461 39087 CDS product malonate transporter subunit MadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112671.1 protein_id gnl|my_center|LOCUS_01040 40262 39546 gene locus_tag LOCUS_01050 40262 39546 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970020.1 protein_id gnl|my_center|LOCUS_01050 40549 40707 gene locus_tag LOCUS_01060 40549 40707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 40796 42166 gene locus_tag LOCUS_01070 40796 42166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 42744 42355 gene locus_tag LOCUS_01080 42744 42355 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142022.1 protein_id gnl|my_center|LOCUS_01080 42977 42741 gene locus_tag LOCUS_01090 42977 42741 CDS product DUF2281 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258326.1 protein_id gnl|my_center|LOCUS_01090 43117 43045 gene locus_tag LOCUS_t00010 43117 43045 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence004 2336 2953 gene locus_tag LOCUS_01100 gene nadD 2336 2953 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228912.1 protein_id gnl|my_center|LOCUS_01100 3538 3284 gene locus_tag LOCUS_01110 3538 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 4268 3549 gene locus_tag LOCUS_01120 4268 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 5042 4290 gene locus_tag LOCUS_01130 5042 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 5252 6085 gene locus_tag LOCUS_01140 5252 6085 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336481.1 protein_id gnl|my_center|LOCUS_01140 6107 7723 gene locus_tag LOCUS_01150 6107 7723 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265670.1 protein_id gnl|my_center|LOCUS_01150 7720 8997 gene locus_tag LOCUS_01160 7720 8997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 8985 11639 gene locus_tag LOCUS_01170 8985 11639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 11636 13483 gene locus_tag LOCUS_01180 11636 13483 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_01180 15419 13506 gene locus_tag LOCUS_01190 15419 13506 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_01190 17340 15457 gene locus_tag LOCUS_01200 17340 15457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 19348 17363 gene locus_tag LOCUS_01210 19348 17363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 20477 19431 gene locus_tag LOCUS_01220 20477 19431 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325468.1 protein_id gnl|my_center|LOCUS_01220 21739 20474 gene locus_tag LOCUS_01230 21739 20474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 22689 21736 gene locus_tag LOCUS_01240 22689 21736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 24872 22740 gene locus_tag LOCUS_01250 24872 22740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 24945 25952 gene locus_tag LOCUS_01260 24945 25952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 27987 25957 gene locus_tag LOCUS_01270 27987 25957 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066516.1 protein_id gnl|my_center|LOCUS_01270 29335 28157 gene locus_tag LOCUS_01280 29335 28157 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615817.1 protein_id gnl|my_center|LOCUS_01280 29577 30746 gene locus_tag LOCUS_01290 29577 30746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 31909 30767 gene locus_tag LOCUS_01300 31909 30767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 32398 35187 gene locus_tag LOCUS_01310 32398 35187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 36466 35201 gene locus_tag LOCUS_01320 36466 35201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 37436 36549 gene locus_tag LOCUS_01330 37436 36549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 39191 37455 gene locus_tag LOCUS_01340 39191 37455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 39400 40515 gene locus_tag LOCUS_01350 39400 40515 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_01350 42117 40519 gene locus_tag LOCUS_01360 42117 40519 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_01360 >Feature sequence005 406 1296 gene locus_tag LOCUS_01370 406 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 1362 1610 gene locus_tag LOCUS_01380 1362 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 2118 1573 gene locus_tag LOCUS_01390 2118 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 3313 2108 gene locus_tag LOCUS_01400 3313 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 3549 3292 gene locus_tag LOCUS_01410 3549 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 3842 3549 gene locus_tag LOCUS_01420 3842 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 4317 3832 gene locus_tag LOCUS_01430 4317 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 7494 4321 gene locus_tag LOCUS_01440 7494 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 8241 7765 gene locus_tag LOCUS_01450 8241 7765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 9134 8241 gene locus_tag LOCUS_01460 9134 8241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 10604 9138 gene locus_tag LOCUS_01470 10604 9138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 10894 10547 gene locus_tag LOCUS_01480 10894 10547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 11292 10939 gene locus_tag LOCUS_01490 11292 10939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 11683 11294 gene locus_tag LOCUS_01500 11683 11294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 12109 11702 gene locus_tag LOCUS_01510 12109 11702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 12544 12119 gene locus_tag LOCUS_01520 12544 12119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 13089 12547 gene locus_tag LOCUS_01530 13089 12547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 13409 13086 gene locus_tag LOCUS_01540 13409 13086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 13979 13413 gene locus_tag LOCUS_01550 13979 13413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 15480 14257 gene locus_tag LOCUS_01560 15480 14257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 15865 15596 gene locus_tag LOCUS_01570 15865 15596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 16176 15874 gene locus_tag LOCUS_01580 16176 15874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 16970 16173 gene locus_tag LOCUS_01590 16970 16173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 17839 16967 gene locus_tag LOCUS_01600 17839 16967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 18213 17836 gene locus_tag LOCUS_01610 18213 17836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 18464 18210 gene locus_tag LOCUS_01620 18464 18210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 18712 18461 gene locus_tag LOCUS_01630 18712 18461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 19086 18715 gene locus_tag LOCUS_01640 19086 18715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 20096 19083 gene locus_tag LOCUS_01650 20096 19083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 21712 20093 gene locus_tag LOCUS_01660 21712 20093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 23392 21749 gene locus_tag LOCUS_01670 23392 21749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 23804 23355 gene locus_tag LOCUS_01680 23804 23355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 24202 23945 gene locus_tag LOCUS_01690 24202 23945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 24594 24277 gene locus_tag LOCUS_01700 24594 24277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 25601 24591 gene locus_tag LOCUS_01710 25601 24591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 25582 25779 gene locus_tag LOCUS_01720 25582 25779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 27134 26172 gene locus_tag LOCUS_01730 27134 26172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 27349 27131 gene locus_tag LOCUS_01740 27349 27131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 27690 27346 gene locus_tag LOCUS_01750 27690 27346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 28089 27700 gene locus_tag LOCUS_01760 28089 27700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 28552 28082 gene locus_tag LOCUS_01770 28552 28082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 29409 28549 gene locus_tag LOCUS_01780 29409 28549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 29716 29399 gene locus_tag LOCUS_01790 29716 29399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 29952 29713 gene locus_tag LOCUS_01800 29952 29713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 31595 29949 gene locus_tag LOCUS_01810 31595 29949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268008.1 protein_id gnl|my_center|LOCUS_01810 32008 31598 gene locus_tag LOCUS_01820 32008 31598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 32807 31998 gene locus_tag LOCUS_01830 32807 31998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 33220 33014 gene locus_tag LOCUS_01840 33220 33014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 33662 33919 gene locus_tag LOCUS_01850 33662 33919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 34118 33927 gene locus_tag LOCUS_01860 34118 33927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 34381 34115 gene locus_tag LOCUS_01870 34381 34115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 34525 34450 gene locus_tag LOCUS_t00020 34525 34450 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 37307 34623 gene locus_tag LOCUS_01880 37307 34623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 37571 38017 gene locus_tag LOCUS_01890 37571 38017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 38134 39693 gene locus_tag LOCUS_01900 38134 39693 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334293.1 protein_id gnl|my_center|LOCUS_01900 >Feature sequence006 2116 2532 gene locus_tag LOCUS_01910 2116 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 2602 2877 gene locus_tag LOCUS_01920 2602 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 3010 9129 gene locus_tag LOCUS_01930 3010 9129 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122194.1 protein_id gnl|my_center|LOCUS_01930 9550 9972 gene locus_tag LOCUS_01940 9550 9972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 9972 11645 gene locus_tag LOCUS_01950 9972 11645 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090268.1 protein_id gnl|my_center|LOCUS_01950 12507 11737 gene locus_tag LOCUS_01960 12507 11737 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275314.1 protein_id gnl|my_center|LOCUS_01960 14195 12504 gene locus_tag LOCUS_01970 14195 12504 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121575.1 protein_id gnl|my_center|LOCUS_01970 16640 14358 gene locus_tag LOCUS_01980 16640 14358 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922898.1 protein_id gnl|my_center|LOCUS_01980 17707 17003 gene locus_tag LOCUS_01990 17707 17003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 21729 17863 gene locus_tag LOCUS_02000 21729 17863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 22996 21722 gene locus_tag LOCUS_02010 22996 21722 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327912.1 protein_id gnl|my_center|LOCUS_02010 25355 23007 gene locus_tag LOCUS_02020 25355 23007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 26338 25352 gene locus_tag LOCUS_02030 26338 25352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 26850 26338 gene locus_tag LOCUS_02040 26850 26338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 27312 28082 gene locus_tag LOCUS_02050 27312 28082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 28201 28587 gene locus_tag LOCUS_02060 28201 28587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 29310 28702 gene locus_tag LOCUS_02070 29310 28702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 30743 29379 gene locus_tag LOCUS_02080 30743 29379 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_02080 33136 30782 gene locus_tag LOCUS_02090 33136 30782 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055503.1 protein_id gnl|my_center|LOCUS_02090 36657 33367 gene locus_tag LOCUS_02100 36657 33367 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122437.1 protein_id gnl|my_center|LOCUS_02100 38817 36820 gene locus_tag LOCUS_02110 38817 36820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 >Feature sequence007 1449 151 gene locus_tag LOCUS_02120 1449 151 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120135.1 protein_id gnl|my_center|LOCUS_02120 4081 1499 gene locus_tag LOCUS_02130 4081 1499 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120136.1 protein_id gnl|my_center|LOCUS_02130 4562 4338 gene locus_tag LOCUS_02140 4562 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 5789 4728 gene locus_tag LOCUS_02150 5789 4728 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061017.1 protein_id gnl|my_center|LOCUS_02150 10600 5858 gene locus_tag LOCUS_02160 10600 5858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 10785 11315 gene locus_tag LOCUS_02170 10785 11315 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331069.1 protein_id gnl|my_center|LOCUS_02170 11631 11332 gene locus_tag LOCUS_02180 11631 11332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 11843 11631 gene locus_tag LOCUS_02190 11843 11631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 12085 13059 gene locus_tag LOCUS_02200 12085 13059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 13079 13714 gene locus_tag LOCUS_02210 13079 13714 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029548.1 protein_id gnl|my_center|LOCUS_02210 13728 14396 gene locus_tag LOCUS_02220 13728 14396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 14436 15716 gene locus_tag LOCUS_02230 14436 15716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 15656 15937 gene locus_tag LOCUS_02240 15656 15937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 16940 15966 gene locus_tag LOCUS_02250 16940 15966 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263043.1 protein_id gnl|my_center|LOCUS_02250 17031 18131 gene locus_tag LOCUS_02260 17031 18131 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533028.1 protein_id gnl|my_center|LOCUS_02260 18273 19964 gene locus_tag LOCUS_02270 18273 19964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 20078 20791 gene locus_tag LOCUS_02280 20078 20791 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393101.1 protein_id gnl|my_center|LOCUS_02280 20893 21831 gene locus_tag LOCUS_02290 20893 21831 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119992.1 protein_id gnl|my_center|LOCUS_02290 21835 22479 gene locus_tag LOCUS_02300 21835 22479 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_02300 22599 24479 gene locus_tag LOCUS_02310 22599 24479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 26580 24670 gene locus_tag LOCUS_02320 26580 24670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 27730 26681 gene locus_tag LOCUS_02330 27730 26681 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_02330 27802 29319 gene locus_tag LOCUS_02340 27802 29319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 31603 29579 gene locus_tag LOCUS_02350 31603 29579 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330748.1 protein_id gnl|my_center|LOCUS_02350 34237 31688 gene locus_tag LOCUS_02360 34237 31688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099150691.1 protein_id gnl|my_center|LOCUS_02360 34463 37087 gene locus_tag LOCUS_02370 34463 37087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 37528 37100 gene locus_tag LOCUS_02380 37528 37100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 >Feature sequence008 119 1294 gene locus_tag LOCUS_02390 119 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 1677 1297 gene locus_tag LOCUS_02400 1677 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 1759 2823 gene locus_tag LOCUS_02410 1759 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 2862 5276 gene locus_tag LOCUS_02420 2862 5276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 6803 5733 gene locus_tag LOCUS_02430 gene purM 6803 5733 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922559.1 protein_id gnl|my_center|LOCUS_02430 8274 6874 gene locus_tag LOCUS_02440 8274 6874 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_02440 8416 10638 gene locus_tag LOCUS_02450 gene glgX 8416 10638 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122228.1 protein_id gnl|my_center|LOCUS_02450 10683 11168 gene locus_tag LOCUS_02460 10683 11168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 11253 11774 gene locus_tag LOCUS_02470 11253 11774 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333887.1 protein_id gnl|my_center|LOCUS_02470 12238 11813 gene locus_tag LOCUS_02480 12238 11813 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633600.1 protein_id gnl|my_center|LOCUS_02480 12501 12235 gene locus_tag LOCUS_02490 12501 12235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 26210 12624 gene locus_tag LOCUS_02500 26210 12624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 27262 26501 gene locus_tag LOCUS_02510 27262 26501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 28486 27389 gene locus_tag LOCUS_02520 28486 27389 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_02520 29734 28646 gene locus_tag LOCUS_02530 gene comC 29734 28646 CDS product L-sulfolactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870943.1 protein_id gnl|my_center|LOCUS_02530 30722 29739 gene locus_tag LOCUS_02540 30722 29739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 31589 30984 gene locus_tag LOCUS_02550 31589 30984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 31768 31586 gene locus_tag LOCUS_02560 31768 31586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 34509 31918 gene locus_tag LOCUS_02570 gene hrpB 34509 31918 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942482.1 protein_id gnl|my_center|LOCUS_02570 34720 35853 gene locus_tag LOCUS_02580 gene solA 34720 35853 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_02580 >Feature sequence009 410 925 gene locus_tag LOCUS_02590 410 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 1381 911 gene locus_tag LOCUS_02600 1381 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 1523 2614 gene locus_tag LOCUS_02610 gene ychF 1523 2614 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037200879.1 protein_id gnl|my_center|LOCUS_02610 6192 2902 gene locus_tag LOCUS_02620 6192 2902 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118092.1 protein_id gnl|my_center|LOCUS_02620 7606 6203 gene locus_tag LOCUS_02630 7606 6203 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120479.1 protein_id gnl|my_center|LOCUS_02630 8307 7603 gene locus_tag LOCUS_02640 8307 7603 CDS product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051073379.1 protein_id gnl|my_center|LOCUS_02640 9732 8440 gene locus_tag LOCUS_02650 9732 8440 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_02650 11466 9973 gene locus_tag LOCUS_02660 11466 9973 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118024.1 protein_id gnl|my_center|LOCUS_02660 12610 11555 gene locus_tag LOCUS_02670 12610 11555 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142872.1 protein_id gnl|my_center|LOCUS_02670 13032 12610 gene locus_tag LOCUS_02680 13032 12610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 13760 13029 gene locus_tag LOCUS_02690 13760 13029 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325025.1 protein_id gnl|my_center|LOCUS_02690 15007 13760 gene locus_tag LOCUS_02700 15007 13760 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631406.1 protein_id gnl|my_center|LOCUS_02700 15339 15007 gene locus_tag LOCUS_02710 15339 15007 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326964.1 protein_id gnl|my_center|LOCUS_02710 15729 16076 gene locus_tag LOCUS_02720 15729 16076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 17999 16929 gene locus_tag LOCUS_02730 17999 16929 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_02730 20299 17996 gene locus_tag LOCUS_02740 20299 17996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 20676 21212 gene locus_tag LOCUS_02750 20676 21212 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922427.1 protein_id gnl|my_center|LOCUS_02750 21229 22245 gene locus_tag LOCUS_02760 21229 22245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 22292 23584 gene locus_tag LOCUS_02770 22292 23584 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120135.1 protein_id gnl|my_center|LOCUS_02770 23956 23600 gene locus_tag LOCUS_02780 23956 23600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 24165 23953 gene locus_tag LOCUS_02790 24165 23953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 24297 26852 gene locus_tag LOCUS_02800 24297 26852 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120136.1 protein_id gnl|my_center|LOCUS_02800 26849 27631 gene locus_tag LOCUS_02810 26849 27631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 27740 28015 gene locus_tag LOCUS_02820 27740 28015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 29204 28032 gene locus_tag LOCUS_02830 29204 28032 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_02830 29833 29201 gene locus_tag LOCUS_02840 29833 29201 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922130.1 protein_id gnl|my_center|LOCUS_02840 30893 29844 gene locus_tag LOCUS_02850 gene queA 30893 29844 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120320.1 protein_id gnl|my_center|LOCUS_02850 30932 31834 gene locus_tag LOCUS_02860 gene rsmH 30932 31834 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121784.1 protein_id gnl|my_center|LOCUS_02860 31912 32454 gene locus_tag LOCUS_02870 31912 32454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 33750 32824 gene locus_tag LOCUS_02880 33750 32824 CDS product DUF1571 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122738.1 protein_id gnl|my_center|LOCUS_02880 33967 34728 gene locus_tag LOCUS_02890 33967 34728 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_02890 >Feature sequence010 24 1748 gene locus_tag LOCUS_02900 24 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921352.1 protein_id gnl|my_center|LOCUS_02900 1949 3742 gene locus_tag LOCUS_02910 1949 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 4864 3791 gene locus_tag LOCUS_02920 4864 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 5035 5709 gene locus_tag LOCUS_02930 5035 5709 CDS product sulfotransferase family 2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339247.1 protein_id gnl|my_center|LOCUS_02930 5706 6680 gene locus_tag LOCUS_02940 5706 6680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 6699 8387 gene locus_tag LOCUS_02950 6699 8387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 8384 9229 gene locus_tag LOCUS_02960 8384 9229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 9299 9961 gene locus_tag LOCUS_02970 9299 9961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 10863 9979 gene locus_tag LOCUS_02980 10863 9979 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122067.1 protein_id gnl|my_center|LOCUS_02980 11899 10820 gene locus_tag LOCUS_02990 11899 10820 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615432.1 protein_id gnl|my_center|LOCUS_02990 12981 11899 gene locus_tag LOCUS_03000 12981 11899 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121410.1 protein_id gnl|my_center|LOCUS_03000 14907 13039 gene locus_tag LOCUS_03010 14907 13039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 15789 14935 gene locus_tag LOCUS_03020 15789 14935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 16651 15833 gene locus_tag LOCUS_03030 16651 15833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 18279 16648 gene locus_tag LOCUS_03040 18279 16648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 18936 19733 gene locus_tag LOCUS_03050 18936 19733 CDS product sulfotransferase family 2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790044.1 protein_id gnl|my_center|LOCUS_03050 20662 19652 gene locus_tag LOCUS_03060 20662 19652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 21428 20682 gene locus_tag LOCUS_03070 21428 20682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 21667 22632 gene locus_tag LOCUS_03080 21667 22632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 23693 22740 gene locus_tag LOCUS_03090 23693 22740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 24921 23725 gene locus_tag LOCUS_03100 24921 23725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 26117 24924 gene locus_tag LOCUS_03110 26117 24924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 27211 26144 gene locus_tag LOCUS_03120 gene rfbB 27211 26144 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035864.1 protein_id gnl|my_center|LOCUS_03120 28104 27193 gene locus_tag LOCUS_03130 gene rfbD 28104 27193 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943001.1 protein_id gnl|my_center|LOCUS_03130 29002 28004 gene locus_tag LOCUS_03140 gene rfbA 29002 28004 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077983464.1 protein_id gnl|my_center|LOCUS_03140 29756 29025 gene locus_tag LOCUS_03150 29756 29025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 29653 30603 gene locus_tag LOCUS_03160 29653 30603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 30704 31897 gene locus_tag LOCUS_03170 gene sucC 30704 31897 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327386.1 protein_id gnl|my_center|LOCUS_03170 31953 32825 gene locus_tag LOCUS_03180 gene sucD 31953 32825 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327387.1 protein_id gnl|my_center|LOCUS_03180 32935 33669 gene locus_tag LOCUS_03190 32935 33669 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150234528.1 protein_id gnl|my_center|LOCUS_03190 >Feature sequence011 <1 1987 gene locus_tag LOCUS_03200 <1 1987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008664503.1:DUF1592 domain-containing protein 1984 3318 gene locus_tag LOCUS_03210 1984 3318 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121153.1 protein_id gnl|my_center|LOCUS_03210 10214 3327 gene locus_tag LOCUS_03220 10214 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 10472 12040 gene locus_tag LOCUS_03230 10472 12040 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922192.1 protein_id gnl|my_center|LOCUS_03230 14042 12051 gene locus_tag LOCUS_03240 14042 12051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121814.1 protein_id gnl|my_center|LOCUS_03240 15317 14193 gene locus_tag LOCUS_03250 15317 14193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 16548 15331 gene locus_tag LOCUS_03260 16548 15331 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326489.1 protein_id gnl|my_center|LOCUS_03260 16571 16801 gene locus_tag LOCUS_03270 16571 16801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 18238 16736 gene locus_tag LOCUS_03280 gene pyk 18238 16736 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943944.1 protein_id gnl|my_center|LOCUS_03280 18387 19211 gene locus_tag LOCUS_03290 18387 19211 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113772.1 protein_id gnl|my_center|LOCUS_03290 21042 19195 gene locus_tag LOCUS_03300 21042 19195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 22920 21067 gene locus_tag LOCUS_03310 22920 21067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 23869 22934 gene locus_tag LOCUS_03320 23869 22934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 24571 24146 gene locus_tag LOCUS_03330 24571 24146 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911311.1 protein_id gnl|my_center|LOCUS_03330 24803 24552 gene locus_tag LOCUS_03340 24803 24552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 25759 25034 gene locus_tag LOCUS_03350 25759 25034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 27306 25756 gene locus_tag LOCUS_03360 27306 25756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 28436 27324 gene locus_tag LOCUS_03370 28436 27324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 28721 31798 gene locus_tag LOCUS_03380 28721 31798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 32098 31865 gene locus_tag LOCUS_03390 32098 31865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 32337 32095 gene locus_tag LOCUS_03400 32337 32095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 32528 32707 gene locus_tag LOCUS_03410 32528 32707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 32851 33090 gene locus_tag LOCUS_03420 32851 33090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 33077 33418 gene locus_tag LOCUS_03430 33077 33418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 >Feature sequence012 602 216 gene locus_tag LOCUS_03440 602 216 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 protein_id gnl|my_center|LOCUS_03440 838 602 gene locus_tag LOCUS_03450 838 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 878 1060 gene locus_tag LOCUS_03460 878 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 1394 1131 gene locus_tag LOCUS_03470 1394 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_03470 1633 1391 gene locus_tag LOCUS_03480 1633 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 1885 3039 gene locus_tag LOCUS_03490 1885 3039 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118841.1 protein_id gnl|my_center|LOCUS_03490 3138 3584 gene locus_tag LOCUS_03500 3138 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 3494 3895 gene locus_tag LOCUS_03510 3494 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 4163 7576 gene locus_tag LOCUS_03520 4163 7576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 7606 8712 gene locus_tag LOCUS_03530 7606 8712 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921829.1 protein_id gnl|my_center|LOCUS_03530 8757 9260 gene locus_tag LOCUS_03540 8757 9260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 9508 9155 gene locus_tag LOCUS_03550 9508 9155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 9762 12725 gene locus_tag LOCUS_03560 9762 12725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 12748 14718 gene locus_tag LOCUS_03570 12748 14718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 14756 18004 gene locus_tag LOCUS_03580 14756 18004 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122437.1 protein_id gnl|my_center|LOCUS_03580 18043 21609 gene locus_tag LOCUS_03590 18043 21609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 21826 21611 gene locus_tag LOCUS_03600 21826 21611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 22018 21827 gene locus_tag LOCUS_03610 22018 21827 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405863.1 protein_id gnl|my_center|LOCUS_03610 22243 22569 gene locus_tag LOCUS_03620 22243 22569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 22557 23039 gene locus_tag LOCUS_03630 22557 23039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 23289 24287 gene locus_tag LOCUS_03640 23289 24287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 24390 25163 gene locus_tag LOCUS_03650 24390 25163 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122630.1 protein_id gnl|my_center|LOCUS_03650 25187 26404 gene locus_tag LOCUS_03660 25187 26404 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923038.1 protein_id gnl|my_center|LOCUS_03660 26607 27767 gene locus_tag LOCUS_03670 26607 27767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 28074 27892 gene locus_tag LOCUS_03680 28074 27892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 28030 28485 gene locus_tag LOCUS_03690 28030 28485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 28482 29438 gene locus_tag LOCUS_03700 28482 29438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 29435 30439 gene locus_tag LOCUS_03710 29435 30439 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122477.1 protein_id gnl|my_center|LOCUS_03710 30436 31239 gene locus_tag LOCUS_03720 gene truA 30436 31239 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118979.1 protein_id gnl|my_center|LOCUS_03720 31206 32051 gene locus_tag LOCUS_03730 31206 32051 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338658.1 protein_id gnl|my_center|LOCUS_03730 >Feature sequence013 783 1022 gene locus_tag LOCUS_03740 783 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 1019 1225 gene locus_tag LOCUS_03750 1019 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 5038 1265 gene locus_tag LOCUS_03760 5038 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 5161 5361 gene locus_tag LOCUS_03770 5161 5361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 5389 5649 gene locus_tag LOCUS_03780 5389 5649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_03780 6047 5742 gene locus_tag LOCUS_03790 6047 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 6185 6451 gene locus_tag LOCUS_03800 6185 6451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 6640 6870 gene locus_tag LOCUS_03810 6640 6870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 6955 7212 gene locus_tag LOCUS_03820 6955 7212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 7206 7478 gene locus_tag LOCUS_03830 7206 7478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 7640 9496 gene locus_tag LOCUS_03840 7640 9496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 9439 9708 gene locus_tag LOCUS_03850 9439 9708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 10323 9955 gene locus_tag LOCUS_03860 10323 9955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 10712 10870 gene locus_tag LOCUS_03870 10712 10870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 10935 11885 gene locus_tag LOCUS_03880 10935 11885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 11929 12201 gene locus_tag LOCUS_03890 11929 12201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 12198 12833 gene locus_tag LOCUS_03900 12198 12833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 13176 12943 gene locus_tag LOCUS_03910 13176 12943 CDS product DUF1653 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229500.1 protein_id gnl|my_center|LOCUS_03910 13604 13197 gene locus_tag LOCUS_03920 13604 13197 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123177.1 protein_id gnl|my_center|LOCUS_03920 13822 13601 gene locus_tag LOCUS_03930 13822 13601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 13966 14595 gene locus_tag LOCUS_03940 13966 14595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 14639 15244 gene locus_tag LOCUS_03950 14639 15244 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123320.1 protein_id gnl|my_center|LOCUS_03950 15284 16036 gene locus_tag LOCUS_03960 15284 16036 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089860.1 protein_id gnl|my_center|LOCUS_03960 16037 16762 gene locus_tag LOCUS_03970 16037 16762 CDS product DUF2293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921987.1 protein_id gnl|my_center|LOCUS_03970 17342 16833 gene locus_tag LOCUS_03980 17342 16833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 18964 17537 gene locus_tag LOCUS_03990 18964 17537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 20196 18961 gene locus_tag LOCUS_04000 20196 18961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 21791 20193 gene locus_tag LOCUS_04010 21791 20193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 22693 21788 gene locus_tag LOCUS_04020 22693 21788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 23123 22734 gene locus_tag LOCUS_04030 23123 22734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 24397 23582 gene locus_tag LOCUS_04040 24397 23582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 25007 26413 gene locus_tag LOCUS_04050 25007 26413 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030832.1 protein_id gnl|my_center|LOCUS_04050 26457 26798 gene locus_tag LOCUS_04060 26457 26798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 27029 27463 gene locus_tag LOCUS_04070 27029 27463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 27552 27728 gene locus_tag LOCUS_04080 27552 27728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 28284 27820 gene locus_tag LOCUS_04090 28284 27820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 28743 28375 gene locus_tag LOCUS_04100 28743 28375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 28934 30367 gene locus_tag LOCUS_04110 28934 30367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 >Feature sequence014 563 87 gene locus_tag LOCUS_04120 563 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 1192 662 gene locus_tag LOCUS_04130 1192 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 1960 1271 gene locus_tag LOCUS_04140 1960 1271 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022003.1 protein_id gnl|my_center|LOCUS_04140 3120 1957 gene locus_tag LOCUS_04150 3120 1957 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087741.1 protein_id gnl|my_center|LOCUS_04150 3615 3301 gene locus_tag LOCUS_04160 3615 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 4225 3845 gene locus_tag LOCUS_04170 4225 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 4635 4321 gene locus_tag LOCUS_04180 4635 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 5240 4809 gene locus_tag LOCUS_04190 5240 4809 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933387.1 protein_id gnl|my_center|LOCUS_04190 5503 5970 gene locus_tag LOCUS_04200 5503 5970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 6604 6206 gene locus_tag LOCUS_04210 6604 6206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 7308 6718 gene locus_tag LOCUS_04220 7308 6718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 7518 7694 gene locus_tag LOCUS_04230 7518 7694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 8210 7773 gene locus_tag LOCUS_04240 8210 7773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 9207 8347 gene locus_tag LOCUS_04250 9207 8347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 9433 9612 gene locus_tag LOCUS_04260 9433 9612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 10409 9609 gene locus_tag LOCUS_04270 10409 9609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 10714 10409 gene locus_tag LOCUS_04280 10714 10409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 11186 10725 gene locus_tag LOCUS_04290 11186 10725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 12435 11254 gene locus_tag LOCUS_04300 12435 11254 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495330.1 protein_id gnl|my_center|LOCUS_04300 13541 12435 gene locus_tag LOCUS_04310 13541 12435 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809085.1 protein_id gnl|my_center|LOCUS_04310 14489 13614 gene locus_tag LOCUS_04320 14489 13614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 14784 14533 gene locus_tag LOCUS_04330 14784 14533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 15175 14849 gene locus_tag LOCUS_04340 15175 14849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 15615 15175 gene locus_tag LOCUS_04350 15615 15175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 15989 15747 gene locus_tag LOCUS_04360 15989 15747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 16279 15986 gene locus_tag LOCUS_04370 16279 15986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 16927 16316 gene locus_tag LOCUS_04380 16927 16316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 17184 17642 gene locus_tag LOCUS_04390 17184 17642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 18345 18653 gene locus_tag LOCUS_04400 18345 18653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 18735 19034 gene locus_tag LOCUS_04410 18735 19034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 19145 19573 gene locus_tag LOCUS_04420 19145 19573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 20819 19509 gene locus_tag LOCUS_04430 20819 19509 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921303.1 protein_id gnl|my_center|LOCUS_04430 21241 21837 gene locus_tag LOCUS_04440 21241 21837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 21896 22705 gene locus_tag LOCUS_04450 21896 22705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 22928 23776 gene locus_tag LOCUS_04460 22928 23776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 24247 23786 gene locus_tag LOCUS_04470 24247 23786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 24359 24775 gene locus_tag LOCUS_04480 24359 24775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 24772 25428 gene locus_tag LOCUS_04490 24772 25428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 27119 25425 gene locus_tag LOCUS_04500 27119 25425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 27696 27103 gene locus_tag LOCUS_04510 27696 27103 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329838.1 protein_id gnl|my_center|LOCUS_04510 27880 28593 gene locus_tag LOCUS_04520 27880 28593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 28817 30001 gene locus_tag LOCUS_04530 28817 30001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 >Feature sequence015 838 146 gene locus_tag LOCUS_04540 838 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 1182 835 gene locus_tag LOCUS_04550 1182 835 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121435.1 protein_id gnl|my_center|LOCUS_04550 2467 1283 gene locus_tag LOCUS_04560 2467 1283 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_04560 4487 2613 gene locus_tag LOCUS_04570 4487 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 4876 5946 gene locus_tag LOCUS_04580 4876 5946 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_04580 5988 6401 gene locus_tag LOCUS_04590 5988 6401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 6401 8692 gene locus_tag LOCUS_04600 6401 8692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 8689 9306 gene locus_tag LOCUS_04610 8689 9306 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230184.1 protein_id gnl|my_center|LOCUS_04610 9368 12709 gene locus_tag LOCUS_04620 9368 12709 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615995.1 protein_id gnl|my_center|LOCUS_04620 12742 13035 gene locus_tag LOCUS_04630 12742 13035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 14356 13181 gene locus_tag LOCUS_04640 14356 13181 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035313.1 protein_id gnl|my_center|LOCUS_04640 14557 15849 gene locus_tag LOCUS_04650 14557 15849 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123393.1 protein_id gnl|my_center|LOCUS_04650 16259 17437 gene locus_tag LOCUS_04660 gene metK 16259 17437 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331112.1 protein_id gnl|my_center|LOCUS_04660 17444 18232 gene locus_tag LOCUS_04670 17444 18232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 18358 19788 gene locus_tag LOCUS_04680 18358 19788 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_04680 21200 20244 gene locus_tag LOCUS_04690 gene xerD 21200 20244 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921953.1 protein_id gnl|my_center|LOCUS_04690 24995 21378 gene locus_tag LOCUS_04700 gene metH 24995 21378 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922281.1 protein_id gnl|my_center|LOCUS_04700 25244 25540 gene locus_tag LOCUS_04710 25244 25540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 25537 26109 gene locus_tag LOCUS_04720 25537 26109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 26106 26765 gene locus_tag LOCUS_04730 26106 26765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 28054 26870 gene locus_tag LOCUS_04740 28054 26870 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122080.1 protein_id gnl|my_center|LOCUS_04740 28777 28076 gene locus_tag LOCUS_04750 28777 28076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 >Feature sequence016 1212 658 gene locus_tag LOCUS_04760 1212 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 1288 2859 gene locus_tag LOCUS_04770 1288 2859 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810537.1 protein_id gnl|my_center|LOCUS_04770 2885 4060 gene locus_tag LOCUS_04780 2885 4060 CDS product HRDC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665238.1 protein_id gnl|my_center|LOCUS_04780 4213 8013 gene locus_tag LOCUS_04790 4213 8013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 8149 8436 gene locus_tag LOCUS_04800 8149 8436 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896092.1 protein_id gnl|my_center|LOCUS_04800 8433 8627 gene locus_tag LOCUS_04810 8433 8627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 8940 9200 gene locus_tag LOCUS_04820 8940 9200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 9476 9240 gene locus_tag LOCUS_04830 9476 9240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 9837 10088 gene locus_tag LOCUS_04840 9837 10088 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_04840 10085 10453 gene locus_tag LOCUS_04850 10085 10453 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200901620.1 protein_id gnl|my_center|LOCUS_04850 10704 10985 gene locus_tag LOCUS_04860 10704 10985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 10927 11271 gene locus_tag LOCUS_04870 10927 11271 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727964.1 protein_id gnl|my_center|LOCUS_04870 11265 11645 gene locus_tag LOCUS_04880 11265 11645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04880 11596 12105 gene locus_tag LOCUS_04890 11596 12105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04890 12124 12894 gene locus_tag LOCUS_04900 12124 12894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 13248 13165 gene locus_tag LOCUS_t00030 13248 13165 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 13392 14555 gene locus_tag LOCUS_04910 13392 14555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 14597 15961 gene locus_tag LOCUS_04920 14597 15961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122399.1 protein_id gnl|my_center|LOCUS_04920 15958 17205 gene locus_tag LOCUS_04930 15958 17205 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122407.1 protein_id gnl|my_center|LOCUS_04930 17338 17658 gene locus_tag LOCUS_04940 17338 17658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 21657 17671 gene locus_tag LOCUS_04950 21657 17671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 23088 21883 gene locus_tag LOCUS_04960 23088 21883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 23312 24655 gene locus_tag LOCUS_04970 23312 24655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 24667 25596 gene locus_tag LOCUS_04980 24667 25596 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335559.1 protein_id gnl|my_center|LOCUS_04980 25679 26188 gene locus_tag LOCUS_04990 25679 26188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 >Feature sequence017 356 1033 gene locus_tag LOCUS_05000 356 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 1774 1058 gene locus_tag LOCUS_05010 1774 1058 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839105.1 protein_id gnl|my_center|LOCUS_05010 3091 1880 gene locus_tag LOCUS_05020 3091 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 3906 3088 gene locus_tag LOCUS_05030 3906 3088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 4395 3994 gene locus_tag LOCUS_05040 4395 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 7557 4396 gene locus_tag LOCUS_05050 7557 4396 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115707.1 protein_id gnl|my_center|LOCUS_05050 9210 7582 gene locus_tag LOCUS_05060 9210 7582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 9907 9371 gene locus_tag LOCUS_05070 9907 9371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 10938 10090 gene locus_tag LOCUS_05080 10938 10090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 11510 10941 gene locus_tag LOCUS_05090 11510 10941 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329277.1 protein_id gnl|my_center|LOCUS_05090 12622 13149 gene locus_tag LOCUS_05100 12622 13149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 13511 14200 gene locus_tag LOCUS_05110 13511 14200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 14239 14571 gene locus_tag LOCUS_05120 14239 14571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 14600 16837 gene locus_tag LOCUS_05130 14600 16837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 16850 20200 gene locus_tag LOCUS_05140 16850 20200 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144156.1 protein_id gnl|my_center|LOCUS_05140 21377 22741 gene locus_tag LOCUS_05150 21377 22741 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113317.1 protein_id gnl|my_center|LOCUS_05150 23250 25148 gene locus_tag LOCUS_05160 23250 25148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 25148 25708 gene locus_tag LOCUS_05170 25148 25708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 26024 26353 gene locus_tag LOCUS_05180 26024 26353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 26399 26650 gene locus_tag LOCUS_05190 26399 26650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 26760 27506 gene locus_tag LOCUS_05200 26760 27506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 >Feature sequence018 <1 509 gene locus_tag LOCUS_05210 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005693849.1:nucleotidyltransferase domain-containing protein 491 901 gene locus_tag LOCUS_05220 491 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 1189 965 gene locus_tag LOCUS_05230 1189 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 1430 1798 gene locus_tag LOCUS_05240 1430 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 1808 2350 gene locus_tag LOCUS_05250 1808 2350 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970715.1 protein_id gnl|my_center|LOCUS_05250 2774 2532 gene locus_tag LOCUS_05260 2774 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 4925 2946 gene locus_tag LOCUS_05270 4925 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 5288 6022 gene locus_tag LOCUS_05280 gene vioB 5288 6022 CDS product dTDP-4-amino-4,6-dideoxy-D-glucose acetyltransferase VioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382700.1 protein_id gnl|my_center|LOCUS_05280 6271 7923 gene locus_tag LOCUS_05290 6271 7923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 7908 9329 gene locus_tag LOCUS_05300 7908 9329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 9587 10429 gene locus_tag LOCUS_05310 9587 10429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 10951 11271 gene locus_tag LOCUS_05320 10951 11271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 11274 12539 gene locus_tag LOCUS_05330 11274 12539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 12710 14011 gene locus_tag LOCUS_05340 12710 14011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 14064 15341 gene locus_tag LOCUS_05350 14064 15341 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019809.1 protein_id gnl|my_center|LOCUS_05350 15441 16199 gene locus_tag LOCUS_05360 15441 16199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 16551 17432 gene locus_tag LOCUS_05370 16551 17432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 17679 17530 gene locus_tag LOCUS_05380 17679 17530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 18244 18885 gene locus_tag LOCUS_05390 18244 18885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 18936 20066 gene locus_tag LOCUS_05400 18936 20066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 20338 20973 gene locus_tag LOCUS_05410 20338 20973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 21882 21025 gene locus_tag LOCUS_05420 21882 21025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05420 22203 21922 gene locus_tag LOCUS_05430 22203 21922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 22248 22436 gene locus_tag LOCUS_05440 22248 22436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 23068 22715 gene locus_tag LOCUS_05450 23068 22715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 23788 23585 gene locus_tag LOCUS_05460 23788 23585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 <26629 25031 gene locus_tag LOCUS_05470 <26629 25031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004532773.1:asparagine synthase (glutamine-hydrolyzing) >Feature sequence019 169 256 gene locus_tag LOCUS_t00040 169 256 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 585 271 gene locus_tag LOCUS_05480 585 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 875 669 gene locus_tag LOCUS_05490 875 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 926 1687 gene locus_tag LOCUS_05500 926 1687 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805161.1 protein_id gnl|my_center|LOCUS_05500 1757 2221 gene locus_tag LOCUS_05510 gene mscL 1757 2221 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815990.1 protein_id gnl|my_center|LOCUS_05510 5660 2349 gene locus_tag LOCUS_05520 5660 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 9152 5826 gene locus_tag LOCUS_05530 9152 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 9379 10626 gene locus_tag LOCUS_05540 9379 10626 CDS product tagaturonate epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119734.1 protein_id gnl|my_center|LOCUS_05540 12012 10639 gene locus_tag LOCUS_05550 12012 10639 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_05550 14684 12048 gene locus_tag LOCUS_05560 14684 12048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 16116 14689 gene locus_tag LOCUS_05570 16116 14689 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920988.1 protein_id gnl|my_center|LOCUS_05570 17546 16113 gene locus_tag LOCUS_05580 gene uxaC 17546 16113 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187442.1 protein_id gnl|my_center|LOCUS_05580 18705 17554 gene locus_tag LOCUS_05590 18705 17554 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126014666.1 protein_id gnl|my_center|LOCUS_05590 21767 18720 gene locus_tag LOCUS_05600 21767 18720 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080241138.1 protein_id gnl|my_center|LOCUS_05600 23203 21839 gene locus_tag LOCUS_05610 gene pelB 23203 21839 CDS product exopolygalacturonase PelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865120.1 protein_id gnl|my_center|LOCUS_05610 23734 23345 gene locus_tag LOCUS_05620 23734 23345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 24768 23734 gene locus_tag LOCUS_05630 24768 23734 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121166.1 protein_id gnl|my_center|LOCUS_05630 26081 24765 gene locus_tag LOCUS_05640 26081 24765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 >Feature sequence020 23 1579 gene locus_tag LOCUS_05650 23 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 1758 5207 gene locus_tag LOCUS_05660 1758 5207 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122837.1 protein_id gnl|my_center|LOCUS_05660 6504 5263 gene locus_tag LOCUS_05670 6504 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 8049 6529 gene locus_tag LOCUS_05680 8049 6529 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_05680 9573 8191 gene locus_tag LOCUS_05690 9573 8191 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032496674.1 protein_id gnl|my_center|LOCUS_05690 10101 9715 gene locus_tag LOCUS_05700 10101 9715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 11273 10236 gene locus_tag LOCUS_05710 11273 10236 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324315.1 protein_id gnl|my_center|LOCUS_05710 13661 11310 gene locus_tag LOCUS_05720 13661 11310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 14145 15998 gene locus_tag LOCUS_05730 14145 15998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 15995 17080 gene locus_tag LOCUS_05740 15995 17080 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977450.1 protein_id gnl|my_center|LOCUS_05740 17112 17309 gene locus_tag LOCUS_05750 17112 17309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 19627 17405 gene locus_tag LOCUS_05760 19627 17405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 19860 20660 gene locus_tag LOCUS_05770 19860 20660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 20752 21687 gene locus_tag LOCUS_05780 20752 21687 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_05780 21691 22107 gene locus_tag LOCUS_05790 21691 22107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 23351 22110 gene locus_tag LOCUS_05800 23351 22110 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126014666.1 protein_id gnl|my_center|LOCUS_05800 24182 23565 gene locus_tag LOCUS_05810 gene msrA 24182 23565 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_05810 24981 24112 gene locus_tag LOCUS_05820 24981 24112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 25540 24992 gene locus_tag LOCUS_05830 25540 24992 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207579.1 protein_id gnl|my_center|LOCUS_05830 >Feature sequence021 349 1434 gene locus_tag LOCUS_05840 349 1434 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122217.1 protein_id gnl|my_center|LOCUS_05840 2212 1391 gene locus_tag LOCUS_05850 2212 1391 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727931.1 protein_id gnl|my_center|LOCUS_05850 2385 3587 gene locus_tag LOCUS_05860 2385 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 3779 4831 gene locus_tag LOCUS_05870 3779 4831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 6340 4832 gene locus_tag LOCUS_05880 6340 4832 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921601.1 protein_id gnl|my_center|LOCUS_05880 6438 8234 gene locus_tag LOCUS_05890 6438 8234 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671072.1 protein_id gnl|my_center|LOCUS_05890 9815 8292 gene locus_tag LOCUS_05900 9815 8292 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922709.1 protein_id gnl|my_center|LOCUS_05900 9941 11341 gene locus_tag LOCUS_05910 gene uxaC 9941 11341 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_05910 12856 11378 gene locus_tag LOCUS_05920 12856 11378 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334705.1 protein_id gnl|my_center|LOCUS_05920 15728 12882 gene locus_tag LOCUS_05930 15728 12882 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008668648.1 protein_id gnl|my_center|LOCUS_05930 17296 15725 gene locus_tag LOCUS_05940 17296 15725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 16480 16390 gene locus_tag LOCUS_t00050 16480 16390 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 17802 17293 gene locus_tag LOCUS_05950 17802 17293 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120964.1 protein_id gnl|my_center|LOCUS_05950 18600 18076 gene locus_tag LOCUS_05960 18600 18076 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124041.1 protein_id gnl|my_center|LOCUS_05960 19747 18635 gene locus_tag LOCUS_05970 19747 18635 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388688.1 protein_id gnl|my_center|LOCUS_05970 20157 19744 gene locus_tag LOCUS_05980 20157 19744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 21642 20203 gene locus_tag LOCUS_05990 21642 20203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 22296 21739 gene locus_tag LOCUS_06000 22296 21739 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939219.1 protein_id gnl|my_center|LOCUS_06000 22831 22631 gene locus_tag LOCUS_06010 22831 22631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 >Feature sequence022 872 2107 gene locus_tag LOCUS_06020 872 2107 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402650.1 protein_id gnl|my_center|LOCUS_06020 2516 3571 gene locus_tag LOCUS_06030 2516 3571 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_06030 3776 4894 gene locus_tag LOCUS_06040 3776 4894 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028064.1 protein_id gnl|my_center|LOCUS_06040 5392 4931 gene locus_tag LOCUS_06050 5392 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 6439 5399 gene locus_tag LOCUS_06060 6439 5399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 8205 6418 gene locus_tag LOCUS_06070 8205 6418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 8644 8823 gene locus_tag LOCUS_06080 8644 8823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 10041 9085 gene locus_tag LOCUS_06090 10041 9085 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202383.1 protein_id gnl|my_center|LOCUS_06090 10751 10038 gene locus_tag LOCUS_06100 10751 10038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 11312 10761 gene locus_tag LOCUS_06110 11312 10761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 11650 11432 gene locus_tag LOCUS_06120 11650 11432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 14612 11811 gene locus_tag LOCUS_06130 14612 11811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 14823 16154 gene locus_tag LOCUS_06140 14823 16154 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_06140 16396 19449 gene locus_tag LOCUS_06150 16396 19449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 19439 20941 gene locus_tag LOCUS_06160 19439 20941 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333131.1 protein_id gnl|my_center|LOCUS_06160 20938 21852 gene locus_tag LOCUS_06170 20938 21852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 23046 21880 gene locus_tag LOCUS_06180 23046 21880 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 protein_id gnl|my_center|LOCUS_06180 23255 23479 gene locus_tag LOCUS_06190 23255 23479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 23476 23883 gene locus_tag LOCUS_06200 23476 23883 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_06200 23929 24429 gene locus_tag LOCUS_06210 23929 24429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 <25204 24416 gene locus_tag LOCUS_06220 <25204 24416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007339462.1:aminofutalosine synthase MqnE >Feature sequence023 569 129 gene locus_tag LOCUS_06230 569 129 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_06230 772 690 gene locus_tag LOCUS_t00060 772 690 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1570 1043 gene locus_tag LOCUS_06240 1570 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 3361 1805 gene locus_tag LOCUS_06250 3361 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 4300 4106 gene locus_tag LOCUS_06260 4300 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 4269 6623 gene locus_tag LOCUS_06270 4269 6623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 6671 7372 gene locus_tag LOCUS_06280 6671 7372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 7398 13829 gene locus_tag LOCUS_06290 7398 13829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 14131 13826 gene locus_tag LOCUS_06300 14131 13826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 14875 19878 gene locus_tag LOCUS_06310 14875 19878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 20319 21341 gene locus_tag LOCUS_06320 20319 21341 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_06320 21400 22635 gene locus_tag LOCUS_06330 21400 22635 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258886.1 protein_id gnl|my_center|LOCUS_06330 22909 23148 gene locus_tag LOCUS_06340 22909 23148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 23145 23414 gene locus_tag LOCUS_06350 23145 23414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 24317 23514 gene locus_tag LOCUS_06360 gene dapB 24317 23514 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123511.1 protein_id gnl|my_center|LOCUS_06360 >Feature sequence024 1945 1721 gene locus_tag LOCUS_06370 1945 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 3403 2027 gene locus_tag LOCUS_06380 3403 2027 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922613.1 protein_id gnl|my_center|LOCUS_06380 4893 3400 gene locus_tag LOCUS_06390 4893 3400 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922522.1 protein_id gnl|my_center|LOCUS_06390 8687 4905 gene locus_tag LOCUS_06400 8687 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 10125 8983 gene locus_tag LOCUS_06410 10125 8983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 12927 10189 gene locus_tag LOCUS_06420 12927 10189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 13013 15442 gene locus_tag LOCUS_06430 13013 15442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 16748 15456 gene locus_tag LOCUS_06440 16748 15456 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327912.1 protein_id gnl|my_center|LOCUS_06440 18772 16793 gene locus_tag LOCUS_06450 18772 16793 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816805.1 protein_id gnl|my_center|LOCUS_06450 18952 22158 gene locus_tag LOCUS_06460 18952 22158 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263823.1 protein_id gnl|my_center|LOCUS_06460 22258 23424 gene locus_tag LOCUS_06470 22258 23424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 >Feature sequence025 1272 196 gene locus_tag LOCUS_06480 1272 196 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328432.1 protein_id gnl|my_center|LOCUS_06480 1916 1269 gene locus_tag LOCUS_06490 1916 1269 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334154.1 protein_id gnl|my_center|LOCUS_06490 2082 3608 gene locus_tag LOCUS_06500 gene trpE 2082 3608 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121650.1 protein_id gnl|my_center|LOCUS_06500 3605 4501 gene locus_tag LOCUS_06510 3605 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 5349 4828 gene locus_tag LOCUS_06520 5349 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328133.1 protein_id gnl|my_center|LOCUS_06520 5441 6778 gene locus_tag LOCUS_06530 5441 6778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 10444 6785 gene locus_tag LOCUS_06540 10444 6785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 11210 11001 gene locus_tag LOCUS_06550 11210 11001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 16508 11223 gene locus_tag LOCUS_06560 16508 11223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 17101 16688 gene locus_tag LOCUS_06570 17101 16688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 17465 17091 gene locus_tag LOCUS_06580 17465 17091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 17662 17961 gene locus_tag LOCUS_06590 17662 17961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 17965 18381 gene locus_tag LOCUS_06600 17965 18381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 18654 18412 gene locus_tag LOCUS_06610 18654 18412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 19251 18691 gene locus_tag LOCUS_06620 19251 18691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 20105 19668 gene locus_tag LOCUS_06630 20105 19668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 20483 20352 gene locus_tag LOCUS_06640 20483 20352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 21417 20587 gene locus_tag LOCUS_06650 gene trpA 21417 20587 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921878.1 protein_id gnl|my_center|LOCUS_06650 22646 21414 gene locus_tag LOCUS_06660 gene trpB 22646 21414 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324127.1 protein_id gnl|my_center|LOCUS_06660 22758 23669 gene locus_tag LOCUS_06670 22758 23669 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121456.1 protein_id gnl|my_center|LOCUS_06670 >Feature sequence026 571 1521 gene locus_tag LOCUS_06680 571 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057419.1 protein_id gnl|my_center|LOCUS_06680 1548 3242 gene locus_tag LOCUS_06690 1548 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 3340 5340 gene locus_tag LOCUS_06700 3340 5340 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_06700 6161 5400 gene locus_tag LOCUS_06710 6161 5400 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665551.1 protein_id gnl|my_center|LOCUS_06710 7932 6388 gene locus_tag LOCUS_06720 7932 6388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 8165 8917 gene locus_tag LOCUS_06730 8165 8917 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339435.1 protein_id gnl|my_center|LOCUS_06730 8996 10309 gene locus_tag LOCUS_06740 gene ahcY 8996 10309 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327756.1 protein_id gnl|my_center|LOCUS_06740 12274 10721 gene locus_tag LOCUS_06750 12274 10721 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363847.1 protein_id gnl|my_center|LOCUS_06750 12445 12873 gene locus_tag LOCUS_06760 12445 12873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 14840 12888 gene locus_tag LOCUS_06770 14840 12888 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921802.1 protein_id gnl|my_center|LOCUS_06770 15861 15286 gene locus_tag LOCUS_06780 15861 15286 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119755.1 protein_id gnl|my_center|LOCUS_06780 15906 16313 gene locus_tag LOCUS_06790 15906 16313 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259291.1 protein_id gnl|my_center|LOCUS_06790 16310 17059 gene locus_tag LOCUS_06800 16310 17059 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014858053.1 protein_id gnl|my_center|LOCUS_06800 18712 17360 gene locus_tag LOCUS_06810 18712 17360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 18817 19146 gene locus_tag LOCUS_06820 18817 19146 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941369.1 protein_id gnl|my_center|LOCUS_06820 21054 19723 gene locus_tag LOCUS_06830 21054 19723 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669743.1 protein_id gnl|my_center|LOCUS_06830 22886 21093 gene locus_tag LOCUS_06840 22886 21093 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546696.1 protein_id gnl|my_center|LOCUS_06840 >Feature sequence027 117 638 gene locus_tag LOCUS_06850 117 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 684 2267 gene locus_tag LOCUS_06860 684 2267 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108692.1 protein_id gnl|my_center|LOCUS_06860 3324 2545 gene locus_tag LOCUS_06870 3324 2545 CDS product DUF3050 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219159941.1 protein_id gnl|my_center|LOCUS_06870 4735 3506 gene locus_tag LOCUS_06880 4735 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 5152 5601 gene locus_tag LOCUS_06890 5152 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 6181 5900 gene locus_tag LOCUS_06900 6181 5900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 6435 6178 gene locus_tag LOCUS_06910 6435 6178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 7094 6840 gene locus_tag LOCUS_06920 7094 6840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 7734 7471 gene locus_tag LOCUS_06930 7734 7471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 8139 7735 gene locus_tag LOCUS_06940 8139 7735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 8440 8117 gene locus_tag LOCUS_06950 8440 8117 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_06950 11081 9768 gene locus_tag LOCUS_06960 11081 9768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 15991 11078 gene locus_tag LOCUS_06970 15991 11078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 16872 15979 gene locus_tag LOCUS_06980 16872 15979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 17906 16884 gene locus_tag LOCUS_06990 17906 16884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 18803 17919 gene locus_tag LOCUS_07000 18803 17919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 19813 18806 gene locus_tag LOCUS_07010 19813 18806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 21138 19810 gene locus_tag LOCUS_07020 21138 19810 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329380.1 protein_id gnl|my_center|LOCUS_07020 <22825 21231 gene locus_tag LOCUS_07030 <22825 21231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007332509.1:ATPase, T2SS/T4P/T4SS family >Feature sequence028 3769 245 gene locus_tag LOCUS_07040 3769 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 4953 3766 gene locus_tag LOCUS_07050 gene fadA 4953 3766 CDS product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047863541.1 protein_id gnl|my_center|LOCUS_07050 7148 4950 gene locus_tag LOCUS_07060 gene fadB 7148 4950 CDS product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703999.1 protein_id gnl|my_center|LOCUS_07060 7274 7879 gene locus_tag LOCUS_07070 7274 7879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 7938 8021 gene locus_tag LOCUS_t00070 7938 8021 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8316 9791 gene locus_tag LOCUS_07080 8316 9791 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326414.1 protein_id gnl|my_center|LOCUS_07080 11067 9781 gene locus_tag LOCUS_07090 gene serS 11067 9781 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118185.1 protein_id gnl|my_center|LOCUS_07090 11113 11478 gene locus_tag LOCUS_07100 11113 11478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 13126 11705 gene locus_tag LOCUS_07110 13126 11705 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_07110 14245 13169 gene locus_tag LOCUS_07120 14245 13169 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_07120 14824 14288 gene locus_tag LOCUS_07130 14824 14288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 14995 16164 gene locus_tag LOCUS_07140 14995 16164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 18584 16860 gene locus_tag LOCUS_07150 18584 16860 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142055.1 protein_id gnl|my_center|LOCUS_07150 19135 18929 gene locus_tag LOCUS_07160 19135 18929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 19481 20110 gene locus_tag LOCUS_07170 19481 20110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 20137 20469 gene locus_tag LOCUS_07180 20137 20469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 20555 21409 gene locus_tag LOCUS_07190 20555 21409 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117757.1 protein_id gnl|my_center|LOCUS_07190 22325 21420 gene locus_tag LOCUS_07200 22325 21420 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144155.1 protein_id gnl|my_center|LOCUS_07200 >Feature sequence029 <1 837 gene locus_tag LOCUS_07210 <1 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007333876.1:sugar phosphate isomerase/epimerase 893 2062 gene locus_tag LOCUS_07220 893 2062 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103756.1 protein_id gnl|my_center|LOCUS_07220 2059 4095 gene locus_tag LOCUS_07230 2059 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 6241 4103 gene locus_tag LOCUS_07240 6241 4103 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615720.1 protein_id gnl|my_center|LOCUS_07240 11703 6412 gene locus_tag LOCUS_07250 11703 6412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 12307 11918 gene locus_tag LOCUS_07260 12307 11918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 12548 12309 gene locus_tag LOCUS_07270 12548 12309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 13346 12690 gene locus_tag LOCUS_07280 13346 12690 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037326.1 protein_id gnl|my_center|LOCUS_07280 15633 13408 gene locus_tag LOCUS_07290 15633 13408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 15770 16816 gene locus_tag LOCUS_07300 15770 16816 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324315.1 protein_id gnl|my_center|LOCUS_07300 16816 17271 gene locus_tag LOCUS_07310 16816 17271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 17405 19480 gene locus_tag LOCUS_07320 gene tkt 17405 19480 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092005623.1 protein_id gnl|my_center|LOCUS_07320 20811 19849 gene locus_tag LOCUS_07330 20811 19849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 21416 20844 gene locus_tag LOCUS_07340 21416 20844 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325344.1 protein_id gnl|my_center|LOCUS_07340 >Feature sequence030 1220 1507 gene locus_tag LOCUS_07350 1220 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 2309 1590 gene locus_tag LOCUS_07360 gene pdxH 2309 1590 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188935.1 protein_id gnl|my_center|LOCUS_07360 3688 2306 gene locus_tag LOCUS_07370 3688 2306 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_07370 4337 3924 gene locus_tag LOCUS_07380 4337 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663813.1 protein_id gnl|my_center|LOCUS_07380 5590 4451 gene locus_tag LOCUS_07390 5590 4451 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121665.1 protein_id gnl|my_center|LOCUS_07390 6532 5759 gene locus_tag LOCUS_07400 6532 5759 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390517.1 protein_id gnl|my_center|LOCUS_07400 7782 6529 gene locus_tag LOCUS_07410 7782 6529 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921296.1 protein_id gnl|my_center|LOCUS_07410 8618 7839 gene locus_tag LOCUS_07420 8618 7839 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270259.1 protein_id gnl|my_center|LOCUS_07420 8791 10872 gene locus_tag LOCUS_07430 8791 10872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 11375 10878 gene locus_tag LOCUS_07440 11375 10878 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976297.1 protein_id gnl|my_center|LOCUS_07440 12587 11556 gene locus_tag LOCUS_07450 12587 11556 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259146.1 protein_id gnl|my_center|LOCUS_07450 13450 12584 gene locus_tag LOCUS_07460 13450 12584 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329752.1 protein_id gnl|my_center|LOCUS_07460 14745 13447 gene locus_tag LOCUS_07470 14745 13447 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120806.1 protein_id gnl|my_center|LOCUS_07470 15266 14862 gene locus_tag LOCUS_07480 15266 14862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 15466 15263 gene locus_tag LOCUS_07490 15466 15263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 16127 15708 gene locus_tag LOCUS_07500 16127 15708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 17493 16243 gene locus_tag LOCUS_07510 17493 16243 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_07510 17637 18269 gene locus_tag LOCUS_07520 17637 18269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 18284 19891 gene locus_tag LOCUS_07530 18284 19891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 19189 19285 gene locus_tag LOCUS_t00080 19189 19285 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 20021 20569 gene locus_tag LOCUS_07540 20021 20569 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124030.1 protein_id gnl|my_center|LOCUS_07540 21465 20632 gene locus_tag LOCUS_07550 21465 20632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 >Feature sequence031 2259 1810 gene locus_tag LOCUS_07560 2259 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 3397 2297 gene locus_tag LOCUS_07570 3397 2297 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121665.1 protein_id gnl|my_center|LOCUS_07570 3686 4672 gene locus_tag LOCUS_07580 3686 4672 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061017.1 protein_id gnl|my_center|LOCUS_07580 4735 5163 gene locus_tag LOCUS_07590 4735 5163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 5344 5625 gene locus_tag LOCUS_07600 5344 5625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 5971 6378 gene locus_tag LOCUS_07610 5971 6378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 6463 8475 gene locus_tag LOCUS_07620 6463 8475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 9511 8519 gene locus_tag LOCUS_07630 9511 8519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 9709 10194 gene locus_tag LOCUS_07640 9709 10194 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_07640 10228 12399 gene locus_tag LOCUS_07650 10228 12399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 12509 12904 gene locus_tag LOCUS_07660 12509 12904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326218.1 protein_id gnl|my_center|LOCUS_07660 13022 13483 gene locus_tag LOCUS_07670 13022 13483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 14811 13438 gene locus_tag LOCUS_07680 14811 13438 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921544.1 protein_id gnl|my_center|LOCUS_07680 15485 14814 gene locus_tag LOCUS_07690 15485 14814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921543.1 protein_id gnl|my_center|LOCUS_07690 15683 16372 gene locus_tag LOCUS_07700 15683 16372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 16876 16376 gene locus_tag LOCUS_07710 16876 16376 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327088.1 protein_id gnl|my_center|LOCUS_07710 17026 17412 gene locus_tag LOCUS_07720 17026 17412 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121782.1 protein_id gnl|my_center|LOCUS_07720 18205 17444 gene locus_tag LOCUS_07730 18205 17444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 18799 19050 gene locus_tag LOCUS_07740 18799 19050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 19431 19186 gene locus_tag LOCUS_07750 19431 19186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 19680 19444 gene locus_tag LOCUS_07760 19680 19444 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_07760 19827 19753 gene locus_tag LOCUS_t00090 19827 19753 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 <21769 20039 gene locus_tag LOCUS_07770 <21769 20039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121776.1:aspartate--tRNA ligase >Feature sequence032 309 115 gene locus_tag LOCUS_07780 309 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07780 661 374 gene locus_tag LOCUS_07790 661 374 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210984.1 protein_id gnl|my_center|LOCUS_07790 1014 766 gene locus_tag LOCUS_07800 1014 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 2588 1419 gene locus_tag LOCUS_07810 2588 1419 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108005.1 protein_id gnl|my_center|LOCUS_07810 2801 3001 gene locus_tag LOCUS_07820 2801 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 3844 4182 gene locus_tag LOCUS_07830 3844 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 4179 4403 gene locus_tag LOCUS_07840 4179 4403 CDS product DUF4926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403415.1 protein_id gnl|my_center|LOCUS_07840 4563 4799 gene locus_tag LOCUS_07850 4563 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 5233 5514 gene locus_tag LOCUS_07860 5233 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 5929 6165 gene locus_tag LOCUS_07870 5929 6165 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844758.1 protein_id gnl|my_center|LOCUS_07870 6159 6503 gene locus_tag LOCUS_07880 6159 6503 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673725.1 protein_id gnl|my_center|LOCUS_07880 6749 7270 gene locus_tag LOCUS_07890 6749 7270 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206563.1 protein_id gnl|my_center|LOCUS_07890 8236 7283 gene locus_tag LOCUS_07900 gene ispH 8236 7283 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922221.1 protein_id gnl|my_center|LOCUS_07900 8343 9338 gene locus_tag LOCUS_07910 gene hpnC 8343 9338 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040123.1 protein_id gnl|my_center|LOCUS_07910 9335 10192 gene locus_tag LOCUS_07920 9335 10192 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333441.1 protein_id gnl|my_center|LOCUS_07920 10189 11595 gene locus_tag LOCUS_07930 gene hpnE 10189 11595 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122224.1 protein_id gnl|my_center|LOCUS_07930 12325 11582 gene locus_tag LOCUS_07940 12325 11582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 12759 12319 gene locus_tag LOCUS_07950 12759 12319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 14579 12792 gene locus_tag LOCUS_07960 14579 12792 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117790.1 protein_id gnl|my_center|LOCUS_07960 16079 14724 gene locus_tag LOCUS_07970 16079 14724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 16785 16114 gene locus_tag LOCUS_07980 16785 16114 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_07980 16951 18054 gene locus_tag LOCUS_07990 16951 18054 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 protein_id gnl|my_center|LOCUS_07990 18098 18409 gene locus_tag LOCUS_08000 18098 18409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227996.1 protein_id gnl|my_center|LOCUS_08000 19951 18425 gene locus_tag LOCUS_08010 gene guaA 19951 18425 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778965.1 protein_id gnl|my_center|LOCUS_08010 20100 20882 gene locus_tag LOCUS_08020 gene surE 20100 20882 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037201557.1 protein_id gnl|my_center|LOCUS_08020 <21692 20877 gene locus_tag LOCUS_08030 <21692 20877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615433.1:serine/threonine-protein kinase >Feature sequence033 862 1956 gene locus_tag LOCUS_08040 862 1956 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870578.1 protein_id gnl|my_center|LOCUS_08040 2768 3802 gene locus_tag LOCUS_08050 2768 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 3810 4478 gene locus_tag LOCUS_08060 3810 4478 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228733.1 protein_id gnl|my_center|LOCUS_08060 4496 5596 gene locus_tag LOCUS_08070 4496 5596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 5577 6887 gene locus_tag LOCUS_08080 5577 6887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 6903 7571 gene locus_tag LOCUS_08090 6903 7571 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200879.1 protein_id gnl|my_center|LOCUS_08090 8605 7589 gene locus_tag LOCUS_08100 8605 7589 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088722.1 protein_id gnl|my_center|LOCUS_08100 9683 8616 gene locus_tag LOCUS_08110 9683 8616 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160648704.1 protein_id gnl|my_center|LOCUS_08110 11315 9744 gene locus_tag LOCUS_08120 11315 9744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 12190 11480 gene locus_tag LOCUS_08130 12190 11480 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226565.1 protein_id gnl|my_center|LOCUS_08130 13208 12183 gene locus_tag LOCUS_08140 13208 12183 CDS product CDP-paratose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770936.1 protein_id gnl|my_center|LOCUS_08140 14191 13196 gene locus_tag LOCUS_08150 14191 13196 CDS product NAD-dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208595.1 protein_id gnl|my_center|LOCUS_08150 15210 14188 gene locus_tag LOCUS_08160 15210 14188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 16856 15504 gene locus_tag LOCUS_08170 gene rfbH 16856 15504 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126347.1 protein_id gnl|my_center|LOCUS_08170 17218 16865 gene locus_tag LOCUS_08180 17218 16865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 17559 17224 gene locus_tag LOCUS_08190 17559 17224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 18729 17608 gene locus_tag LOCUS_08200 gene rfbG 18729 17608 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565909.1 protein_id gnl|my_center|LOCUS_08200 19505 18729 gene locus_tag LOCUS_08210 gene rfbF 19505 18729 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648803.1 protein_id gnl|my_center|LOCUS_08210 >Feature sequence034 160 627 gene locus_tag LOCUS_08220 160 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 1947 1027 gene locus_tag LOCUS_08230 gene lipA 1947 1027 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665013.1 protein_id gnl|my_center|LOCUS_08230 2728 1937 gene locus_tag LOCUS_08240 2728 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 6796 2753 gene locus_tag LOCUS_08250 6796 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334944.1 protein_id gnl|my_center|LOCUS_08250 6925 8202 gene locus_tag LOCUS_08260 6925 8202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 10154 8421 gene locus_tag LOCUS_08270 10154 8421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 10243 11217 gene locus_tag LOCUS_08280 10243 11217 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665997.1 protein_id gnl|my_center|LOCUS_08280 11226 11492 gene locus_tag LOCUS_08290 11226 11492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 11500 13227 gene locus_tag LOCUS_08300 gene lnt 11500 13227 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921835.1 protein_id gnl|my_center|LOCUS_08300 13248 14108 gene locus_tag LOCUS_08310 13248 14108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 14141 14305 gene locus_tag LOCUS_08320 14141 14305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 14318 15100 gene locus_tag LOCUS_08330 14318 15100 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039642892.1 protein_id gnl|my_center|LOCUS_08330 16173 15535 gene locus_tag LOCUS_08340 16173 15535 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533589.1 protein_id gnl|my_center|LOCUS_08340 17864 16188 gene locus_tag LOCUS_08350 17864 16188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 18090 20189 gene locus_tag LOCUS_08360 gene metG 18090 20189 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120499.1 protein_id gnl|my_center|LOCUS_08360 >Feature sequence035 968 171 gene locus_tag LOCUS_08370 968 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 1024 1818 gene locus_tag LOCUS_08380 1024 1818 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338546.1 protein_id gnl|my_center|LOCUS_08380 1890 2612 gene locus_tag LOCUS_08390 1890 2612 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123928.1 protein_id gnl|my_center|LOCUS_08390 2630 4300 gene locus_tag LOCUS_08400 2630 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120907.1 protein_id gnl|my_center|LOCUS_08400 4459 5898 gene locus_tag LOCUS_08410 4459 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 5921 7639 gene locus_tag LOCUS_08420 5921 7639 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616258.1 protein_id gnl|my_center|LOCUS_08420 9568 7811 gene locus_tag LOCUS_08430 9568 7811 CDS product NADPH-dependent assimilatory sulfite reductase hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327402.1 protein_id gnl|my_center|LOCUS_08430 9702 10238 gene locus_tag LOCUS_08440 9702 10238 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442700.1 protein_id gnl|my_center|LOCUS_08440 10235 10693 gene locus_tag LOCUS_08450 10235 10693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 10693 12375 gene locus_tag LOCUS_08460 10693 12375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 12389 13366 gene locus_tag LOCUS_08470 12389 13366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 13737 14003 gene locus_tag LOCUS_08480 13737 14003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 14267 14431 gene locus_tag LOCUS_08490 14267 14431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 15078 14446 gene locus_tag LOCUS_08500 15078 14446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 <20263 15711 gene locus_tag LOCUS_08510 <20263 15711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_084743078.1:RHS repeat-associated core domain-containing protein >Feature sequence036 1 420 gene locus_tag LOCUS_08520 1 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 1215 913 gene locus_tag LOCUS_08530 1215 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 1388 2035 gene locus_tag LOCUS_08540 1388 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 2553 2107 gene locus_tag LOCUS_08550 2553 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 2945 4501 gene locus_tag LOCUS_08560 2945 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 4627 5025 gene locus_tag LOCUS_08570 4627 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 8576 5379 gene locus_tag LOCUS_08580 8576 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 9636 8581 gene locus_tag LOCUS_08590 9636 8581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 >Feature sequence037 3778 1376 gene locus_tag LOCUS_08600 3778 1376 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615954.1 protein_id gnl|my_center|LOCUS_08600 4855 3866 gene locus_tag LOCUS_08610 4855 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 7518 4867 gene locus_tag LOCUS_08620 7518 4867 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616124.1 protein_id gnl|my_center|LOCUS_08620 8723 7515 gene locus_tag LOCUS_08630 8723 7515 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922300.1 protein_id gnl|my_center|LOCUS_08630 13112 8913 gene locus_tag LOCUS_08640 13112 8913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 14760 13408 gene locus_tag LOCUS_08650 14760 13408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 15371 14655 gene locus_tag LOCUS_08660 15371 14655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 15629 15913 gene locus_tag LOCUS_08670 15629 15913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 15915 16349 gene locus_tag LOCUS_08680 15915 16349 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900837.1 protein_id gnl|my_center|LOCUS_08680 17065 16445 gene locus_tag LOCUS_08690 17065 16445 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695801.1 protein_id gnl|my_center|LOCUS_08690 19058 17109 gene locus_tag LOCUS_08700 19058 17109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 >Feature sequence038 183 1142 gene locus_tag LOCUS_08710 183 1142 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122054.1 protein_id gnl|my_center|LOCUS_08710 1151 2344 gene locus_tag LOCUS_08720 1151 2344 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402885.1 protein_id gnl|my_center|LOCUS_08720 5717 2247 gene locus_tag LOCUS_08730 5717 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 6389 5793 gene locus_tag LOCUS_08740 gene hisB 6389 5793 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325657.1 protein_id gnl|my_center|LOCUS_08740 7495 6413 gene locus_tag LOCUS_08750 gene hisC 7495 6413 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121508.1 protein_id gnl|my_center|LOCUS_08750 7763 7518 gene locus_tag LOCUS_08760 7763 7518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 9529 8075 gene locus_tag LOCUS_08770 gene hisD 9529 8075 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118440.1 protein_id gnl|my_center|LOCUS_08770 10269 9556 gene locus_tag LOCUS_08780 10269 9556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 10667 11308 gene locus_tag LOCUS_08790 10667 11308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 12318 11503 gene locus_tag LOCUS_08800 12318 11503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 14062 12446 gene locus_tag LOCUS_08810 14062 12446 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337137.1 protein_id gnl|my_center|LOCUS_08810 14849 14085 gene locus_tag LOCUS_08820 14849 14085 CDS product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888039.1 protein_id gnl|my_center|LOCUS_08820 15040 15342 gene locus_tag LOCUS_08830 15040 15342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 15339 15866 gene locus_tag LOCUS_08840 15339 15866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 16152 16910 gene locus_tag LOCUS_08850 gene ubiE 16152 16910 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328112.1 protein_id gnl|my_center|LOCUS_08850 16907 17518 gene locus_tag LOCUS_08860 16907 17518 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119018.1 protein_id gnl|my_center|LOCUS_08860 17515 18420 gene locus_tag LOCUS_08870 gene ubiA 17515 18420 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119017.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence039 2306 261 gene locus_tag LOCUS_08880 2306 261 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120669.1 protein_id gnl|my_center|LOCUS_08880 2397 3359 gene locus_tag LOCUS_08890 2397 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 4278 3367 gene locus_tag LOCUS_08900 4278 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 7356 4450 gene locus_tag LOCUS_08910 7356 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 7729 7409 gene locus_tag LOCUS_08920 7729 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 8970 7855 gene locus_tag LOCUS_08930 gene tgt 8970 7855 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778950.1 protein_id gnl|my_center|LOCUS_08930 11594 9075 gene locus_tag LOCUS_08940 11594 9075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 13143 11833 gene locus_tag LOCUS_08950 13143 11833 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_08950 15924 13183 gene locus_tag LOCUS_08960 gene gyrA 15924 13183 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922184.1 protein_id gnl|my_center|LOCUS_08960 16172 17860 gene locus_tag LOCUS_08970 16172 17860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 >Feature sequence040 396 2039 gene locus_tag LOCUS_08980 396 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 2084 4585 gene locus_tag LOCUS_08990 2084 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 4823 12394 gene locus_tag LOCUS_09000 4823 12394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 12410 12625 gene locus_tag LOCUS_09010 12410 12625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 12629 13549 gene locus_tag LOCUS_09020 12629 13549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 13924 15219 gene locus_tag LOCUS_09030 13924 15219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 15259 16509 gene locus_tag LOCUS_09040 15259 16509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 >Feature sequence041 426 100 gene locus_tag LOCUS_09050 gene rpsJ 426 100 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326795.1 protein_id gnl|my_center|LOCUS_09050 1332 568 gene locus_tag LOCUS_09060 1332 568 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921820.1 protein_id gnl|my_center|LOCUS_09060 1407 2534 gene locus_tag LOCUS_09070 1407 2534 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405429.1 protein_id gnl|my_center|LOCUS_09070 2531 3310 gene locus_tag LOCUS_09080 2531 3310 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975830.1 protein_id gnl|my_center|LOCUS_09080 4079 3285 gene locus_tag LOCUS_09090 4079 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 6332 4218 gene locus_tag LOCUS_09100 gene fusA 6332 4218 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121593.1 protein_id gnl|my_center|LOCUS_09100 6845 6447 gene locus_tag LOCUS_09110 6845 6447 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392906.1 protein_id gnl|my_center|LOCUS_09110 7246 6842 gene locus_tag LOCUS_09120 7246 6842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 7743 7366 gene locus_tag LOCUS_09130 7743 7366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 8413 8706 gene locus_tag LOCUS_09140 8413 8706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 10443 9154 gene locus_tag LOCUS_09150 10443 9154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 11981 10440 gene locus_tag LOCUS_09160 11981 10440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 13726 11993 gene locus_tag LOCUS_09170 13726 11993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 14829 13978 gene locus_tag LOCUS_09180 14829 13978 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123510.1 protein_id gnl|my_center|LOCUS_09180 15485 14826 gene locus_tag LOCUS_09190 gene mqnB 15485 14826 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118202.1 protein_id gnl|my_center|LOCUS_09190 16311 15550 gene locus_tag LOCUS_09200 16311 15550 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975830.1 protein_id gnl|my_center|LOCUS_09200 17384 16308 gene locus_tag LOCUS_09210 17384 16308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 17740 17393 gene locus_tag LOCUS_09220 17740 17393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 18015 17746 gene locus_tag LOCUS_09230 18015 17746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 >Feature sequence042 298 609 gene locus_tag LOCUS_09240 298 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 606 1595 gene locus_tag LOCUS_09250 606 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 1592 2941 gene locus_tag LOCUS_09260 1592 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 3016 3960 gene locus_tag LOCUS_09270 gene mdh 3016 3960 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325654.1 protein_id gnl|my_center|LOCUS_09270 5742 4228 gene locus_tag LOCUS_09280 5742 4228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 7495 6092 gene locus_tag LOCUS_09290 7495 6092 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921382.1 protein_id gnl|my_center|LOCUS_09290 7935 8099 gene locus_tag LOCUS_09300 gene rpmG 7935 8099 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324504.1 protein_id gnl|my_center|LOCUS_09300 9580 8480 gene locus_tag LOCUS_09310 9580 8480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 10671 9577 gene locus_tag LOCUS_09320 gene lpxK 10671 9577 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121336.1 protein_id gnl|my_center|LOCUS_09320 10868 14497 gene locus_tag LOCUS_09330 10868 14497 CDS product circumsporozoite protein- membrane associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263491.1 protein_id gnl|my_center|LOCUS_09330 14494 16218 gene locus_tag LOCUS_09340 gene nadB 14494 16218 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119573.1 protein_id gnl|my_center|LOCUS_09340 16310 17047 gene locus_tag LOCUS_09350 16310 17047 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329136.1 protein_id gnl|my_center|LOCUS_09350 >Feature sequence043 1271 6049 gene locus_tag LOCUS_09360 1271 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 6640 6095 gene locus_tag LOCUS_09370 6640 6095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 7754 6705 gene locus_tag LOCUS_09380 7754 6705 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435072.1 protein_id gnl|my_center|LOCUS_09380 8220 7786 gene locus_tag LOCUS_09390 8220 7786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 9173 8217 gene locus_tag LOCUS_09400 9173 8217 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061017.1 protein_id gnl|my_center|LOCUS_09400 9388 11538 gene locus_tag LOCUS_09410 9388 11538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 11615 12265 gene locus_tag LOCUS_09420 11615 12265 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228286.1 protein_id gnl|my_center|LOCUS_09420 12262 14469 gene locus_tag LOCUS_09430 12262 14469 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230224.1 protein_id gnl|my_center|LOCUS_09430 15801 14506 gene locus_tag LOCUS_09440 15801 14506 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122793.1 protein_id gnl|my_center|LOCUS_09440 16421 15825 gene locus_tag LOCUS_09450 16421 15825 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_09450 16643 17965 gene locus_tag LOCUS_09460 gene gntT 16643 17965 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131758.1 protein_id gnl|my_center|LOCUS_09460 >Feature sequence044 4384 1913 gene locus_tag LOCUS_09470 4384 1913 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_09470 6882 4480 gene locus_tag LOCUS_09480 6882 4480 CDS product PPC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260401.1 protein_id gnl|my_center|LOCUS_09480 8236 6911 gene locus_tag LOCUS_09490 8236 6911 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_09490 9782 8409 gene locus_tag LOCUS_09500 9782 8409 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 protein_id gnl|my_center|LOCUS_09500 11657 9798 gene locus_tag LOCUS_09510 11657 9798 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120741.1 protein_id gnl|my_center|LOCUS_09510 11736 13100 gene locus_tag LOCUS_09520 gene glmM 11736 13100 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922275.1 protein_id gnl|my_center|LOCUS_09520 14838 13300 gene locus_tag LOCUS_09530 14838 13300 CDS product DUF1598 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435082.1 protein_id gnl|my_center|LOCUS_09530 <17879 14889 gene locus_tag LOCUS_09540 <17879 14889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119187.1:DNA polymerase III subunit alpha >Feature sequence045 611 54 gene locus_tag LOCUS_09550 611 54 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087368.1 protein_id gnl|my_center|LOCUS_09550 699 625 gene locus_tag LOCUS_t00100 699 625 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 874 2913 gene locus_tag LOCUS_09560 gene thrS 874 2913 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228977.1 protein_id gnl|my_center|LOCUS_09560 3041 3415 gene locus_tag LOCUS_09570 3041 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 4117 3419 gene locus_tag LOCUS_09580 4117 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 4272 5684 gene locus_tag LOCUS_09590 gene glnA 4272 5684 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_09590 6890 6126 gene locus_tag LOCUS_09600 6890 6126 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612370.1 protein_id gnl|my_center|LOCUS_09600 8084 6915 gene locus_tag LOCUS_09610 8084 6915 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977660.1 protein_id gnl|my_center|LOCUS_09610 9282 8095 gene locus_tag LOCUS_09620 9282 8095 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326127.1 protein_id gnl|my_center|LOCUS_09620 9437 11788 gene locus_tag LOCUS_09630 9437 11788 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120839.1 protein_id gnl|my_center|LOCUS_09630 11788 13302 gene locus_tag LOCUS_09640 11788 13302 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333131.1 protein_id gnl|my_center|LOCUS_09640 13299 14234 gene locus_tag LOCUS_09650 13299 14234 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121256.1 protein_id gnl|my_center|LOCUS_09650 15627 14485 gene locus_tag LOCUS_09660 gene yjiB 15627 14485 CDS product monooxygenase YjiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232789.1 protein_id gnl|my_center|LOCUS_09660 15732 16496 gene locus_tag LOCUS_09670 15732 16496 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122515.1 protein_id gnl|my_center|LOCUS_09670 16493 17209 gene locus_tag LOCUS_09680 16493 17209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 >Feature sequence046 1488 661 gene locus_tag LOCUS_09690 1488 661 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815039.1 protein_id gnl|my_center|LOCUS_09690 4230 1690 gene locus_tag LOCUS_09700 4230 1690 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 protein_id gnl|my_center|LOCUS_09700 5026 4412 gene locus_tag LOCUS_09710 5026 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 5101 6231 gene locus_tag LOCUS_09720 5101 6231 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120858.1 protein_id gnl|my_center|LOCUS_09720 6781 6191 gene locus_tag LOCUS_09730 6781 6191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 6806 7378 gene locus_tag LOCUS_09740 gene cyaB 6806 7378 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120856.1 protein_id gnl|my_center|LOCUS_09740 7944 7417 gene locus_tag LOCUS_09750 7944 7417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 10430 7941 gene locus_tag LOCUS_09760 10430 7941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 11980 10826 gene locus_tag LOCUS_09770 11980 10826 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121679.1 protein_id gnl|my_center|LOCUS_09770 12064 13356 gene locus_tag LOCUS_09780 12064 13356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 13401 13889 gene locus_tag LOCUS_09790 13401 13889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327803.1 protein_id gnl|my_center|LOCUS_09790 14365 15600 gene locus_tag LOCUS_09800 gene lpxB 14365 15600 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921562.1 protein_id gnl|my_center|LOCUS_09800 15600 16388 gene locus_tag LOCUS_09810 15600 16388 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325327.1 protein_id gnl|my_center|LOCUS_09810 16370 17155 gene locus_tag LOCUS_09820 16370 17155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 >Feature sequence047 3323 129 gene locus_tag LOCUS_09830 3323 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 6610 3473 gene locus_tag LOCUS_09840 6610 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 8694 6607 gene locus_tag LOCUS_09850 8694 6607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 9820 8903 gene locus_tag LOCUS_09860 9820 8903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 10368 9820 gene locus_tag LOCUS_09870 10368 9820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 10956 12050 gene locus_tag LOCUS_09880 10956 12050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 12037 13401 gene locus_tag LOCUS_09890 12037 13401 CDS product PhoPQ-activated pathogenicity-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921868.1 protein_id gnl|my_center|LOCUS_09890 14851 13493 gene locus_tag LOCUS_09900 14851 13493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 16836 14848 gene locus_tag LOCUS_09910 16836 14848 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257045.1 protein_id gnl|my_center|LOCUS_09910 17497 16925 gene locus_tag LOCUS_09920 17497 16925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 >Feature sequence048 1 2400 gene locus_tag LOCUS_09930 1 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 4988 2343 gene locus_tag LOCUS_09940 4988 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 6075 4990 gene locus_tag LOCUS_09950 6075 4990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 6177 9680 gene locus_tag LOCUS_09960 6177 9680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 9843 10988 gene locus_tag LOCUS_09970 9843 10988 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_09970 11123 15532 gene locus_tag LOCUS_09980 11123 15532 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921311.1 protein_id gnl|my_center|LOCUS_09980 15669 16865 gene locus_tag LOCUS_09990 15669 16865 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324978.1 protein_id gnl|my_center|LOCUS_09990 >Feature sequence049 97 714 gene locus_tag LOCUS_10000 gene leuD 97 714 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330456.1 protein_id gnl|my_center|LOCUS_10000 760 1701 gene locus_tag LOCUS_10010 760 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 1698 2027 gene locus_tag LOCUS_10020 1698 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 3680 2634 gene locus_tag LOCUS_10030 gene bioB 3680 2634 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326296.1 protein_id gnl|my_center|LOCUS_10030 3815 5029 gene locus_tag LOCUS_10040 3815 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 5029 6396 gene locus_tag LOCUS_10050 5029 6396 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715488.1 protein_id gnl|my_center|LOCUS_10050 8061 6490 gene locus_tag LOCUS_10060 8061 6490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 9592 8123 gene locus_tag LOCUS_10070 9592 8123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332518.1 protein_id gnl|my_center|LOCUS_10070 10804 9629 gene locus_tag LOCUS_10080 10804 9629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 12005 10887 gene locus_tag LOCUS_10090 12005 10887 CDS product DUF1570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665225.1 protein_id gnl|my_center|LOCUS_10090 12487 13182 gene locus_tag LOCUS_10100 12487 13182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 13420 15018 gene locus_tag LOCUS_10110 13420 15018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 15172 16104 gene locus_tag LOCUS_10120 15172 16104 CDS product DNA integrity scanning protein DisA nucleotide-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615923.1 protein_id gnl|my_center|LOCUS_10120 >Feature sequence050 <1 1317 gene locus_tag LOCUS_10130 <1 1317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808186.1:Rieske 2Fe-2S domain-containing protein 1345 2118 gene locus_tag LOCUS_10140 1345 2118 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625442.1 protein_id gnl|my_center|LOCUS_10140 2129 3454 gene locus_tag LOCUS_10150 2129 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 3521 8050 gene locus_tag LOCUS_10160 3521 8050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 8061 8879 gene locus_tag LOCUS_10170 8061 8879 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118964.1 protein_id gnl|my_center|LOCUS_10170 8890 9780 gene locus_tag LOCUS_10180 8890 9780 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118964.1 protein_id gnl|my_center|LOCUS_10180 9792 11048 gene locus_tag LOCUS_10190 9792 11048 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122077.1 protein_id gnl|my_center|LOCUS_10190 11061 11864 gene locus_tag LOCUS_10200 11061 11864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 11882 13690 gene locus_tag LOCUS_10210 gene ctaD 11882 13690 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142160.1 protein_id gnl|my_center|LOCUS_10210 13692 14651 gene locus_tag LOCUS_10220 13692 14651 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123498.1 protein_id gnl|my_center|LOCUS_10220 14648 15661 gene locus_tag LOCUS_10230 14648 15661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 >Feature sequence051 1255 2442 gene locus_tag LOCUS_10240 1255 2442 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957954.1 protein_id gnl|my_center|LOCUS_10240 5026 2471 gene locus_tag LOCUS_10250 5026 2471 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120136.1 protein_id gnl|my_center|LOCUS_10250 5702 5325 gene locus_tag LOCUS_10260 5702 5325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 5680 9543 gene locus_tag LOCUS_10270 5680 9543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 9548 10039 gene locus_tag LOCUS_10280 9548 10039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 10048 11037 gene locus_tag LOCUS_10290 10048 11037 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102017617.1 protein_id gnl|my_center|LOCUS_10290 11037 11582 gene locus_tag LOCUS_10300 11037 11582 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327230.1 protein_id gnl|my_center|LOCUS_10300 11629 13116 gene locus_tag LOCUS_10310 11629 13116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 13162 14175 gene locus_tag LOCUS_10320 13162 14175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 14228 15064 gene locus_tag LOCUS_10330 14228 15064 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123462.1 protein_id gnl|my_center|LOCUS_10330 <16056 15141 gene locus_tag LOCUS_10340 <16056 15141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528058.1:heavy metal translocating P-type ATPase >Feature sequence052 240 1700 gene locus_tag LOCUS_10350 gene zwf 240 1700 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335201.1 protein_id gnl|my_center|LOCUS_10350 1697 2749 gene locus_tag LOCUS_10360 1697 2749 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118292.1 protein_id gnl|my_center|LOCUS_10360 3890 2766 gene locus_tag LOCUS_10370 gene queG 3890 2766 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120810.1 protein_id gnl|my_center|LOCUS_10370 4101 4802 gene locus_tag LOCUS_10380 4101 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 5294 7216 gene locus_tag LOCUS_10390 5294 7216 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328238.1 protein_id gnl|my_center|LOCUS_10390 7916 9025 gene locus_tag LOCUS_10400 7916 9025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 9085 10113 gene locus_tag LOCUS_10410 gene dusB 9085 10113 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334998.1 protein_id gnl|my_center|LOCUS_10410 10121 10906 gene locus_tag LOCUS_10420 10121 10906 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329801.1 protein_id gnl|my_center|LOCUS_10420 10903 11526 gene locus_tag LOCUS_10430 10903 11526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 11561 12445 gene locus_tag LOCUS_10440 gene sufC 11561 12445 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329802.1 protein_id gnl|my_center|LOCUS_10440 12470 13882 gene locus_tag LOCUS_10450 gene sufB 12470 13882 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329803.1 protein_id gnl|my_center|LOCUS_10450 13886 15280 gene locus_tag LOCUS_10460 gene sufD 13886 15280 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922298.1 protein_id gnl|my_center|LOCUS_10460 >Feature sequence053 3052 2567 gene locus_tag LOCUS_10470 3052 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 4202 3045 gene locus_tag LOCUS_10480 4202 3045 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325404.1 protein_id gnl|my_center|LOCUS_10480 9889 4223 gene locus_tag LOCUS_10490 9889 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 5531 5447 gene locus_tag LOCUS_t00110 5531 5447 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 10124 12070 gene locus_tag LOCUS_10500 10124 12070 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036927.1 protein_id gnl|my_center|LOCUS_10500 12476 13003 gene locus_tag LOCUS_10510 12476 13003 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105333325.1 protein_id gnl|my_center|LOCUS_10510 13000 14022 gene locus_tag LOCUS_10520 13000 14022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 14019 15572 gene locus_tag LOCUS_10530 14019 15572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 >Feature sequence054 2383 1505 gene locus_tag LOCUS_10540 gene sdhB 2383 1505 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122819.1 protein_id gnl|my_center|LOCUS_10540 4411 2414 gene locus_tag LOCUS_10550 gene sdhA 4411 2414 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122818.1 protein_id gnl|my_center|LOCUS_10550 5229 4417 gene locus_tag LOCUS_10560 5229 4417 CDS product succinate dehydrogenase cytochrome b558 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922342.1 protein_id gnl|my_center|LOCUS_10560 5383 6963 gene locus_tag LOCUS_10570 5383 6963 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331356.1 protein_id gnl|my_center|LOCUS_10570 7131 9956 gene locus_tag LOCUS_10580 7131 9956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 9972 10364 gene locus_tag LOCUS_10590 9972 10364 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888499.1 protein_id gnl|my_center|LOCUS_10590 11498 10836 gene locus_tag LOCUS_10600 11498 10836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 12087 11599 gene locus_tag LOCUS_10610 12087 11599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 12463 12068 gene locus_tag LOCUS_10620 12463 12068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 13758 12499 gene locus_tag LOCUS_10630 13758 12499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 15173 13869 gene locus_tag LOCUS_10640 15173 13869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 >Feature sequence055 1497 643 gene locus_tag LOCUS_10650 1497 643 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922781.1 protein_id gnl|my_center|LOCUS_10650 3374 1722 gene locus_tag LOCUS_10660 3374 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 3280 3561 gene locus_tag LOCUS_10670 3280 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 4270 3524 gene locus_tag LOCUS_10680 4270 3524 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_10680 5184 4267 gene locus_tag LOCUS_10690 5184 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 5382 5648 gene locus_tag LOCUS_10700 5382 5648 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326827.1 protein_id gnl|my_center|LOCUS_10700 6999 5677 gene locus_tag LOCUS_10710 gene aroA 6999 5677 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332883.1 protein_id gnl|my_center|LOCUS_10710 6914 8266 gene locus_tag LOCUS_10720 6914 8266 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337640.1 protein_id gnl|my_center|LOCUS_10720 9632 8274 gene locus_tag LOCUS_10730 9632 8274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 11898 9679 gene locus_tag LOCUS_10740 gene ovoA 11898 9679 CDS product 5-histidylcysteine sulfoxide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074094.1 protein_id gnl|my_center|LOCUS_10740 12920 11910 gene locus_tag LOCUS_10750 12920 11910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 13645 12917 gene locus_tag LOCUS_10760 13645 12917 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943290.1 protein_id gnl|my_center|LOCUS_10760 <14355 13648 gene locus_tag LOCUS_10770 <14355 13648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943289.1:amino acid ABC transporter permease >Feature sequence056 649 167 gene locus_tag LOCUS_10780 649 167 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327445.1 protein_id gnl|my_center|LOCUS_10780 1094 654 gene locus_tag LOCUS_10790 1094 654 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327446.1 protein_id gnl|my_center|LOCUS_10790 1845 1102 gene locus_tag LOCUS_10800 1845 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 3111 2017 gene locus_tag LOCUS_10810 3111 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 6429 3130 gene locus_tag LOCUS_10820 6429 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922202.1 protein_id gnl|my_center|LOCUS_10820 8629 6521 gene locus_tag LOCUS_10830 8629 6521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 9125 8634 gene locus_tag LOCUS_10840 9125 8634 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313922.1 protein_id gnl|my_center|LOCUS_10840 10949 9285 gene locus_tag LOCUS_10850 gene serA 10949 9285 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326392.1 protein_id gnl|my_center|LOCUS_10850 12111 10990 gene locus_tag LOCUS_10860 gene serC 12111 10990 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434814.1 protein_id gnl|my_center|LOCUS_10860 12878 12225 gene locus_tag LOCUS_10870 12878 12225 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816749.1 protein_id gnl|my_center|LOCUS_10870 13572 13333 gene locus_tag LOCUS_10880 13572 13333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 <14313 13762 gene locus_tag LOCUS_10890 <14313 13762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007325534.1:FHA domain-containing protein >Feature sequence057 <1 1938 gene locus_tag LOCUS_10900 <1 1938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122785.1:hemolysin D 2306 2013 gene locus_tag LOCUS_10910 2306 2013 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_10910 2587 2306 gene locus_tag LOCUS_10920 2587 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 2675 2917 gene locus_tag LOCUS_10930 2675 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 2933 3169 gene locus_tag LOCUS_10940 2933 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 3166 3537 gene locus_tag LOCUS_10950 3166 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 3580 4467 gene locus_tag LOCUS_10960 3580 4467 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903268.1 protein_id gnl|my_center|LOCUS_10960 6416 4473 gene locus_tag LOCUS_10970 6416 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 8776 6557 gene locus_tag LOCUS_10980 8776 6557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 11751 8836 gene locus_tag LOCUS_10990 11751 8836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 14068 12032 gene locus_tag LOCUS_11000 14068 12032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 >Feature sequence058 1573 134 gene locus_tag LOCUS_11010 1573 134 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119574.1 protein_id gnl|my_center|LOCUS_11010 2489 1794 gene locus_tag LOCUS_11020 2489 1794 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331623.1 protein_id gnl|my_center|LOCUS_11020 2587 3702 gene locus_tag LOCUS_11030 2587 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 3714 5183 gene locus_tag LOCUS_11040 3714 5183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 6619 5219 gene locus_tag LOCUS_11050 gene hisS 6619 5219 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117814.1 protein_id gnl|my_center|LOCUS_11050 7113 6616 gene locus_tag LOCUS_11060 7113 6616 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117815.1 protein_id gnl|my_center|LOCUS_11060 7203 8987 gene locus_tag LOCUS_11070 gene recJ 7203 8987 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338790.1 protein_id gnl|my_center|LOCUS_11070 9031 10389 gene locus_tag LOCUS_11080 9031 10389 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 protein_id gnl|my_center|LOCUS_11080 10488 10563 gene locus_tag LOCUS_t00120 10488 10563 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 11527 10577 gene locus_tag LOCUS_11090 11527 10577 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616128.1 protein_id gnl|my_center|LOCUS_11090 12436 11789 gene locus_tag LOCUS_11100 gene pdxH 12436 11789 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188935.1 protein_id gnl|my_center|LOCUS_11100 12990 12583 gene locus_tag LOCUS_11110 12990 12583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663813.1 protein_id gnl|my_center|LOCUS_11110 <14020 13110 gene locus_tag LOCUS_11120 <14020 13110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124080.1:DUF1559 domain-containing protein >Feature sequence059 <1 2039 gene locus_tag LOCUS_11130 <1 2039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119132.1:glycosyltransferase family 4 protein 1933 3360 gene locus_tag LOCUS_11140 1933 3360 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119131.1 protein_id gnl|my_center|LOCUS_11140 3986 3534 gene locus_tag LOCUS_11150 3986 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 4181 4657 gene locus_tag LOCUS_11160 4181 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 4915 4676 gene locus_tag LOCUS_11170 4915 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 5575 5117 gene locus_tag LOCUS_11180 5575 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 6133 5690 gene locus_tag LOCUS_11190 6133 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 6248 6742 gene locus_tag LOCUS_11200 6248 6742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 6811 7782 gene locus_tag LOCUS_11210 6811 7782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 9497 7779 gene locus_tag LOCUS_11220 9497 7779 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066137.1 protein_id gnl|my_center|LOCUS_11220 9731 10330 gene locus_tag LOCUS_11230 9731 10330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 11167 10334 gene locus_tag LOCUS_11240 11167 10334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 11234 12106 gene locus_tag LOCUS_11250 11234 12106 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529491.1 protein_id gnl|my_center|LOCUS_11250 12124 13380 gene locus_tag LOCUS_11260 12124 13380 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_11260 13418 13729 gene locus_tag LOCUS_11270 13418 13729 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704380.1 protein_id gnl|my_center|LOCUS_11270 >Feature sequence060 3723 2368 gene locus_tag LOCUS_11280 3723 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 6606 3769 gene locus_tag LOCUS_11290 gene aceE 6606 3769 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119356.1 protein_id gnl|my_center|LOCUS_11290 8136 6709 gene locus_tag LOCUS_11300 gene lpdA 8136 6709 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118277.1 protein_id gnl|my_center|LOCUS_11300 8293 9777 gene locus_tag LOCUS_11310 8293 9777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 9832 9914 gene locus_tag LOCUS_t00130 9832 9914 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11099 9966 gene locus_tag LOCUS_11320 11099 9966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 >Feature sequence061 341 1891 gene locus_tag LOCUS_11330 341 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 1888 2550 gene locus_tag LOCUS_11340 1888 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 3389 2538 gene locus_tag LOCUS_11350 3389 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 4441 3386 gene locus_tag LOCUS_11360 4441 3386 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533312.1 protein_id gnl|my_center|LOCUS_11360 4687 5781 gene locus_tag LOCUS_11370 4687 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 5818 6471 gene locus_tag LOCUS_11380 5818 6471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 8932 6488 gene locus_tag LOCUS_11390 8932 6488 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858944.1 protein_id gnl|my_center|LOCUS_11390 9496 9284 gene locus_tag LOCUS_11400 9496 9284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 9633 9974 gene locus_tag LOCUS_11410 9633 9974 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229003.1 protein_id gnl|my_center|LOCUS_11410 10371 9991 gene locus_tag LOCUS_11420 10371 9991 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075358.1 protein_id gnl|my_center|LOCUS_11420 11489 10695 gene locus_tag LOCUS_11430 11489 10695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 11938 12657 gene locus_tag LOCUS_11440 11938 12657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 12735 13652 gene locus_tag LOCUS_11450 12735 13652 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324646.1 protein_id gnl|my_center|LOCUS_11450 >Feature sequence062 1193 2371 gene locus_tag LOCUS_11460 1193 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 3952 2390 gene locus_tag LOCUS_11470 3952 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 4408 3962 gene locus_tag LOCUS_11480 4408 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 5461 4535 gene locus_tag LOCUS_11490 5461 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 5841 7118 gene locus_tag LOCUS_11500 gene rhaA 5841 7118 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211483.1 protein_id gnl|my_center|LOCUS_11500 7115 8785 gene locus_tag LOCUS_11510 7115 8785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921337.1 protein_id gnl|my_center|LOCUS_11510 10171 8849 gene locus_tag LOCUS_11520 10171 8849 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448293.1 protein_id gnl|my_center|LOCUS_11520 13063 10313 gene locus_tag LOCUS_11530 gene ppc 13063 10313 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259010.1 protein_id gnl|my_center|LOCUS_11530 >Feature sequence063 <1 775 gene locus_tag LOCUS_11540 <1 775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922486.1:dihydroxy-acid dehydratase 2041 1142 gene locus_tag LOCUS_11550 2041 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 2797 2105 gene locus_tag LOCUS_11560 2797 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326821.1 protein_id gnl|my_center|LOCUS_11560 3004 4479 gene locus_tag LOCUS_11570 gene guaB 3004 4479 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325011.1 protein_id gnl|my_center|LOCUS_11570 4572 5204 gene locus_tag LOCUS_11580 4572 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 5940 5224 gene locus_tag LOCUS_11590 5940 5224 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530940.1 protein_id gnl|my_center|LOCUS_11590 7202 5937 gene locus_tag LOCUS_11600 7202 5937 CDS product DUF3419 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530941.1 protein_id gnl|my_center|LOCUS_11600 8776 7292 gene locus_tag LOCUS_11610 8776 7292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 9142 10593 gene locus_tag LOCUS_11620 9142 10593 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121117.1 protein_id gnl|my_center|LOCUS_11620 11351 11022 gene locus_tag LOCUS_11630 gene trxA 11351 11022 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329897.1 protein_id gnl|my_center|LOCUS_11630 11477 12859 gene locus_tag LOCUS_11640 11477 12859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 12865 13077 gene locus_tag LOCUS_11650 12865 13077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 >Feature sequence064 691 1503 gene locus_tag LOCUS_11660 691 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 4050 1513 gene locus_tag LOCUS_11670 4050 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 5198 4461 gene locus_tag LOCUS_11680 5198 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 6268 5195 gene locus_tag LOCUS_11690 6268 5195 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_11690 7284 6265 gene locus_tag LOCUS_11700 7284 6265 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_11700 8531 7452 gene locus_tag LOCUS_11710 8531 7452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 9517 8528 gene locus_tag LOCUS_11720 9517 8528 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546375.1 protein_id gnl|my_center|LOCUS_11720 11518 9521 gene locus_tag LOCUS_11730 11518 9521 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_11730 12815 11562 gene locus_tag LOCUS_11740 gene ribA 12815 11562 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123761.1 protein_id gnl|my_center|LOCUS_11740 >Feature sequence065 1906 65 gene locus_tag LOCUS_11750 1906 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 2670 2080 gene locus_tag LOCUS_11760 2670 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 2587 2778 gene locus_tag LOCUS_11770 2587 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 2865 4217 gene locus_tag LOCUS_11780 gene thiC 2865 4217 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326663.1 protein_id gnl|my_center|LOCUS_11780 4833 4378 gene locus_tag LOCUS_11790 4833 4378 CDS product ABA4-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143823.1 protein_id gnl|my_center|LOCUS_11790 6377 4830 gene locus_tag LOCUS_11800 gene cysS 6377 4830 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921769.1 protein_id gnl|my_center|LOCUS_11800 6903 6409 gene locus_tag LOCUS_11810 gene ispF 6903 6409 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921639.1 protein_id gnl|my_center|LOCUS_11810 7045 7593 gene locus_tag LOCUS_11820 7045 7593 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888357.1 protein_id gnl|my_center|LOCUS_11820 7590 8606 gene locus_tag LOCUS_11830 7590 8606 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327241.1 protein_id gnl|my_center|LOCUS_11830 8603 9466 gene locus_tag LOCUS_11840 8603 9466 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333288.1 protein_id gnl|my_center|LOCUS_11840 9468 10286 gene locus_tag LOCUS_11850 9468 10286 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333289.1 protein_id gnl|my_center|LOCUS_11850 10372 11442 gene locus_tag LOCUS_11860 10372 11442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 11439 12827 gene locus_tag LOCUS_11870 11439 12827 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259854.1 protein_id gnl|my_center|LOCUS_11870 12824 13057 gene locus_tag LOCUS_11880 12824 13057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 >Feature sequence066 <1 666 gene locus_tag LOCUS_11890 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918484.1:chemotaxis response regulator protein-glutamate methylesterase 663 1490 gene locus_tag LOCUS_11900 663 1490 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084985.1 protein_id gnl|my_center|LOCUS_11900 1880 1572 gene locus_tag LOCUS_11910 1880 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 3347 1968 gene locus_tag LOCUS_11920 3347 1968 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463782.1 protein_id gnl|my_center|LOCUS_11920 3703 3347 gene locus_tag LOCUS_11930 3703 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 4312 3818 gene locus_tag LOCUS_11940 4312 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 5299 4355 gene locus_tag LOCUS_11950 5299 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118516.1 protein_id gnl|my_center|LOCUS_11950 5805 5296 gene locus_tag LOCUS_11960 5805 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 5786 6322 gene locus_tag LOCUS_11970 5786 6322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 6772 8619 gene locus_tag LOCUS_11980 6772 8619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 8663 9400 gene locus_tag LOCUS_11990 8663 9400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 9670 9404 gene locus_tag LOCUS_12000 9670 9404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442631.1 protein_id gnl|my_center|LOCUS_12000 10837 9794 gene locus_tag LOCUS_12010 10837 9794 CDS product transaldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119230.1 protein_id gnl|my_center|LOCUS_12010 10955 12370 gene locus_tag LOCUS_12020 10955 12370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 >Feature sequence067 <1 1540 gene locus_tag LOCUS_12030 <1 1540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921470.1:polyketide synthase 1551 3266 gene locus_tag LOCUS_12040 1551 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 3646 4692 gene locus_tag LOCUS_12050 3646 4692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615992.1 protein_id gnl|my_center|LOCUS_12050 4718 5890 gene locus_tag LOCUS_12060 4718 5890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 5887 7665 gene locus_tag LOCUS_12070 5887 7665 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922881.1 protein_id gnl|my_center|LOCUS_12070 7740 8720 gene locus_tag LOCUS_12080 7740 8720 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922058.1 protein_id gnl|my_center|LOCUS_12080 8717 10711 gene locus_tag LOCUS_12090 8717 10711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 12073 10754 gene locus_tag LOCUS_12100 12073 10754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 >Feature sequence068 539 1675 gene locus_tag LOCUS_12110 539 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 1708 2934 gene locus_tag LOCUS_12120 1708 2934 CDS product ribonucleotide-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729614.1 protein_id gnl|my_center|LOCUS_12120 2931 4460 gene locus_tag LOCUS_12130 2931 4460 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061255.1 protein_id gnl|my_center|LOCUS_12130 5489 4455 gene locus_tag LOCUS_12140 5489 4455 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922490.1 protein_id gnl|my_center|LOCUS_12140 6791 5574 gene locus_tag LOCUS_12150 gene chrA 6791 5574 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008460270.1 protein_id gnl|my_center|LOCUS_12150 7759 6839 gene locus_tag LOCUS_12160 7759 6839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 9345 7756 gene locus_tag LOCUS_12170 9345 7756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 9455 12244 gene locus_tag LOCUS_12180 gene leuS 9455 12244 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122073.1 protein_id gnl|my_center|LOCUS_12180 >Feature sequence069 1535 378 gene locus_tag LOCUS_12190 1535 378 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922041.1 protein_id gnl|my_center|LOCUS_12190 2104 1556 gene locus_tag LOCUS_12200 2104 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 2245 3063 gene locus_tag LOCUS_12210 2245 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 4720 3050 gene locus_tag LOCUS_12220 4720 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615466.1 protein_id gnl|my_center|LOCUS_12220 4831 6216 gene locus_tag LOCUS_12230 4831 6216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 6770 6402 gene locus_tag LOCUS_12240 6770 6402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 6941 7852 gene locus_tag LOCUS_12250 6941 7852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 7849 8637 gene locus_tag LOCUS_12260 7849 8637 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221995.1 protein_id gnl|my_center|LOCUS_12260 8634 9725 gene locus_tag LOCUS_12270 8634 9725 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809384.1 protein_id gnl|my_center|LOCUS_12270 9856 10182 gene locus_tag LOCUS_12280 9856 10182 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442716.1 protein_id gnl|my_center|LOCUS_12280 10259 12346 gene locus_tag LOCUS_12290 10259 12346 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922336.1 protein_id gnl|my_center|LOCUS_12290 >Feature sequence070 773 174 gene locus_tag LOCUS_12300 773 174 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921444.1 protein_id gnl|my_center|LOCUS_12300 772 1476 gene locus_tag LOCUS_12310 772 1476 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921977.1 protein_id gnl|my_center|LOCUS_12310 1481 2854 gene locus_tag LOCUS_12320 1481 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 2957 3030 gene locus_tag LOCUS_t00140 2957 3030 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3439 3110 gene locus_tag LOCUS_12330 3439 3110 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957599.1 protein_id gnl|my_center|LOCUS_12330 3796 8472 gene locus_tag LOCUS_12340 3796 8472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 7608 7700 gene locus_tag LOCUS_t00150 7608 7700 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8481 9512 gene locus_tag LOCUS_12350 8481 9512 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615947.1 protein_id gnl|my_center|LOCUS_12350 9559 10608 gene locus_tag LOCUS_12360 9559 10608 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_12360 10598 11473 gene locus_tag LOCUS_12370 10598 11473 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118532.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence071 27 3125 gene locus_tag LOCUS_12380 27 3125 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615874.1 protein_id gnl|my_center|LOCUS_12380 3122 3445 gene locus_tag LOCUS_12390 3122 3445 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326696.1 protein_id gnl|my_center|LOCUS_12390 3446 5635 gene locus_tag LOCUS_12400 3446 5635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 5632 6564 gene locus_tag LOCUS_12410 5632 6564 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326694.1 protein_id gnl|my_center|LOCUS_12410 6775 7167 gene locus_tag LOCUS_12420 6775 7167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 7152 7604 gene locus_tag LOCUS_12430 7152 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 7705 7839 gene locus_tag LOCUS_12440 7705 7839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 8048 9100 gene locus_tag LOCUS_12450 8048 9100 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_12450 9132 10370 gene locus_tag LOCUS_12460 9132 10370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 >Feature sequence072 147 476 gene locus_tag LOCUS_12470 147 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 436 711 gene locus_tag LOCUS_12480 436 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 844 993 gene locus_tag LOCUS_12490 844 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 1030 1383 gene locus_tag LOCUS_12500 1030 1383 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_12500 1389 1637 gene locus_tag LOCUS_12510 1389 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 1917 2240 gene locus_tag LOCUS_12520 1917 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12520 2469 2993 gene locus_tag LOCUS_12530 2469 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 3222 2974 gene locus_tag LOCUS_12540 3222 2974 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966522.1 protein_id gnl|my_center|LOCUS_12540 3328 3702 gene locus_tag LOCUS_12550 3328 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 4046 3699 gene locus_tag LOCUS_12560 4046 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 4300 4043 gene locus_tag LOCUS_12570 4300 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 5455 4316 gene locus_tag LOCUS_12580 5455 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 5870 6049 gene locus_tag LOCUS_12590 5870 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 6176 6103 gene locus_tag LOCUS_t00160 6176 6103 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6895 6269 gene locus_tag LOCUS_12600 6895 6269 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122508.1 protein_id gnl|my_center|LOCUS_12600 8160 6934 gene locus_tag LOCUS_12610 gene fabF 8160 6934 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144002.1 protein_id gnl|my_center|LOCUS_12610 9020 8160 gene locus_tag LOCUS_12620 9020 8160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 9306 9040 gene locus_tag LOCUS_12630 9306 9040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 9386 9787 gene locus_tag LOCUS_12640 9386 9787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 10954 9884 gene locus_tag LOCUS_12650 10954 9884 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921666.1 protein_id gnl|my_center|LOCUS_12650 11010 11834 gene locus_tag LOCUS_12660 11010 11834 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_12660 >Feature sequence073 1457 168 gene locus_tag LOCUS_12670 1457 168 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117891.1 protein_id gnl|my_center|LOCUS_12670 3706 1472 gene locus_tag LOCUS_12680 3706 1472 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117890.1 protein_id gnl|my_center|LOCUS_12680 3930 4868 gene locus_tag LOCUS_12690 3930 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 4955 5566 gene locus_tag LOCUS_12700 4955 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 5725 5652 gene locus_tag LOCUS_t00170 5725 5652 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 7196 5997 gene locus_tag LOCUS_12710 7196 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 7195 7731 gene locus_tag LOCUS_12720 7195 7731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 9004 7982 gene locus_tag LOCUS_12730 9004 7982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 10828 9623 gene locus_tag LOCUS_12740 gene ilvA 10828 9623 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_12740 11391 10825 gene locus_tag LOCUS_12750 11391 10825 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117887.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence074 830 1012 gene locus_tag LOCUS_12760 830 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 1915 1076 gene locus_tag LOCUS_12770 1915 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339871.1 protein_id gnl|my_center|LOCUS_12770 2679 1912 gene locus_tag LOCUS_12780 2679 1912 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327962.1 protein_id gnl|my_center|LOCUS_12780 3083 3631 gene locus_tag LOCUS_12790 3083 3631 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942345.1 protein_id gnl|my_center|LOCUS_12790 3628 4776 gene locus_tag LOCUS_12800 gene dgt 3628 4776 CDS product dNTP triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817450.1 protein_id gnl|my_center|LOCUS_12800 4786 5811 gene locus_tag LOCUS_12810 4786 5811 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338937.1 protein_id gnl|my_center|LOCUS_12810 5864 7354 gene locus_tag LOCUS_12820 5864 7354 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_12820 8684 7356 gene locus_tag LOCUS_12830 8684 7356 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615422.1 protein_id gnl|my_center|LOCUS_12830 8715 11108 gene locus_tag LOCUS_12840 8715 11108 CDS product PA14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122548.1 protein_id gnl|my_center|LOCUS_12840 >Feature sequence075 630 11669 gene locus_tag LOCUS_12850 630 11669 CDS product autotransporter-associated beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104543246.1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence076 1 1809 gene locus_tag LOCUS_12860 1 1809 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332595.1 protein_id gnl|my_center|LOCUS_12860 2857 1811 gene locus_tag LOCUS_12870 2857 1811 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102017617.1 protein_id gnl|my_center|LOCUS_12870 6219 2854 gene locus_tag LOCUS_12880 6219 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 6869 6183 gene locus_tag LOCUS_12890 6869 6183 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339513.1 protein_id gnl|my_center|LOCUS_12890 7180 8220 gene locus_tag LOCUS_12900 7180 8220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 8689 8192 gene locus_tag LOCUS_12910 8689 8192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 8974 10467 gene locus_tag LOCUS_12920 8974 10467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 10597 11565 gene locus_tag LOCUS_12930 10597 11565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 >Feature sequence077 1703 597 gene locus_tag LOCUS_12940 1703 597 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208032.1 protein_id gnl|my_center|LOCUS_12940 2005 2727 gene locus_tag LOCUS_12950 2005 2727 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407647.1 protein_id gnl|my_center|LOCUS_12950 2753 3562 gene locus_tag LOCUS_12960 2753 3562 CDS product PGL/p-HBAD biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003918527.1 protein_id gnl|my_center|LOCUS_12960 4016 3636 gene locus_tag LOCUS_12970 4016 3636 CDS product DUF3127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330460.1 protein_id gnl|my_center|LOCUS_12970 4947 4180 gene locus_tag LOCUS_12980 4947 4180 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_12980 5088 6131 gene locus_tag LOCUS_12990 5088 6131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 7883 6222 gene locus_tag LOCUS_13000 7883 6222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 8055 7982 gene locus_tag LOCUS_t00180 8055 7982 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8267 9835 gene locus_tag LOCUS_13010 8267 9835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 10254 11678 gene locus_tag LOCUS_13020 10254 11678 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_13020 >Feature sequence078 128 48 gene locus_tag LOCUS_r00010 128 48 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 68 percent of the 5S ribosomal RNA 3132 232 gene locus_tag LOCUS_r00020 3132 232 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3734 4984 gene locus_tag LOCUS_13030 3734 4984 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140498.1 protein_id gnl|my_center|LOCUS_13030 4981 8334 gene locus_tag LOCUS_13040 4981 8334 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461050.1 protein_id gnl|my_center|LOCUS_13040 8791 8273 gene locus_tag LOCUS_13050 8791 8273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 8982 8910 gene locus_tag LOCUS_t00190 8982 8910 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 9285 10739 gene locus_tag LOCUS_13060 gene gnd 9285 10739 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119037.1 protein_id gnl|my_center|LOCUS_13060 10736 11530 gene locus_tag LOCUS_13070 10736 11530 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332279.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence079 343 1356 gene locus_tag LOCUS_13080 343 1356 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_13080 1359 1826 gene locus_tag LOCUS_13090 1359 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 3030 2206 gene locus_tag LOCUS_13100 3030 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 2921 3208 gene locus_tag LOCUS_13110 2921 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 3205 3765 gene locus_tag LOCUS_13120 3205 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 5369 3789 gene locus_tag LOCUS_13130 5369 3789 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435129.1 protein_id gnl|my_center|LOCUS_13130 6255 5362 gene locus_tag LOCUS_13140 6255 5362 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992443.1 protein_id gnl|my_center|LOCUS_13140 6466 8703 gene locus_tag LOCUS_13150 6466 8703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 8870 9874 gene locus_tag LOCUS_13160 gene gmd 8870 9874 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_13160 10799 9948 gene locus_tag LOCUS_13170 10799 9948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 >Feature sequence080 151 2421 gene locus_tag LOCUS_13180 151 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 3314 2328 gene locus_tag LOCUS_13190 3314 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 5369 3777 gene locus_tag LOCUS_13200 5369 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 8327 5610 gene locus_tag LOCUS_13210 gene acnA 8327 5610 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118669.1 protein_id gnl|my_center|LOCUS_13210 10471 8822 gene locus_tag LOCUS_13220 10471 8822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 >Feature sequence081 2714 888 gene locus_tag LOCUS_13230 2714 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 3374 2796 gene locus_tag LOCUS_13240 gene pyrE 3374 2796 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231846080.1 protein_id gnl|my_center|LOCUS_13240 3484 5577 gene locus_tag LOCUS_13250 3484 5577 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921569.1 protein_id gnl|my_center|LOCUS_13250 5574 6185 gene locus_tag LOCUS_13260 5574 6185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 6259 7272 gene locus_tag LOCUS_13270 gene floA 6259 7272 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327694.1 protein_id gnl|my_center|LOCUS_13270 7269 7958 gene locus_tag LOCUS_13280 7269 7958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 8391 9902 gene locus_tag LOCUS_13290 8391 9902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 11263 10349 gene locus_tag LOCUS_13300 11263 10349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 >Feature sequence082 1483 293 gene locus_tag LOCUS_13310 1483 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 2345 1701 gene locus_tag LOCUS_13320 2345 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 2785 2342 gene locus_tag LOCUS_13330 2785 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 3864 2782 gene locus_tag LOCUS_13340 3864 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121229.1 protein_id gnl|my_center|LOCUS_13340 4275 3970 gene locus_tag LOCUS_13350 4275 3970 CDS product DNA-directed RNA polymerase subunit alpha C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326741.1 protein_id gnl|my_center|LOCUS_13350 4392 6752 gene locus_tag LOCUS_13360 4392 6752 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123700.1 protein_id gnl|my_center|LOCUS_13360 7000 6839 gene locus_tag LOCUS_13370 7000 6839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 8325 7273 gene locus_tag LOCUS_13380 8325 7273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 9193 8351 gene locus_tag LOCUS_13390 9193 8351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 9853 10111 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cacctgcacgctcaccggc >Feature sequence083 669 1214 gene locus_tag LOCUS_13400 gene smpB 669 1214 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615559.1 protein_id gnl|my_center|LOCUS_13400 1463 1242 gene locus_tag LOCUS_13410 1463 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 2237 1779 gene locus_tag LOCUS_13420 2237 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 2896 2249 gene locus_tag LOCUS_13430 2896 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 3458 2913 gene locus_tag LOCUS_13440 3458 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122270.1 protein_id gnl|my_center|LOCUS_13440 3563 4483 gene locus_tag LOCUS_13450 3563 4483 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615838.1 protein_id gnl|my_center|LOCUS_13450 4855 6519 gene locus_tag LOCUS_13460 gene purH 4855 6519 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122619.1 protein_id gnl|my_center|LOCUS_13460 6793 7593 gene locus_tag LOCUS_13470 gene trpC 6793 7593 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122620.1 protein_id gnl|my_center|LOCUS_13470 8291 7575 gene locus_tag LOCUS_13480 8291 7575 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326130.1 protein_id gnl|my_center|LOCUS_13480 9336 8296 gene locus_tag LOCUS_13490 9336 8296 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922157.1 protein_id gnl|my_center|LOCUS_13490 9572 10699 gene locus_tag LOCUS_13500 9572 10699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667978.1 protein_id gnl|my_center|LOCUS_13500 11056 10706 gene locus_tag LOCUS_13510 11056 10706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 >Feature sequence084 996 85 gene locus_tag LOCUS_13520 gene cysD 996 85 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140408.1 protein_id gnl|my_center|LOCUS_13520 2689 1412 gene locus_tag LOCUS_13530 2689 1412 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119979.1 protein_id gnl|my_center|LOCUS_13530 3192 2686 gene locus_tag LOCUS_13540 3192 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 5648 3192 gene locus_tag LOCUS_13550 5648 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 6597 5662 gene locus_tag LOCUS_13560 6597 5662 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119981.1 protein_id gnl|my_center|LOCUS_13560 7645 6719 gene locus_tag LOCUS_13570 7645 6719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 8319 7642 gene locus_tag LOCUS_13580 gene uppS 8319 7642 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328291.1 protein_id gnl|my_center|LOCUS_13580 9695 8373 gene locus_tag LOCUS_13590 9695 8373 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333174.1 protein_id gnl|my_center|LOCUS_13590 9819 10805 gene locus_tag LOCUS_13600 9819 10805 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383613.1 protein_id gnl|my_center|LOCUS_13600 >Feature sequence085 <1 618 gene locus_tag LOCUS_13610 <1 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227835.1:2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase 625 2010 gene locus_tag LOCUS_13620 gene lpdA 625 2010 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119002.1 protein_id gnl|my_center|LOCUS_13620 2408 2160 gene locus_tag LOCUS_13630 2408 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 2495 3796 gene locus_tag LOCUS_13640 2495 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 3918 4175 gene locus_tag LOCUS_13650 3918 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 4227 5177 gene locus_tag LOCUS_13660 gene prmA 4227 5177 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941115.1 protein_id gnl|my_center|LOCUS_13660 5732 6298 gene locus_tag LOCUS_13670 5732 6298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 7031 6684 gene locus_tag LOCUS_13680 7031 6684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 7339 7028 gene locus_tag LOCUS_13690 7339 7028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 7414 7713 gene locus_tag LOCUS_13700 7414 7713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 8092 8019 gene locus_tag LOCUS_t00200 8092 8019 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9204 8155 gene locus_tag LOCUS_13710 9204 8155 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120960.1 protein_id gnl|my_center|LOCUS_13710 10538 9201 gene locus_tag LOCUS_13720 10538 9201 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121211.1 protein_id gnl|my_center|LOCUS_13720 <11122 10535 gene locus_tag LOCUS_13730 <11122 10535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922871.1:DUF1592 domain-containing protein >Feature sequence086 <1 653 gene locus_tag LOCUS_13740 <1 653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027286.1:endo-1,4-beta-xylanase 945 1613 gene locus_tag LOCUS_13750 945 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1692 2462 gene locus_tag LOCUS_13760 1692 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 2695 3699 gene locus_tag LOCUS_13770 2695 3699 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328832.1 protein_id gnl|my_center|LOCUS_13770 3709 4200 gene locus_tag LOCUS_13780 3709 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 4217 4732 gene locus_tag LOCUS_13790 4217 4732 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105333325.1 protein_id gnl|my_center|LOCUS_13790 4798 6228 gene locus_tag LOCUS_13800 4798 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 6228 7571 gene locus_tag LOCUS_13810 6228 7571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 7658 8431 gene locus_tag LOCUS_13820 7658 8431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 8447 10735 gene locus_tag LOCUS_13830 8447 10735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 >Feature sequence087 4246 1226 gene locus_tag LOCUS_13840 4246 1226 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_13840 4386 5768 gene locus_tag LOCUS_13850 4386 5768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 5869 7587 gene locus_tag LOCUS_13860 5869 7587 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256609.1 protein_id gnl|my_center|LOCUS_13860 8287 7568 gene locus_tag LOCUS_13870 8287 7568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 10420 8351 gene locus_tag LOCUS_13880 10420 8351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 >Feature sequence088 1037 189 gene locus_tag LOCUS_13890 1037 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 1956 1048 gene locus_tag LOCUS_13900 1956 1048 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231846539.1 protein_id gnl|my_center|LOCUS_13900 2697 2014 gene locus_tag LOCUS_13910 2697 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 2635 2817 gene locus_tag LOCUS_13920 2635 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 2860 3585 gene locus_tag LOCUS_13930 2860 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 5782 3608 gene locus_tag LOCUS_13940 5782 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 7281 5806 gene locus_tag LOCUS_13950 7281 5806 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_13950 8834 7965 gene locus_tag LOCUS_13960 8834 7965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 9691 8846 gene locus_tag LOCUS_13970 9691 8846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 <11039 9756 gene locus_tag LOCUS_13980 <11039 9756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788731.1:PhoH family protein >Feature sequence089 379 2001 gene locus_tag LOCUS_13990 379 2001 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405542.1 protein_id gnl|my_center|LOCUS_13990 2005 3012 gene locus_tag LOCUS_14000 2005 3012 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082403.1 protein_id gnl|my_center|LOCUS_14000 3157 4683 gene locus_tag LOCUS_14010 3157 4683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 4755 7796 gene locus_tag LOCUS_14020 4755 7796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 7786 8481 gene locus_tag LOCUS_14030 7786 8481 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063801.1 protein_id gnl|my_center|LOCUS_14030 >Feature sequence090 <1 582 gene locus_tag LOCUS_14040 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938554.1:glutamine synthetase III 582 1241 gene locus_tag LOCUS_14050 gene rsmG 582 1241 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334161.1 protein_id gnl|my_center|LOCUS_14050 1548 2510 gene locus_tag LOCUS_14060 1548 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 2830 3324 gene locus_tag LOCUS_14070 2830 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 3403 3585 gene locus_tag LOCUS_14080 3403 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 3799 4932 gene locus_tag LOCUS_14090 3799 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 6270 5044 gene locus_tag LOCUS_14100 6270 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 6401 6823 gene locus_tag LOCUS_14110 6401 6823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 8260 6845 gene locus_tag LOCUS_14120 8260 6845 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096456532.1 protein_id gnl|my_center|LOCUS_14120 10858 8780 gene locus_tag LOCUS_14130 gene ppdK 10858 8780 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933346.1 protein_id gnl|my_center|LOCUS_14130 >Feature sequence091 187 2697 gene locus_tag LOCUS_14140 gene mutS 187 2697 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121304.1 protein_id gnl|my_center|LOCUS_14140 5190 2875 gene locus_tag LOCUS_14150 5190 2875 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121932.1 protein_id gnl|my_center|LOCUS_14150 6853 5375 gene locus_tag LOCUS_14160 6853 5375 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122652.1 protein_id gnl|my_center|LOCUS_14160 7028 7597 gene locus_tag LOCUS_14170 7028 7597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328536.1 protein_id gnl|my_center|LOCUS_14170 7817 9115 gene locus_tag LOCUS_14180 7817 9115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 9145 9555 gene locus_tag LOCUS_14190 9145 9555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 9545 9952 gene locus_tag LOCUS_14200 9545 9952 CDS product type II toxin-antitoxin system toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073053.1 protein_id gnl|my_center|LOCUS_14200 9967 10464 gene locus_tag LOCUS_14210 9967 10464 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257521.1 protein_id gnl|my_center|LOCUS_14210 >Feature sequence092 1766 180 gene locus_tag LOCUS_14220 1766 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 2012 2953 gene locus_tag LOCUS_14230 gene galT 2012 2953 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367649.1 protein_id gnl|my_center|LOCUS_14230 2950 3966 gene locus_tag LOCUS_14240 2950 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 3963 5180 gene locus_tag LOCUS_14250 3963 5180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 6208 5213 gene locus_tag LOCUS_14260 6208 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 7663 6257 gene locus_tag LOCUS_14270 7663 6257 CDS product glycoside hydrolase family 140 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 protein_id gnl|my_center|LOCUS_14270 <10691 7791 gene locus_tag LOCUS_14280 <10691 7791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099260976.1:preprotein translocase subunit SecA >Feature sequence093 272 2230 gene locus_tag LOCUS_14290 272 2230 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868795.1 protein_id gnl|my_center|LOCUS_14290 2275 3390 gene locus_tag LOCUS_14300 2275 3390 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044915.1 protein_id gnl|my_center|LOCUS_14300 3403 4533 gene locus_tag LOCUS_14310 3403 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 4530 6449 gene locus_tag LOCUS_14320 4530 6449 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272023.1 protein_id gnl|my_center|LOCUS_14320 6568 7191 gene locus_tag LOCUS_14330 6568 7191 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256836.1 protein_id gnl|my_center|LOCUS_14330 7188 7466 gene locus_tag LOCUS_14340 7188 7466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 7463 8827 gene locus_tag LOCUS_14350 7463 8827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 8948 9154 gene locus_tag LOCUS_14360 8948 9154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 9151 9405 gene locus_tag LOCUS_14370 9151 9405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 9410 10132 gene locus_tag LOCUS_14380 9410 10132 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284930.1 protein_id gnl|my_center|LOCUS_14380 10409 10146 gene locus_tag LOCUS_14390 10409 10146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 >Feature sequence094 <1 867 gene locus_tag LOCUS_14400 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921970.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme note possible pseudo, frameshifted 888 2030 gene locus_tag LOCUS_14410 888 2030 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120921.1 protein_id gnl|my_center|LOCUS_14410 2373 4265 gene locus_tag LOCUS_14420 2373 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 4377 5708 gene locus_tag LOCUS_14430 4377 5708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 6549 5806 gene locus_tag LOCUS_14440 6549 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123337.1 protein_id gnl|my_center|LOCUS_14440 6728 6919 gene locus_tag LOCUS_14450 6728 6919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 8145 6940 gene locus_tag LOCUS_14460 gene rho 8145 6940 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330229.1 protein_id gnl|my_center|LOCUS_14460 8523 8708 gene locus_tag LOCUS_14470 8523 8708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 8867 10297 gene locus_tag LOCUS_14480 8867 10297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 >Feature sequence095 308 1729 gene locus_tag LOCUS_14490 308 1729 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123577.1 protein_id gnl|my_center|LOCUS_14490 1755 3515 gene locus_tag LOCUS_14500 gene mutL 1755 3515 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037442.1 protein_id gnl|my_center|LOCUS_14500 3593 5047 gene locus_tag LOCUS_14510 gene aroE 3593 5047 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327789.1 protein_id gnl|my_center|LOCUS_14510 5056 5607 gene locus_tag LOCUS_14520 5056 5607 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119378.1 protein_id gnl|my_center|LOCUS_14520 5604 6713 gene locus_tag LOCUS_14530 5604 6713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 6962 6765 gene locus_tag LOCUS_14540 6962 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 6961 7680 gene locus_tag LOCUS_14550 6961 7680 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921566.1 protein_id gnl|my_center|LOCUS_14550 7705 8307 gene locus_tag LOCUS_14560 gene hisH 7705 8307 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333911.1 protein_id gnl|my_center|LOCUS_14560 8332 9057 gene locus_tag LOCUS_14570 gene hisA 8332 9057 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989518.1 protein_id gnl|my_center|LOCUS_14570 9266 10267 gene locus_tag LOCUS_14580 9266 10267 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence096 873 298 gene locus_tag LOCUS_14590 873 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 1102 863 gene locus_tag LOCUS_14600 1102 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 1181 1528 gene locus_tag LOCUS_14610 1181 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 1554 2165 gene locus_tag LOCUS_14620 1554 2165 CDS product SprT-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_14620 2685 2461 gene locus_tag LOCUS_14630 2685 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 2989 3816 gene locus_tag LOCUS_14640 2989 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 3973 5166 gene locus_tag LOCUS_14650 3973 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 5163 5936 gene locus_tag LOCUS_14660 5163 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 6721 5978 gene locus_tag LOCUS_14670 6721 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 6910 7464 gene locus_tag LOCUS_14680 gene fae 6910 7464 CDS product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122249.1 protein_id gnl|my_center|LOCUS_14680 8393 7491 gene locus_tag LOCUS_14690 8393 7491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 8398 9441 gene locus_tag LOCUS_14700 8398 9441 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762705.1 protein_id gnl|my_center|LOCUS_14700 <10516 9395 gene locus_tag LOCUS_14710 <10516 9395 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107563.1:glycoside hydrolase family 127 protein >Feature sequence097 315 896 gene locus_tag LOCUS_14720 315 896 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_14720 1269 985 gene locus_tag LOCUS_14730 1269 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 1770 1330 gene locus_tag LOCUS_14740 1770 1330 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037198267.1 protein_id gnl|my_center|LOCUS_14740 3123 1993 gene locus_tag LOCUS_14750 3123 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 3488 4000 gene locus_tag LOCUS_14760 3488 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 3997 4971 gene locus_tag LOCUS_14770 gene hemC 3997 4971 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349245.1 protein_id gnl|my_center|LOCUS_14770 5323 5955 gene locus_tag LOCUS_14780 5323 5955 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328106.1 protein_id gnl|my_center|LOCUS_14780 6325 6600 gene locus_tag LOCUS_14790 6325 6600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 7580 6762 gene locus_tag LOCUS_14800 7580 6762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 9708 8170 gene locus_tag LOCUS_14810 9708 8170 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037250650.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence098 1779 175 gene locus_tag LOCUS_14820 1779 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 2027 3034 gene locus_tag LOCUS_14830 2027 3034 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537160.1 protein_id gnl|my_center|LOCUS_14830 3164 3967 gene locus_tag LOCUS_14840 gene cysT 3164 3967 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391148.1 protein_id gnl|my_center|LOCUS_14840 3973 4875 gene locus_tag LOCUS_14850 gene cysW 3973 4875 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530874.1 protein_id gnl|my_center|LOCUS_14850 4872 5954 gene locus_tag LOCUS_14860 4872 5954 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027092.1 protein_id gnl|my_center|LOCUS_14860 5951 6145 gene locus_tag LOCUS_14870 5951 6145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 6257 6928 gene locus_tag LOCUS_14880 6257 6928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 6990 8081 gene locus_tag LOCUS_14890 6990 8081 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122054.1 protein_id gnl|my_center|LOCUS_14890 8181 8660 gene locus_tag LOCUS_14900 8181 8660 CDS product MEKHLA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057304.1 protein_id gnl|my_center|LOCUS_14900 8793 10133 gene locus_tag LOCUS_14910 8793 10133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 >Feature sequence099 113 997 gene locus_tag LOCUS_14920 113 997 CDS product Brp/Blh family beta-carotene 15,15'-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289439.1 protein_id gnl|my_center|LOCUS_14920 994 2193 gene locus_tag LOCUS_14930 994 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 2190 3188 gene locus_tag LOCUS_14940 2190 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 3185 4738 gene locus_tag LOCUS_14950 3185 4738 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106515452.1 protein_id gnl|my_center|LOCUS_14950 4811 5728 gene locus_tag LOCUS_14960 4811 5728 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388253.1 protein_id gnl|my_center|LOCUS_14960 5756 5983 gene locus_tag LOCUS_14970 5756 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 6938 5991 gene locus_tag LOCUS_14980 6938 5991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061589.1 protein_id gnl|my_center|LOCUS_14980 7237 8196 gene locus_tag LOCUS_14990 7237 8196 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140504.1 protein_id gnl|my_center|LOCUS_14990 9857 8289 gene locus_tag LOCUS_15000 gene cimA 9857 8289 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332450.1 protein_id gnl|my_center|LOCUS_15000 >Feature sequence100 237 1718 gene locus_tag LOCUS_15010 gene glgA 237 1718 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121026.1 protein_id gnl|my_center|LOCUS_15010 1833 2168 gene locus_tag LOCUS_15020 1833 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 3184 2177 gene locus_tag LOCUS_15030 3184 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118845.1 protein_id gnl|my_center|LOCUS_15030 4262 3438 gene locus_tag LOCUS_15040 4262 3438 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887660.1 protein_id gnl|my_center|LOCUS_15040 5134 4259 gene locus_tag LOCUS_15050 5134 4259 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258229.1 protein_id gnl|my_center|LOCUS_15050 5199 5672 gene locus_tag LOCUS_15060 5199 5672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 5878 9000 gene locus_tag LOCUS_15070 5878 9000 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666716.1 protein_id gnl|my_center|LOCUS_15070 >Feature sequence101 156 1340 gene locus_tag LOCUS_15080 156 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 1947 1693 gene locus_tag LOCUS_15090 1947 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 3860 1944 gene locus_tag LOCUS_15100 3860 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921289.1 protein_id gnl|my_center|LOCUS_15100 3812 4003 gene locus_tag LOCUS_15110 3812 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 4185 5114 gene locus_tag LOCUS_15120 4185 5114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 5465 5163 gene locus_tag LOCUS_15130 5465 5163 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327966.1 protein_id gnl|my_center|LOCUS_15130 5948 5601 gene locus_tag LOCUS_15140 5948 5601 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057369.1 protein_id gnl|my_center|LOCUS_15140 6034 6294 gene locus_tag LOCUS_15150 6034 6294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333356.1 protein_id gnl|my_center|LOCUS_15150 6351 7271 gene locus_tag LOCUS_15160 gene thyX 6351 7271 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383016.1 protein_id gnl|my_center|LOCUS_15160 7286 7705 gene locus_tag LOCUS_15170 7286 7705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 9319 8075 gene locus_tag LOCUS_15180 9319 8075 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143728.1 protein_id gnl|my_center|LOCUS_15180 10020 9439 gene locus_tag LOCUS_15190 10020 9439 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333306.1 protein_id gnl|my_center|LOCUS_15190 >Feature sequence102 1379 39 gene locus_tag LOCUS_15200 gene mgtE 1379 39 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118267.1 protein_id gnl|my_center|LOCUS_15200 1499 2854 gene locus_tag LOCUS_15210 1499 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616020.1 protein_id gnl|my_center|LOCUS_15210 5146 2894 gene locus_tag LOCUS_15220 5146 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 7199 5226 gene locus_tag LOCUS_15230 7199 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 8212 7196 gene locus_tag LOCUS_15240 8212 7196 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061140.1 protein_id gnl|my_center|LOCUS_15240 10017 8251 gene locus_tag LOCUS_15250 10017 8251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence103 833 63 gene locus_tag LOCUS_15260 833 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 3032 867 gene locus_tag LOCUS_15270 3032 867 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144294.1 protein_id gnl|my_center|LOCUS_15270 4252 3155 gene locus_tag LOCUS_15280 4252 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 5158 4262 gene locus_tag LOCUS_15290 5158 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 5249 6253 gene locus_tag LOCUS_15300 5249 6253 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140943.1 protein_id gnl|my_center|LOCUS_15300 7737 6244 gene locus_tag LOCUS_15310 7737 6244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 7906 8526 gene locus_tag LOCUS_15320 7906 8526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 9048 8611 gene locus_tag LOCUS_15330 9048 8611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 >Feature sequence104 1865 249 gene locus_tag LOCUS_15340 1865 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 2482 1844 gene locus_tag LOCUS_15350 2482 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 3203 2490 gene locus_tag LOCUS_15360 3203 2490 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122393.1 protein_id gnl|my_center|LOCUS_15360 4225 3200 gene locus_tag LOCUS_15370 4225 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 4635 4222 gene locus_tag LOCUS_15380 4635 4222 CDS product PqqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528271.1 protein_id gnl|my_center|LOCUS_15380 5747 4632 gene locus_tag LOCUS_15390 5747 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 6637 5780 gene locus_tag LOCUS_15400 6637 5780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 8651 6789 gene locus_tag LOCUS_15410 8651 6789 CDS product OPT family oligopeptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768135.1 protein_id gnl|my_center|LOCUS_15410 9572 9186 gene locus_tag LOCUS_15420 9572 9186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 >Feature sequence105 215 1246 gene locus_tag LOCUS_15430 215 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 1401 3044 gene locus_tag LOCUS_15440 1401 3044 CDS product IS91-like element ISVsa3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120888.1 protein_id gnl|my_center|LOCUS_15440 4196 3063 gene locus_tag LOCUS_15450 4196 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 4253 4326 gene locus_tag LOCUS_t00210 4253 4326 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4395 4922 gene locus_tag LOCUS_15460 4395 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 5316 5143 gene locus_tag LOCUS_15470 5316 5143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 6407 5313 gene locus_tag LOCUS_15480 6407 5313 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_15480 6808 6407 gene locus_tag LOCUS_15490 6808 6407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 7985 6969 gene locus_tag LOCUS_15500 7985 6969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 9285 8500 gene locus_tag LOCUS_15510 9285 8500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 >Feature sequence106 295 1509 gene locus_tag LOCUS_15520 gene rfaF 295 1509 CDS product ADP-heptose--LPS heptosyltransferase RfaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094907.1 protein_id gnl|my_center|LOCUS_15520 2714 1437 gene locus_tag LOCUS_15530 2714 1437 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037434.1 protein_id gnl|my_center|LOCUS_15530 2934 5426 gene locus_tag LOCUS_15540 2934 5426 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615954.1 protein_id gnl|my_center|LOCUS_15540 5452 6918 gene locus_tag LOCUS_15550 5452 6918 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326676.1 protein_id gnl|my_center|LOCUS_15550 9105 7300 gene locus_tag LOCUS_15560 9105 7300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 9792 9127 gene locus_tag LOCUS_15570 9792 9127 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403350.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence107 1007 426 gene locus_tag LOCUS_15580 1007 426 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_15580 1828 1055 gene locus_tag LOCUS_15590 1828 1055 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391597.1 protein_id gnl|my_center|LOCUS_15590 2419 1988 gene locus_tag LOCUS_15600 2419 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 4086 2428 gene locus_tag LOCUS_15610 gene nuoN 4086 2428 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389443.1 protein_id gnl|my_center|LOCUS_15610 5867 4083 gene locus_tag LOCUS_15620 5867 4083 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257847.1 protein_id gnl|my_center|LOCUS_15620 8315 5910 gene locus_tag LOCUS_15630 gene nuoL 8315 5910 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902441.1 protein_id gnl|my_center|LOCUS_15630 8744 8355 gene locus_tag LOCUS_15640 gene nuoK 8744 8355 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932455.1 protein_id gnl|my_center|LOCUS_15640 9424 8741 gene locus_tag LOCUS_15650 9424 8741 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932454.1 protein_id gnl|my_center|LOCUS_15650 9855 9421 gene locus_tag LOCUS_15660 9855 9421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 >Feature sequence108 263 610 gene locus_tag LOCUS_15670 263 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 653 2236 gene locus_tag LOCUS_15680 653 2236 CDS product IS91-like element ISCR1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050481.1 protein_id gnl|my_center|LOCUS_15680 4421 2433 gene locus_tag LOCUS_15690 4421 2433 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121854.1 protein_id gnl|my_center|LOCUS_15690 6385 4418 gene locus_tag LOCUS_15700 6385 4418 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008705477.1 protein_id gnl|my_center|LOCUS_15700 7985 6459 gene locus_tag LOCUS_15710 7985 6459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 9722 8058 gene locus_tag LOCUS_15720 9722 8058 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922252.1 protein_id gnl|my_center|LOCUS_15720 >Feature sequence109 1758 196 gene locus_tag LOCUS_15730 1758 196 CDS product methyltransferase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387742.1 protein_id gnl|my_center|LOCUS_15730 3103 2105 gene locus_tag LOCUS_15740 3103 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 3983 3108 gene locus_tag LOCUS_15750 3983 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 4087 4824 gene locus_tag LOCUS_15760 4087 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 6024 4960 gene locus_tag LOCUS_15770 6024 4960 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257835.1 protein_id gnl|my_center|LOCUS_15770 6503 8212 gene locus_tag LOCUS_15780 6503 8212 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326169.1 protein_id gnl|my_center|LOCUS_15780 8242 8559 gene locus_tag LOCUS_15790 8242 8559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 8556 9452 gene locus_tag LOCUS_15800 gene folD 8556 9452 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922068.1 protein_id gnl|my_center|LOCUS_15800 >Feature sequence110 404 2416 gene locus_tag LOCUS_15810 404 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 2431 2988 gene locus_tag LOCUS_15820 2431 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 3127 3909 gene locus_tag LOCUS_15830 gene folP 3127 3909 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120943.1 protein_id gnl|my_center|LOCUS_15830 4034 5293 gene locus_tag LOCUS_15840 4034 5293 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121351.1 protein_id gnl|my_center|LOCUS_15840 5476 7590 gene locus_tag LOCUS_15850 5476 7590 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038598.1 protein_id gnl|my_center|LOCUS_15850 8242 7544 gene locus_tag LOCUS_15860 8242 7544 CDS product NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122200.1 protein_id gnl|my_center|LOCUS_15860 <9716 8698 gene locus_tag LOCUS_15870 <9716 8698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869365.1:carbon starvation protein A >Feature sequence111 3219 2563 gene locus_tag LOCUS_15880 3219 2563 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_15880 3881 3216 gene locus_tag LOCUS_15890 gene cmk 3881 3216 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122796.1 protein_id gnl|my_center|LOCUS_15890 6148 3878 gene locus_tag LOCUS_15900 6148 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 6826 6161 gene locus_tag LOCUS_15910 6826 6161 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327679.1 protein_id gnl|my_center|LOCUS_15910 6913 6986 gene locus_tag LOCUS_t00220 6913 6986 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7732 8319 gene locus_tag LOCUS_15920 7732 8319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 8316 8780 gene locus_tag LOCUS_15930 8316 8780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 9656 8892 gene locus_tag LOCUS_15940 9656 8892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 >Feature sequence112 1281 199 gene locus_tag LOCUS_15950 1281 199 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122045.1 protein_id gnl|my_center|LOCUS_15950 3032 1284 gene locus_tag LOCUS_15960 3032 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 4762 3038 gene locus_tag LOCUS_15970 4762 3038 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061939.1 protein_id gnl|my_center|LOCUS_15970 7041 4798 gene locus_tag LOCUS_15980 gene nuoL 7041 4798 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546379.1 protein_id gnl|my_center|LOCUS_15980 7536 7075 gene locus_tag LOCUS_15990 7536 7075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 8396 7533 gene locus_tag LOCUS_16000 8396 7533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 8935 8402 gene locus_tag LOCUS_16010 8935 8402 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964313.1 protein_id gnl|my_center|LOCUS_16010 <9509 8937 gene locus_tag LOCUS_16020 <9509 8937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141583.1:NADH-quinone oxidoreductase subunit NuoH >Feature sequence113 2212 371 gene locus_tag LOCUS_16030 2212 371 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390371.1 protein_id gnl|my_center|LOCUS_16030 2408 3154 gene locus_tag LOCUS_16040 gene lexA 2408 3154 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615546.1 protein_id gnl|my_center|LOCUS_16040 4619 3213 gene locus_tag LOCUS_16050 4619 3213 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037228658.1 protein_id gnl|my_center|LOCUS_16050 6414 4624 gene locus_tag LOCUS_16060 6414 4624 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921563.1 protein_id gnl|my_center|LOCUS_16060 8698 6401 gene locus_tag LOCUS_16070 8698 6401 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922366.1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence114 1009 221 gene locus_tag LOCUS_16080 1009 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 1932 1006 gene locus_tag LOCUS_16090 1932 1006 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_16090 3028 1937 gene locus_tag LOCUS_16100 3028 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 3977 3015 gene locus_tag LOCUS_16110 3977 3015 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974987.1 protein_id gnl|my_center|LOCUS_16110 6059 4002 gene locus_tag LOCUS_16120 6059 4002 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921992.1 protein_id gnl|my_center|LOCUS_16120 6602 9115 gene locus_tag LOCUS_16130 6602 9115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 >Feature sequence115 659 1816 gene locus_tag LOCUS_16140 gene proB 659 1816 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331575.1 protein_id gnl|my_center|LOCUS_16140 1829 3118 gene locus_tag LOCUS_16150 1829 3118 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056829.1 protein_id gnl|my_center|LOCUS_16150 4639 3119 gene locus_tag LOCUS_16160 4639 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 6462 4636 gene locus_tag LOCUS_16170 6462 4636 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325469.1 protein_id gnl|my_center|LOCUS_16170 7443 6520 gene locus_tag LOCUS_16180 7443 6520 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325468.1 protein_id gnl|my_center|LOCUS_16180 7629 8606 gene locus_tag LOCUS_16190 7629 8606 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102017617.1 protein_id gnl|my_center|LOCUS_16190 >Feature sequence116 <1 620 gene locus_tag LOCUS_16200 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121253.1:phenylalanine--tRNA ligase subunit alpha 748 2814 gene locus_tag LOCUS_16210 gene pheT 748 2814 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663007.1 protein_id gnl|my_center|LOCUS_16210 5133 2929 gene locus_tag LOCUS_16220 5133 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 6177 5284 gene locus_tag LOCUS_16230 gene fhcD 6177 5284 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334456.1 protein_id gnl|my_center|LOCUS_16230 6314 8632 gene locus_tag LOCUS_16240 6314 8632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 >Feature sequence117 1689 580 gene locus_tag LOCUS_16250 gene ribD 1689 580 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_16250 3898 1703 gene locus_tag LOCUS_16260 3898 1703 CDS product protein disulfide-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328585.1 protein_id gnl|my_center|LOCUS_16260 4029 5423 gene locus_tag LOCUS_16270 4029 5423 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808174.1 protein_id gnl|my_center|LOCUS_16270 7244 5889 gene locus_tag LOCUS_16280 7244 5889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 8064 7321 gene locus_tag LOCUS_16290 8064 7321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 <9261 8107 gene locus_tag LOCUS_16300 <9261 8107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123802.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence118 838 1449 gene locus_tag LOCUS_16310 838 1449 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037422.1 protein_id gnl|my_center|LOCUS_16310 1632 2690 gene locus_tag LOCUS_16320 1632 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 2756 3856 gene locus_tag LOCUS_16330 2756 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 4256 3843 gene locus_tag LOCUS_16340 4256 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330016.1 protein_id gnl|my_center|LOCUS_16340 4486 5286 gene locus_tag LOCUS_16350 4486 5286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 5391 5465 gene locus_tag LOCUS_t00230 5391 5465 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5431 6333 gene locus_tag LOCUS_16360 5431 6333 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110575.1 protein_id gnl|my_center|LOCUS_16360 7906 6764 gene locus_tag LOCUS_16370 7906 6764 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324953.1 protein_id gnl|my_center|LOCUS_16370 8898 7903 gene locus_tag LOCUS_16380 8898 7903 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122566.1 protein_id gnl|my_center|LOCUS_16380 >Feature sequence119 1 180 gene locus_tag LOCUS_16390 1 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 637 398 gene locus_tag LOCUS_16400 637 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 1341 676 gene locus_tag LOCUS_16410 1341 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 1486 1809 gene locus_tag LOCUS_16420 1486 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 2697 1813 gene locus_tag LOCUS_16430 2697 1813 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132696218.1 protein_id gnl|my_center|LOCUS_16430 2772 3485 gene locus_tag LOCUS_16440 2772 3485 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064314.1 protein_id gnl|my_center|LOCUS_16440 4374 3568 gene locus_tag LOCUS_16450 4374 3568 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120403.1 protein_id gnl|my_center|LOCUS_16450 5467 4367 gene locus_tag LOCUS_16460 5467 4367 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921814.1 protein_id gnl|my_center|LOCUS_16460 6172 5537 gene locus_tag LOCUS_16470 6172 5537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 6271 6603 gene locus_tag LOCUS_16480 6271 6603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 6823 8208 gene locus_tag LOCUS_16490 6823 8208 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123471.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence120 839 90 gene locus_tag LOCUS_16500 839 90 CDS product CPBP family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837919.1 protein_id gnl|my_center|LOCUS_16500 1536 2342 gene locus_tag LOCUS_16510 1536 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 2342 3244 gene locus_tag LOCUS_16520 gene panC 2342 3244 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173797.1 protein_id gnl|my_center|LOCUS_16520 3302 4357 gene locus_tag LOCUS_16530 3302 4357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 4390 4701 gene locus_tag LOCUS_16540 4390 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 5063 7591 gene locus_tag LOCUS_16550 5063 7591 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921616.1 protein_id gnl|my_center|LOCUS_16550 7584 8816 gene locus_tag LOCUS_16560 7584 8816 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120906.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence121 <1 2046 gene locus_tag LOCUS_16570 <1 2046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120349.1:DUF1553 domain-containing protein 2255 4975 gene locus_tag LOCUS_16580 2255 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921842.1 protein_id gnl|my_center|LOCUS_16580 5007 5528 gene locus_tag LOCUS_16590 5007 5528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 5635 6300 gene locus_tag LOCUS_16600 5635 6300 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071927869.1 protein_id gnl|my_center|LOCUS_16600 6311 7357 gene locus_tag LOCUS_16610 6311 7357 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808104.1 protein_id gnl|my_center|LOCUS_16610 7354 8697 gene locus_tag LOCUS_16620 7354 8697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence122 207 971 gene locus_tag LOCUS_16630 207 971 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121230.1 protein_id gnl|my_center|LOCUS_16630 1216 1485 gene locus_tag LOCUS_16640 1216 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 1571 2557 gene locus_tag LOCUS_16650 1571 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 2651 2726 gene locus_tag LOCUS_t00240 2651 2726 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2901 3128 gene locus_tag LOCUS_16660 2901 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 3246 4040 gene locus_tag LOCUS_16670 3246 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 4120 4356 gene locus_tag LOCUS_16680 4120 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 4837 4613 gene locus_tag LOCUS_16690 4837 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 5176 4922 gene locus_tag LOCUS_16700 5176 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 6771 5173 gene locus_tag LOCUS_16710 6771 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 7167 6931 gene locus_tag LOCUS_16720 7167 6931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 7299 8417 gene locus_tag LOCUS_16730 7299 8417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 <9049 8408 gene locus_tag LOCUS_16740 <9049 8408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257729.1:histone deacetylase >Feature sequence123 1207 446 gene locus_tag LOCUS_16750 1207 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 1508 2764 gene locus_tag LOCUS_16760 1508 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 3862 2849 gene locus_tag LOCUS_16770 3862 2849 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928508.1 protein_id gnl|my_center|LOCUS_16770 4102 4524 gene locus_tag LOCUS_16780 4102 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 5634 4600 gene locus_tag LOCUS_16790 5634 4600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 >Feature sequence124 3052 623 gene locus_tag LOCUS_16800 3052 623 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121001.1 protein_id gnl|my_center|LOCUS_16800 4826 3174 gene locus_tag LOCUS_16810 4826 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 6190 4823 gene locus_tag LOCUS_16820 6190 4823 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122712.1 protein_id gnl|my_center|LOCUS_16820 <8959 6187 gene locus_tag LOCUS_16830 <8959 6187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122713.1:DUF2309 domain-containing protein >Feature sequence125 1440 151 gene locus_tag LOCUS_16840 gene clpX 1440 151 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324828.1 protein_id gnl|my_center|LOCUS_16840 1742 1464 gene locus_tag LOCUS_16850 1742 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 2024 3766 gene locus_tag LOCUS_16860 2024 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 4174 5310 gene locus_tag LOCUS_16870 4174 5310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 5307 6752 gene locus_tag LOCUS_16880 gene purB 5307 6752 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121816.1 protein_id gnl|my_center|LOCUS_16880 8241 6772 gene locus_tag LOCUS_16890 8241 6772 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546530.1 protein_id gnl|my_center|LOCUS_16890 8648 8238 gene locus_tag LOCUS_16900 8648 8238 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978373.1 protein_id gnl|my_center|LOCUS_16900 >Feature sequence126 1629 832 gene locus_tag LOCUS_16910 1629 832 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121328.1 protein_id gnl|my_center|LOCUS_16910 2342 1626 gene locus_tag LOCUS_16920 2342 1626 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082922.1 protein_id gnl|my_center|LOCUS_16920 2494 2862 gene locus_tag LOCUS_16930 2494 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 2859 3293 gene locus_tag LOCUS_16940 2859 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 3301 4380 gene locus_tag LOCUS_16950 3301 4380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 4392 5108 gene locus_tag LOCUS_16960 4392 5108 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443912.1 protein_id gnl|my_center|LOCUS_16960 5105 5857 gene locus_tag LOCUS_16970 5105 5857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 6199 5867 gene locus_tag LOCUS_16980 6199 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 6405 6211 gene locus_tag LOCUS_16990 6405 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 6476 7390 gene locus_tag LOCUS_17000 6476 7390 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245029.1 protein_id gnl|my_center|LOCUS_17000 6796 6871 gene locus_tag LOCUS_t00250 6796 6871 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 7907 7380 gene locus_tag LOCUS_17010 7907 7380 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124030.1 protein_id gnl|my_center|LOCUS_17010 <8900 7937 gene locus_tag LOCUS_17020 <8900 7937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071113.1:IS1595-like element ISSod11 family transposase >Feature sequence127 5059 3644 gene locus_tag LOCUS_17030 5059 3644 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198286.1 protein_id gnl|my_center|LOCUS_17030 6275 5049 gene locus_tag LOCUS_17040 gene bioF 6275 5049 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_17040 6742 6275 gene locus_tag LOCUS_17050 6742 6275 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939688.1 protein_id gnl|my_center|LOCUS_17050 8726 7407 gene locus_tag LOCUS_17060 8726 7407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 >Feature sequence128 3345 190 gene locus_tag LOCUS_17070 gene cphA 3345 190 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447960.1 protein_id gnl|my_center|LOCUS_17070 4106 6424 gene locus_tag LOCUS_17080 4106 6424 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_17080 6435 6950 gene locus_tag LOCUS_17090 6435 6950 CDS product DUF1854 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928936.1 protein_id gnl|my_center|LOCUS_17090 8482 7415 gene locus_tag LOCUS_17100 8482 7415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 >Feature sequence129 1226 171 gene locus_tag LOCUS_17110 1226 171 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922273.1 protein_id gnl|my_center|LOCUS_17110 1409 1714 gene locus_tag LOCUS_17120 1409 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 2812 1772 gene locus_tag LOCUS_17130 gene fba 2812 1772 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333980.1 protein_id gnl|my_center|LOCUS_17130 2918 3379 gene locus_tag LOCUS_17140 2918 3379 CDS product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188905.1 protein_id gnl|my_center|LOCUS_17140 3553 4677 gene locus_tag LOCUS_17150 3553 4677 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921329.1 protein_id gnl|my_center|LOCUS_17150 5454 4636 gene locus_tag LOCUS_17160 5454 4636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 5906 5364 gene locus_tag LOCUS_17170 5906 5364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 7429 5957 gene locus_tag LOCUS_17180 7429 5957 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123371.1 protein_id gnl|my_center|LOCUS_17180 7967 7530 gene locus_tag LOCUS_17190 7967 7530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 >Feature sequence130 <1 1131 gene locus_tag LOCUS_17200 <1 1131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889251.1:class II fumarate hydratase 1176 2969 gene locus_tag LOCUS_17210 1176 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 3437 3099 gene locus_tag LOCUS_17220 3437 3099 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325418.1 protein_id gnl|my_center|LOCUS_17220 3733 4878 gene locus_tag LOCUS_17230 3733 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 5007 8396 gene locus_tag LOCUS_17240 5007 8396 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263915.1 protein_id gnl|my_center|LOCUS_17240 >Feature sequence131 976 347 gene locus_tag LOCUS_17250 gene atpH 976 347 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816489.1 protein_id gnl|my_center|LOCUS_17250 1654 1010 gene locus_tag LOCUS_17260 1654 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 2142 1828 gene locus_tag LOCUS_17270 2142 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 3303 2236 gene locus_tag LOCUS_17280 3303 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 3769 3392 gene locus_tag LOCUS_17290 3769 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 4032 3808 gene locus_tag LOCUS_17300 4032 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 4234 5253 gene locus_tag LOCUS_17310 gene corA 4234 5253 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141025.1 protein_id gnl|my_center|LOCUS_17310 6322 5288 gene locus_tag LOCUS_17320 6322 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 6533 6461 gene locus_tag LOCUS_t00260 6533 6461 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6792 7058 gene locus_tag LOCUS_17330 6792 7058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 7844 7083 gene locus_tag LOCUS_17340 7844 7083 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920648.1 protein_id gnl|my_center|LOCUS_17340 >Feature sequence132 800 417 gene locus_tag LOCUS_17350 800 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 1071 823 gene locus_tag LOCUS_17360 1071 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 2539 1316 gene locus_tag LOCUS_17370 gene argJ 2539 1316 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119260.1 protein_id gnl|my_center|LOCUS_17370 3559 2549 gene locus_tag LOCUS_17380 gene argC 3559 2549 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118924.1 protein_id gnl|my_center|LOCUS_17380 4294 3659 gene locus_tag LOCUS_17390 4294 3659 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121990.1 protein_id gnl|my_center|LOCUS_17390 4889 4323 gene locus_tag LOCUS_17400 4889 4323 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121238.1 protein_id gnl|my_center|LOCUS_17400 5149 4886 gene locus_tag LOCUS_17410 5149 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 5763 5146 gene locus_tag LOCUS_17420 gene gmk 5763 5146 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326728.1 protein_id gnl|my_center|LOCUS_17420 6888 6007 gene locus_tag LOCUS_17430 6888 6007 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_17430 7417 6908 gene locus_tag LOCUS_17440 7417 6908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 8254 7490 gene locus_tag LOCUS_17450 gene tpiA 8254 7490 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121241.1 protein_id gnl|my_center|LOCUS_17450 >Feature sequence133 2760 250 gene locus_tag LOCUS_17460 2760 250 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207316850.1 protein_id gnl|my_center|LOCUS_17460 3461 2757 gene locus_tag LOCUS_17470 3461 2757 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021173.1 protein_id gnl|my_center|LOCUS_17470 3775 5202 gene locus_tag LOCUS_17480 3775 5202 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119960.1 protein_id gnl|my_center|LOCUS_17480 6468 5212 gene locus_tag LOCUS_17490 6468 5212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 6576 7580 gene locus_tag LOCUS_17500 6576 7580 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327421.1 protein_id gnl|my_center|LOCUS_17500 >Feature sequence134 318 932 gene locus_tag LOCUS_17510 gene rplE 318 932 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173391575.1 protein_id gnl|my_center|LOCUS_17510 992 1177 gene locus_tag LOCUS_17520 992 1177 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326809.1 protein_id gnl|my_center|LOCUS_17520 1264 1659 gene locus_tag LOCUS_17530 gene rpsH 1264 1659 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326810.1 protein_id gnl|my_center|LOCUS_17530 1679 2224 gene locus_tag LOCUS_17540 gene rplF 1679 2224 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121609.1 protein_id gnl|my_center|LOCUS_17540 2255 2623 gene locus_tag LOCUS_17550 gene rplR 2255 2623 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055951.1 protein_id gnl|my_center|LOCUS_17550 2657 3190 gene locus_tag LOCUS_17560 gene rpsE 2657 3190 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326813.1 protein_id gnl|my_center|LOCUS_17560 3249 3752 gene locus_tag LOCUS_17570 gene rplO 3249 3752 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326814.1 protein_id gnl|my_center|LOCUS_17570 3808 5169 gene locus_tag LOCUS_17580 gene secY 3808 5169 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326816.1 protein_id gnl|my_center|LOCUS_17580 5266 5880 gene locus_tag LOCUS_17590 5266 5880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 5976 6740 gene locus_tag LOCUS_17600 gene map 5976 6740 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393915.1 protein_id gnl|my_center|LOCUS_17600 7125 7508 gene locus_tag LOCUS_17610 gene rpsM 7125 7508 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123828.1 protein_id gnl|my_center|LOCUS_17610 7582 7926 gene locus_tag LOCUS_17620 gene rpsK 7582 7926 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328401.1 protein_id gnl|my_center|LOCUS_17620 7996 8622 gene locus_tag LOCUS_17630 gene rpsD 7996 8622 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459108.1 protein_id gnl|my_center|LOCUS_17630 >Feature sequence135 259 333 gene locus_tag LOCUS_t00270 259 333 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 616 792 gene locus_tag LOCUS_17640 616 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 3239 879 gene locus_tag LOCUS_17650 3239 879 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123700.1 protein_id gnl|my_center|LOCUS_17650 3356 3661 gene locus_tag LOCUS_17660 3356 3661 CDS product DNA-directed RNA polymerase subunit alpha C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326741.1 protein_id gnl|my_center|LOCUS_17660 3767 4849 gene locus_tag LOCUS_17670 3767 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121229.1 protein_id gnl|my_center|LOCUS_17670 4846 5289 gene locus_tag LOCUS_17680 4846 5289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 5286 5930 gene locus_tag LOCUS_17690 5286 5930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 6166 7320 gene locus_tag LOCUS_17700 6166 7320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 >Feature sequence136 11 95 gene locus_tag LOCUS_t00280 11 95 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1118 120 gene locus_tag LOCUS_17710 1118 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 1121 1193 gene locus_tag LOCUS_t00290 1121 1193 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3521 1191 gene locus_tag LOCUS_17720 gene katG 3521 1191 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615656.1 protein_id gnl|my_center|LOCUS_17720 3626 4774 gene locus_tag LOCUS_17730 3626 4774 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186744778.1 protein_id gnl|my_center|LOCUS_17730 4816 6474 gene locus_tag LOCUS_17740 4816 6474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 7353 6520 gene locus_tag LOCUS_17750 gene gluQRS 7353 6520 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 protein_id gnl|my_center|LOCUS_17750 8053 7388 gene locus_tag LOCUS_17760 8053 7388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 >Feature sequence137 5910 6545 gene locus_tag LOCUS_17770 5910 6545 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325344.1 protein_id gnl|my_center|LOCUS_17770 6646 6867 gene locus_tag LOCUS_17780 6646 6867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402859.1 protein_id gnl|my_center|LOCUS_17780 6867 7169 gene locus_tag LOCUS_17790 6867 7169 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942865.1 protein_id gnl|my_center|LOCUS_17790 8264 7206 gene locus_tag LOCUS_17800 8264 7206 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071191.1 protein_id gnl|my_center|LOCUS_17800 >Feature sequence138 55 7140 gene locus_tag LOCUS_17810 55 7140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 7140 7727 gene locus_tag LOCUS_17820 7140 7727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 >Feature sequence139 2028 1216 gene locus_tag LOCUS_17830 2028 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 2567 2055 gene locus_tag LOCUS_17840 2567 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 3243 2557 gene locus_tag LOCUS_17850 3243 2557 CDS product DUF4190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326835.1 protein_id gnl|my_center|LOCUS_17850 4716 3247 gene locus_tag LOCUS_17860 4716 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327711.1 protein_id gnl|my_center|LOCUS_17860 6606 5290 gene locus_tag LOCUS_17870 6606 5290 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327631.1 protein_id gnl|my_center|LOCUS_17870 7298 6603 gene locus_tag LOCUS_17880 7298 6603 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120140.1 protein_id gnl|my_center|LOCUS_17880 7435 8451 gene locus_tag LOCUS_17890 gene gap 7435 8451 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_17890 >Feature sequence140 1047 220 gene locus_tag LOCUS_17900 gene proC 1047 220 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392379.1 protein_id gnl|my_center|LOCUS_17900 2210 1047 gene locus_tag LOCUS_17910 2210 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 2234 2773 gene locus_tag LOCUS_17920 2234 2773 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404046.1 protein_id gnl|my_center|LOCUS_17920 2751 5396 gene locus_tag LOCUS_17930 gene glnD 2751 5396 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325417.1 protein_id gnl|my_center|LOCUS_17930 6783 5296 gene locus_tag LOCUS_17940 6783 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 8111 6798 gene locus_tag LOCUS_17950 gene xylA 8111 6798 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118969.1 protein_id gnl|my_center|LOCUS_17950 >Feature sequence141 1367 2086 gene locus_tag LOCUS_17960 1367 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 2177 3730 gene locus_tag LOCUS_17970 2177 3730 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941285.1 protein_id gnl|my_center|LOCUS_17970 3952 5880 gene locus_tag LOCUS_17980 3952 5880 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_17980 6774 6013 gene locus_tag LOCUS_17990 6774 6013 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665551.1 protein_id gnl|my_center|LOCUS_17990 <8324 7008 gene locus_tag LOCUS_18000 <8324 7008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118564.1:AAA family ATPase >Feature sequence142 >Feature sequence143 419 1936 gene locus_tag LOCUS_18010 gene lysS 419 1936 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672011.1 protein_id gnl|my_center|LOCUS_18010 2003 3637 gene locus_tag LOCUS_18020 2003 3637 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121144.1 protein_id gnl|my_center|LOCUS_18020 3630 4334 gene locus_tag LOCUS_18030 3630 4334 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331945.1 protein_id gnl|my_center|LOCUS_18030 4353 5210 gene locus_tag LOCUS_18040 gene ilvE 4353 5210 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336792.1 protein_id gnl|my_center|LOCUS_18040 5765 5337 gene locus_tag LOCUS_18050 5765 5337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 6752 5835 gene locus_tag LOCUS_18060 gene ispE 6752 5835 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122808.1 protein_id gnl|my_center|LOCUS_18060 6969 6754 gene locus_tag LOCUS_18070 6969 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 >Feature sequence144 1422 124 gene locus_tag LOCUS_18080 gene hemL 1422 124 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331929.1 protein_id gnl|my_center|LOCUS_18080 3422 1599 gene locus_tag LOCUS_18090 3422 1599 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921424.1 protein_id gnl|my_center|LOCUS_18090 3526 5001 gene locus_tag LOCUS_18100 3526 5001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 4986 5864 gene locus_tag LOCUS_18110 gene truB 4986 5864 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804656.1 protein_id gnl|my_center|LOCUS_18110 6357 5836 gene locus_tag LOCUS_18120 6357 5836 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977146.1 protein_id gnl|my_center|LOCUS_18120 6437 7756 gene locus_tag LOCUS_18130 6437 7756 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921586.1 protein_id gnl|my_center|LOCUS_18130 >Feature sequence145 602 1462 gene locus_tag LOCUS_18140 602 1462 CDS product RMD1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100934544.1 protein_id gnl|my_center|LOCUS_18140 1502 3061 gene locus_tag LOCUS_18150 1502 3061 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941595.1 protein_id gnl|my_center|LOCUS_18150 3136 4005 gene locus_tag LOCUS_18160 3136 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18160 4021 4674 gene locus_tag LOCUS_18170 4021 4674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18170 4815 5081 gene locus_tag LOCUS_18180 4815 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 6242 5226 gene locus_tag LOCUS_18190 6242 5226 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122163.1 protein_id gnl|my_center|LOCUS_18190 6357 6677 gene locus_tag LOCUS_18200 6357 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 <7993 7142 gene locus_tag LOCUS_18210 <7993 7142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007329265.1:type III PLP-dependent enzyme >Feature sequence146 <1 536 gene locus_tag LOCUS_18220 <1 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007329623.1:glucose-1-phosphate adenylyltransferase 552 1952 gene locus_tag LOCUS_18230 552 1952 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165447220.1 protein_id gnl|my_center|LOCUS_18230 3233 1848 gene locus_tag LOCUS_18240 3233 1848 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_18240 3524 4561 gene locus_tag LOCUS_18250 3524 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 5569 4676 gene locus_tag LOCUS_18260 5569 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 5979 5578 gene locus_tag LOCUS_18270 5979 5578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 7019 5982 gene locus_tag LOCUS_18280 7019 5982 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061017.1 protein_id gnl|my_center|LOCUS_18280 7676 7095 gene locus_tag LOCUS_18290 7676 7095 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336247.1 protein_id gnl|my_center|LOCUS_18290 >Feature sequence147 1914 211 gene locus_tag LOCUS_18300 1914 211 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327691.1 protein_id gnl|my_center|LOCUS_18300 2876 2046 gene locus_tag LOCUS_18310 2876 2046 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119258.1 protein_id gnl|my_center|LOCUS_18310 3851 2973 gene locus_tag LOCUS_18320 3851 2973 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921623.1 protein_id gnl|my_center|LOCUS_18320 4198 3848 gene locus_tag LOCUS_18330 4198 3848 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680824.1 protein_id gnl|my_center|LOCUS_18330 4493 4179 gene locus_tag LOCUS_18340 4493 4179 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667001.1 protein_id gnl|my_center|LOCUS_18340 5345 4530 gene locus_tag LOCUS_18350 5345 4530 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836202.1 protein_id gnl|my_center|LOCUS_18350 >Feature sequence148 1356 451 gene locus_tag LOCUS_18360 gene cysD 1356 451 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140408.1 protein_id gnl|my_center|LOCUS_18360 2281 1382 gene locus_tag LOCUS_18370 gene nhaR 2281 1382 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405479.1 protein_id gnl|my_center|LOCUS_18370 2892 2323 gene locus_tag LOCUS_18380 2892 2323 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039240.1 protein_id gnl|my_center|LOCUS_18380 3290 4267 gene locus_tag LOCUS_18390 3290 4267 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124396.1 protein_id gnl|my_center|LOCUS_18390 4431 4237 gene locus_tag LOCUS_18400 4431 4237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 4532 4927 gene locus_tag LOCUS_18410 4532 4927 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_18410 4918 5541 gene locus_tag LOCUS_18420 4918 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 5569 6078 gene locus_tag LOCUS_18430 5569 6078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 6115 7353 gene locus_tag LOCUS_18440 gene nuoD 6115 7353 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967799.1 protein_id gnl|my_center|LOCUS_18440 7350 7847 gene locus_tag LOCUS_18450 gene nuoE 7350 7847 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967798.1 protein_id gnl|my_center|LOCUS_18450 >Feature sequence149 7628 1140 gene locus_tag LOCUS_18460 7628 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 >Feature sequence150 1401 2594 gene locus_tag LOCUS_18470 1401 2594 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839296.1 protein_id gnl|my_center|LOCUS_18470 2585 4663 gene locus_tag LOCUS_18480 2585 4663 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435048.1 protein_id gnl|my_center|LOCUS_18480 4672 5352 gene locus_tag LOCUS_18490 4672 5352 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530139.1 protein_id gnl|my_center|LOCUS_18490 6273 5512 gene locus_tag LOCUS_18500 6273 5512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 6227 6394 gene locus_tag LOCUS_18510 6227 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 6412 7593 gene locus_tag LOCUS_18520 6412 7593 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943373.1 protein_id gnl|my_center|LOCUS_18520 >Feature sequence151 <1 810 gene locus_tag LOCUS_18530 <1 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007325559.1:1-deoxy-D-xylulose-5-phosphate synthase 807 1763 gene locus_tag LOCUS_18540 807 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 1760 2587 gene locus_tag LOCUS_18550 1760 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 4336 2840 gene locus_tag LOCUS_18560 4336 2840 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_18560 5997 4462 gene locus_tag LOCUS_18570 5997 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 6428 7258 gene locus_tag LOCUS_18580 6428 7258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 >Feature sequence152 <1 774 gene locus_tag LOCUS_18590 <1 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007341012.1:DegT/DnrJ/EryC1/StrS family aminotransferase 838 1980 gene locus_tag LOCUS_18600 838 1980 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249749.1 protein_id gnl|my_center|LOCUS_18600 2517 2215 gene locus_tag LOCUS_18610 2517 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 4426 2579 gene locus_tag LOCUS_18620 4426 2579 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840152.1 protein_id gnl|my_center|LOCUS_18620 5219 4470 gene locus_tag LOCUS_18630 5219 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 5342 5268 gene locus_tag LOCUS_t00300 5342 5268 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 6732 5413 gene locus_tag LOCUS_18640 6732 5413 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121727.1 protein_id gnl|my_center|LOCUS_18640 >Feature sequence153 280 759 gene locus_tag LOCUS_18650 280 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 3039 1096 gene locus_tag LOCUS_18660 3039 1096 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921710.1 protein_id gnl|my_center|LOCUS_18660 3340 4617 gene locus_tag LOCUS_18670 3340 4617 CDS product DUF1598 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119759.1 protein_id gnl|my_center|LOCUS_18670 5223 4555 gene locus_tag LOCUS_18680 5223 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 6233 5223 gene locus_tag LOCUS_18690 6233 5223 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261424.1 protein_id gnl|my_center|LOCUS_18690 7230 6247 gene locus_tag LOCUS_18700 7230 6247 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123514.1 protein_id gnl|my_center|LOCUS_18700 >Feature sequence154 3141 331 gene locus_tag LOCUS_18710 3141 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 4300 3161 gene locus_tag LOCUS_18720 4300 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 4526 5329 gene locus_tag LOCUS_18730 4526 5329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 5326 6246 gene locus_tag LOCUS_18740 5326 6246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 6839 6234 gene locus_tag LOCUS_18750 6839 6234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 6990 7295 gene locus_tag LOCUS_18760 6990 7295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 >Feature sequence155 1704 367 gene locus_tag LOCUS_18770 1704 367 CDS product DNA-directed RNA polymerase subunit alpha C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332711.1 protein_id gnl|my_center|LOCUS_18770 1808 1735 gene locus_tag LOCUS_t00310 1808 1735 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2279 3133 gene locus_tag LOCUS_18780 gene kdsA 2279 3133 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120986.1 protein_id gnl|my_center|LOCUS_18780 3172 4797 gene locus_tag LOCUS_18790 3172 4797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 5975 5109 gene locus_tag LOCUS_18800 gene prmC 5975 5109 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122233.1 protein_id gnl|my_center|LOCUS_18800 7080 5986 gene locus_tag LOCUS_18810 gene prfA 7080 5986 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328933.1 protein_id gnl|my_center|LOCUS_18810 7352 7104 gene locus_tag LOCUS_18820 gene rpmE 7352 7104 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328932.1 protein_id gnl|my_center|LOCUS_18820 >Feature sequence156 973 1587 gene locus_tag LOCUS_18830 973 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 2790 1594 gene locus_tag LOCUS_18840 2790 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 2931 4454 gene locus_tag LOCUS_18850 2931 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 4855 4517 gene locus_tag LOCUS_18860 4855 4517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 6648 5449 gene locus_tag LOCUS_18870 6648 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 >Feature sequence157 >Feature sequence158 1182 190 gene locus_tag LOCUS_18880 gene pstS 1182 190 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 protein_id gnl|my_center|LOCUS_18880 4387 1322 gene locus_tag LOCUS_18890 gene pruA 4387 1322 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944006.1 protein_id gnl|my_center|LOCUS_18890 4533 5267 gene locus_tag LOCUS_18900 gene rpe 4533 5267 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118429.1 protein_id gnl|my_center|LOCUS_18900 5299 5901 gene locus_tag LOCUS_18910 5299 5901 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332332.1 protein_id gnl|my_center|LOCUS_18910 5996 6826 gene locus_tag LOCUS_18920 gene accD 5996 6826 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327662.1 protein_id gnl|my_center|LOCUS_18920 7333 6974 gene locus_tag LOCUS_18930 7333 6974 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119951.1 protein_id gnl|my_center|LOCUS_18930 >Feature sequence159 2638 1292 gene locus_tag LOCUS_18940 gene accC 2638 1292 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332220.1 protein_id gnl|my_center|LOCUS_18940 3158 2679 gene locus_tag LOCUS_18950 gene accB 3158 2679 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328900.1 protein_id gnl|my_center|LOCUS_18950 3310 4215 gene locus_tag LOCUS_18960 3310 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 4879 4172 gene locus_tag LOCUS_18970 gene pdeM 4879 4172 CDS product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268716.1 protein_id gnl|my_center|LOCUS_18970 7398 4876 gene locus_tag LOCUS_18980 7398 4876 CDS product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268715.1 protein_id gnl|my_center|LOCUS_18980 7640 7395 gene locus_tag LOCUS_18990 7640 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 >Feature sequence160 1439 21 gene locus_tag LOCUS_19000 gene leuC 1439 21 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340234.1 protein_id gnl|my_center|LOCUS_19000 2028 1474 gene locus_tag LOCUS_19010 2028 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 4060 2147 gene locus_tag LOCUS_19020 4060 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 4315 4995 gene locus_tag LOCUS_19030 4315 4995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 6330 5011 gene locus_tag LOCUS_19040 6330 5011 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121030.1 protein_id gnl|my_center|LOCUS_19040 6428 7345 gene locus_tag LOCUS_19050 6428 7345 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056318.1 protein_id gnl|my_center|LOCUS_19050 >Feature sequence161 2090 1047 gene locus_tag LOCUS_19060 2090 1047 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_19060 4116 2443 gene locus_tag LOCUS_19070 gene ettA 4116 2443 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329503.1 protein_id gnl|my_center|LOCUS_19070 4286 5164 gene locus_tag LOCUS_19080 4286 5164 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259324.1 protein_id gnl|my_center|LOCUS_19080 5179 5622 gene locus_tag LOCUS_19090 5179 5622 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256843.1 protein_id gnl|my_center|LOCUS_19090 5642 6655 gene locus_tag LOCUS_19100 5642 6655 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174053.1 protein_id gnl|my_center|LOCUS_19100 <7604 6663 gene locus_tag LOCUS_19110 <7604 6663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056444.1:adenosyl-hopene transferase HpnH >Feature sequence162 2479 290 gene locus_tag LOCUS_19120 gene shc 2479 290 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190626.1 protein_id gnl|my_center|LOCUS_19120 3549 2602 gene locus_tag LOCUS_19130 3549 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 4361 3774 gene locus_tag LOCUS_19140 4361 3774 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328727.1 protein_id gnl|my_center|LOCUS_19140 5137 4529 gene locus_tag LOCUS_19150 5137 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921915.1 protein_id gnl|my_center|LOCUS_19150 7001 5124 gene locus_tag LOCUS_19160 7001 5124 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120684.1 protein_id gnl|my_center|LOCUS_19160 7531 7094 gene locus_tag LOCUS_19170 7531 7094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 >Feature sequence163 319 972 gene locus_tag LOCUS_19180 319 972 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007388333.1 protein_id gnl|my_center|LOCUS_19180 1386 988 gene locus_tag LOCUS_19190 1386 988 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409273.1 protein_id gnl|my_center|LOCUS_19190 1676 1383 gene locus_tag LOCUS_19200 1676 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 3959 1707 gene locus_tag LOCUS_19210 3959 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 >Feature sequence164 625 221 gene locus_tag LOCUS_19220 gene cdd 625 221 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080780.1 protein_id gnl|my_center|LOCUS_19220 676 1383 gene locus_tag LOCUS_19230 gene upp 676 1383 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257403.1 protein_id gnl|my_center|LOCUS_19230 1409 2722 gene locus_tag LOCUS_19240 1409 2722 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838623.1 protein_id gnl|my_center|LOCUS_19240 2761 3990 gene locus_tag LOCUS_19250 2761 3990 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356704.1 protein_id gnl|my_center|LOCUS_19250 5217 3997 gene locus_tag LOCUS_19260 5217 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117732.1 protein_id gnl|my_center|LOCUS_19260 6833 5232 gene locus_tag LOCUS_19270 6833 5232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 >Feature sequence165 1538 3079 gene locus_tag LOCUS_19280 1538 3079 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922561.1 protein_id gnl|my_center|LOCUS_19280 4999 3299 gene locus_tag LOCUS_19290 4999 3299 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940935.1 protein_id gnl|my_center|LOCUS_19290 5544 5197 gene locus_tag LOCUS_19300 5544 5197 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327264.1 protein_id gnl|my_center|LOCUS_19300 <7284 5926 gene locus_tag LOCUS_19310 <7284 5926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056043.1:ammonium transporter 6610 6517 gene locus_tag LOCUS_t00320 6610 6517 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence166 1986 973 gene locus_tag LOCUS_19320 1986 973 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922725.1 protein_id gnl|my_center|LOCUS_19320 2403 2017 gene locus_tag LOCUS_19330 2403 2017 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324336.1 protein_id gnl|my_center|LOCUS_19330 2422 3159 gene locus_tag LOCUS_19340 gene queC 2422 3159 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390955.1 protein_id gnl|my_center|LOCUS_19340 3180 3878 gene locus_tag LOCUS_19350 3180 3878 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904152.1 protein_id gnl|my_center|LOCUS_19350 4993 3950 gene locus_tag LOCUS_19360 4993 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 6081 4978 gene locus_tag LOCUS_19370 gene waaF 6081 4978 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526219.1 protein_id gnl|my_center|LOCUS_19370 7102 6137 gene locus_tag LOCUS_19380 7102 6137 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922172.1 protein_id gnl|my_center|LOCUS_19380 >Feature sequence167 918 448 gene locus_tag LOCUS_19390 918 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 2080 971 gene locus_tag LOCUS_19400 2080 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 2274 4484 gene locus_tag LOCUS_19410 2274 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 5225 4479 gene locus_tag LOCUS_19420 5225 4479 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333120.1 protein_id gnl|my_center|LOCUS_19420 5276 5908 gene locus_tag LOCUS_19430 5276 5908 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328106.1 protein_id gnl|my_center|LOCUS_19430 6268 5915 gene locus_tag LOCUS_19440 6268 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 6390 6839 gene locus_tag LOCUS_19450 6390 6839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 >Feature sequence168 <1 687 gene locus_tag LOCUS_19460 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099262485.1:tRNA adenylyltransferase 1542 913 gene locus_tag LOCUS_19470 1542 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 1662 1907 gene locus_tag LOCUS_19480 1662 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 1923 5060 gene locus_tag LOCUS_19490 1923 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 5384 5175 gene locus_tag LOCUS_19500 5384 5175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 5818 5381 gene locus_tag LOCUS_19510 5818 5381 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013196.1 protein_id gnl|my_center|LOCUS_19510 6951 6028 gene locus_tag LOCUS_19520 6951 6028 CDS product lactate/malate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118931.1 protein_id gnl|my_center|LOCUS_19520 >Feature sequence169 5053 1757 gene locus_tag LOCUS_19530 5053 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 5958 5158 gene locus_tag LOCUS_19540 5958 5158 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921300.1 protein_id gnl|my_center|LOCUS_19540 6063 6788 gene locus_tag LOCUS_19550 6063 6788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 >Feature sequence170 476 1738 gene locus_tag LOCUS_19560 476 1738 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124080.1 protein_id gnl|my_center|LOCUS_19560 1865 2182 gene locus_tag LOCUS_19570 1865 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 2391 3890 gene locus_tag LOCUS_19580 2391 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 6714 3868 gene locus_tag LOCUS_19590 6714 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 >Feature sequence171 505 230 gene locus_tag LOCUS_19600 505 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 1626 622 gene locus_tag LOCUS_19610 gene ilvC 1626 622 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339869.1 protein_id gnl|my_center|LOCUS_19610 2253 1696 gene locus_tag LOCUS_19620 gene ilvN 2253 1696 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339870.1 protein_id gnl|my_center|LOCUS_19620 2189 2452 gene locus_tag LOCUS_19630 2189 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 2586 3308 gene locus_tag LOCUS_19640 gene rpsB 2586 3308 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122857.1 protein_id gnl|my_center|LOCUS_19640 3490 4332 gene locus_tag LOCUS_19650 gene tsf 3490 4332 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933440.1 protein_id gnl|my_center|LOCUS_19650 4396 5133 gene locus_tag LOCUS_19660 gene pyrH 4396 5133 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261659.1 protein_id gnl|my_center|LOCUS_19660 5258 6247 gene locus_tag LOCUS_19670 5258 6247 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102017617.1 protein_id gnl|my_center|LOCUS_19670 6319 6849 gene locus_tag LOCUS_19680 6319 6849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 >Feature sequence172 2505 208 gene locus_tag LOCUS_19690 2505 208 CDS product YidC/Oxa1 family insertase periplasmic-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615850.1 protein_id gnl|my_center|LOCUS_19690 3362 2595 gene locus_tag LOCUS_19700 3362 2595 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327496.1 protein_id gnl|my_center|LOCUS_19700 3491 4189 gene locus_tag LOCUS_19710 3491 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 4342 5004 gene locus_tag LOCUS_19720 4342 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 5816 4962 gene locus_tag LOCUS_19730 5816 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 5951 6748 gene locus_tag LOCUS_19740 5951 6748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 >Feature sequence173 784 317 gene locus_tag LOCUS_19750 784 317 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963897.1 protein_id gnl|my_center|LOCUS_19750 874 1368 gene locus_tag LOCUS_19760 874 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 2096 1374 gene locus_tag LOCUS_19770 2096 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 2454 2200 gene locus_tag LOCUS_19780 2454 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 6759 2518 gene locus_tag LOCUS_19790 6759 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 >Feature sequence174 <1 1269 gene locus_tag LOCUS_19800 <1 1269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123580.1:carbamoyl-phosphate synthase large subunit 1423 2079 gene locus_tag LOCUS_19810 1423 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 2544 5042 gene locus_tag LOCUS_19820 2544 5042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 5267 6571 gene locus_tag LOCUS_19830 5267 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 6590 6838 gene locus_tag LOCUS_19840 6590 6838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 >Feature sequence175 493 1404 gene locus_tag LOCUS_19850 gene cysD 493 1404 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140408.1 protein_id gnl|my_center|LOCUS_19850 1482 3413 gene locus_tag LOCUS_19860 gene cysN 1482 3413 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121644.1 protein_id gnl|my_center|LOCUS_19860 3468 4007 gene locus_tag LOCUS_19870 gene mog 3468 4007 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879970.1 protein_id gnl|my_center|LOCUS_19870 5016 3991 gene locus_tag LOCUS_19880 gene hemB 5016 3991 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921457.1 protein_id gnl|my_center|LOCUS_19880 5469 5026 gene locus_tag LOCUS_19890 gene queD 5469 5026 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099264135.1 protein_id gnl|my_center|LOCUS_19890 6352 5510 gene locus_tag LOCUS_19900 6352 5510 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326598.1 protein_id gnl|my_center|LOCUS_19900 6622 6380 gene locus_tag LOCUS_19910 6622 6380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 >Feature sequence176 <1 1665 gene locus_tag LOCUS_19920 <1 1665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615857.1:PQQ-binding-like beta-propeller repeat protein 1662 3299 gene locus_tag LOCUS_19930 1662 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 3301 4917 gene locus_tag LOCUS_19940 3301 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 4944 6602 gene locus_tag LOCUS_19950 4944 6602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 >Feature sequence177 1431 154 gene locus_tag LOCUS_19960 1431 154 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123735.1 protein_id gnl|my_center|LOCUS_19960 2294 1428 gene locus_tag LOCUS_19970 2294 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 3076 2291 gene locus_tag LOCUS_19980 3076 2291 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325374.1 protein_id gnl|my_center|LOCUS_19980 4020 3076 gene locus_tag LOCUS_19990 4020 3076 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427752.1 protein_id gnl|my_center|LOCUS_19990 4154 4774 gene locus_tag LOCUS_20000 4154 4774 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008654974.1 protein_id gnl|my_center|LOCUS_20000 4771 6018 gene locus_tag LOCUS_20010 4771 6018 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327204.1 protein_id gnl|my_center|LOCUS_20010 >Feature sequence178 1320 2066 gene locus_tag LOCUS_20020 1320 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 2399 2088 gene locus_tag LOCUS_20030 2399 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 3361 2717 gene locus_tag LOCUS_20040 3361 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 3276 3758 gene locus_tag LOCUS_20050 3276 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 3842 4222 gene locus_tag LOCUS_20060 3842 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 4399 4327 gene locus_tag LOCUS_t00330 4399 4327 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4628 6175 gene locus_tag LOCUS_20070 4628 6175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 >Feature sequence179 262 3012 gene locus_tag LOCUS_20080 gene polA 262 3012 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393341.1 protein_id gnl|my_center|LOCUS_20080 3020 3667 gene locus_tag LOCUS_20090 3020 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 3786 5177 gene locus_tag LOCUS_20100 gene rho 3786 5177 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813585.1 protein_id gnl|my_center|LOCUS_20100 5185 5721 gene locus_tag LOCUS_20110 5185 5721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 5718 6143 gene locus_tag LOCUS_20120 gene nusB 5718 6143 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326965.1 protein_id gnl|my_center|LOCUS_20120 >Feature sequence180 377 2017 gene locus_tag LOCUS_20130 377 2017 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454162.1 protein_id gnl|my_center|LOCUS_20130 2943 2041 gene locus_tag LOCUS_20140 2943 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 3846 3001 gene locus_tag LOCUS_20150 3846 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 4046 4984 gene locus_tag LOCUS_20160 4046 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 >Feature sequence181 1127 78 gene locus_tag LOCUS_20170 1127 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 1604 1260 gene locus_tag LOCUS_20180 1604 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 1907 3211 gene locus_tag LOCUS_20190 1907 3211 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118102.1 protein_id gnl|my_center|LOCUS_20190 3259 5295 gene locus_tag LOCUS_20200 3259 5295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 5332 6327 gene locus_tag LOCUS_20210 5332 6327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 >Feature sequence182 1825 326 gene locus_tag LOCUS_20220 gene cls 1825 326 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943983.1 protein_id gnl|my_center|LOCUS_20220 3307 1859 gene locus_tag LOCUS_20230 3307 1859 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118296.1 protein_id gnl|my_center|LOCUS_20230 3339 4313 gene locus_tag LOCUS_20240 3339 4313 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921398.1 protein_id gnl|my_center|LOCUS_20240 4967 4356 gene locus_tag LOCUS_20250 gene tdk 4967 4356 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068066.1 protein_id gnl|my_center|LOCUS_20250 5736 4990 gene locus_tag LOCUS_20260 5736 4990 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922324.1 protein_id gnl|my_center|LOCUS_20260 5826 6533 gene locus_tag LOCUS_20270 5826 6533 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387954.1 protein_id gnl|my_center|LOCUS_20270 >Feature sequence183 871 170 gene locus_tag LOCUS_20280 871 170 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173343.1 protein_id gnl|my_center|LOCUS_20280 2541 1093 gene locus_tag LOCUS_20290 2541 1093 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921298.1 protein_id gnl|my_center|LOCUS_20290 2664 3869 gene locus_tag LOCUS_20300 2664 3869 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227721.1 protein_id gnl|my_center|LOCUS_20300 4235 4360 gene locus_tag LOCUS_20310 4235 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 4420 4848 gene locus_tag LOCUS_20320 4420 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 4915 5469 gene locus_tag LOCUS_20330 4915 5469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 5502 6044 gene locus_tag LOCUS_20340 5502 6044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 >Feature sequence184 4247 5224 gene locus_tag LOCUS_20350 4247 5224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 6172 5216 gene locus_tag LOCUS_20360 6172 5216 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328412.1 protein_id gnl|my_center|LOCUS_20360 <6742 6180 gene locus_tag LOCUS_20370 <6742 6180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007332043.1:lysophospholipid acyltransferase family protein >Feature sequence185 468 109 gene locus_tag LOCUS_20380 468 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 1456 503 gene locus_tag LOCUS_20390 1456 503 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121326.1 protein_id gnl|my_center|LOCUS_20390 2765 1917 gene locus_tag LOCUS_20400 2765 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 3359 2769 gene locus_tag LOCUS_20410 gene pgsA 3359 2769 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330879.1 protein_id gnl|my_center|LOCUS_20410 4804 3356 gene locus_tag LOCUS_20420 gene rimO 4804 3356 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922374.1 protein_id gnl|my_center|LOCUS_20420 5907 4801 gene locus_tag LOCUS_20430 gene ispG 5907 4801 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118672.1 protein_id gnl|my_center|LOCUS_20430 6011 6490 gene locus_tag LOCUS_20440 6011 6490 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814644.1 protein_id gnl|my_center|LOCUS_20440 >Feature sequence186 887 324 gene locus_tag LOCUS_20450 887 324 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332895.1 protein_id gnl|my_center|LOCUS_20450 1578 970 gene locus_tag LOCUS_20460 1578 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 2173 1688 gene locus_tag LOCUS_20470 2173 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329952.1 protein_id gnl|my_center|LOCUS_20470 3291 2374 gene locus_tag LOCUS_20480 3291 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 3443 4435 gene locus_tag LOCUS_20490 3443 4435 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122039.1 protein_id gnl|my_center|LOCUS_20490 6498 4507 gene locus_tag LOCUS_20500 gene nadE 6498 4507 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192277.1 protein_id gnl|my_center|LOCUS_20500 >Feature sequence187 586 275 gene locus_tag LOCUS_20510 586 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 815 1672 gene locus_tag LOCUS_20520 gene lpxA 815 1672 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690880.1 protein_id gnl|my_center|LOCUS_20520 2812 1658 gene locus_tag LOCUS_20530 2812 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 2820 2954 gene locus_tag LOCUS_20540 2820 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 3216 4577 gene locus_tag LOCUS_20550 gene urtA 3216 4577 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056962.1 protein_id gnl|my_center|LOCUS_20550 4594 6654 gene locus_tag LOCUS_20560 4594 6654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 >Feature sequence188 347 871 gene locus_tag LOCUS_20570 gene ruvC 347 871 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120029.1 protein_id gnl|my_center|LOCUS_20570 882 1523 gene locus_tag LOCUS_20580 882 1523 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326966.1 protein_id gnl|my_center|LOCUS_20580 1830 2852 gene locus_tag LOCUS_20590 gene ruvB 1830 2852 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331968.1 protein_id gnl|my_center|LOCUS_20590 3119 4051 gene locus_tag LOCUS_20600 gene fabD 3119 4051 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117846.1 protein_id gnl|my_center|LOCUS_20600 4092 4877 gene locus_tag LOCUS_20610 gene fabG 4092 4877 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324898.1 protein_id gnl|my_center|LOCUS_20610 4981 5226 gene locus_tag LOCUS_20620 4981 5226 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324899.1 protein_id gnl|my_center|LOCUS_20620 5301 6476 gene locus_tag LOCUS_20630 gene fabF 5301 6476 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331838.1 protein_id gnl|my_center|LOCUS_20630 >Feature sequence189 2613 1138 gene locus_tag LOCUS_20640 gene miaB 2613 1138 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122282.1 protein_id gnl|my_center|LOCUS_20640 3650 2610 gene locus_tag LOCUS_20650 gene fmt 3650 2610 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123937.1 protein_id gnl|my_center|LOCUS_20650 4258 3635 gene locus_tag LOCUS_20660 gene def 4258 3635 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324462.1 protein_id gnl|my_center|LOCUS_20660 4284 4835 gene locus_tag LOCUS_20670 4284 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 4851 5489 gene locus_tag LOCUS_20680 4851 5489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 5740 6486 gene locus_tag LOCUS_20690 5740 6486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 >Feature sequence190 3565 1895 gene locus_tag LOCUS_20700 3565 1895 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921045.1 protein_id gnl|my_center|LOCUS_20700 4350 3550 gene locus_tag LOCUS_20710 4350 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 5129 5548 gene locus_tag LOCUS_20720 5129 5548 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063677.1 protein_id gnl|my_center|LOCUS_20720 >Feature sequence191 2275 962 gene locus_tag LOCUS_20730 2275 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 >Feature sequence192 1965 2900 gene locus_tag LOCUS_20740 1965 2900 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922317.1 protein_id gnl|my_center|LOCUS_20740 3573 2881 gene locus_tag LOCUS_20750 3573 2881 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289175.1 protein_id gnl|my_center|LOCUS_20750 3689 4693 gene locus_tag LOCUS_20760 gene mch 3689 4693 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145084390.1 protein_id gnl|my_center|LOCUS_20760 4698 5564 gene locus_tag LOCUS_20770 4698 5564 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922006.1 protein_id gnl|my_center|LOCUS_20770 5845 6267 gene locus_tag LOCUS_20780 5845 6267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 >Feature sequence193 1014 292 gene locus_tag LOCUS_20790 1014 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 1835 1035 gene locus_tag LOCUS_20800 1835 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 2096 1839 gene locus_tag LOCUS_20810 2096 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 3565 2123 gene locus_tag LOCUS_20820 3565 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 5034 3562 gene locus_tag LOCUS_20830 5034 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 5544 5077 gene locus_tag LOCUS_20840 5544 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 6254 5541 gene locus_tag LOCUS_20850 6254 5541 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120692.1 protein_id gnl|my_center|LOCUS_20850 >Feature sequence194 105 33 gene locus_tag LOCUS_t00340 105 33 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 250 177 gene locus_tag LOCUS_t00350 250 177 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 436 2370 gene locus_tag LOCUS_20860 436 2370 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325434.1 protein_id gnl|my_center|LOCUS_20860 2490 2759 gene locus_tag LOCUS_20870 2490 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 2933 4141 gene locus_tag LOCUS_20880 2933 4141 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329274.1 protein_id gnl|my_center|LOCUS_20880 4344 4922 gene locus_tag LOCUS_20890 4344 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329453.1 protein_id gnl|my_center|LOCUS_20890 5344 6159 gene locus_tag LOCUS_20900 5344 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 >Feature sequence195 361 1857 gene locus_tag LOCUS_20910 361 1857 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869326.1 protein_id gnl|my_center|LOCUS_20910 2873 2034 gene locus_tag LOCUS_20920 2873 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 3743 4513 gene locus_tag LOCUS_20930 3743 4513 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120930.1 protein_id gnl|my_center|LOCUS_20930 4507 5373 gene locus_tag LOCUS_20940 4507 5373 CDS product DUF4465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667002.1 protein_id gnl|my_center|LOCUS_20940 5385 6197 gene locus_tag LOCUS_20950 5385 6197 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333044.1 protein_id gnl|my_center|LOCUS_20950 6246 6533 gene locus_tag LOCUS_20960 6246 6533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 >Feature sequence196 242 1981 gene locus_tag LOCUS_20970 242 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 3347 2208 gene locus_tag LOCUS_20980 3347 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 4061 3651 gene locus_tag LOCUS_20990 4061 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 4493 4966 gene locus_tag LOCUS_21000 4493 4966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 5045 5257 gene locus_tag LOCUS_21010 5045 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 5272 5724 gene locus_tag LOCUS_21020 5272 5724 CDS product DUF2294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831496.1 protein_id gnl|my_center|LOCUS_21020 >Feature sequence197 290 838 gene locus_tag LOCUS_21030 290 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 828 1649 gene locus_tag LOCUS_21040 gene hisN 828 1649 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921412.1 protein_id gnl|my_center|LOCUS_21040 1989 2270 gene locus_tag LOCUS_21050 1989 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 2299 2601 gene locus_tag LOCUS_21060 gene gatC 2299 2601 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329511.1 protein_id gnl|my_center|LOCUS_21060 2616 4121 gene locus_tag LOCUS_21070 gene gatA 2616 4121 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119740.1 protein_id gnl|my_center|LOCUS_21070 3556 3476 gene locus_tag LOCUS_t00360 3556 3476 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4118 5605 gene locus_tag LOCUS_21080 gene gatB 4118 5605 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122965.1 protein_id gnl|my_center|LOCUS_21080 >Feature sequence198 252 797 gene locus_tag LOCUS_21090 252 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 970 3894 gene locus_tag LOCUS_21100 gene gcvP 970 3894 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115850.1 protein_id gnl|my_center|LOCUS_21100 5522 3915 gene locus_tag LOCUS_21110 5522 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 >Feature sequence199 1148 147 gene locus_tag LOCUS_21120 1148 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 1316 1246 gene locus_tag LOCUS_t00370 1316 1246 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1589 1320 gene locus_tag LOCUS_21130 1589 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 1852 1586 gene locus_tag LOCUS_21140 1852 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 3346 1922 gene locus_tag LOCUS_21150 3346 1922 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327689.1 protein_id gnl|my_center|LOCUS_21150 4146 3466 gene locus_tag LOCUS_21160 4146 3466 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975516.1 protein_id gnl|my_center|LOCUS_21160 5880 6492 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aggtgtgccgcatggtgcc >Feature sequence200 1288 290 gene locus_tag LOCUS_21170 1288 290 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975361.1 protein_id gnl|my_center|LOCUS_21170 1920 1285 gene locus_tag LOCUS_21180 1920 1285 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921958.1 protein_id gnl|my_center|LOCUS_21180 2933 1917 gene locus_tag LOCUS_21190 2933 1917 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121766.1 protein_id gnl|my_center|LOCUS_21190 3030 2958 gene locus_tag LOCUS_t00380 3030 2958 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3415 3068 gene locus_tag LOCUS_21200 3415 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 3649 4176 gene locus_tag LOCUS_21210 3649 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 4184 4810 gene locus_tag LOCUS_21220 4184 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 4867 5397 gene locus_tag LOCUS_21230 4867 5397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 >Feature sequence201 1435 2865 gene locus_tag LOCUS_21240 1435 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 2930 3232 gene locus_tag LOCUS_21250 gene rpsT 2930 3232 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771970.1 protein_id gnl|my_center|LOCUS_21250 4168 3257 gene locus_tag LOCUS_21260 4168 3257 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118509.1 protein_id gnl|my_center|LOCUS_21260 5374 4304 gene locus_tag LOCUS_21270 5374 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 5887 5492 gene locus_tag LOCUS_21280 5887 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 >Feature sequence202 262 579 gene locus_tag LOCUS_21290 262 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 667 1770 gene locus_tag LOCUS_21300 667 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 2752 1751 gene locus_tag LOCUS_21310 2752 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 2864 4561 gene locus_tag LOCUS_21320 2864 4561 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975360.1 protein_id gnl|my_center|LOCUS_21320 4577 6103 gene locus_tag LOCUS_21330 gene glpK 4577 6103 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229157.1 protein_id gnl|my_center|LOCUS_21330 >Feature sequence203 2464 1289 gene locus_tag LOCUS_21340 2464 1289 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_21340 3714 2572 gene locus_tag LOCUS_21350 3714 2572 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393239.1 protein_id gnl|my_center|LOCUS_21350 4314 3721 gene locus_tag LOCUS_21360 4314 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 4574 4311 gene locus_tag LOCUS_21370 4574 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 4672 4938 gene locus_tag LOCUS_21380 4672 4938 CDS product type II toxin-antitoxin system antitoxin VapB27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403139.1 protein_id gnl|my_center|LOCUS_21380 4935 5375 gene locus_tag LOCUS_21390 4935 5375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 5801 5505 gene locus_tag LOCUS_21400 5801 5505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 6121 5798 gene locus_tag LOCUS_21410 6121 5798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 >Feature sequence204 263 1492 gene locus_tag LOCUS_21420 263 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 2792 1659 gene locus_tag LOCUS_21430 2792 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 3202 3020 gene locus_tag LOCUS_21440 3202 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 3777 3283 gene locus_tag LOCUS_21450 3777 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 5058 4096 gene locus_tag LOCUS_21460 5058 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 6079 5420 gene locus_tag LOCUS_21470 gene rsmG 6079 5420 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334161.1 protein_id gnl|my_center|LOCUS_21470 >Feature sequence205 <1 1359 gene locus_tag LOCUS_21480 <1 1359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007334446.1:YifB family Mg chelatase-like AAA ATPase 1504 2229 gene locus_tag LOCUS_21490 1504 2229 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067384.1 protein_id gnl|my_center|LOCUS_21490 2368 2829 gene locus_tag LOCUS_21500 2368 2829 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324235.1 protein_id gnl|my_center|LOCUS_21500 2983 4848 gene locus_tag LOCUS_21510 2983 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 >Feature sequence206 <1 687 gene locus_tag LOCUS_21520 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007332129.1:adenylyl-sulfate kinase 1673 1137 gene locus_tag LOCUS_21530 1673 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 3168 1744 gene locus_tag LOCUS_21540 3168 1744 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921673.1 protein_id gnl|my_center|LOCUS_21540 5625 3190 gene locus_tag LOCUS_21550 5625 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 <6314 5622 gene locus_tag LOCUS_21560 <6314 5622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007329353.1:DUF1501 domain-containing protein >Feature sequence207 355 1503 gene locus_tag LOCUS_21570 355 1503 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615603.1 protein_id gnl|my_center|LOCUS_21570 2772 1624 gene locus_tag LOCUS_21580 2772 1624 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829167.1 protein_id gnl|my_center|LOCUS_21580 3694 2798 gene locus_tag LOCUS_21590 gene prpB 3694 2798 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112517.1 protein_id gnl|my_center|LOCUS_21590 3769 5373 gene locus_tag LOCUS_21600 3769 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615709.1 protein_id gnl|my_center|LOCUS_21600 5370 6095 gene locus_tag LOCUS_21610 5370 6095 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922323.1 protein_id gnl|my_center|LOCUS_21610 >Feature sequence208 1 180 gene locus_tag LOCUS_21620 1 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 507 268 gene locus_tag LOCUS_21630 507 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 1211 546 gene locus_tag LOCUS_21640 1211 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 1354 1674 gene locus_tag LOCUS_21650 1354 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 2562 1678 gene locus_tag LOCUS_21660 2562 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 2637 3350 gene locus_tag LOCUS_21670 2637 3350 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064314.1 protein_id gnl|my_center|LOCUS_21670 4239 3433 gene locus_tag LOCUS_21680 4239 3433 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120403.1 protein_id gnl|my_center|LOCUS_21680 5296 4232 gene locus_tag LOCUS_21690 5296 4232 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921814.1 protein_id gnl|my_center|LOCUS_21690 6094 5465 gene locus_tag LOCUS_21700 6094 5465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 >Feature sequence209 4622 441 gene locus_tag LOCUS_21710 4622 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 4851 4615 gene locus_tag LOCUS_21720 4851 4615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 5465 4848 gene locus_tag LOCUS_21730 5465 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 5760 5488 gene locus_tag LOCUS_21740 5760 5488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 >Feature sequence210 301 1698 gene locus_tag LOCUS_21750 301 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 3406 1637 gene locus_tag LOCUS_21760 3406 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 3844 3566 gene locus_tag LOCUS_21770 3844 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 4399 3857 gene locus_tag LOCUS_21780 4399 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 4988 4434 gene locus_tag LOCUS_21790 4988 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 5496 5068 gene locus_tag LOCUS_21800 5496 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 >Feature sequence211 425 1222 gene locus_tag LOCUS_21810 425 1222 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118674.1 protein_id gnl|my_center|LOCUS_21810 1261 2373 gene locus_tag LOCUS_21820 1261 2373 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228417.1 protein_id gnl|my_center|LOCUS_21820 3814 2519 gene locus_tag LOCUS_21830 3814 2519 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_21830 5876 4032 gene locus_tag LOCUS_21840 gene mnmG 5876 4032 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427787.1 protein_id gnl|my_center|LOCUS_21840 >Feature sequence212 >Feature sequence213 631 1269 gene locus_tag LOCUS_21850 631 1269 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338989.1 protein_id gnl|my_center|LOCUS_21850 1738 2700 gene locus_tag LOCUS_21860 gene cysK 1738 2700 CDS product O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899275.1 protein_id gnl|my_center|LOCUS_21860 3470 2757 gene locus_tag LOCUS_21870 3470 2757 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203675.1 protein_id gnl|my_center|LOCUS_21870 4170 3472 gene locus_tag LOCUS_21880 4170 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 >Feature sequence214 1504 755 gene locus_tag LOCUS_21890 1504 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 2931 1501 gene locus_tag LOCUS_21900 2931 1501 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389166.1 protein_id gnl|my_center|LOCUS_21900 2988 4631 gene locus_tag LOCUS_21910 2988 4631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 4640 5767 gene locus_tag LOCUS_21920 4640 5767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 >Feature sequence215 346 1497 gene locus_tag LOCUS_21930 346 1497 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122678.1 protein_id gnl|my_center|LOCUS_21930 1497 3401 gene locus_tag LOCUS_21940 1497 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 3408 4001 gene locus_tag LOCUS_21950 3408 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 4038 4673 gene locus_tag LOCUS_21960 4038 4673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 5595 4654 gene locus_tag LOCUS_21970 gene epmA 5595 4654 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921800.1 protein_id gnl|my_center|LOCUS_21970 >Feature sequence216 1789 1145 gene locus_tag LOCUS_21980 1789 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 3120 1822 gene locus_tag LOCUS_21990 3120 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 3378 4283 gene locus_tag LOCUS_22000 3378 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 5322 4264 gene locus_tag LOCUS_22010 gene pdxA 5322 4264 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393087.1 protein_id gnl|my_center|LOCUS_22010 5389 5904 gene locus_tag LOCUS_22020 5389 5904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 >Feature sequence217 4218 775 gene locus_tag LOCUS_22030 4218 775 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922034.1 protein_id gnl|my_center|LOCUS_22030 4895 4215 gene locus_tag LOCUS_22040 4895 4215 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118407.1 protein_id gnl|my_center|LOCUS_22040 5357 4935 gene locus_tag LOCUS_22050 5357 4935 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121867.1 protein_id gnl|my_center|LOCUS_22050 5649 5371 gene locus_tag LOCUS_22060 gene rpsR 5649 5371 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236620859.1 protein_id gnl|my_center|LOCUS_22060 >Feature sequence218 593 225 gene locus_tag LOCUS_22070 gene rplN 593 225 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326806.1 protein_id gnl|my_center|LOCUS_22070 955 590 gene locus_tag LOCUS_22080 gene rpsQ 955 590 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812390.1 protein_id gnl|my_center|LOCUS_22080 1214 984 gene locus_tag LOCUS_22090 gene rpmC 1214 984 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326804.1 protein_id gnl|my_center|LOCUS_22090 1642 1226 gene locus_tag LOCUS_22100 gene rplP 1642 1226 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121605.1 protein_id gnl|my_center|LOCUS_22100 2276 1581 gene locus_tag LOCUS_22110 gene rpsC 2276 1581 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326802.1 protein_id gnl|my_center|LOCUS_22110 2650 2315 gene locus_tag LOCUS_22120 gene rplV 2650 2315 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121604.1 protein_id gnl|my_center|LOCUS_22120 2973 2677 gene locus_tag LOCUS_22130 gene rpsS 2973 2677 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326800.1 protein_id gnl|my_center|LOCUS_22130 3840 2983 gene locus_tag LOCUS_22140 gene rplB 3840 2983 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121603.1 protein_id gnl|my_center|LOCUS_22140 4200 3880 gene locus_tag LOCUS_22150 gene rplW 4200 3880 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326798.1 protein_id gnl|my_center|LOCUS_22150 4977 4204 gene locus_tag LOCUS_22160 gene rplD 4977 4204 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326797.1 protein_id gnl|my_center|LOCUS_22160 5777 4974 gene locus_tag LOCUS_22170 gene rplC 5777 4974 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121602.1 protein_id gnl|my_center|LOCUS_22170 >Feature sequence219 2032 719 gene locus_tag LOCUS_22180 2032 719 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257455.1 protein_id gnl|my_center|LOCUS_22180 2116 3345 gene locus_tag LOCUS_22190 gene xseA 2116 3345 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119437.1 protein_id gnl|my_center|LOCUS_22190 3335 3709 gene locus_tag LOCUS_22200 3335 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 3749 4741 gene locus_tag LOCUS_22210 3749 4741 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118683.1 protein_id gnl|my_center|LOCUS_22210 >Feature sequence220 1923 790 gene locus_tag LOCUS_22220 1923 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 2733 2008 gene locus_tag LOCUS_22230 2733 2008 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057678.1 protein_id gnl|my_center|LOCUS_22230 4082 2967 gene locus_tag LOCUS_22240 4082 2967 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926879.1 protein_id gnl|my_center|LOCUS_22240 4249 5247 gene locus_tag LOCUS_22250 gene tatC 4249 5247 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338730.1 protein_id gnl|my_center|LOCUS_22250 5729 5220 gene locus_tag LOCUS_22260 5729 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 >Feature sequence221 279 554 gene locus_tag LOCUS_22270 279 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 572 1495 gene locus_tag LOCUS_22280 gene xerC 572 1495 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_22280 1806 3659 gene locus_tag LOCUS_22290 1806 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 3686 5164 gene locus_tag LOCUS_22300 3686 5164 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403192.1 protein_id gnl|my_center|LOCUS_22300 <5932 5125 gene locus_tag LOCUS_22310 <5932 5125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004190908.1:chemotaxis response regulator protein-glutamate methylesterase >Feature sequence222 1161 256 gene locus_tag LOCUS_22320 1161 256 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324364.1 protein_id gnl|my_center|LOCUS_22320 1611 1300 gene locus_tag LOCUS_22330 1611 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 2376 1621 gene locus_tag LOCUS_22340 2376 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 2662 2399 gene locus_tag LOCUS_22350 2662 2399 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118934.1 protein_id gnl|my_center|LOCUS_22350 4212 2743 gene locus_tag LOCUS_22360 4212 2743 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333579.1 protein_id gnl|my_center|LOCUS_22360 4557 4252 gene locus_tag LOCUS_22370 4557 4252 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324359.1 protein_id gnl|my_center|LOCUS_22370 5804 4557 gene locus_tag LOCUS_22380 5804 4557 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118936.1 protein_id gnl|my_center|LOCUS_22380 >Feature sequence223 <1 1134 gene locus_tag LOCUS_22390 <1 1134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460894.1:GTPase ObgE 1190 1576 gene locus_tag LOCUS_22400 gene vsr 1190 1576 CDS product DNA mismatch endonuclease Vsr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940109.1 protein_id gnl|my_center|LOCUS_22400 1573 3054 gene locus_tag LOCUS_22410 1573 3054 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_22410 3680 3075 gene locus_tag LOCUS_22420 3680 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 3690 3914 gene locus_tag LOCUS_22430 3690 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 5065 3827 gene locus_tag LOCUS_22440 5065 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 >Feature sequence224 1113 2579 gene locus_tag LOCUS_22450 1113 2579 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119613.1 protein_id gnl|my_center|LOCUS_22450 3495 2752 gene locus_tag LOCUS_22460 3495 2752 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121194.1 protein_id gnl|my_center|LOCUS_22460 3596 5092 gene locus_tag LOCUS_22470 3596 5092 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921863.1 protein_id gnl|my_center|LOCUS_22470 5525 5013 gene locus_tag LOCUS_22480 5525 5013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 >Feature sequence225 514 1383 gene locus_tag LOCUS_22490 514 1383 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037249854.1 protein_id gnl|my_center|LOCUS_22490 1825 2757 gene locus_tag LOCUS_22500 1825 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 3182 3529 gene locus_tag LOCUS_22510 3182 3529 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330019.1 protein_id gnl|my_center|LOCUS_22510 3563 4000 gene locus_tag LOCUS_22520 3563 4000 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616222.1 protein_id gnl|my_center|LOCUS_22520 4042 5481 gene locus_tag LOCUS_22530 4042 5481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332558.1 protein_id gnl|my_center|LOCUS_22530 >Feature sequence226 38 1204 gene locus_tag LOCUS_22540 38 1204 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958509.1 protein_id gnl|my_center|LOCUS_22540 2387 1182 gene locus_tag LOCUS_22550 2387 1182 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462194.1 protein_id gnl|my_center|LOCUS_22550 2876 4423 gene locus_tag LOCUS_22560 2876 4423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 >Feature sequence227 2558 1128 gene locus_tag LOCUS_22570 2558 1128 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326676.1 protein_id gnl|my_center|LOCUS_22570 <5707 2555 gene locus_tag LOCUS_22580 <5707 2555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121300.1:DUF1553 domain-containing protein >Feature sequence228 1261 839 gene locus_tag LOCUS_22590 1261 839 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324538.1 protein_id gnl|my_center|LOCUS_22590 2650 1463 gene locus_tag LOCUS_22600 2650 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 3804 2647 gene locus_tag LOCUS_22610 3804 2647 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122942.1 protein_id gnl|my_center|LOCUS_22610 5240 3804 gene locus_tag LOCUS_22620 5240 3804 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922220.1 protein_id gnl|my_center|LOCUS_22620 >Feature sequence229 188 1027 gene locus_tag LOCUS_22630 188 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 1064 2497 gene locus_tag LOCUS_22640 1064 2497 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037247553.1 protein_id gnl|my_center|LOCUS_22640 2497 4221 gene locus_tag LOCUS_22650 2497 4221 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123969.1 protein_id gnl|my_center|LOCUS_22650 4573 5190 gene locus_tag LOCUS_22660 4573 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 5494 5156 gene locus_tag LOCUS_22670 5494 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 >Feature sequence230 <1 1148 gene locus_tag LOCUS_22680 <1 1148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870057.1:flagellar biosynthesis protein FlhA 1331 2113 gene locus_tag LOCUS_22690 1331 2113 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817082.1 protein_id gnl|my_center|LOCUS_22690 2466 2747 gene locus_tag LOCUS_22700 2466 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 3721 2885 gene locus_tag LOCUS_22710 3721 2885 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028851.1 protein_id gnl|my_center|LOCUS_22710 4668 3736 gene locus_tag LOCUS_22720 4668 3736 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666219.1 protein_id gnl|my_center|LOCUS_22720 5065 4691 gene locus_tag LOCUS_22730 5065 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 5268 5062 gene locus_tag LOCUS_22740 5268 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 >Feature sequence231 387 1049 gene locus_tag LOCUS_22750 387 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 2745 1624 gene locus_tag LOCUS_22760 2745 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 2912 4231 gene locus_tag LOCUS_22770 2912 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 <5656 4292 gene locus_tag LOCUS_22780 <5656 4292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527896.1:glutamate synthase subunit beta >Feature sequence232 832 1416 gene locus_tag LOCUS_22790 832 1416 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121244.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22790 1406 3526 gene locus_tag LOCUS_22800 1406 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 4616 3555 gene locus_tag LOCUS_22810 4616 3555 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326673.1 protein_id gnl|my_center|LOCUS_22810 >Feature sequence233 22 2634 gene locus_tag LOCUS_22820 gene alaS 22 2634 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121911.1 protein_id gnl|my_center|LOCUS_22820 3350 2829 gene locus_tag LOCUS_22830 gene tpx 3350 2829 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326977.1 protein_id gnl|my_center|LOCUS_22830 3539 3709 gene locus_tag LOCUS_22840 3539 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 4017 3817 gene locus_tag LOCUS_22850 4017 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 4006 4686 gene locus_tag LOCUS_22860 4006 4686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 4979 5236 gene locus_tag LOCUS_22870 4979 5236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 >Feature sequence234 287 42 gene locus_tag LOCUS_22880 gene rpmA 287 42 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327901.1 protein_id gnl|my_center|LOCUS_22880 1975 332 gene locus_tag LOCUS_22890 1975 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 2230 2508 gene locus_tag LOCUS_22900 2230 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 3305 2463 gene locus_tag LOCUS_22910 3305 2463 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330043.1 protein_id gnl|my_center|LOCUS_22910 3916 3395 gene locus_tag LOCUS_22920 3916 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 3999 4235 gene locus_tag LOCUS_22930 3999 4235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 4238 5350 gene locus_tag LOCUS_22940 gene aroB 4238 5350 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231846185.1 protein_id gnl|my_center|LOCUS_22940 >Feature sequence235 1766 621 gene locus_tag LOCUS_22950 1766 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 1981 4320 gene locus_tag LOCUS_22960 1981 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 4570 5217 gene locus_tag LOCUS_22970 4570 5217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 >Feature sequence236 3306 2881 gene locus_tag LOCUS_22980 3306 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 4133 3855 gene locus_tag LOCUS_22990 4133 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 4726 4289 gene locus_tag LOCUS_23000 4726 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 5167 4823 gene locus_tag LOCUS_23010 5167 4823 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942865.1 protein_id gnl|my_center|LOCUS_23010 5364 5152 gene locus_tag LOCUS_23020 5364 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 >Feature sequence237 <1 1575 gene locus_tag LOCUS_23030 <1 1575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_047815631.1:DUF4159 domain-containing protein 2621 1788 gene locus_tag LOCUS_23040 2621 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 5459 2709 gene locus_tag LOCUS_23050 5459 2709 CDS product calcium-transporting P-type ATPase, PMR1-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272458.1 protein_id gnl|my_center|LOCUS_23050 >Feature sequence238 <1 1491 gene locus_tag LOCUS_23060 <1 1491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007328293.1:sigma-70 family RNA polymerase sigma factor 1573 1806 gene locus_tag LOCUS_23070 1573 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 1936 5055 gene locus_tag LOCUS_23080 1936 5055 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921281.1 protein_id gnl|my_center|LOCUS_23080 >Feature sequence239 <1 648 gene locus_tag LOCUS_23090 <1 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122671.1:ATP synthase F1 subunit gamma 679 2109 gene locus_tag LOCUS_23100 gene atpD 679 2109 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122672.1 protein_id gnl|my_center|LOCUS_23100 2136 2570 gene locus_tag LOCUS_23110 2136 2570 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327186.1 protein_id gnl|my_center|LOCUS_23110 2578 3903 gene locus_tag LOCUS_23120 2578 3903 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403883.1 protein_id gnl|my_center|LOCUS_23120 3900 5165 gene locus_tag LOCUS_23130 3900 5165 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838600.1 protein_id gnl|my_center|LOCUS_23130 >Feature sequence240 1305 619 gene locus_tag LOCUS_23140 1305 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 1923 1327 gene locus_tag LOCUS_23150 1923 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 4562 2757 gene locus_tag LOCUS_23160 4562 2757 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133037249.1 protein_id gnl|my_center|LOCUS_23160 5007 4654 gene locus_tag LOCUS_23170 gene tnpB 5007 4654 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971016.1 protein_id gnl|my_center|LOCUS_23170 5342 5001 gene locus_tag LOCUS_23180 5342 5001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 >Feature sequence241 <1 2133 gene locus_tag LOCUS_23190 <1 2133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922491.1:PSD1 and planctomycete cytochrome C domain-containing protein 2153 3592 gene locus_tag LOCUS_23200 2153 3592 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922492.1 protein_id gnl|my_center|LOCUS_23200 3637 5001 gene locus_tag LOCUS_23210 3637 5001 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275393.1 protein_id gnl|my_center|LOCUS_23210 >Feature sequence242 2228 156 gene locus_tag LOCUS_23220 2228 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 2460 5228 gene locus_tag LOCUS_23230 2460 5228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 >Feature sequence243 158 1687 gene locus_tag LOCUS_23240 158 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 1752 2717 gene locus_tag LOCUS_23250 1752 2717 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434800.1 protein_id gnl|my_center|LOCUS_23250 3007 3717 gene locus_tag LOCUS_23260 3007 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 5233 4052 gene locus_tag LOCUS_23270 5233 4052 CDS product IS256-like element ISRm5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969296.1 protein_id gnl|my_center|LOCUS_23270 >Feature sequence244 <1 678 gene locus_tag LOCUS_23280 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000925324.1:MBL fold metallo-hydrolase 858 1643 gene locus_tag LOCUS_23290 858 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 1726 1953 gene locus_tag LOCUS_23300 1726 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 2068 1995 gene locus_tag LOCUS_t00390 2068 1995 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2913 2104 gene locus_tag LOCUS_23310 2913 2104 CDS product DUF4239 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223420.1 protein_id gnl|my_center|LOCUS_23310 3639 2929 gene locus_tag LOCUS_23320 3639 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 4740 3721 gene locus_tag LOCUS_23330 gene hflC 4740 3721 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678885.1 protein_id gnl|my_center|LOCUS_23330 <5384 4737 gene locus_tag LOCUS_23340 <5384 4737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002678884.1:FtsH protease activity modulator HflK >Feature sequence245 1493 360 gene locus_tag LOCUS_23350 1493 360 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_23350 2662 1631 gene locus_tag LOCUS_23360 2662 1631 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_23360 3924 2662 gene locus_tag LOCUS_23370 3924 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328450.1 protein_id gnl|my_center|LOCUS_23370 >Feature sequence246 2059 1142 gene locus_tag LOCUS_23380 2059 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 2646 2056 gene locus_tag LOCUS_23390 2646 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 2817 2890 gene locus_tag LOCUS_t00400 2817 2890 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2896 3837 gene locus_tag LOCUS_23400 gene ilvE 2896 3837 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_23400 3903 4544 gene locus_tag LOCUS_23410 3903 4544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 4572 5219 gene locus_tag LOCUS_23420 4572 5219 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461663.1 protein_id gnl|my_center|LOCUS_23420 >Feature sequence247 1368 382 gene locus_tag LOCUS_23430 1368 382 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337469.1 protein_id gnl|my_center|LOCUS_23430 1612 2934 gene locus_tag LOCUS_23440 1612 2934 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333174.1 protein_id gnl|my_center|LOCUS_23440 2931 3665 gene locus_tag LOCUS_23450 gene uppS 2931 3665 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328291.1 protein_id gnl|my_center|LOCUS_23450 3662 4588 gene locus_tag LOCUS_23460 3662 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 >Feature sequence248 1651 5193 gene locus_tag LOCUS_23470 gene ileS 1651 5193 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434976.1 protein_id gnl|my_center|LOCUS_23470 >Feature sequence249 1789 482 gene locus_tag LOCUS_23480 1789 482 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_23480 3552 2209 gene locus_tag LOCUS_23490 gene der 3552 2209 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330049.1 protein_id gnl|my_center|LOCUS_23490 <5326 3752 gene locus_tag LOCUS_23500 <5326 3752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122658.1:oligoendopeptidase F >Feature sequence250 1179 313 gene locus_tag LOCUS_23510 1179 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 1251 1688 gene locus_tag LOCUS_23520 1251 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 3659 1791 gene locus_tag LOCUS_23530 3659 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 >Feature sequence251 1471 893 gene locus_tag LOCUS_23540 1471 893 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329717.1 protein_id gnl|my_center|LOCUS_23540 1944 1591 gene locus_tag LOCUS_23550 1944 1591 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122082.1 protein_id gnl|my_center|LOCUS_23550 2140 2817 gene locus_tag LOCUS_23560 2140 2817 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524934.1 protein_id gnl|my_center|LOCUS_23560 2810 4252 gene locus_tag LOCUS_23570 2810 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 >Feature sequence252 <1 1149 gene locus_tag LOCUS_23580 <1 1149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120288.1:flagellar basal body P-ring protein FlgI 1146 4844 gene locus_tag LOCUS_23590 gene smc 1146 4844 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921931.1 protein_id gnl|my_center|LOCUS_23590 >Feature sequence253 593 237 gene locus_tag LOCUS_23600 593 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 963 1286 gene locus_tag LOCUS_23610 963 1286 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325910.1 protein_id gnl|my_center|LOCUS_23610 1360 2988 gene locus_tag LOCUS_23620 gene groL 1360 2988 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325911.1 protein_id gnl|my_center|LOCUS_23620 2206 2113 gene locus_tag LOCUS_t00410 2206 2113 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3217 3044 gene locus_tag LOCUS_23630 3217 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 5190 3220 gene locus_tag LOCUS_23640 gene feoB 5190 3220 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640041.1 protein_id gnl|my_center|LOCUS_23640 >Feature sequence254 1281 256 gene locus_tag LOCUS_23650 gene waaC 1281 256 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942882.1 protein_id gnl|my_center|LOCUS_23650 2419 1370 gene locus_tag LOCUS_23660 2419 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 2536 4770 gene locus_tag LOCUS_23670 2536 4770 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_23670 >Feature sequence255 419 1096 gene locus_tag LOCUS_23680 419 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 1110 3872 gene locus_tag LOCUS_23690 1110 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 3841 4227 gene locus_tag LOCUS_23700 3841 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 4354 4602 gene locus_tag LOCUS_23710 4354 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 >Feature sequence256 <1 1269 gene locus_tag LOCUS_23720 <1 1269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123504.1:phytoene desaturase family protein 1290 2084 gene locus_tag LOCUS_23730 1290 2084 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123503.1 protein_id gnl|my_center|LOCUS_23730 2081 3235 gene locus_tag LOCUS_23740 2081 3235 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922473.1 protein_id gnl|my_center|LOCUS_23740 4646 3570 gene locus_tag LOCUS_23750 4646 3570 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328432.1 protein_id gnl|my_center|LOCUS_23750 <5210 4643 gene locus_tag LOCUS_23760 <5210 4643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007334154.1:UvrB/UvrC motif-containing protein >Feature sequence257 163 747 gene locus_tag LOCUS_23770 163 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 761 1870 gene locus_tag LOCUS_23780 761 1870 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330337.1 protein_id gnl|my_center|LOCUS_23780 1930 3957 gene locus_tag LOCUS_23790 1930 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 <5172 3990 gene locus_tag LOCUS_23800 <5172 3990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_211409870.1:DUF2130 domain-containing protein >Feature sequence258 837 2153 gene locus_tag LOCUS_23810 gene lysA 837 2153 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103031.1 protein_id gnl|my_center|LOCUS_23810 2361 2756 gene locus_tag LOCUS_23820 2361 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 2909 4027 gene locus_tag LOCUS_23830 gene dprA 2909 4027 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922340.1 protein_id gnl|my_center|LOCUS_23830 >Feature sequence259 <1 762 gene locus_tag LOCUS_23840 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007333812.1:DNA-directed RNA polymerase subunit beta' 852 1721 gene locus_tag LOCUS_23850 852 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 1821 2741 gene locus_tag LOCUS_23860 1821 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 2802 3902 gene locus_tag LOCUS_23870 2802 3902 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026311868.1 protein_id gnl|my_center|LOCUS_23870 <5070 4354 gene locus_tag LOCUS_23880 <5070 4354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615613.1:DNA polymerase/3'-5' exonuclease PolX >Feature sequence260 1044 382 gene locus_tag LOCUS_23890 1044 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 1633 1145 gene locus_tag LOCUS_23900 1633 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 2009 1614 gene locus_tag LOCUS_23910 2009 1614 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199838.1 protein_id gnl|my_center|LOCUS_23910 3303 2044 gene locus_tag LOCUS_23920 3303 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 4703 3414 gene locus_tag LOCUS_23930 4703 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 >Feature sequence261 4235 1878 gene locus_tag LOCUS_23940 4235 1878 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118530.1 protein_id gnl|my_center|LOCUS_23940 4443 4715 gene locus_tag LOCUS_23950 4443 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 >Feature sequence262 1064 90 gene locus_tag LOCUS_23960 1064 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 1394 2404 gene locus_tag LOCUS_23970 1394 2404 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035718.1 protein_id gnl|my_center|LOCUS_23970 2643 4655 gene locus_tag LOCUS_23980 2643 4655 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090696.1 protein_id gnl|my_center|LOCUS_23980 >Feature sequence263 789 130 gene locus_tag LOCUS_23990 gene pabA 789 130 CDS product aminodeoxychorismate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369400.1 protein_id gnl|my_center|LOCUS_23990 2318 786 gene locus_tag LOCUS_24000 gene pabB 2318 786 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393598.1 protein_id gnl|my_center|LOCUS_24000 3775 2315 gene locus_tag LOCUS_24010 3775 2315 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118487.1 protein_id gnl|my_center|LOCUS_24010 3887 4477 gene locus_tag LOCUS_24020 3887 4477 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119639.1 protein_id gnl|my_center|LOCUS_24020 4451 4625 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq catcgacgggccatcgacaggcc >Feature sequence264 2041 170 gene locus_tag LOCUS_24030 gene recQ 2041 170 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921919.1 protein_id gnl|my_center|LOCUS_24030 3164 2454 gene locus_tag LOCUS_24040 3164 2454 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937857.1 protein_id gnl|my_center|LOCUS_24040 4536 3169 gene locus_tag LOCUS_24050 4536 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 >Feature sequence265 1574 1011 gene locus_tag LOCUS_24060 1574 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 2623 1631 gene locus_tag LOCUS_24070 2623 1631 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327113.1 protein_id gnl|my_center|LOCUS_24070 3671 2613 gene locus_tag LOCUS_24080 3671 2613 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121793.1 protein_id gnl|my_center|LOCUS_24080 >Feature sequence266 <1 2211 gene locus_tag LOCUS_24090 <1 2211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007340662.1:DNA-directed RNA polymerase subunit beta >Feature sequence267 1108 314 gene locus_tag LOCUS_24100 1108 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 1316 1086 gene locus_tag LOCUS_24110 1316 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 2240 1449 gene locus_tag LOCUS_24120 2240 1449 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839974.1 protein_id gnl|my_center|LOCUS_24120 3496 2288 gene locus_tag LOCUS_24130 3496 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 3879 4637 gene locus_tag LOCUS_24140 3879 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 >Feature sequence268 1663 167 gene locus_tag LOCUS_24150 1663 167 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121094.1 protein_id gnl|my_center|LOCUS_24150 2105 3523 gene locus_tag LOCUS_24160 2105 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 3745 4194 gene locus_tag LOCUS_24170 gene infC 3745 4194 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329878.1 protein_id gnl|my_center|LOCUS_24170 4226 4429 gene locus_tag LOCUS_24180 gene rpmI 4226 4429 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125945.1 protein_id gnl|my_center|LOCUS_24180 >Feature sequence269 2049 157 gene locus_tag LOCUS_24190 2049 157 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942647.1 protein_id gnl|my_center|LOCUS_24190 2148 2558 gene locus_tag LOCUS_24200 2148 2558 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119515.1 protein_id gnl|my_center|LOCUS_24200 2582 3670 gene locus_tag LOCUS_24210 2582 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 <4805 3966 gene locus_tag LOCUS_24220 <4805 3966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015444660.1:TolC family protein >Feature sequence270 <1 840 gene locus_tag LOCUS_24230 <1 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583250.1:excinuclease ABC subunit UvrA 1078 2349 gene locus_tag LOCUS_24240 1078 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 2405 3691 gene locus_tag LOCUS_24250 2405 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 <4802 3705 gene locus_tag LOCUS_24260 <4802 3705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941413.1:fibronectin type III domain-containing protein >Feature sequence271 4147 4219 gene locus_tag LOCUS_t00420 4147 4219 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence272 935 270 gene locus_tag LOCUS_24270 935 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 1579 989 gene locus_tag LOCUS_24280 gene folE 1579 989 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336701.1 protein_id gnl|my_center|LOCUS_24280 2423 1731 gene locus_tag LOCUS_24290 2423 1731 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327343.1 protein_id gnl|my_center|LOCUS_24290 2849 2457 gene locus_tag LOCUS_24300 2849 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 2936 3703 gene locus_tag LOCUS_24310 gene nth 2936 3703 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_24310 3779 4354 gene locus_tag LOCUS_24320 gene dcd 3779 4354 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963354.1 protein_id gnl|my_center|LOCUS_24320 4361 4558 gene locus_tag LOCUS_24330 4361 4558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 >Feature sequence273 <1 906 gene locus_tag LOCUS_24340 <1 906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257880.1:circularly permuted type 2 ATP-grasp protein 923 1873 gene locus_tag LOCUS_24350 923 1873 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_24350 1890 2840 gene locus_tag LOCUS_24360 1890 2840 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919474.1 protein_id gnl|my_center|LOCUS_24360 2867 4453 gene locus_tag LOCUS_24370 gene pckA 2867 4453 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405091.1 protein_id gnl|my_center|LOCUS_24370 >Feature sequence274 2740 1535 gene locus_tag LOCUS_24380 2740 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 3497 2733 gene locus_tag LOCUS_24390 3497 2733 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328032.1 protein_id gnl|my_center|LOCUS_24390 4387 3542 gene locus_tag LOCUS_24400 4387 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 >Feature sequence275 25 116 gene locus_tag LOCUS_t00430 25 116 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 134 583 gene locus_tag LOCUS_24410 134 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 1814 966 gene locus_tag LOCUS_24420 1814 966 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973992.1 protein_id gnl|my_center|LOCUS_24420 1940 2911 gene locus_tag LOCUS_24430 1940 2911 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_24430 4002 2920 gene locus_tag LOCUS_24440 4002 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 >Feature sequence276 <1 3618 gene locus_tag LOCUS_24450 <1 3618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226244.1:alpha-L-arabinofuranosidase C-terminal domain-containing protein 4147 3626 gene locus_tag LOCUS_24460 4147 3626 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615596.1 protein_id gnl|my_center|LOCUS_24460 <4707 4161 gene locus_tag LOCUS_24470 <4707 4161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326621.1:phosphoribosylglycinamide formyltransferase >Feature sequence277 2446 1547 gene locus_tag LOCUS_24480 2446 1547 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324200.1 protein_id gnl|my_center|LOCUS_24480 3496 2471 gene locus_tag LOCUS_24490 3496 2471 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922840.1 protein_id gnl|my_center|LOCUS_24490 >Feature sequence278 1362 3053 gene locus_tag LOCUS_24500 1362 3053 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121786.1 protein_id gnl|my_center|LOCUS_24500 3050 3829 gene locus_tag LOCUS_24510 3050 3829 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_24510 >Feature sequence279 566 943 gene locus_tag LOCUS_24520 gene rplT 566 943 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332030.1 protein_id gnl|my_center|LOCUS_24520 948 1961 gene locus_tag LOCUS_24530 gene pheS 948 1961 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121253.1 protein_id gnl|my_center|LOCUS_24530 2121 4187 gene locus_tag LOCUS_24540 gene pheT 2121 4187 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663007.1 protein_id gnl|my_center|LOCUS_24540 >Feature sequence280 1965 481 gene locus_tag LOCUS_24550 gene hemG 1965 481 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122777.1 protein_id gnl|my_center|LOCUS_24550 2074 4371 gene locus_tag LOCUS_24560 2074 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 >Feature sequence281 2299 1433 gene locus_tag LOCUS_24570 2299 1433 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813366.1 protein_id gnl|my_center|LOCUS_24570 2364 3404 gene locus_tag LOCUS_24580 2364 3404 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173401898.1 protein_id gnl|my_center|LOCUS_24580 3417 4328 gene locus_tag LOCUS_24590 3417 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 >Feature sequence282 1599 229 gene locus_tag LOCUS_24600 1599 229 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_24600 1803 1600 gene locus_tag LOCUS_24610 1803 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 2143 2805 gene locus_tag LOCUS_24620 2143 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24620 <4560 3251 gene locus_tag LOCUS_24630 <4560 3251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120362.1:PQQ-binding-like beta-propeller repeat protein >Feature sequence283 243 3371 gene locus_tag LOCUS_24640 243 3371 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666716.1 protein_id gnl|my_center|LOCUS_24640 >Feature sequence284 736 2589 gene locus_tag LOCUS_24650 736 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 2616 3341 gene locus_tag LOCUS_24660 2616 3341 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008669481.1 protein_id gnl|my_center|LOCUS_24660 3814 3338 gene locus_tag LOCUS_24670 gene greA 3814 3338 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339475.1 protein_id gnl|my_center|LOCUS_24670 <4508 3861 gene locus_tag LOCUS_24680 <4508 3861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326094.1:phospholipase >Feature sequence285 1109 267 gene locus_tag LOCUS_24690 gene miaA 1109 267 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_24690 1212 1556 gene locus_tag LOCUS_24700 1212 1556 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391340.1 protein_id gnl|my_center|LOCUS_24700 1553 2419 gene locus_tag LOCUS_24710 gene hisG 1553 2419 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329831.1 protein_id gnl|my_center|LOCUS_24710 3850 2609 gene locus_tag LOCUS_24720 3850 2609 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121756.1 protein_id gnl|my_center|LOCUS_24720 4506 3847 gene locus_tag LOCUS_24730 4506 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 >Feature sequence286 345 1445 gene locus_tag LOCUS_24740 345 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 1459 2394 gene locus_tag LOCUS_24750 gene thiL 1459 2394 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121111.1 protein_id gnl|my_center|LOCUS_24750 2378 2917 gene locus_tag LOCUS_24760 2378 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 3674 2856 gene locus_tag LOCUS_24770 3674 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975431.1 protein_id gnl|my_center|LOCUS_24770 3740 4285 gene locus_tag LOCUS_24780 3740 4285 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933341.1 protein_id gnl|my_center|LOCUS_24780 >Feature sequence287 1075 791 gene locus_tag LOCUS_24790 1075 791 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792685.1 protein_id gnl|my_center|LOCUS_24790 1548 1072 gene locus_tag LOCUS_24800 1548 1072 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328918.1 protein_id gnl|my_center|LOCUS_24800 1914 1594 gene locus_tag LOCUS_24810 gene raiA 1914 1594 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328917.1 protein_id gnl|my_center|LOCUS_24810 4227 2008 gene locus_tag LOCUS_24820 4227 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 >Feature sequence288 >Feature sequence289 1277 375 gene locus_tag LOCUS_24830 1277 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 2965 1655 gene locus_tag LOCUS_24840 2965 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 <4446 3200 gene locus_tag LOCUS_24850 <4446 3200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236616082.1:PQQ-binding-like beta-propeller repeat protein >Feature sequence290 331 3810 gene locus_tag LOCUS_24860 331 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 3857 4081 gene locus_tag LOCUS_24870 3857 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 >Feature sequence291 <1 654 gene locus_tag LOCUS_24880 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193427766.1:nucleotide sugar dehydrogenase 1557 661 gene locus_tag LOCUS_24890 1557 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 2654 1554 gene locus_tag LOCUS_24900 2654 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 <4426 2675 gene locus_tag LOCUS_24910 <4426 2675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202927.1:glycosyltransferase family 2 protein >Feature sequence292 <1 1281 gene locus_tag LOCUS_24920 <1 1281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918481.1:chemotaxis protein CheA 1275 1763 gene locus_tag LOCUS_24930 1275 1763 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918482.1 protein_id gnl|my_center|LOCUS_24930 1753 3894 gene locus_tag LOCUS_24940 1753 3894 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338076.1 protein_id gnl|my_center|LOCUS_24940 >Feature sequence293 106 687 gene locus_tag LOCUS_24950 106 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 871 789 gene locus_tag LOCUS_t00440 871 789 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 973 2217 gene locus_tag LOCUS_24960 973 2217 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921696.1 protein_id gnl|my_center|LOCUS_24960 2286 3182 gene locus_tag LOCUS_24970 gene metF 2286 3182 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615859.1 protein_id gnl|my_center|LOCUS_24970 3753 3265 gene locus_tag LOCUS_24980 3753 3265 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325476.1 protein_id gnl|my_center|LOCUS_24980 4296 3757 gene locus_tag LOCUS_24990 4296 3757 CDS product DUF2617 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199169876.1 protein_id gnl|my_center|LOCUS_24990 >Feature sequence294 1774 2748 gene locus_tag LOCUS_25000 1774 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 >Feature sequence295 <1 603 gene locus_tag LOCUS_25010 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008665250.1:FAD-binding and (Fe-S)-binding domain-containing protein 620 859 gene locus_tag LOCUS_25020 gene moaD 620 859 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232366.1 protein_id gnl|my_center|LOCUS_25020 861 1310 gene locus_tag LOCUS_25030 861 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 1307 2353 gene locus_tag LOCUS_25040 gene moaA 1307 2353 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119704.1 protein_id gnl|my_center|LOCUS_25040 2355 3512 gene locus_tag LOCUS_25050 2355 3512 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942513.1 protein_id gnl|my_center|LOCUS_25050 3526 3951 gene locus_tag LOCUS_25060 3526 3951 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328825.1 protein_id gnl|my_center|LOCUS_25060 >Feature sequence296 91 1158 gene locus_tag LOCUS_25070 91 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 2726 1227 gene locus_tag LOCUS_25080 2726 1227 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532027.1 protein_id gnl|my_center|LOCUS_25080 3625 2723 gene locus_tag LOCUS_25090 3625 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 <4323 3622 gene locus_tag LOCUS_25100 <4323 3622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922962.1:DUF1552 domain-containing protein >Feature sequence297 <1 1012 gene locus_tag LOCUS_25110 <1 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957791.1:ATP-binding protein 1022 1786 gene locus_tag LOCUS_25120 1022 1786 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142916.1 protein_id gnl|my_center|LOCUS_25120 1811 2035 gene locus_tag LOCUS_25130 1811 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 2032 2589 gene locus_tag LOCUS_25140 2032 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 2582 3943 gene locus_tag LOCUS_25150 gene bioA 2582 3943 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942227.1 protein_id gnl|my_center|LOCUS_25150 >Feature sequence298 <1 951 gene locus_tag LOCUS_25160 <1 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120515.1:ATP-dependent zinc metalloprotease FtsH 1106 1336 gene locus_tag LOCUS_25170 1106 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 1399 1794 gene locus_tag LOCUS_25180 1399 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 2854 1820 gene locus_tag LOCUS_25190 2854 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 3793 3026 gene locus_tag LOCUS_25200 3793 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 >Feature sequence299 165 1472 gene locus_tag LOCUS_25210 gene nusA 165 1472 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120487.1 protein_id gnl|my_center|LOCUS_25210 1561 4242 gene locus_tag LOCUS_25220 1561 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 >Feature sequence300 1347 1081 gene locus_tag LOCUS_25230 gene rpsO 1347 1081 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965113.1 protein_id gnl|my_center|LOCUS_25230 2571 1597 gene locus_tag LOCUS_25240 2571 1597 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921799.1 protein_id gnl|my_center|LOCUS_25240 3976 2726 gene locus_tag LOCUS_25250 3976 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 >Feature sequence301 1020 175 gene locus_tag LOCUS_25260 1020 175 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921488.1 protein_id gnl|my_center|LOCUS_25260 1499 1017 gene locus_tag LOCUS_25270 gene ruvX 1499 1017 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331673.1 protein_id gnl|my_center|LOCUS_25270 2496 1492 gene locus_tag LOCUS_25280 2496 1492 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121358.1 protein_id gnl|my_center|LOCUS_25280 3560 2478 gene locus_tag LOCUS_25290 3560 2478 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120825.1 protein_id gnl|my_center|LOCUS_25290 >Feature sequence302 1702 920 gene locus_tag LOCUS_25300 1702 920 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039041.1 protein_id gnl|my_center|LOCUS_25300 2336 1704 gene locus_tag LOCUS_25310 gene frr 2336 1704 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339966.1 protein_id gnl|my_center|LOCUS_25310 <4230 2338 gene locus_tag LOCUS_25320 <4230 2338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225976.1:APC family permease >Feature sequence303 1426 467 gene locus_tag LOCUS_25330 1426 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 3494 1992 gene locus_tag LOCUS_25340 3494 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 <4225 3715 gene locus_tag LOCUS_25350 <4225 3715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007331084.1:signal recognition particle-docking protein FtsY >Feature sequence304 485 1039 gene locus_tag LOCUS_25360 485 1039 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112742.1 protein_id gnl|my_center|LOCUS_25360 1064 4192 gene locus_tag LOCUS_25370 1064 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 >Feature sequence305 1529 3703 gene locus_tag LOCUS_25380 1529 3703 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_25380 >Feature sequence306 1615 860 gene locus_tag LOCUS_25390 1615 860 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333296.1 protein_id gnl|my_center|LOCUS_25390 2655 1612 gene locus_tag LOCUS_25400 2655 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 3581 2706 gene locus_tag LOCUS_25410 3581 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 >Feature sequence307 405 3839 gene locus_tag LOCUS_25420 405 3839 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117884.1 protein_id gnl|my_center|LOCUS_25420 >Feature sequence308 1196 2446 gene locus_tag LOCUS_25430 1196 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 2687 3982 gene locus_tag LOCUS_25440 2687 3982 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922459.1 protein_id gnl|my_center|LOCUS_25440 >Feature sequence309 <1 1061 gene locus_tag LOCUS_25450 <1 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008669069.1:ThuA domain-containing protein 3237 1105 gene locus_tag LOCUS_25460 gene recG 3237 1105 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921377.1 protein_id gnl|my_center|LOCUS_25460 3955 3464 gene locus_tag LOCUS_25470 gene rnhA 3955 3464 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326294.1 protein_id gnl|my_center|LOCUS_25470 >Feature sequence310 1781 162 gene locus_tag LOCUS_25480 1781 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 <4131 1820 gene locus_tag LOCUS_25490 <4131 1820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921396.1:Gldg family protein >Feature sequence311 <1 1514 gene locus_tag LOCUS_25500 <1 1514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104543246.1:autotransporter-associated beta strand repeat-containing protein 3802 2363 gene locus_tag LOCUS_25510 3802 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118655.1 protein_id gnl|my_center|LOCUS_25510 >Feature sequence312 <1 885 gene locus_tag LOCUS_25520 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056995.1:SpoIIE family protein phosphatase 952 1025 gene locus_tag LOCUS_t00450 952 1025 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1124 1206 gene locus_tag LOCUS_t00460 1124 1206 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1223 1293 gene locus_tag LOCUS_t00470 1223 1293 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1331 1404 gene locus_tag LOCUS_t00480 1331 1404 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1527 2726 gene locus_tag LOCUS_25530 gene tuf 1527 2726 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121621.1 protein_id gnl|my_center|LOCUS_25530 2784 2858 gene locus_tag LOCUS_t00490 2784 2858 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2904 3383 gene locus_tag LOCUS_25540 gene secE 2904 3383 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324991.1 protein_id gnl|my_center|LOCUS_25540 3394 4116 gene locus_tag LOCUS_25550 gene nusG 3394 4116 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324992.1 protein_id gnl|my_center|LOCUS_25550 >Feature sequence313 <1 1719 gene locus_tag LOCUS_25560 <1 1719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121893.1:TolC family protein 3116 1968 gene locus_tag LOCUS_25570 3116 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327711.1 protein_id gnl|my_center|LOCUS_25570 3792 3121 gene locus_tag LOCUS_25580 3792 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 >Feature sequence314 3224 774 gene locus_tag LOCUS_25590 3224 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 4094 3258 gene locus_tag LOCUS_25600 4094 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 >Feature sequence315 44 247 gene locus_tag LOCUS_25610 44 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 615 1574 gene locus_tag LOCUS_25620 615 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 3209 1620 gene locus_tag LOCUS_25630 3209 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 3523 3293 gene locus_tag LOCUS_25640 3523 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 3685 3599 gene locus_tag LOCUS_t00500 3685 3599 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence316 2636 3448 gene locus_tag LOCUS_25650 2636 3448 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528860.1 protein_id gnl|my_center|LOCUS_25650 >Feature sequence317 396 172 gene locus_tag LOCUS_25660 396 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 614 387 gene locus_tag LOCUS_25670 614 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 891 646 gene locus_tag LOCUS_25680 891 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 1284 1018 gene locus_tag LOCUS_25690 1284 1018 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259540.1 protein_id gnl|my_center|LOCUS_25690 1606 1289 gene locus_tag LOCUS_25700 1606 1289 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388650.1 protein_id gnl|my_center|LOCUS_25700 2019 1726 gene locus_tag LOCUS_25710 2019 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 2248 2012 gene locus_tag LOCUS_25720 2248 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 2539 2336 gene locus_tag LOCUS_25730 2539 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 2807 2637 gene locus_tag LOCUS_25740 2807 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 3106 2804 gene locus_tag LOCUS_25750 3106 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 3535 3236 gene locus_tag LOCUS_25760 3535 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 >Feature sequence318 325 3708 gene locus_tag LOCUS_25770 325 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 >Feature sequence319 1416 316 gene locus_tag LOCUS_25780 1416 316 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037252469.1 protein_id gnl|my_center|LOCUS_25780 2429 1473 gene locus_tag LOCUS_25790 2429 1473 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102017617.1 protein_id gnl|my_center|LOCUS_25790 3280 2708 gene locus_tag LOCUS_25800 3280 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328467.1 protein_id gnl|my_center|LOCUS_25800 >Feature sequence320 1377 2117 gene locus_tag LOCUS_25810 gene ispD 1377 2117 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122160.1 protein_id gnl|my_center|LOCUS_25810 2108 3391 gene locus_tag LOCUS_25820 gene tyrS 2108 3391 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332625.1 protein_id gnl|my_center|LOCUS_25820 3537 3761 gene locus_tag LOCUS_25830 3537 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 >Feature sequence321 <1 873 gene locus_tag LOCUS_25840 <1 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946742.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence322 <3975 1411 gene locus_tag LOCUS_25850 <3975 1411 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071862.1:ABC transporter permease subunit >Feature sequence323 1279 218 gene locus_tag LOCUS_25860 1279 218 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038728.1 protein_id gnl|my_center|LOCUS_25860 1372 2025 gene locus_tag LOCUS_25870 1372 2025 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922279.1 protein_id gnl|my_center|LOCUS_25870 2167 3852 gene locus_tag LOCUS_25880 2167 3852 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122500.1 protein_id gnl|my_center|LOCUS_25880 >Feature sequence324 1289 2680 gene locus_tag LOCUS_25890 1289 2680 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616218.1 protein_id gnl|my_center|LOCUS_25890 2677 3726 gene locus_tag LOCUS_25900 2677 3726 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921437.1 protein_id gnl|my_center|LOCUS_25900 >Feature sequence325 <1 633 gene locus_tag LOCUS_25910 <1 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051156418.1:quinolinate synthase NadA 630 2993 gene locus_tag LOCUS_25920 630 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 >Feature sequence326 1033 326 gene locus_tag LOCUS_25930 gene surE 1033 326 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122691.1 protein_id gnl|my_center|LOCUS_25930 1869 1030 gene locus_tag LOCUS_25940 1869 1030 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939505.1 protein_id gnl|my_center|LOCUS_25940 2024 2914 gene locus_tag LOCUS_25950 gene dapA 2024 2914 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921565.1 protein_id gnl|my_center|LOCUS_25950 3887 3033 gene locus_tag LOCUS_25960 3887 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 >Feature sequence327 2517 91 gene locus_tag LOCUS_25970 2517 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 >Feature sequence328 54 1043 gene locus_tag LOCUS_25980 54 1043 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328400.1 protein_id gnl|my_center|LOCUS_25980 1127 1723 gene locus_tag LOCUS_25990 1127 1723 CDS product L17 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123829.1 protein_id gnl|my_center|LOCUS_25990 2183 3865 gene locus_tag LOCUS_26000 2183 3865 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123879.1 protein_id gnl|my_center|LOCUS_26000 >Feature sequence329 279 1775 gene locus_tag LOCUS_26010 279 1775 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922489.1 protein_id gnl|my_center|LOCUS_26010 3116 2052 gene locus_tag LOCUS_26020 gene mtnA 3116 2052 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392224.1 protein_id gnl|my_center|LOCUS_26020 <3850 3113 gene locus_tag LOCUS_26030 <3850 3113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118338.1:alanine dehydrogenase >Feature sequence330 >Feature sequence331 213 1187 gene locus_tag LOCUS_26040 213 1187 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338657.1 protein_id gnl|my_center|LOCUS_26040 1261 2484 gene locus_tag LOCUS_26050 1261 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 2481 2933 gene locus_tag LOCUS_26060 2481 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 >Feature sequence332 2434 800 gene locus_tag LOCUS_26070 2434 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 3789 2434 gene locus_tag LOCUS_26080 gene nuoF 3789 2434 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967797.1 protein_id gnl|my_center|LOCUS_26080 >Feature sequence333 <1 1458 gene locus_tag LOCUS_26090 <1 1458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118036.1:PSD1 and planctomycete cytochrome C domain-containing protein 1455 2954 gene locus_tag LOCUS_26100 1455 2954 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921302.1 protein_id gnl|my_center|LOCUS_26100 3446 3093 gene locus_tag LOCUS_26110 3446 3093 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167581.1 protein_id gnl|my_center|LOCUS_26110 >Feature sequence334 1412 2131 gene locus_tag LOCUS_26120 1412 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 >Feature sequence335 <1 1170 gene locus_tag LOCUS_26130 <1 1170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008669535.1:Gfo/Idh/MocA family oxidoreductase 1170 1985 gene locus_tag LOCUS_26140 1170 1985 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122244.1 protein_id gnl|my_center|LOCUS_26140 2940 2158 gene locus_tag LOCUS_26150 2940 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 3401 2952 gene locus_tag LOCUS_26160 3401 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 >Feature sequence336 2302 239 gene locus_tag LOCUS_26170 gene uvrB 2302 239 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329492.1 protein_id gnl|my_center|LOCUS_26170 2697 2299 gene locus_tag LOCUS_26180 2697 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 2696 3640 gene locus_tag LOCUS_26190 gene nadC 2696 3640 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921990.1 protein_id gnl|my_center|LOCUS_26190 >Feature sequence337 351 1301 gene locus_tag LOCUS_26200 351 1301 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817229.1 protein_id gnl|my_center|LOCUS_26200 2407 1466 gene locus_tag LOCUS_26210 2407 1466 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328910.1 protein_id gnl|my_center|LOCUS_26210 2482 3357 gene locus_tag LOCUS_26220 2482 3357 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932021.1 protein_id gnl|my_center|LOCUS_26220 <3775 3270 gene locus_tag LOCUS_26230 <3775 3270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121461.1:sigma-54 dependent transcriptional regulator >Feature sequence338 373 11 gene locus_tag LOCUS_26240 373 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26240 1062 562 gene locus_tag LOCUS_26250 1062 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26250 1230 1517 gene locus_tag LOCUS_26260 1230 1517 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210984.1 protein_id gnl|my_center|LOCUS_26260 1648 2322 gene locus_tag LOCUS_26270 1648 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26270 2499 3026 gene locus_tag LOCUS_26280 2499 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 3011 3277 gene locus_tag LOCUS_26290 3011 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 3684 3259 gene locus_tag LOCUS_26300 3684 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 >Feature sequence339 1035 274 gene locus_tag LOCUS_26310 1035 274 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_26310 1222 1416 gene locus_tag LOCUS_26320 gene rpsU 1222 1416 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338941.1 protein_id gnl|my_center|LOCUS_26320 2535 1435 gene locus_tag LOCUS_26330 2535 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 3609 2764 gene locus_tag LOCUS_26340 3609 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 >Feature sequence340 397 1287 gene locus_tag LOCUS_26350 397 1287 CDS product NADP-dependent methylenetetrahydromethanopterin/methylenetetrahydrofolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122705.1 protein_id gnl|my_center|LOCUS_26350 1658 1284 gene locus_tag LOCUS_26360 1658 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 3011 1662 gene locus_tag LOCUS_26370 gene hflX 3011 1662 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121200.1 protein_id gnl|my_center|LOCUS_26370 <3746 3008 gene locus_tag LOCUS_26380 <3746 3008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119119.1:ribosome small subunit-dependent GTPase A >Feature sequence341 <1 1884 gene locus_tag LOCUS_26390 <1 1884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813559.1:ABC transporter ATP-binding protein <3740 2027 gene locus_tag LOCUS_26400 <3740 2027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140940.1:DUF3656 domain-containing protein >Feature sequence342 755 276 gene locus_tag LOCUS_26410 755 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 1150 818 gene locus_tag LOCUS_26420 1150 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 1295 3544 gene locus_tag LOCUS_26430 1295 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 >Feature sequence343 1456 257 gene locus_tag LOCUS_26440 1456 257 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028853.1 protein_id gnl|my_center|LOCUS_26440 1543 2742 gene locus_tag LOCUS_26450 1543 2742 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392999.1 protein_id gnl|my_center|LOCUS_26450 2750 3472 gene locus_tag LOCUS_26460 2750 3472 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902576.1 protein_id gnl|my_center|LOCUS_26460 >Feature sequence344 3472 1613 gene locus_tag LOCUS_26470 3472 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 >Feature sequence345 3620 1893 gene locus_tag LOCUS_26480 3620 1893 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921618.1 protein_id gnl|my_center|LOCUS_26480 >Feature sequence346 1279 377 gene locus_tag LOCUS_26490 1279 377 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932656.1 protein_id gnl|my_center|LOCUS_26490 3067 1508 gene locus_tag LOCUS_26500 gene gltX 3067 1508 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922083.1 protein_id gnl|my_center|LOCUS_26500 >Feature sequence347 437 165 gene locus_tag LOCUS_26510 437 165 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333249.1 protein_id gnl|my_center|LOCUS_26510 702 1367 gene locus_tag LOCUS_26520 702 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 2299 1409 gene locus_tag LOCUS_26530 2299 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 2733 2296 gene locus_tag LOCUS_26540 2733 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 <3709 2847 gene locus_tag LOCUS_26550 <3709 2847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002359053.1:Cof-type HAD-IIB family hydrolase >Feature sequence348 2406 3518 gene locus_tag LOCUS_26560 2406 3518 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142095.1 protein_id gnl|my_center|LOCUS_26560 >Feature sequence349 1506 301 gene locus_tag LOCUS_26570 1506 301 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403248.1 protein_id gnl|my_center|LOCUS_26570 2247 1549 gene locus_tag LOCUS_26580 gene mtnC 2247 1549 CDS product acireductone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147428.1 protein_id gnl|my_center|LOCUS_26580 2813 2244 gene locus_tag LOCUS_26590 2813 2244 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103818.1 protein_id gnl|my_center|LOCUS_26590 3521 2832 gene locus_tag LOCUS_26600 3521 2832 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103182.1 protein_id gnl|my_center|LOCUS_26600 >Feature sequence350 472 1350 gene locus_tag LOCUS_26610 gene lpxC 472 1350 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615542.1 protein_id gnl|my_center|LOCUS_26610 1370 2236 gene locus_tag LOCUS_26620 gene lpxA 1370 2236 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328498.1 protein_id gnl|my_center|LOCUS_26620 2233 3321 gene locus_tag LOCUS_26630 2233 3321 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120182.1 protein_id gnl|my_center|LOCUS_26630 >Feature sequence351 >Feature sequence352 218 2395 gene locus_tag LOCUS_26640 218 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 2454 3092 gene locus_tag LOCUS_26650 2454 3092 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230184.1 protein_id gnl|my_center|LOCUS_26650 >Feature sequence353 40 2748 gene locus_tag LOCUS_26660 40 2748 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941349.1 protein_id gnl|my_center|LOCUS_26660 2832 3461 gene locus_tag LOCUS_26670 2832 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 >Feature sequence354 25 594 gene locus_tag LOCUS_26680 gene efp 25 594 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814655.1 protein_id gnl|my_center|LOCUS_26680 610 864 gene locus_tag LOCUS_26690 610 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 2489 1128 gene locus_tag LOCUS_26700 2489 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 >Feature sequence355 579 1118 gene locus_tag LOCUS_26710 579 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 2230 1115 gene locus_tag LOCUS_26720 2230 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 3318 2404 gene locus_tag LOCUS_26730 3318 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 >Feature sequence356 >Feature sequence357 824 396 gene locus_tag LOCUS_26740 gene arfB 824 396 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919096.1 protein_id gnl|my_center|LOCUS_26740 857 2221 gene locus_tag LOCUS_26750 857 2221 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123970.1 protein_id gnl|my_center|LOCUS_26750 2409 3230 gene locus_tag LOCUS_26760 2409 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 >Feature sequence358 1963 2661 gene locus_tag LOCUS_26770 1963 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 2663 3376 gene locus_tag LOCUS_26780 2663 3376 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108741.1 protein_id gnl|my_center|LOCUS_26780 >Feature sequence359 253 1461 gene locus_tag LOCUS_26790 253 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 1472 2395 gene locus_tag LOCUS_26800 1472 2395 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798219.1 protein_id gnl|my_center|LOCUS_26800 >Feature sequence360 1533 265 gene locus_tag LOCUS_26810 1533 265 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118607.1 protein_id gnl|my_center|LOCUS_26810 1743 2792 gene locus_tag LOCUS_26820 1743 2792 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119407.1 protein_id gnl|my_center|LOCUS_26820 2882 3229 gene locus_tag LOCUS_26830 2882 3229 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522276.1 protein_id gnl|my_center|LOCUS_26830 >Feature sequence361 <1 832 gene locus_tag LOCUS_26840 <1 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938705.1:D-2-hydroxyacid dehydrogenase 3586 1034 gene locus_tag LOCUS_26850 3586 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 >Feature sequence362 1182 607 gene locus_tag LOCUS_26860 1182 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 1238 1711 gene locus_tag LOCUS_26870 1238 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 2844 1855 gene locus_tag LOCUS_26880 2844 1855 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119125.1 protein_id gnl|my_center|LOCUS_26880 >Feature sequence363 244 951 gene locus_tag LOCUS_26890 244 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 965 2338 gene locus_tag LOCUS_26900 965 2338 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926478.1 protein_id gnl|my_center|LOCUS_26900 2351 3268 gene locus_tag LOCUS_26910 2351 3268 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256676.1 protein_id gnl|my_center|LOCUS_26910 >Feature sequence364 2106 1279 gene locus_tag LOCUS_26920 2106 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26920 3252 2179 gene locus_tag LOCUS_26930 3252 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26930 3541 3386 gene locus_tag LOCUS_26940 3541 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 >Feature sequence365 153 1436 gene locus_tag LOCUS_26950 153 1436 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340206.1 protein_id gnl|my_center|LOCUS_26950 1520 3442 gene locus_tag LOCUS_26960 gene speA 1520 3442 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119511.1 protein_id gnl|my_center|LOCUS_26960 >Feature sequence366 822 1886 gene locus_tag LOCUS_26970 822 1886 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_26970 2024 2632 gene locus_tag LOCUS_26980 2024 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 2653 3384 gene locus_tag LOCUS_26990 2653 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 >Feature sequence367 579 3221 gene locus_tag LOCUS_27000 gene clpB 579 3221 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922205.1 protein_id gnl|my_center|LOCUS_27000 3426 3229 gene locus_tag LOCUS_27010 3426 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 >Feature sequence368 798 1862 gene locus_tag LOCUS_27020 798 1862 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_27020 2000 2614 gene locus_tag LOCUS_27030 2000 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 2635 3366 gene locus_tag LOCUS_27040 2635 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 >Feature sequence369 1118 369 gene locus_tag LOCUS_27050 1118 369 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120816.1 protein_id gnl|my_center|LOCUS_27050 2800 1115 gene locus_tag LOCUS_27060 2800 1115 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615865.1 protein_id gnl|my_center|LOCUS_27060 >Feature sequence370 623 174 gene locus_tag LOCUS_27070 gene hisI 623 174 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088269.1 protein_id gnl|my_center|LOCUS_27070 806 2095 gene locus_tag LOCUS_27080 806 2095 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_27080 2794 2099 gene locus_tag LOCUS_27090 gene aqpZ 2794 2099 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262065.1 protein_id gnl|my_center|LOCUS_27090 3251 2877 gene locus_tag LOCUS_27100 3251 2877 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256528.1 protein_id gnl|my_center|LOCUS_27100 >Feature sequence371 1098 2756 gene locus_tag LOCUS_27110 1098 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 >Feature sequence372 381 665 gene locus_tag LOCUS_27120 381 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 662 2683 gene locus_tag LOCUS_27130 gene ligA 662 2683 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122894.1 protein_id gnl|my_center|LOCUS_27130 3238 3417 gene locus_tag LOCUS_27140 3238 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 >Feature sequence373 69 1064 gene locus_tag LOCUS_27150 69 1064 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404758.1 protein_id gnl|my_center|LOCUS_27150 1228 2259 gene locus_tag LOCUS_27160 1228 2259 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978054.1 protein_id gnl|my_center|LOCUS_27160 >Feature sequence374 2115 802 gene locus_tag LOCUS_27170 gene ahcY 2115 802 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327756.1 protein_id gnl|my_center|LOCUS_27170 2932 2195 gene locus_tag LOCUS_27180 2932 2195 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207615.1 protein_id gnl|my_center|LOCUS_27180 >Feature sequence375 2464 782 gene locus_tag LOCUS_27190 2464 782 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326639.1 protein_id gnl|my_center|LOCUS_27190 >Feature sequence376 1126 737 gene locus_tag LOCUS_27200 gene nuoK 1126 737 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932455.1 protein_id gnl|my_center|LOCUS_27200 1806 1123 gene locus_tag LOCUS_27210 1806 1123 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932454.1 protein_id gnl|my_center|LOCUS_27210 3011 1803 gene locus_tag LOCUS_27220 gene nuoH 3011 1803 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932452.1 protein_id gnl|my_center|LOCUS_27220 >Feature sequence377 199 813 gene locus_tag LOCUS_27230 gene clpP 199 813 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327157.1 protein_id gnl|my_center|LOCUS_27230 858 1832 gene locus_tag LOCUS_27240 858 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 2942 1842 gene locus_tag LOCUS_27250 2942 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 >Feature sequence378 1057 1500 gene locus_tag LOCUS_27260 1057 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 1577 2668 gene locus_tag LOCUS_27270 1577 2668 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256178.1 protein_id gnl|my_center|LOCUS_27270 >Feature sequence379 351 815 gene locus_tag LOCUS_27280 351 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 1054 3162 gene locus_tag LOCUS_27290 gene pilM 1054 3162 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119060.1 protein_id gnl|my_center|LOCUS_27290 >Feature sequence380 1494 2195 gene locus_tag LOCUS_27300 1494 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 3087 2254 gene locus_tag LOCUS_27310 3087 2254 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121000.1 protein_id gnl|my_center|LOCUS_27310 >Feature sequence381 <1 1066 gene locus_tag LOCUS_27320 <1 1066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256818.1:branched-chain amino acid ABC transporter substrate-binding protein 1085 1333 gene locus_tag LOCUS_27330 1085 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 1330 1716 gene locus_tag LOCUS_27340 1330 1716 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 protein_id gnl|my_center|LOCUS_27340 1721 2662 gene locus_tag LOCUS_27350 1721 2662 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938014.1 protein_id gnl|my_center|LOCUS_27350 >Feature sequence382 <1 819 gene locus_tag LOCUS_27360 <1 819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104144.1:transcriptional activator NhaR 1022 2044 gene locus_tag LOCUS_27370 1022 2044 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337607.1 protein_id gnl|my_center|LOCUS_27370 2146 3183 gene locus_tag LOCUS_27380 2146 3183 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922558.1 protein_id gnl|my_center|LOCUS_27380 >Feature sequence383 2875 149 gene locus_tag LOCUS_27390 2875 149 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122605.1 protein_id gnl|my_center|LOCUS_27390 >Feature sequence384 273 2222 gene locus_tag LOCUS_27400 gene asnB 273 2222 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089038.1 protein_id gnl|my_center|LOCUS_27400 >Feature sequence385 <1 879 gene locus_tag LOCUS_27410 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121588.1:uroporphyrinogen decarboxylase >Feature sequence386 542 420 gene locus_tag LOCUS_27420 542 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 853 1035 gene locus_tag LOCUS_27430 853 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 1068 1631 gene locus_tag LOCUS_27440 1068 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 2716 1694 gene locus_tag LOCUS_27450 2716 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 3105 2755 gene locus_tag LOCUS_27460 3105 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 >Feature sequence387 2172 1117 gene locus_tag LOCUS_27470 2172 1117 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122947.1 protein_id gnl|my_center|LOCUS_27470 2803 2174 gene locus_tag LOCUS_27480 2803 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 >Feature sequence388 1757 210 gene locus_tag LOCUS_27490 1757 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 2953 1754 gene locus_tag LOCUS_27500 2953 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 >Feature sequence389 463 954 gene locus_tag LOCUS_27510 463 954 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034855332.1 protein_id gnl|my_center|LOCUS_27510 1005 1397 gene locus_tag LOCUS_27520 1005 1397 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943046.1 protein_id gnl|my_center|LOCUS_27520 1516 2007 gene locus_tag LOCUS_27530 1516 2007 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 protein_id gnl|my_center|LOCUS_27530 2102 2944 gene locus_tag LOCUS_27540 2102 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 >Feature sequence390 795 577 gene locus_tag LOCUS_27550 gene thiS 795 577 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919747.1 protein_id gnl|my_center|LOCUS_27550 1403 822 gene locus_tag LOCUS_27560 1403 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 2736 1480 gene locus_tag LOCUS_27570 2736 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 >Feature sequence391 2640 1552 gene locus_tag LOCUS_27580 gene trpD 2640 1552 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117897.1 protein_id gnl|my_center|LOCUS_27580 >Feature sequence392 966 1496 gene locus_tag LOCUS_27590 966 1496 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105333325.1 protein_id gnl|my_center|LOCUS_27590 1493 2530 gene locus_tag LOCUS_27600 1493 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 2527 2934 gene locus_tag LOCUS_27610 2527 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 >Feature sequence393 462 1433 gene locus_tag LOCUS_27620 462 1433 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789714.1 protein_id gnl|my_center|LOCUS_27620 1433 1831 gene locus_tag LOCUS_27630 gene rnpA 1433 1831 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121387.1 protein_id gnl|my_center|LOCUS_27630 1831 2079 gene locus_tag LOCUS_27640 1831 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 2528 2127 gene locus_tag LOCUS_27650 2528 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 <3151 2525 gene locus_tag LOCUS_27660 <3151 2525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007327143.1:enoyl-ACP reductase >Feature sequence394 1087 233 gene locus_tag LOCUS_27670 gene istB 1087 233 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030890.1 protein_id gnl|my_center|LOCUS_27670 2920 1133 gene locus_tag LOCUS_27680 gene istA 2920 1133 CDS product IS21-like element ISRsp2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153440448.1 protein_id gnl|my_center|LOCUS_27680 >Feature sequence395 442 1155 gene locus_tag LOCUS_27690 442 1155 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056682.1 protein_id gnl|my_center|LOCUS_27690 1379 2455 gene locus_tag LOCUS_27700 1379 2455 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639906.1 protein_id gnl|my_center|LOCUS_27700 >Feature sequence396 1873 644 gene locus_tag LOCUS_27710 1873 644 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922187.1 protein_id gnl|my_center|LOCUS_27710 2565 1846 gene locus_tag LOCUS_27720 2565 1846 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339994.1 protein_id gnl|my_center|LOCUS_27720 2946 2602 gene locus_tag LOCUS_27730 2946 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 >Feature sequence397 <1 1101 gene locus_tag LOCUS_27740 <1 1101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921547.1:DUF1015 domain-containing protein 1337 2083 gene locus_tag LOCUS_27750 1337 2083 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118760.1 protein_id gnl|my_center|LOCUS_27750 >Feature sequence398 825 1409 gene locus_tag LOCUS_27760 gene rimI 825 1409 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102017535.1 protein_id gnl|my_center|LOCUS_27760 2552 1425 gene locus_tag LOCUS_27770 2552 1425 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532032.1 protein_id gnl|my_center|LOCUS_27770 >Feature sequence399 1775 780 gene locus_tag LOCUS_27780 1775 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022102.1 protein_id gnl|my_center|LOCUS_27780 1815 2864 gene locus_tag LOCUS_27790 1815 2864 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403630.1 protein_id gnl|my_center|LOCUS_27790 >Feature sequence400 >Feature sequence401 2009 258 gene locus_tag LOCUS_27800 2009 258 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123401.1 protein_id gnl|my_center|LOCUS_27800 2586 2026 gene locus_tag LOCUS_27810 2586 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615841.1 protein_id gnl|my_center|LOCUS_27810 >Feature sequence402 1423 2826 gene locus_tag LOCUS_27820 1423 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 >Feature sequence403 2306 1881 gene locus_tag LOCUS_27830 gene rplL 2306 1881 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324459.1 protein_id gnl|my_center|LOCUS_27830 2969 2430 gene locus_tag LOCUS_27840 gene rplJ 2969 2430 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324458.1 protein_id gnl|my_center|LOCUS_27840 >Feature sequence404 1898 585 gene locus_tag LOCUS_27850 gene lysA 1898 585 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103031.1 protein_id gnl|my_center|LOCUS_27850 >Feature sequence405 1524 445 gene locus_tag LOCUS_27860 1524 445 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104885.1 protein_id gnl|my_center|LOCUS_27860 2400 2065 gene locus_tag LOCUS_27870 2400 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 >Feature sequence406 <1 780 gene locus_tag LOCUS_27880 <1 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921665.1:MFS transporter 1808 774 gene locus_tag LOCUS_27890 1808 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 1961 2608 gene locus_tag LOCUS_27900 1961 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 >Feature sequence407 1011 598 gene locus_tag LOCUS_27910 1011 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 1555 1034 gene locus_tag LOCUS_27920 1555 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 <2960 1770 gene locus_tag LOCUS_27930 <2960 1770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922914.1:porin >Feature sequence408 716 1960 gene locus_tag LOCUS_27940 716 1960 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_27940 >Feature sequence409 3 308 gene locus_tag LOCUS_27950 3 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 451 1173 gene locus_tag LOCUS_27960 451 1173 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_27960 <2947 1895 gene locus_tag LOCUS_27970 <2947 1895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615779.1:glucose-1-phosphate adenylyltransferase >Feature sequence410 <1 2253 gene locus_tag LOCUS_27980 <1 2253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461496.1:Tex family protein 2574 2353 gene locus_tag LOCUS_27990 gene infA 2574 2353 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328023.1 protein_id gnl|my_center|LOCUS_27990 >Feature sequence411 >Feature sequence412 1083 319 gene locus_tag LOCUS_28000 1083 319 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121230.1 protein_id gnl|my_center|LOCUS_28000 1136 2134 gene locus_tag LOCUS_28010 1136 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 2177 2629 gene locus_tag LOCUS_28020 2177 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 >Feature sequence413 2870 966 gene locus_tag LOCUS_28030 2870 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 >Feature sequence414 667 1671 gene locus_tag LOCUS_28040 667 1671 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615834.1 protein_id gnl|my_center|LOCUS_28040 1726 2433 gene locus_tag LOCUS_28050 1726 2433 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395055.1 protein_id gnl|my_center|LOCUS_28050 >Feature sequence415 357 803 gene locus_tag LOCUS_28060 357 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 1859 1059 gene locus_tag LOCUS_28070 gene panB 1859 1059 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122138.1 protein_id gnl|my_center|LOCUS_28070 1978 2703 gene locus_tag LOCUS_28080 1978 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 >Feature sequence416 924 184 gene locus_tag LOCUS_28090 924 184 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118984.1 protein_id gnl|my_center|LOCUS_28090 1230 2621 gene locus_tag LOCUS_28100 1230 2621 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_28100 >Feature sequence417 1560 916 gene locus_tag LOCUS_28110 1560 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 <2877 1557 gene locus_tag LOCUS_28120 <2877 1557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922335.1:type I polyketide synthase >Feature sequence418 <1 957 gene locus_tag LOCUS_28130 <1 957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120445.1:elongation factor G 2228 1317 gene locus_tag LOCUS_28140 gene argF 2228 1317 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921923.1 protein_id gnl|my_center|LOCUS_28140 <2870 2256 gene locus_tag LOCUS_28150 <2870 2256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940827.1:acetylornithine transaminase >Feature sequence419 2051 2584 gene locus_tag LOCUS_28160 2051 2584 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084585.1 protein_id gnl|my_center|LOCUS_28160 >Feature sequence420 <2846 1544 gene locus_tag LOCUS_28170 <2846 1544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036483.1:ATP-dependent DNA ligase >Feature sequence421 170 1507 gene locus_tag LOCUS_28180 gene purD 170 1507 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334006.1 protein_id gnl|my_center|LOCUS_28180 1504 2511 gene locus_tag LOCUS_28190 1504 2511 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427765.1 protein_id gnl|my_center|LOCUS_28190 >Feature sequence422 91 642 gene locus_tag LOCUS_28200 gene rsfS 91 642 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615413.1 protein_id gnl|my_center|LOCUS_28200 635 2461 gene locus_tag LOCUS_28210 gene argS 635 2461 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056669.1 protein_id gnl|my_center|LOCUS_28210 >Feature sequence423 2024 1056 gene locus_tag LOCUS_28220 2024 1056 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922391.1 protein_id gnl|my_center|LOCUS_28220 2146 2523 gene locus_tag LOCUS_28230 gene crcB 2146 2523 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971646.1 protein_id gnl|my_center|LOCUS_28230 2613 2539 gene locus_tag LOCUS_t00510 2613 2539 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence424 >Feature sequence425 <1 546 gene locus_tag LOCUS_28240 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939418.1:HD domain-containing protein 557 2647 gene locus_tag LOCUS_28250 557 2647 CDS product VacB/RNase II family 3'-5' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121841.1 protein_id gnl|my_center|LOCUS_28250 >Feature sequence426 16 600 gene locus_tag LOCUS_28260 16 600 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326693.1 protein_id gnl|my_center|LOCUS_28260 777 1163 gene locus_tag LOCUS_28270 777 1163 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326692.1 protein_id gnl|my_center|LOCUS_28270 1165 1665 gene locus_tag LOCUS_28280 1165 1665 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326691.1 protein_id gnl|my_center|LOCUS_28280 >Feature sequence427 1094 492 gene locus_tag LOCUS_28290 gene recR 1094 492 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327785.1 protein_id gnl|my_center|LOCUS_28290 <2791 1087 gene locus_tag LOCUS_28300 <2791 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921981.1:DNA polymerase III subunit gamma/tau >Feature sequence428 761 973 gene locus_tag LOCUS_28310 761 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 2009 1089 gene locus_tag LOCUS_28320 2009 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 >Feature sequence429 1567 215 gene locus_tag LOCUS_28330 1567 215 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326127.1 protein_id gnl|my_center|LOCUS_28330 >Feature sequence430 1180 227 gene locus_tag LOCUS_28340 1180 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 2365 1349 gene locus_tag LOCUS_28350 2365 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 2762 2562 gene locus_tag LOCUS_28360 2762 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 >Feature sequence431 1379 666 gene locus_tag LOCUS_28370 1379 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 1538 1999 gene locus_tag LOCUS_28380 1538 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 >Feature sequence432 257 1261 gene locus_tag LOCUS_28390 257 1261 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_28390 >Feature sequence433 1472 147 gene locus_tag LOCUS_28400 1472 147 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119953.1 protein_id gnl|my_center|LOCUS_28400 2482 1511 gene locus_tag LOCUS_28410 2482 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 >Feature sequence434 1067 117 gene locus_tag LOCUS_28420 1067 117 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327669.1 protein_id gnl|my_center|LOCUS_28420 1802 1125 gene locus_tag LOCUS_28430 1802 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 >Feature sequence435 133 1989 gene locus_tag LOCUS_28440 133 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 >Feature sequence436 1496 930 gene locus_tag LOCUS_28450 1496 930 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121244.1 protein_id gnl|my_center|LOCUS_28450 2194 1694 gene locus_tag LOCUS_28460 2194 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 >Feature sequence437 <2742 1219 gene locus_tag LOCUS_28470 <2742 1219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922371.1:RHS repeat-associated core domain-containing protein >Feature sequence438 222 1271 gene locus_tag LOCUS_28480 222 1271 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921437.1 protein_id gnl|my_center|LOCUS_28480 >Feature sequence439 888 1139 gene locus_tag LOCUS_28490 888 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 1701 1096 gene locus_tag LOCUS_28500 1701 1096 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922484.1 protein_id gnl|my_center|LOCUS_28500 >Feature sequence440 1279 1064 gene locus_tag LOCUS_28510 1279 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 2041 1676 gene locus_tag LOCUS_28520 2041 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 2322 2044 gene locus_tag LOCUS_28530 2322 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 >Feature sequence441 302 877 gene locus_tag LOCUS_28540 302 877 CDS product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946938.1 protein_id gnl|my_center|LOCUS_28540 874 1551 gene locus_tag LOCUS_28550 874 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 1548 2234 gene locus_tag LOCUS_28560 1548 2234 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228697.1 protein_id gnl|my_center|LOCUS_28560 2702 2256 gene locus_tag LOCUS_28570 2702 2256 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334911.1 protein_id gnl|my_center|LOCUS_28570 >Feature sequence442 383 114 gene locus_tag LOCUS_28580 383 114 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324357.1 protein_id gnl|my_center|LOCUS_28580 733 440 gene locus_tag LOCUS_28590 733 440 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324356.1 protein_id gnl|my_center|LOCUS_28590 1563 823 gene locus_tag LOCUS_28600 1563 823 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333582.1 protein_id gnl|my_center|LOCUS_28600 2375 1560 gene locus_tag LOCUS_28610 2375 1560 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118937.1 protein_id gnl|my_center|LOCUS_28610 >Feature sequence443 880 1917 gene locus_tag LOCUS_28620 880 1917 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400558.1 protein_id gnl|my_center|LOCUS_28620 1922 2209 gene locus_tag LOCUS_28630 1922 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400556.1 protein_id gnl|my_center|LOCUS_28630 2257 2380 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tccgacaggcctggaggcccgtcgc >Feature sequence444 940 620 gene locus_tag LOCUS_28640 940 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 1515 937 gene locus_tag LOCUS_28650 1515 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 <2651 1668 gene locus_tag LOCUS_28660 <2651 1668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007327661.1:biosynthetic-type acetolactate synthase large subunit >Feature sequence445 102 491 gene locus_tag LOCUS_28670 gene rbfA 102 491 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325039.1 protein_id gnl|my_center|LOCUS_28670 488 1657 gene locus_tag LOCUS_28680 488 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 1686 2438 gene locus_tag LOCUS_28690 1686 2438 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340094.1 protein_id gnl|my_center|LOCUS_28690 >Feature sequence446 172 1218 gene locus_tag LOCUS_28700 172 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 1565 1194 gene locus_tag LOCUS_28710 1565 1194 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094547338.1 protein_id gnl|my_center|LOCUS_28710 1991 1581 gene locus_tag LOCUS_28720 gene rplS 1991 1581 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814465.1 protein_id gnl|my_center|LOCUS_28720 <2641 1988 gene locus_tag LOCUS_28730 <2641 1988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123923.1:tRNA (guanosine(37)-N1)-methyltransferase TrmD >Feature sequence447 935 1723 gene locus_tag LOCUS_28740 935 1723 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121125.1 protein_id gnl|my_center|LOCUS_28740 >Feature sequence448 1269 139 gene locus_tag LOCUS_28750 gene hemW 1269 139 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122512.1 protein_id gnl|my_center|LOCUS_28750 <2624 1641 gene locus_tag LOCUS_28760 <2624 1641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007327661.1:biosynthetic-type acetolactate synthase large subunit >Feature sequence449 <1 2379 gene locus_tag LOCUS_28770 <1 2379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037249708.1:ComEC/Rec2 family competence protein >Feature sequence450 348 821 gene locus_tag LOCUS_28780 gene moaC 348 821 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 protein_id gnl|my_center|LOCUS_28780 1292 831 gene locus_tag LOCUS_28790 gene nrdR 1292 831 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723246.1 protein_id gnl|my_center|LOCUS_28790 <2595 1363 gene locus_tag LOCUS_28800 <2595 1363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083435015.1:RNA polymerase factor sigma-54 >Feature sequence451 990 220 gene locus_tag LOCUS_28810 990 220 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922163.1 protein_id gnl|my_center|LOCUS_28810 2333 990 gene locus_tag LOCUS_28820 2333 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28820 >Feature sequence452 1991 708 gene locus_tag LOCUS_28830 1991 708 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113845.1 protein_id gnl|my_center|LOCUS_28830 2482 1988 gene locus_tag LOCUS_28840 2482 1988 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941344.1 protein_id gnl|my_center|LOCUS_28840 >Feature sequence453 136 209 gene locus_tag LOCUS_t00520 136 209 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 460 248 gene locus_tag LOCUS_28850 460 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 851 2071 gene locus_tag LOCUS_28860 851 2071 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023091.1 protein_id gnl|my_center|LOCUS_28860 2308 2135 gene locus_tag LOCUS_28870 2308 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 >Feature sequence454 130 597 gene locus_tag LOCUS_28880 130 597 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327289.1 protein_id gnl|my_center|LOCUS_28880 1517 1263 gene locus_tag LOCUS_28890 1517 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 >Feature sequence455 654 1703 gene locus_tag LOCUS_28900 gene glpX 654 1703 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214469.1 protein_id gnl|my_center|LOCUS_28900 >Feature sequence456 1588 236 gene locus_tag LOCUS_28910 1588 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 1793 2404 gene locus_tag LOCUS_28920 1793 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920