>Feature sequence01 1036 374 gene locus_tag LOCUS_00010 gene lipB 1036 374 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943071.1 protein_id gnl|my_center|LOCUS_00010 1570 1067 gene locus_tag LOCUS_00020 gene ruvC 1570 1067 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111361.1 protein_id gnl|my_center|LOCUS_00020 2898 1699 gene locus_tag LOCUS_00030 2898 1699 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00030 3084 3356 gene locus_tag LOCUS_00040 3084 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3366 3899 gene locus_tag LOCUS_00050 3366 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 3896 4108 gene locus_tag LOCUS_00060 3896 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 4092 7982 gene locus_tag LOCUS_00070 4092 7982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8125 9174 gene locus_tag LOCUS_00080 8125 9174 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046898.1 protein_id gnl|my_center|LOCUS_00080 9199 10452 gene locus_tag LOCUS_00090 gene nirJ1 9199 10452 CDS product putative heme d1 biosynthesis radical SAM protein NirJ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460179.1 protein_id gnl|my_center|LOCUS_00090 10524 11705 gene locus_tag LOCUS_00100 10524 11705 CDS product DUF3570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072166.1 protein_id gnl|my_center|LOCUS_00100 11715 12686 gene locus_tag LOCUS_00110 11715 12686 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932752.1 protein_id gnl|my_center|LOCUS_00110 12720 13208 gene locus_tag LOCUS_00120 12720 13208 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932750.1 protein_id gnl|my_center|LOCUS_00120 13230 13460 gene locus_tag LOCUS_00130 13230 13460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 13501 14376 gene locus_tag LOCUS_00140 13501 14376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 15553 14399 gene locus_tag LOCUS_00150 15553 14399 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 protein_id gnl|my_center|LOCUS_00150 16790 15681 gene locus_tag LOCUS_00160 16790 15681 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546105.1 protein_id gnl|my_center|LOCUS_00160 17916 16834 gene locus_tag LOCUS_00170 17916 16834 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_00170 18318 17923 gene locus_tag LOCUS_00180 18318 17923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 18722 18282 gene locus_tag LOCUS_00190 18722 18282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 19214 18795 gene locus_tag LOCUS_00200 19214 18795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 19685 19416 gene locus_tag LOCUS_00210 19685 19416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 19569 20330 gene locus_tag LOCUS_00220 19569 20330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 21071 20313 gene locus_tag LOCUS_00230 21071 20313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 21391 21071 gene locus_tag LOCUS_00240 21391 21071 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941982.1 protein_id gnl|my_center|LOCUS_00240 21910 21416 gene locus_tag LOCUS_00250 21910 21416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 22767 21910 gene locus_tag LOCUS_00260 22767 21910 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256749.1 protein_id gnl|my_center|LOCUS_00260 23220 22819 gene locus_tag LOCUS_00270 23220 22819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 23647 23378 gene locus_tag LOCUS_00280 23647 23378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 25998 23707 gene locus_tag LOCUS_00290 gene uvrB 25998 23707 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938896.1 protein_id gnl|my_center|LOCUS_00290 25992 26405 gene locus_tag LOCUS_00300 25992 26405 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444836.1 protein_id gnl|my_center|LOCUS_00300 31447 26456 gene locus_tag LOCUS_00310 31447 26456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 37487 31548 gene locus_tag LOCUS_00320 37487 31548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 40063 37712 gene locus_tag LOCUS_00330 40063 37712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 41482 40100 gene locus_tag LOCUS_00340 41482 40100 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_00340 41667 42848 gene locus_tag LOCUS_00350 41667 42848 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427756.1 protein_id gnl|my_center|LOCUS_00350 42915 43493 gene locus_tag LOCUS_00360 42915 43493 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119049.1 protein_id gnl|my_center|LOCUS_00360 43490 45064 gene locus_tag LOCUS_00370 43490 45064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 45061 47517 gene locus_tag LOCUS_00380 45061 47517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099150691.1 protein_id gnl|my_center|LOCUS_00380 49612 47531 gene locus_tag LOCUS_00390 49612 47531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 51354 49717 gene locus_tag LOCUS_00400 51354 49717 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938901.1 protein_id gnl|my_center|LOCUS_00400 51454 52485 gene locus_tag LOCUS_00410 gene rsmH 51454 52485 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784016.1 protein_id gnl|my_center|LOCUS_00410 53128 52523 gene locus_tag LOCUS_00420 53128 52523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 53326 53401 gene locus_tag LOCUS_t00010 53326 53401 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 53771 55642 gene locus_tag LOCUS_00430 53771 55642 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932358.1 protein_id gnl|my_center|LOCUS_00430 55751 56443 gene locus_tag LOCUS_00440 55751 56443 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389739.1 protein_id gnl|my_center|LOCUS_00440 56708 58021 gene locus_tag LOCUS_00450 56708 58021 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257684.1 protein_id gnl|my_center|LOCUS_00450 58039 59250 gene locus_tag LOCUS_00460 58039 59250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 59243 59968 gene locus_tag LOCUS_00470 59243 59968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 60126 63221 gene locus_tag LOCUS_00480 60126 63221 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_00480 63586 63317 gene locus_tag LOCUS_00490 63586 63317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 65820 63631 gene locus_tag LOCUS_00500 65820 63631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 67875 66277 gene locus_tag LOCUS_00510 67875 66277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 69279 67918 gene locus_tag LOCUS_00520 69279 67918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 70703 69312 gene locus_tag LOCUS_00530 gene cysS 70703 69312 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873400.1 protein_id gnl|my_center|LOCUS_00530 71067 70765 gene locus_tag LOCUS_00540 71067 70765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 71174 71719 gene locus_tag LOCUS_00550 71174 71719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 71814 72140 gene locus_tag LOCUS_00560 71814 72140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 72137 72616 gene locus_tag LOCUS_00570 72137 72616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 72669 73187 gene locus_tag LOCUS_00580 72669 73187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 73184 73804 gene locus_tag LOCUS_00590 73184 73804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 75084 73801 gene locus_tag LOCUS_00600 75084 73801 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265722.1 protein_id gnl|my_center|LOCUS_00600 75193 75933 gene locus_tag LOCUS_00610 75193 75933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 75944 77305 gene locus_tag LOCUS_00620 75944 77305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 77474 77313 gene locus_tag LOCUS_00630 77474 77313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 77707 78873 gene locus_tag LOCUS_00640 77707 78873 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058190.1 protein_id gnl|my_center|LOCUS_00640 79866 79027 gene locus_tag LOCUS_00650 gene cdaA 79866 79027 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_00650 80054 80626 gene locus_tag LOCUS_00660 80054 80626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 80703 82385 gene locus_tag LOCUS_00670 80703 82385 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921647.1 protein_id gnl|my_center|LOCUS_00670 83703 82516 gene locus_tag LOCUS_00680 83703 82516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 84304 83693 gene locus_tag LOCUS_00690 84304 83693 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142702.1 protein_id gnl|my_center|LOCUS_00690 84446 84991 gene locus_tag LOCUS_00700 gene sufT 84446 84991 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770997.1 protein_id gnl|my_center|LOCUS_00700 85471 85007 gene locus_tag LOCUS_00710 85471 85007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 85595 86638 gene locus_tag LOCUS_00720 gene trpD 85595 86638 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257622.1 protein_id gnl|my_center|LOCUS_00720 86839 87180 gene locus_tag LOCUS_00730 86839 87180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 87254 87787 gene locus_tag LOCUS_00740 gene hpt 87254 87787 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705261.1 protein_id gnl|my_center|LOCUS_00740 89124 87832 gene locus_tag LOCUS_00750 89124 87832 CDS product anti-phage deoxyguanosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888443.1 protein_id gnl|my_center|LOCUS_00750 89287 90978 gene locus_tag LOCUS_00760 89287 90978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 91179 94334 gene locus_tag LOCUS_00770 91179 94334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 94406 95191 gene locus_tag LOCUS_00780 94406 95191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 96067 95216 gene locus_tag LOCUS_00790 gene ftsY 96067 95216 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888888.1 protein_id gnl|my_center|LOCUS_00790 96161 97936 gene locus_tag LOCUS_00800 gene mutL 96161 97936 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942644.1 protein_id gnl|my_center|LOCUS_00800 98145 98885 gene locus_tag LOCUS_00810 98145 98885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 98913 99932 gene locus_tag LOCUS_00820 98913 99932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 100263 101048 gene locus_tag LOCUS_00830 100263 101048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 101326 102063 gene locus_tag LOCUS_00840 101326 102063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 102198 102626 gene locus_tag LOCUS_00850 102198 102626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 102623 103654 gene locus_tag LOCUS_00860 102623 103654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 104207 103656 gene locus_tag LOCUS_00870 104207 103656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 104301 104744 gene locus_tag LOCUS_00880 104301 104744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 104741 105271 gene locus_tag LOCUS_00890 104741 105271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 105307 107427 gene locus_tag LOCUS_00900 105307 107427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 108135 107431 gene locus_tag LOCUS_00910 108135 107431 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852139.1 protein_id gnl|my_center|LOCUS_00910 109021 108197 gene locus_tag LOCUS_00920 gene rarD 109021 108197 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256111.1 protein_id gnl|my_center|LOCUS_00920 109156 109617 gene locus_tag LOCUS_00930 109156 109617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 110649 109627 gene locus_tag LOCUS_00940 110649 109627 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324151.1 protein_id gnl|my_center|LOCUS_00940 112499 110655 gene locus_tag LOCUS_00950 112499 110655 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324152.1 protein_id gnl|my_center|LOCUS_00950 112670 114343 gene locus_tag LOCUS_00960 112670 114343 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793588.1 protein_id gnl|my_center|LOCUS_00960 114747 114427 gene locus_tag LOCUS_00970 gene trxA 114747 114427 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405369.1 protein_id gnl|my_center|LOCUS_00970 115626 114943 gene locus_tag LOCUS_00980 115626 114943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 116628 115726 gene locus_tag LOCUS_00990 116628 115726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 116723 118258 gene locus_tag LOCUS_01000 gene proS 116723 118258 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921836.1 protein_id gnl|my_center|LOCUS_01000 118272 118946 gene locus_tag LOCUS_01010 118272 118946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 119042 119938 gene locus_tag LOCUS_01020 119042 119938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 121039 119951 gene locus_tag LOCUS_01030 gene rlmN 121039 119951 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392423.1 protein_id gnl|my_center|LOCUS_01030 121144 122148 gene locus_tag LOCUS_01040 121144 122148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814283.1 protein_id gnl|my_center|LOCUS_01040 122214 125684 gene locus_tag LOCUS_01050 122214 125684 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583743.1 protein_id gnl|my_center|LOCUS_01050 126254 125697 gene locus_tag LOCUS_01060 126254 125697 CDS product DUF1802 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143201.1 protein_id gnl|my_center|LOCUS_01060 126507 126277 gene locus_tag LOCUS_01070 126507 126277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 126854 126591 gene locus_tag LOCUS_01080 gene rpsT 126854 126591 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939182.1 protein_id gnl|my_center|LOCUS_01080 127575 126946 gene locus_tag LOCUS_01090 127575 126946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 129094 127583 gene locus_tag LOCUS_01100 129094 127583 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262844.1 protein_id gnl|my_center|LOCUS_01100 130117 129377 gene locus_tag LOCUS_01110 130117 129377 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_01110 130239 131282 gene locus_tag LOCUS_01120 130239 131282 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035992.1 protein_id gnl|my_center|LOCUS_01120 132563 131286 gene locus_tag LOCUS_01130 gene clpX 132563 131286 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640796.1 protein_id gnl|my_center|LOCUS_01130 133260 132586 gene locus_tag LOCUS_01140 gene clpP 133260 132586 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327157.1 protein_id gnl|my_center|LOCUS_01140 134593 133262 gene locus_tag LOCUS_01150 gene tig 134593 133262 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460919.1 protein_id gnl|my_center|LOCUS_01150 135590 134751 gene locus_tag LOCUS_01160 gene ispE 135590 134751 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772104.1 protein_id gnl|my_center|LOCUS_01160 136264 135587 gene locus_tag LOCUS_01170 136264 135587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 136790 136335 gene locus_tag LOCUS_01180 136790 136335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 137479 136985 gene locus_tag LOCUS_01190 137479 136985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 139847 137568 gene locus_tag LOCUS_01200 139847 137568 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183692.1 protein_id gnl|my_center|LOCUS_01200 142969 139925 gene locus_tag LOCUS_01210 142969 139925 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839665.1 protein_id gnl|my_center|LOCUS_01210 143067 144170 gene locus_tag LOCUS_01220 gene alr 143067 144170 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941268.1 protein_id gnl|my_center|LOCUS_01220 144234 144542 gene locus_tag LOCUS_01230 144234 144542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 145598 144543 gene locus_tag LOCUS_01240 145598 144543 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035273.1 protein_id gnl|my_center|LOCUS_01240 145966 145595 gene locus_tag LOCUS_01250 145966 145595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 146052 148478 gene locus_tag LOCUS_01260 146052 148478 CDS product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268715.1 protein_id gnl|my_center|LOCUS_01260 148475 149140 gene locus_tag LOCUS_01270 gene pdeM 148475 149140 CDS product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922347.1 protein_id gnl|my_center|LOCUS_01270 149137 150054 gene locus_tag LOCUS_01280 149137 150054 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119250.1 protein_id gnl|my_center|LOCUS_01280 153150 150067 gene locus_tag LOCUS_01290 153150 150067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 154910 153219 gene locus_tag LOCUS_01300 154910 153219 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819869.1 protein_id gnl|my_center|LOCUS_01300 156388 154907 gene locus_tag LOCUS_01310 156388 154907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 157460 156393 gene locus_tag LOCUS_01320 157460 156393 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_01320 159326 157617 gene locus_tag LOCUS_01330 gene rpsA 159326 157617 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882963.1 protein_id gnl|my_center|LOCUS_01330 159979 159557 gene locus_tag LOCUS_01340 159979 159557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 160132 160641 gene locus_tag LOCUS_01350 160132 160641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 160638 161063 gene locus_tag LOCUS_01360 160638 161063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 161094 161978 gene locus_tag LOCUS_01370 161094 161978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 162725 161979 gene locus_tag LOCUS_01380 162725 161979 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259141.1 protein_id gnl|my_center|LOCUS_01380 163267 162722 gene locus_tag LOCUS_01390 163267 162722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 163444 164475 gene locus_tag LOCUS_01400 gene ruvB 163444 164475 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220958.1 protein_id gnl|my_center|LOCUS_01400 164528 164953 gene locus_tag LOCUS_01410 164528 164953 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056047.1 protein_id gnl|my_center|LOCUS_01410 165901 164999 gene locus_tag LOCUS_01420 165901 164999 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940569.1 protein_id gnl|my_center|LOCUS_01420 166016 166720 gene locus_tag LOCUS_01430 166016 166720 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_01430 166747 167421 gene locus_tag LOCUS_01440 166747 167421 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705502.1 protein_id gnl|my_center|LOCUS_01440 167488 167763 gene locus_tag LOCUS_01450 167488 167763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 167792 168862 gene locus_tag LOCUS_01460 167792 168862 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175517123.1 protein_id gnl|my_center|LOCUS_01460 168859 169752 gene locus_tag LOCUS_01470 168859 169752 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941599.1 protein_id gnl|my_center|LOCUS_01470 169814 170380 gene locus_tag LOCUS_01480 169814 170380 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141342.1 protein_id gnl|my_center|LOCUS_01480 170380 172248 gene locus_tag LOCUS_01490 170380 172248 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106526748.1 protein_id gnl|my_center|LOCUS_01490 172845 172249 gene locus_tag LOCUS_01500 172845 172249 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057751.1 protein_id gnl|my_center|LOCUS_01500 174489 172849 gene locus_tag LOCUS_01510 174489 172849 CDS product putative Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929970.1 protein_id gnl|my_center|LOCUS_01510 175399 174551 gene locus_tag LOCUS_01520 gene miaA 175399 174551 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_01520 176803 175430 gene locus_tag LOCUS_01530 gene ffh 176803 175430 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863461.1 protein_id gnl|my_center|LOCUS_01530 178196 176967 gene locus_tag LOCUS_01540 178196 176967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 180100 178271 gene locus_tag LOCUS_01550 180100 178271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 180021 180305 gene locus_tag LOCUS_01560 180021 180305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 183818 180339 gene locus_tag LOCUS_01570 183818 180339 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943065.1 protein_id gnl|my_center|LOCUS_01570 185127 183889 gene locus_tag LOCUS_01580 185127 183889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121732.1 protein_id gnl|my_center|LOCUS_01580 186692 185190 gene locus_tag LOCUS_01590 186692 185190 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107897.1 protein_id gnl|my_center|LOCUS_01590 187432 186689 gene locus_tag LOCUS_01600 187432 186689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 189184 187523 gene locus_tag LOCUS_01610 189184 187523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 189735 189181 gene locus_tag LOCUS_01620 189735 189181 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327230.1 protein_id gnl|my_center|LOCUS_01620 190082 191224 gene locus_tag LOCUS_01630 190082 191224 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035976.1 protein_id gnl|my_center|LOCUS_01630 196654 191240 gene locus_tag LOCUS_01640 196654 191240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 198979 196793 gene locus_tag LOCUS_01650 198979 196793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 202755 199249 gene locus_tag LOCUS_01660 202755 199249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 203466 202945 gene locus_tag LOCUS_01670 203466 202945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 204754 203519 gene locus_tag LOCUS_01680 gene rsmB 204754 203519 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_01680 205547 204903 gene locus_tag LOCUS_01690 gene bioD 205547 204903 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398591.1 protein_id gnl|my_center|LOCUS_01690 205642 207255 gene locus_tag LOCUS_01700 gene nadB 205642 207255 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_01700 208580 207258 gene locus_tag LOCUS_01710 208580 207258 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040212.1 protein_id gnl|my_center|LOCUS_01710 208677 209339 gene locus_tag LOCUS_01720 208677 209339 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918966.1 protein_id gnl|my_center|LOCUS_01720 209387 209890 gene locus_tag LOCUS_01730 209387 209890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 209887 210456 gene locus_tag LOCUS_01740 209887 210456 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648011.1 protein_id gnl|my_center|LOCUS_01740 210546 211949 gene locus_tag LOCUS_01750 gene uxaC 210546 211949 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_01750 211965 213071 gene locus_tag LOCUS_01760 211965 213071 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121679.1 protein_id gnl|my_center|LOCUS_01760 213241 215085 gene locus_tag LOCUS_01770 gene htpG 213241 215085 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460040.1 protein_id gnl|my_center|LOCUS_01770 218105 215082 gene locus_tag LOCUS_01780 gene dnaE2 218105 215082 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895514.1 protein_id gnl|my_center|LOCUS_01780 218298 219629 gene locus_tag LOCUS_01790 218298 219629 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123589.1 protein_id gnl|my_center|LOCUS_01790 219648 220034 gene locus_tag LOCUS_01800 219648 220034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 220083 221768 gene locus_tag LOCUS_01810 220083 221768 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943977.1 protein_id gnl|my_center|LOCUS_01810 221899 222267 gene locus_tag LOCUS_01820 gene fabZ 221899 222267 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125568.1 protein_id gnl|my_center|LOCUS_01820 222724 222305 gene locus_tag LOCUS_01830 222724 222305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 224154 222757 gene locus_tag LOCUS_01840 224154 222757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967480.1 protein_id gnl|my_center|LOCUS_01840 225283 224210 gene locus_tag LOCUS_01850 225283 224210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 225851 225228 gene locus_tag LOCUS_01860 225851 225228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 226467 225871 gene locus_tag LOCUS_01870 226467 225871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 227063 226518 gene locus_tag LOCUS_01880 227063 226518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 228741 227086 gene locus_tag LOCUS_01890 gene recN 228741 227086 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393016.1 protein_id gnl|my_center|LOCUS_01890 229560 228817 gene locus_tag LOCUS_01900 gene pxpA 229560 228817 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197223.1 protein_id gnl|my_center|LOCUS_01900 231167 229557 gene locus_tag LOCUS_01910 gene pxpB 231167 229557 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228353.1 protein_id gnl|my_center|LOCUS_01910 >Feature sequence02 695 255 gene locus_tag LOCUS_01920 695 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 1109 696 gene locus_tag LOCUS_01930 1109 696 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812950.1 protein_id gnl|my_center|LOCUS_01930 1788 1111 gene locus_tag LOCUS_01940 1788 1111 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141387.1 protein_id gnl|my_center|LOCUS_01940 2568 1798 gene locus_tag LOCUS_01950 2568 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 4851 2623 gene locus_tag LOCUS_01960 4851 2623 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787020.1 protein_id gnl|my_center|LOCUS_01960 5049 6950 gene locus_tag LOCUS_01970 gene ettA 5049 6950 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_01970 8358 6982 gene locus_tag LOCUS_01980 8358 6982 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_01980 9762 8482 gene locus_tag LOCUS_01990 9762 8482 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460659.1 protein_id gnl|my_center|LOCUS_01990 9906 10148 gene locus_tag LOCUS_02000 9906 10148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 10145 10552 gene locus_tag LOCUS_02010 10145 10552 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679685.1 protein_id gnl|my_center|LOCUS_02010 11515 10589 gene locus_tag LOCUS_02020 11515 10589 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768321.1 protein_id gnl|my_center|LOCUS_02020 12248 11505 gene locus_tag LOCUS_02030 12248 11505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 12778 12245 gene locus_tag LOCUS_02040 gene pyrR 12778 12245 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257759.1 protein_id gnl|my_center|LOCUS_02040 13986 12787 gene locus_tag LOCUS_02050 gene purD 13986 12787 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404599.1 protein_id gnl|my_center|LOCUS_02050 14169 15095 gene locus_tag LOCUS_02060 14169 15095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 15126 16538 gene locus_tag LOCUS_02070 15126 16538 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122845.1 protein_id gnl|my_center|LOCUS_02070 16605 17573 gene locus_tag LOCUS_02080 16605 17573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 21611 17580 gene locus_tag LOCUS_02090 21611 17580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 21940 22179 gene locus_tag LOCUS_02100 21940 22179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 22390 24678 gene locus_tag LOCUS_02110 22390 24678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 26178 24688 gene locus_tag LOCUS_02120 26178 24688 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122120.1 protein_id gnl|my_center|LOCUS_02120 29070 26185 gene locus_tag LOCUS_02130 29070 26185 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037253593.1 protein_id gnl|my_center|LOCUS_02130 29403 29855 gene locus_tag LOCUS_02140 29403 29855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 30602 30120 gene locus_tag LOCUS_02150 30602 30120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 30796 31755 gene locus_tag LOCUS_02160 gene rsmH 30796 31755 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920418.1 protein_id gnl|my_center|LOCUS_02160 31752 32093 gene locus_tag LOCUS_02170 31752 32093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 32097 34019 gene locus_tag LOCUS_02180 32097 34019 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_02180 34016 35515 gene locus_tag LOCUS_02190 34016 35515 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943699.1 protein_id gnl|my_center|LOCUS_02190 35512 36876 gene locus_tag LOCUS_02200 35512 36876 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392358.1 protein_id gnl|my_center|LOCUS_02200 36880 38097 gene locus_tag LOCUS_02210 gene mraY 36880 38097 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651824.1 protein_id gnl|my_center|LOCUS_02210 38098 39408 gene locus_tag LOCUS_02220 gene murD 38098 39408 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_02220 39420 40235 gene locus_tag LOCUS_02230 39420 40235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 40273 41421 gene locus_tag LOCUS_02240 gene spoVE 40273 41421 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_02240 41585 44209 gene locus_tag LOCUS_02250 41585 44209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 44229 45491 gene locus_tag LOCUS_02260 44229 45491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 45511 48057 gene locus_tag LOCUS_02270 45511 48057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 48152 55027 gene locus_tag LOCUS_02280 48152 55027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 55239 57326 gene locus_tag LOCUS_02290 55239 57326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 57331 57960 gene locus_tag LOCUS_02300 57331 57960 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141682.1 protein_id gnl|my_center|LOCUS_02300 58552 58004 gene locus_tag LOCUS_02310 58552 58004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 58674 59279 gene locus_tag LOCUS_02320 58674 59279 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977317.1 protein_id gnl|my_center|LOCUS_02320 59827 59306 gene locus_tag LOCUS_02330 59827 59306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 60720 59992 gene locus_tag LOCUS_02340 60720 59992 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016086425.1 protein_id gnl|my_center|LOCUS_02340 61391 60804 gene locus_tag LOCUS_02350 61391 60804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 63552 61576 gene locus_tag LOCUS_02360 gene tkt 63552 61576 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193030.1 protein_id gnl|my_center|LOCUS_02360 63487 63666 gene locus_tag LOCUS_02370 63487 63666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 66039 63721 gene locus_tag LOCUS_02380 gene rnr 66039 63721 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228386.1 protein_id gnl|my_center|LOCUS_02380 66261 66848 gene locus_tag LOCUS_02390 66261 66848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 67733 67050 gene locus_tag LOCUS_02400 67733 67050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 68977 67703 gene locus_tag LOCUS_02410 68977 67703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02410 69186 69497 gene locus_tag LOCUS_02420 69186 69497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 69648 69965 gene locus_tag LOCUS_02430 69648 69965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 69952 70494 gene locus_tag LOCUS_02440 69952 70494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403820.1 protein_id gnl|my_center|LOCUS_02440 71367 70498 gene locus_tag LOCUS_02450 gene argB 71367 70498 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335411.1 protein_id gnl|my_center|LOCUS_02450 72017 71424 gene locus_tag LOCUS_02460 72017 71424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 72140 72487 gene locus_tag LOCUS_02470 72140 72487 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141229.1 protein_id gnl|my_center|LOCUS_02470 72545 74263 gene locus_tag LOCUS_02480 72545 74263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 75469 74264 gene locus_tag LOCUS_02490 gene trpB 75469 74264 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391174.1 protein_id gnl|my_center|LOCUS_02490 77597 75534 gene locus_tag LOCUS_02500 77597 75534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 79013 77607 gene locus_tag LOCUS_02510 79013 77607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 79953 79018 gene locus_tag LOCUS_02520 79953 79018 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887563.1 protein_id gnl|my_center|LOCUS_02520 80932 79940 gene locus_tag LOCUS_02530 80932 79940 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224650.1 protein_id gnl|my_center|LOCUS_02530 81051 82034 gene locus_tag LOCUS_02540 81051 82034 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206339.1 protein_id gnl|my_center|LOCUS_02540 82116 83519 gene locus_tag LOCUS_02550 82116 83519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 83516 84409 gene locus_tag LOCUS_02560 83516 84409 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206340.1 protein_id gnl|my_center|LOCUS_02560 84474 85832 gene locus_tag LOCUS_02570 gene glnT 84474 85832 CDS product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267555.1 protein_id gnl|my_center|LOCUS_02570 85836 86624 gene locus_tag LOCUS_02580 85836 86624 CDS product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067911.1 protein_id gnl|my_center|LOCUS_02580 87093 87722 gene locus_tag LOCUS_02590 87093 87722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 87719 88558 gene locus_tag LOCUS_02600 87719 88558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 88555 89751 gene locus_tag LOCUS_02610 88555 89751 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926041.1 protein_id gnl|my_center|LOCUS_02610 89805 90263 gene locus_tag LOCUS_02620 89805 90263 CDS product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640341.1 protein_id gnl|my_center|LOCUS_02620 90267 90983 gene locus_tag LOCUS_02630 90267 90983 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420904.1 protein_id gnl|my_center|LOCUS_02630 90985 91617 gene locus_tag LOCUS_02640 90985 91617 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 protein_id gnl|my_center|LOCUS_02640 91644 91988 gene locus_tag LOCUS_02650 91644 91988 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_02650 92044 95604 gene locus_tag LOCUS_02660 gene uca 92044 95604 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140960.1 protein_id gnl|my_center|LOCUS_02660 95601 97352 gene locus_tag LOCUS_02670 gene atzF 95601 97352 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140963.1 protein_id gnl|my_center|LOCUS_02670 98094 97330 gene locus_tag LOCUS_02680 98094 97330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 98248 100665 gene locus_tag LOCUS_02690 98248 100665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 100662 101759 gene locus_tag LOCUS_02700 100662 101759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 101783 102541 gene locus_tag LOCUS_02710 101783 102541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 102779 103342 gene locus_tag LOCUS_02720 102779 103342 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336412.1 protein_id gnl|my_center|LOCUS_02720 103360 105528 gene locus_tag LOCUS_02730 103360 105528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 105651 110057 gene locus_tag LOCUS_02740 105651 110057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 110058 110879 gene locus_tag LOCUS_02750 110058 110879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 110984 113140 gene locus_tag LOCUS_02760 110984 113140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 113703 115784 gene locus_tag LOCUS_02770 113703 115784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 115781 116419 gene locus_tag LOCUS_02780 115781 116419 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_02780 116597 120508 gene locus_tag LOCUS_02790 116597 120508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 120586 121809 gene locus_tag LOCUS_02800 120586 121809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 125578 122159 gene locus_tag LOCUS_02810 125578 122159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 127168 126068 gene locus_tag LOCUS_02820 127168 126068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 127591 131697 gene locus_tag LOCUS_02830 127591 131697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 131739 133982 gene locus_tag LOCUS_02840 131739 133982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 134153 136228 gene locus_tag LOCUS_02850 134153 136228 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767024.1 protein_id gnl|my_center|LOCUS_02850 138324 136282 gene locus_tag LOCUS_02860 138324 136282 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883393.1 protein_id gnl|my_center|LOCUS_02860 138666 138848 gene locus_tag LOCUS_02870 138666 138848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 138917 139258 gene locus_tag LOCUS_02880 138917 139258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 139579 141432 gene locus_tag LOCUS_02890 139579 141432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 142503 141448 gene locus_tag LOCUS_02900 142503 141448 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243962.1 protein_id gnl|my_center|LOCUS_02900 142823 143683 gene locus_tag LOCUS_02910 142823 143683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 144035 144439 gene locus_tag LOCUS_02920 gene rpsL 144035 144439 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002782934.1 protein_id gnl|my_center|LOCUS_02920 144473 144946 gene locus_tag LOCUS_02930 gene rpsG 144473 144946 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055588.1 protein_id gnl|my_center|LOCUS_02930 144983 147124 gene locus_tag LOCUS_02940 gene fusA 144983 147124 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_02940 147173 147481 gene locus_tag LOCUS_02950 gene rpsJ 147173 147481 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390499.1 protein_id gnl|my_center|LOCUS_02950 147544 148179 gene locus_tag LOCUS_02960 gene rplC 147544 148179 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222604.1 protein_id gnl|my_center|LOCUS_02960 148217 148825 gene locus_tag LOCUS_02970 gene rplD 148217 148825 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886957.1 protein_id gnl|my_center|LOCUS_02970 148849 149133 gene locus_tag LOCUS_02980 148849 149133 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_02980 149182 150021 gene locus_tag LOCUS_02990 gene rplB 149182 150021 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933839.1 protein_id gnl|my_center|LOCUS_02990 150064 150336 gene locus_tag LOCUS_03000 gene rpsS 150064 150336 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545511.1 protein_id gnl|my_center|LOCUS_03000 150358 151077 gene locus_tag LOCUS_03010 150358 151077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 151101 151526 gene locus_tag LOCUS_03020 151101 151526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 151559 152296 gene locus_tag LOCUS_03030 gene rpsC 151559 152296 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390432.1 protein_id gnl|my_center|LOCUS_03030 152343 152762 gene locus_tag LOCUS_03040 gene rplP 152343 152762 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872721.1 protein_id gnl|my_center|LOCUS_03040 152786 152986 gene locus_tag LOCUS_03050 gene rpmC 152786 152986 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720942.1 protein_id gnl|my_center|LOCUS_03050 153022 153291 gene locus_tag LOCUS_03060 gene rpsQ 153022 153291 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055945.1 protein_id gnl|my_center|LOCUS_03060 153348 153713 gene locus_tag LOCUS_03070 gene rplN 153348 153713 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323021.1 protein_id gnl|my_center|LOCUS_03070 153742 153975 gene locus_tag LOCUS_03080 153742 153975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 154038 154625 gene locus_tag LOCUS_03090 gene rplE 154038 154625 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357534.1 protein_id gnl|my_center|LOCUS_03090 154662 155057 gene locus_tag LOCUS_03100 gene rpsH 154662 155057 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938612.1 protein_id gnl|my_center|LOCUS_03100 155090 155629 gene locus_tag LOCUS_03110 gene rplF 155090 155629 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869914.1 protein_id gnl|my_center|LOCUS_03110 155665 156021 gene locus_tag LOCUS_03120 gene rplR 155665 156021 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628816.1 protein_id gnl|my_center|LOCUS_03120 156106 156723 gene locus_tag LOCUS_03130 gene rpsE 156106 156723 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938615.1 protein_id gnl|my_center|LOCUS_03130 156839 157282 gene locus_tag LOCUS_03140 gene rplO 156839 157282 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869910.1 protein_id gnl|my_center|LOCUS_03140 157390 158907 gene locus_tag LOCUS_03150 gene secY 157390 158907 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933822.1 protein_id gnl|my_center|LOCUS_03150 158904 159563 gene locus_tag LOCUS_03160 158904 159563 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_03160 159560 160417 gene locus_tag LOCUS_03170 gene map 159560 160417 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393915.1 protein_id gnl|my_center|LOCUS_03170 160672 161241 gene locus_tag LOCUS_03180 160672 161241 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056493.1 protein_id gnl|my_center|LOCUS_03180 161822 161445 gene locus_tag LOCUS_03190 161822 161445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 163980 162055 gene locus_tag LOCUS_03200 163980 162055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 165116 164016 gene locus_tag LOCUS_03210 165116 164016 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404059.1 protein_id gnl|my_center|LOCUS_03210 165237 166937 gene locus_tag LOCUS_03220 gene ilvD 165237 166937 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502719.1 protein_id gnl|my_center|LOCUS_03220 166960 167625 gene locus_tag LOCUS_03230 166960 167625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 167641 168747 gene locus_tag LOCUS_03240 167641 168747 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530677.1 protein_id gnl|my_center|LOCUS_03240 169691 168777 gene locus_tag LOCUS_03250 169691 168777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 169912 170928 gene locus_tag LOCUS_03260 gene tdh 169912 170928 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707888.1 protein_id gnl|my_center|LOCUS_03260 170992 172653 gene locus_tag LOCUS_03270 gene glgP 170992 172653 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871155.1 protein_id gnl|my_center|LOCUS_03270 172737 174131 gene locus_tag LOCUS_03280 172737 174131 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_03280 175187 174147 gene locus_tag LOCUS_03290 175187 174147 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943878.1 protein_id gnl|my_center|LOCUS_03290 175347 176810 gene locus_tag LOCUS_03300 175347 176810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 176807 177538 gene locus_tag LOCUS_03310 176807 177538 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136101.1 protein_id gnl|my_center|LOCUS_03310 177692 178372 gene locus_tag LOCUS_03320 177692 178372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 178369 178884 gene locus_tag LOCUS_03330 178369 178884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 178881 179642 gene locus_tag LOCUS_03340 178881 179642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 179629 182649 gene locus_tag LOCUS_03350 179629 182649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 182633 183316 gene locus_tag LOCUS_03360 182633 183316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 183361 184578 gene locus_tag LOCUS_03370 183361 184578 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337450.1 protein_id gnl|my_center|LOCUS_03370 184630 185412 gene locus_tag LOCUS_03380 184630 185412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 185494 186894 gene locus_tag LOCUS_03390 185494 186894 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390122.1 protein_id gnl|my_center|LOCUS_03390 186918 188414 gene locus_tag LOCUS_03400 186918 188414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 188425 189618 gene locus_tag LOCUS_03410 188425 189618 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392273.1 protein_id gnl|my_center|LOCUS_03410 189713 190081 gene locus_tag LOCUS_03420 189713 190081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 190808 190164 gene locus_tag LOCUS_03430 190808 190164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 191929 190868 gene locus_tag LOCUS_03440 191929 190868 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014889.1 protein_id gnl|my_center|LOCUS_03440 192037 193704 gene locus_tag LOCUS_03450 192037 193704 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584095.1 protein_id gnl|my_center|LOCUS_03450 193732 195210 gene locus_tag LOCUS_03460 193732 195210 CDS product fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584080.1 protein_id gnl|my_center|LOCUS_03460 195223 195915 gene locus_tag LOCUS_03470 gene araD 195223 195915 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169913.1 protein_id gnl|my_center|LOCUS_03470 195932 196891 gene locus_tag LOCUS_03480 195932 196891 CDS product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174243.1 protein_id gnl|my_center|LOCUS_03480 196911 198437 gene locus_tag LOCUS_03490 196911 198437 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528380.1 protein_id gnl|my_center|LOCUS_03490 198434 199375 gene locus_tag LOCUS_03500 198434 199375 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085059.1 protein_id gnl|my_center|LOCUS_03500 199481 200515 gene locus_tag LOCUS_03510 199481 200515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 201347 200502 gene locus_tag LOCUS_03520 201347 200502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 201399 201992 gene locus_tag LOCUS_03530 201399 201992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 202026 203327 gene locus_tag LOCUS_03540 202026 203327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 203335 203610 gene locus_tag LOCUS_03550 203335 203610 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672192.1 protein_id gnl|my_center|LOCUS_03550 203668 203748 gene locus_tag LOCUS_t00020 203668 203748 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 203787 204605 gene locus_tag LOCUS_03560 gene lpxI 203787 204605 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791912.1 protein_id gnl|my_center|LOCUS_03560 204661 207009 gene locus_tag LOCUS_03570 204661 207009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 208575 207028 gene locus_tag LOCUS_03580 208575 207028 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125226.1 protein_id gnl|my_center|LOCUS_03580 209330 208593 gene locus_tag LOCUS_03590 gene dapB 209330 208593 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095210.1 protein_id gnl|my_center|LOCUS_03590 211935 209380 gene locus_tag LOCUS_03600 211935 209380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 212618 211995 gene locus_tag LOCUS_03610 gene upp 212618 211995 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699935.1 protein_id gnl|my_center|LOCUS_03610 214005 212626 gene locus_tag LOCUS_03620 gene zraR 214005 212626 CDS product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368806.1 protein_id gnl|my_center|LOCUS_03620 215503 214160 gene locus_tag LOCUS_03630 215503 214160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 216229 215564 gene locus_tag LOCUS_03640 216229 215564 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545169.1 protein_id gnl|my_center|LOCUS_03640 217018 216260 gene locus_tag LOCUS_03650 217018 216260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 218758 217244 gene locus_tag LOCUS_03660 gene cobA 218758 217244 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938035.1 protein_id gnl|my_center|LOCUS_03660 219714 218755 gene locus_tag LOCUS_03670 gene hemC 219714 218755 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258453.1 protein_id gnl|my_center|LOCUS_03670 219995 226636 gene locus_tag LOCUS_03680 219995 226636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 227770 226673 gene locus_tag LOCUS_03690 227770 226673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 228015 227803 gene locus_tag LOCUS_03700 228015 227803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 228739 228245 gene locus_tag LOCUS_03710 228739 228245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 >Feature sequence03 2773 1589 gene locus_tag LOCUS_03720 2773 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 3903 2923 gene locus_tag LOCUS_03730 3903 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 4403 3900 gene locus_tag LOCUS_03740 4403 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 5220 4678 gene locus_tag LOCUS_03750 5220 4678 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036141.1 protein_id gnl|my_center|LOCUS_03750 9453 5269 gene locus_tag LOCUS_03760 9453 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 10735 9590 gene locus_tag LOCUS_03770 gene eboE 10735 9590 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_03770 11538 10738 gene locus_tag LOCUS_03780 11538 10738 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326598.1 protein_id gnl|my_center|LOCUS_03780 11980 11558 gene locus_tag LOCUS_03790 11980 11558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 11930 12910 gene locus_tag LOCUS_03800 gene lgt 11930 12910 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688557.1 protein_id gnl|my_center|LOCUS_03800 12972 13880 gene locus_tag LOCUS_03810 12972 13880 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922059.1 protein_id gnl|my_center|LOCUS_03810 14042 15022 gene locus_tag LOCUS_03820 14042 15022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 16455 15034 gene locus_tag LOCUS_03830 16455 15034 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922285.1 protein_id gnl|my_center|LOCUS_03830 19556 16458 gene locus_tag LOCUS_03840 19556 16458 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_03840 19832 19757 gene locus_tag LOCUS_t00030 19832 19757 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 20754 19930 gene locus_tag LOCUS_03850 20754 19930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 20993 21610 gene locus_tag LOCUS_03860 20993 21610 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922130.1 protein_id gnl|my_center|LOCUS_03860 21918 21553 gene locus_tag LOCUS_03870 21918 21553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 21838 22848 gene locus_tag LOCUS_03880 21838 22848 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434916.1 protein_id gnl|my_center|LOCUS_03880 24026 23286 gene locus_tag LOCUS_03890 24026 23286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 24209 24376 gene locus_tag LOCUS_03900 24209 24376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 24687 24454 gene locus_tag LOCUS_03910 24687 24454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 24909 26030 gene locus_tag LOCUS_03920 24909 26030 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116208.1 protein_id gnl|my_center|LOCUS_03920 26108 27211 gene locus_tag LOCUS_03930 gene lptF 26108 27211 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_03930 27225 29105 gene locus_tag LOCUS_03940 27225 29105 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937364.1 protein_id gnl|my_center|LOCUS_03940 29102 29584 gene locus_tag LOCUS_03950 29102 29584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 30541 29603 gene locus_tag LOCUS_03960 30541 29603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 31599 30565 gene locus_tag LOCUS_03970 31599 30565 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940693.1 protein_id gnl|my_center|LOCUS_03970 31762 33087 gene locus_tag LOCUS_03980 31762 33087 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765838.1 protein_id gnl|my_center|LOCUS_03980 33059 34195 gene locus_tag LOCUS_03990 33059 34195 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486733.1 protein_id gnl|my_center|LOCUS_03990 35450 34200 gene locus_tag LOCUS_04000 35450 34200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 36841 35450 gene locus_tag LOCUS_04010 36841 35450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 38043 36847 gene locus_tag LOCUS_04020 38043 36847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 38216 38557 gene locus_tag LOCUS_04030 38216 38557 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185161.1 protein_id gnl|my_center|LOCUS_04030 38634 41849 gene locus_tag LOCUS_04040 38634 41849 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140878.1 protein_id gnl|my_center|LOCUS_04040 41954 42952 gene locus_tag LOCUS_04050 41954 42952 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140877.1 protein_id gnl|my_center|LOCUS_04050 43941 42970 gene locus_tag LOCUS_04060 43941 42970 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098208.1 protein_id gnl|my_center|LOCUS_04060 44102 45217 gene locus_tag LOCUS_04070 44102 45217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 45296 46081 gene locus_tag LOCUS_04080 45296 46081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 46190 47116 gene locus_tag LOCUS_04090 46190 47116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 52922 47106 gene locus_tag LOCUS_04100 52922 47106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 54197 53004 gene locus_tag LOCUS_04110 54197 53004 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479718.1 protein_id gnl|my_center|LOCUS_04110 55170 54256 gene locus_tag LOCUS_04120 55170 54256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 56024 55167 gene locus_tag LOCUS_04130 gene pssA 56024 55167 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_04130 56111 56650 gene locus_tag LOCUS_04140 56111 56650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 56696 57832 gene locus_tag LOCUS_04150 56696 57832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 57848 59035 gene locus_tag LOCUS_04160 57848 59035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 60321 59098 gene locus_tag LOCUS_04170 60321 59098 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391154.1 protein_id gnl|my_center|LOCUS_04170 60429 60968 gene locus_tag LOCUS_04180 60429 60968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 61055 62446 gene locus_tag LOCUS_04190 61055 62446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 63414 62455 gene locus_tag LOCUS_04200 63414 62455 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056272.1 protein_id gnl|my_center|LOCUS_04200 65678 63480 gene locus_tag LOCUS_04210 65678 63480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 66794 65685 gene locus_tag LOCUS_04220 66794 65685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 69513 66829 gene locus_tag LOCUS_04230 69513 66829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 70811 69807 gene locus_tag LOCUS_04240 70811 69807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 72548 71064 gene locus_tag LOCUS_04250 72548 71064 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918672.1 protein_id gnl|my_center|LOCUS_04250 72657 73439 gene locus_tag LOCUS_04260 72657 73439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 73981 73436 gene locus_tag LOCUS_04270 73981 73436 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421522.1 protein_id gnl|my_center|LOCUS_04270 74759 74025 gene locus_tag LOCUS_04280 74759 74025 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_04280 75461 74904 gene locus_tag LOCUS_04290 75461 74904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 75576 76265 gene locus_tag LOCUS_04300 75576 76265 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928484.1 protein_id gnl|my_center|LOCUS_04300 76323 76706 gene locus_tag LOCUS_04310 76323 76706 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919370.1 protein_id gnl|my_center|LOCUS_04310 79538 76746 gene locus_tag LOCUS_04320 gene acnA 79538 76746 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839326.1 protein_id gnl|my_center|LOCUS_04320 80007 80567 gene locus_tag LOCUS_04330 80007 80567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 80936 81364 gene locus_tag LOCUS_04340 80936 81364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 81374 83665 gene locus_tag LOCUS_04350 81374 83665 CDS product Piwi domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031225.1 protein_id gnl|my_center|LOCUS_04350 84085 85056 gene locus_tag LOCUS_04360 84085 85056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 85308 87770 gene locus_tag LOCUS_04370 85308 87770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 88244 88038 gene locus_tag LOCUS_04380 88244 88038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 88675 88367 gene locus_tag LOCUS_04390 88675 88367 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_04390 89039 88680 gene locus_tag LOCUS_04400 89039 88680 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_04400 91969 89198 gene locus_tag LOCUS_04410 91969 89198 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974111.1 protein_id gnl|my_center|LOCUS_04410 92398 92174 gene locus_tag LOCUS_04420 92398 92174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 92295 92564 gene locus_tag LOCUS_04430 92295 92564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 92561 93187 gene locus_tag LOCUS_04440 92561 93187 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120430.1 protein_id gnl|my_center|LOCUS_04440 93926 93249 gene locus_tag LOCUS_04450 93926 93249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 94425 93991 gene locus_tag LOCUS_04460 94425 93991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 94556 94840 gene locus_tag LOCUS_04470 94556 94840 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730347.1 protein_id gnl|my_center|LOCUS_04470 95633 94857 gene locus_tag LOCUS_04480 95633 94857 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841479.1 protein_id gnl|my_center|LOCUS_04480 96723 95692 gene locus_tag LOCUS_04490 gene fbaA 96723 95692 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230818.1 protein_id gnl|my_center|LOCUS_04490 96837 97664 gene locus_tag LOCUS_04500 96837 97664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 97775 98017 gene locus_tag LOCUS_04510 gene acpP 97775 98017 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_04510 98120 98656 gene locus_tag LOCUS_04520 98120 98656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 98673 99560 gene locus_tag LOCUS_04530 98673 99560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 99615 100571 gene locus_tag LOCUS_04540 99615 100571 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_04540 100624 101703 gene locus_tag LOCUS_04550 100624 101703 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153481.1 protein_id gnl|my_center|LOCUS_04550 101740 102903 gene locus_tag LOCUS_04560 101740 102903 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839857.1 protein_id gnl|my_center|LOCUS_04560 103905 102958 gene locus_tag LOCUS_04570 103905 102958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 104116 105171 gene locus_tag LOCUS_04580 104116 105171 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103810.1 protein_id gnl|my_center|LOCUS_04580 105221 105643 gene locus_tag LOCUS_04590 105221 105643 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769424.1 protein_id gnl|my_center|LOCUS_04590 106270 105635 gene locus_tag LOCUS_04600 106270 105635 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 protein_id gnl|my_center|LOCUS_04600 106712 106323 gene locus_tag LOCUS_04610 106712 106323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 107523 106771 gene locus_tag LOCUS_04620 107523 106771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 107595 108170 gene locus_tag LOCUS_04630 107595 108170 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888275.1 protein_id gnl|my_center|LOCUS_04630 109060 108167 gene locus_tag LOCUS_04640 109060 108167 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312095.1 protein_id gnl|my_center|LOCUS_04640 109186 110304 gene locus_tag LOCUS_04650 109186 110304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 110314 110592 gene locus_tag LOCUS_04660 110314 110592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 110716 112065 gene locus_tag LOCUS_04670 110716 112065 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038455.1 protein_id gnl|my_center|LOCUS_04670 112118 113947 gene locus_tag LOCUS_04680 112118 113947 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765636.1 protein_id gnl|my_center|LOCUS_04680 114771 113974 gene locus_tag LOCUS_04690 gene trpA 114771 113974 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338525.1 protein_id gnl|my_center|LOCUS_04690 116977 114830 gene locus_tag LOCUS_04700 116977 114830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 118515 117148 gene locus_tag LOCUS_04710 118515 117148 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328624.1 protein_id gnl|my_center|LOCUS_04710 120949 118544 gene locus_tag LOCUS_04720 120949 118544 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922871.1 protein_id gnl|my_center|LOCUS_04720 122708 120957 gene locus_tag LOCUS_04730 122708 120957 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036446.1 protein_id gnl|my_center|LOCUS_04730 123630 122884 gene locus_tag LOCUS_04740 123630 122884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 124907 123783 gene locus_tag LOCUS_04750 gene aroB 124907 123783 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942668.1 protein_id gnl|my_center|LOCUS_04750 124962 125315 gene locus_tag LOCUS_04760 124962 125315 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023525.1 protein_id gnl|my_center|LOCUS_04760 125312 127384 gene locus_tag LOCUS_04770 125312 127384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 127365 128099 gene locus_tag LOCUS_04780 127365 128099 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227326.1 protein_id gnl|my_center|LOCUS_04780 128363 130522 gene locus_tag LOCUS_04790 128363 130522 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922617.1 protein_id gnl|my_center|LOCUS_04790 130875 130534 gene locus_tag LOCUS_04800 130875 130534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 132540 130879 gene locus_tag LOCUS_04810 132540 130879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 132820 132599 gene locus_tag LOCUS_04820 132820 132599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 132720 134672 gene locus_tag LOCUS_04830 132720 134672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 135909 134680 gene locus_tag LOCUS_04840 135909 134680 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056884.1 protein_id gnl|my_center|LOCUS_04840 136012 138540 gene locus_tag LOCUS_04850 136012 138540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 138960 138544 gene locus_tag LOCUS_04860 138960 138544 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_04860 139100 139810 gene locus_tag LOCUS_04870 139100 139810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 140296 139814 gene locus_tag LOCUS_04880 140296 139814 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057647.1 protein_id gnl|my_center|LOCUS_04880 141455 140307 gene locus_tag LOCUS_04890 141455 140307 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039292.1 protein_id gnl|my_center|LOCUS_04890 141550 142728 gene locus_tag LOCUS_04900 141550 142728 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_04900 143398 142730 gene locus_tag LOCUS_04910 143398 142730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 143358 143639 gene locus_tag LOCUS_04920 143358 143639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 144799 144128 gene locus_tag LOCUS_04930 144799 144128 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527401.1 protein_id gnl|my_center|LOCUS_04930 149730 144796 gene locus_tag LOCUS_04940 149730 144796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 150654 149803 gene locus_tag LOCUS_04950 150654 149803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 154729 150671 gene locus_tag LOCUS_04960 154729 150671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04960 163667 154734 gene locus_tag LOCUS_04970 163667 154734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04970 165508 163664 gene locus_tag LOCUS_04980 165508 163664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 165773 166978 gene locus_tag LOCUS_04990 165773 166978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 166984 167556 gene locus_tag LOCUS_05000 166984 167556 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261151.1 protein_id gnl|my_center|LOCUS_05000 167581 169800 gene locus_tag LOCUS_05010 167581 169800 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006742214.1 protein_id gnl|my_center|LOCUS_05010 169908 171419 gene locus_tag LOCUS_05020 169908 171419 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_05020 171466 172806 gene locus_tag LOCUS_05030 171466 172806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 173693 173154 gene locus_tag LOCUS_05040 173693 173154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118344.1 protein_id gnl|my_center|LOCUS_05040 173821 174174 gene locus_tag LOCUS_05050 173821 174174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 174178 175527 gene locus_tag LOCUS_05060 174178 175527 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730516.1 protein_id gnl|my_center|LOCUS_05060 175524 175868 gene locus_tag LOCUS_05070 175524 175868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 175880 176548 gene locus_tag LOCUS_05080 175880 176548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 177045 176545 gene locus_tag LOCUS_05090 gene folK 177045 176545 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 protein_id gnl|my_center|LOCUS_05090 178499 177048 gene locus_tag LOCUS_05100 178499 177048 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125226.1 protein_id gnl|my_center|LOCUS_05100 180217 178559 gene locus_tag LOCUS_05110 180217 178559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 180271 180570 gene locus_tag LOCUS_05120 180271 180570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 183055 180581 gene locus_tag LOCUS_05130 183055 180581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 183709 183269 gene locus_tag LOCUS_05140 183709 183269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 184441 183767 gene locus_tag LOCUS_05150 184441 183767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 184621 187194 gene locus_tag LOCUS_05160 gene clpB 184621 187194 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941319.1 protein_id gnl|my_center|LOCUS_05160 187265 187936 gene locus_tag LOCUS_05170 187265 187936 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940907.1 protein_id gnl|my_center|LOCUS_05170 188720 188013 gene locus_tag LOCUS_05180 188720 188013 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922255.1 protein_id gnl|my_center|LOCUS_05180 190835 188838 gene locus_tag LOCUS_05190 gene thiC 190835 188838 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193963.1 protein_id gnl|my_center|LOCUS_05190 191151 191227 gene locus_tag LOCUS_t00040 191151 191227 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 191312 191698 gene locus_tag LOCUS_05200 gene apaG 191312 191698 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383338.1 protein_id gnl|my_center|LOCUS_05200 192252 191710 gene locus_tag LOCUS_05210 192252 191710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 192397 192849 gene locus_tag LOCUS_05220 192397 192849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 192861 193331 gene locus_tag LOCUS_05230 192861 193331 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_05230 193420 194289 gene locus_tag LOCUS_05240 gene ilvE 193420 194289 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_05240 194327 194842 gene locus_tag LOCUS_05250 194327 194842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 194932 196056 gene locus_tag LOCUS_05260 194932 196056 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391708.1 protein_id gnl|my_center|LOCUS_05260 196053 198590 gene locus_tag LOCUS_05270 196053 198590 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 protein_id gnl|my_center|LOCUS_05270 200498 198693 gene locus_tag LOCUS_05280 200498 198693 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882974.1 protein_id gnl|my_center|LOCUS_05280 200626 201018 gene locus_tag LOCUS_05290 200626 201018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 202168 201125 gene locus_tag LOCUS_05300 202168 201125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 202260 203171 gene locus_tag LOCUS_05310 gene cynR 202260 203171 CDS product transcriptional regulator CynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256690.1 protein_id gnl|my_center|LOCUS_05310 203668 203231 gene locus_tag LOCUS_05320 203668 203231 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037733.1 protein_id gnl|my_center|LOCUS_05320 205156 203678 gene locus_tag LOCUS_05330 205156 203678 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615699.1 protein_id gnl|my_center|LOCUS_05330 206289 205441 gene locus_tag LOCUS_05340 206289 205441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 206407 207255 gene locus_tag LOCUS_05350 206407 207255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 207447 209075 gene locus_tag LOCUS_05360 207447 209075 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218033054.1 protein_id gnl|my_center|LOCUS_05360 209120 209542 gene locus_tag LOCUS_05370 209120 209542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 209626 210087 gene locus_tag LOCUS_05380 gene rnhA 209626 210087 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705464.1 protein_id gnl|my_center|LOCUS_05380 210110 211036 gene locus_tag LOCUS_05390 210110 211036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 211090 212556 gene locus_tag LOCUS_05400 211090 212556 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_05400 212611 212868 gene locus_tag LOCUS_05410 212611 212868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 212971 213594 gene locus_tag LOCUS_05420 gene tmk 212971 213594 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039005.1 protein_id gnl|my_center|LOCUS_05420 213653 214003 gene locus_tag LOCUS_05430 213653 214003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 215791 214004 gene locus_tag LOCUS_05440 215791 214004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 215853 216668 gene locus_tag LOCUS_05450 215853 216668 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338675.1 protein_id gnl|my_center|LOCUS_05450 <217198 216676 gene locus_tag LOCUS_05460 <217198 216676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615476.1:NPCBM/NEW2 domain-containing protein >Feature sequence04 2697 697 gene locus_tag LOCUS_05470 2697 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 3317 2766 gene locus_tag LOCUS_05480 3317 2766 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937654.1 protein_id gnl|my_center|LOCUS_05480 4188 3343 gene locus_tag LOCUS_05490 4188 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 5369 4218 gene locus_tag LOCUS_05500 5369 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 6574 5426 gene locus_tag LOCUS_05510 6574 5426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 7751 6591 gene locus_tag LOCUS_05520 7751 6591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 8786 7845 gene locus_tag LOCUS_05530 8786 7845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 10358 8829 gene locus_tag LOCUS_05540 10358 8829 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390841.1 protein_id gnl|my_center|LOCUS_05540 11949 10456 gene locus_tag LOCUS_05550 11949 10456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 14362 11990 gene locus_tag LOCUS_05560 14362 11990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 15095 14385 gene locus_tag LOCUS_05570 15095 14385 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_05570 15401 16075 gene locus_tag LOCUS_05580 15401 16075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 16807 16355 gene locus_tag LOCUS_05590 16807 16355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 18340 17096 gene locus_tag LOCUS_05600 18340 17096 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365065.1 protein_id gnl|my_center|LOCUS_05600 19369 18464 gene locus_tag LOCUS_05610 gene cysD 19369 18464 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016337.1 protein_id gnl|my_center|LOCUS_05610 20248 19655 gene locus_tag LOCUS_05620 gene cysC 20248 19655 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202511.1 protein_id gnl|my_center|LOCUS_05620 21758 20370 gene locus_tag LOCUS_05630 21758 20370 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118525.1 protein_id gnl|my_center|LOCUS_05630 22583 21801 gene locus_tag LOCUS_05640 22583 21801 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920874.1 protein_id gnl|my_center|LOCUS_05640 23662 22580 gene locus_tag LOCUS_05650 23662 22580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 24817 23699 gene locus_tag LOCUS_05660 gene gmd 24817 23699 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167740.1 protein_id gnl|my_center|LOCUS_05660 25797 24859 gene locus_tag LOCUS_05670 25797 24859 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118908.1 protein_id gnl|my_center|LOCUS_05670 26719 26171 gene locus_tag LOCUS_05680 26719 26171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 27225 26716 gene locus_tag LOCUS_05690 27225 26716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 27357 28289 gene locus_tag LOCUS_05700 27357 28289 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942460.1 protein_id gnl|my_center|LOCUS_05700 28360 29685 gene locus_tag LOCUS_05710 28360 29685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 30890 29706 gene locus_tag LOCUS_05720 gene larC 30890 29706 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460167.1 protein_id gnl|my_center|LOCUS_05720 31549 30887 gene locus_tag LOCUS_05730 gene larB 31549 30887 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940816.1 protein_id gnl|my_center|LOCUS_05730 32345 31542 gene locus_tag LOCUS_05740 gene larE 32345 31542 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_05740 33405 32416 gene locus_tag LOCUS_05750 33405 32416 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122560.1 protein_id gnl|my_center|LOCUS_05750 33464 36946 gene locus_tag LOCUS_05760 33464 36946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 36946 38934 gene locus_tag LOCUS_05770 36946 38934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 38941 40125 gene locus_tag LOCUS_05780 38941 40125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 40554 40141 gene locus_tag LOCUS_05790 40554 40141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 42229 40493 gene locus_tag LOCUS_05800 42229 40493 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948104.1 protein_id gnl|my_center|LOCUS_05800 42340 43071 gene locus_tag LOCUS_05810 42340 43071 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122308.1 protein_id gnl|my_center|LOCUS_05810 43712 43083 gene locus_tag LOCUS_05820 43712 43083 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325327.1 protein_id gnl|my_center|LOCUS_05820 43925 44566 gene locus_tag LOCUS_05830 43925 44566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 45793 44684 gene locus_tag LOCUS_05840 45793 44684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 46603 45950 gene locus_tag LOCUS_05850 gene efp 46603 45950 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258741.1 protein_id gnl|my_center|LOCUS_05850 47148 46579 gene locus_tag LOCUS_05860 47148 46579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 48320 47139 gene locus_tag LOCUS_05870 gene deoB 48320 47139 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230444.1 protein_id gnl|my_center|LOCUS_05870 48880 48347 gene locus_tag LOCUS_05880 48880 48347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 50146 48941 gene locus_tag LOCUS_05890 50146 48941 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706898.1 protein_id gnl|my_center|LOCUS_05890 50187 51146 gene locus_tag LOCUS_05900 50187 51146 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096126.1 protein_id gnl|my_center|LOCUS_05900 51624 51139 gene locus_tag LOCUS_05910 51624 51139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 51722 52270 gene locus_tag LOCUS_05920 51722 52270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 52296 53228 gene locus_tag LOCUS_05930 52296 53228 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393022.1 protein_id gnl|my_center|LOCUS_05930 53418 54440 gene locus_tag LOCUS_05940 53418 54440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 54437 55828 gene locus_tag LOCUS_05950 54437 55828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332558.1 protein_id gnl|my_center|LOCUS_05950 56220 55810 gene locus_tag LOCUS_05960 56220 55810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 56488 57201 gene locus_tag LOCUS_05970 56488 57201 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420966.1 protein_id gnl|my_center|LOCUS_05970 57955 57251 gene locus_tag LOCUS_05980 57955 57251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 61533 57967 gene locus_tag LOCUS_05990 61533 57967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 62806 61781 gene locus_tag LOCUS_06000 62806 61781 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259146.1 protein_id gnl|my_center|LOCUS_06000 64265 62925 gene locus_tag LOCUS_06010 gene fucP 64265 62925 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703668.1 protein_id gnl|my_center|LOCUS_06010 66206 64353 gene locus_tag LOCUS_06020 gene fucI 66206 64353 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779363.1 protein_id gnl|my_center|LOCUS_06020 66338 67216 gene locus_tag LOCUS_06030 66338 67216 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102276.1 protein_id gnl|my_center|LOCUS_06030 68051 67149 gene locus_tag LOCUS_06040 68051 67149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 68526 69890 gene locus_tag LOCUS_06050 68526 69890 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_06050 69891 70421 gene locus_tag LOCUS_06060 69891 70421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 71326 70436 gene locus_tag LOCUS_06070 71326 70436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 71608 71372 gene locus_tag LOCUS_06080 71608 71372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 71719 72459 gene locus_tag LOCUS_06090 71719 72459 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921342.1 protein_id gnl|my_center|LOCUS_06090 72473 75289 gene locus_tag LOCUS_06100 72473 75289 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202548.1 protein_id gnl|my_center|LOCUS_06100 75364 76782 gene locus_tag LOCUS_06110 gene purB 75364 76782 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 protein_id gnl|my_center|LOCUS_06110 78621 76795 gene locus_tag LOCUS_06120 78621 76795 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948830.1 protein_id gnl|my_center|LOCUS_06120 79606 78713 gene locus_tag LOCUS_06130 79606 78713 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_06130 80086 79619 gene locus_tag LOCUS_06140 80086 79619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 81670 80111 gene locus_tag LOCUS_06150 81670 80111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 82671 82072 gene locus_tag LOCUS_06160 gene rpoE 82671 82072 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309371.1 protein_id gnl|my_center|LOCUS_06160 83169 82768 gene locus_tag LOCUS_06170 83169 82768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 84257 83376 gene locus_tag LOCUS_06180 84257 83376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 84703 84254 gene locus_tag LOCUS_06190 84703 84254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 84746 84931 gene locus_tag LOCUS_06200 84746 84931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 85453 85992 gene locus_tag LOCUS_06210 85453 85992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 86015 87634 gene locus_tag LOCUS_06220 86015 87634 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326169.1 protein_id gnl|my_center|LOCUS_06220 89725 87650 gene locus_tag LOCUS_06230 89725 87650 CDS product DUF5722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061473288.1 protein_id gnl|my_center|LOCUS_06230 92478 89722 gene locus_tag LOCUS_06240 92478 89722 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671005.1 protein_id gnl|my_center|LOCUS_06240 94040 92580 gene locus_tag LOCUS_06250 94040 92580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 95456 94065 gene locus_tag LOCUS_06260 95456 94065 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921299.1 protein_id gnl|my_center|LOCUS_06260 95563 96456 gene locus_tag LOCUS_06270 gene mtnP 95563 96456 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_06270 96515 97369 gene locus_tag LOCUS_06280 96515 97369 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_06280 98212 97370 gene locus_tag LOCUS_06290 98212 97370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226805.1 protein_id gnl|my_center|LOCUS_06290 98383 99144 gene locus_tag LOCUS_06300 98383 99144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 99270 99346 gene locus_tag LOCUS_t00050 99270 99346 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 99561 100796 gene locus_tag LOCUS_06310 99561 100796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 101928 100756 gene locus_tag LOCUS_06320 101928 100756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 102286 101972 gene locus_tag LOCUS_06330 102286 101972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 102425 103255 gene locus_tag LOCUS_06340 102425 103255 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921869.1 protein_id gnl|my_center|LOCUS_06340 104128 103769 gene locus_tag LOCUS_06350 104128 103769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 104416 107124 gene locus_tag LOCUS_06360 104416 107124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 107121 107780 gene locus_tag LOCUS_06370 107121 107780 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226658.1 protein_id gnl|my_center|LOCUS_06370 108173 110833 gene locus_tag LOCUS_06380 108173 110833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 110845 111498 gene locus_tag LOCUS_06390 110845 111498 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_06390 111704 118432 gene locus_tag LOCUS_06400 111704 118432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 118721 121702 gene locus_tag LOCUS_06410 118721 121702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 121761 124367 gene locus_tag LOCUS_06420 121761 124367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 124893 126338 gene locus_tag LOCUS_06430 124893 126338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 126440 129214 gene locus_tag LOCUS_06440 126440 129214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 129211 129954 gene locus_tag LOCUS_06450 129211 129954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06450 129979 130188 gene locus_tag LOCUS_06460 129979 130188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06460 130512 136862 gene locus_tag LOCUS_06470 130512 136862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 136859 143191 gene locus_tag LOCUS_06480 136859 143191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 143223 144626 gene locus_tag LOCUS_06490 143223 144626 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769537.1 protein_id gnl|my_center|LOCUS_06490 144640 146919 gene locus_tag LOCUS_06500 144640 146919 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230224.1 protein_id gnl|my_center|LOCUS_06500 146916 148748 gene locus_tag LOCUS_06510 146916 148748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 148763 150574 gene locus_tag LOCUS_06520 148763 150574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 150580 152319 gene locus_tag LOCUS_06530 150580 152319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 152408 155365 gene locus_tag LOCUS_06540 152408 155365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 155362 157782 gene locus_tag LOCUS_06550 155362 157782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 157861 159294 gene locus_tag LOCUS_06560 157861 159294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 159309 160409 gene locus_tag LOCUS_06570 159309 160409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 160458 162734 gene locus_tag LOCUS_06580 160458 162734 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_06580 163111 163839 gene locus_tag LOCUS_06590 163111 163839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 164092 167385 gene locus_tag LOCUS_06600 164092 167385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 167550 171392 gene locus_tag LOCUS_06610 167550 171392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 171933 173546 gene locus_tag LOCUS_06620 171933 173546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 173661 174878 gene locus_tag LOCUS_06630 173661 174878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 174981 175853 gene locus_tag LOCUS_06640 174981 175853 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819176.1 protein_id gnl|my_center|LOCUS_06640 175850 177643 gene locus_tag LOCUS_06650 175850 177643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 177710 178879 gene locus_tag LOCUS_06660 177710 178879 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922679.1 protein_id gnl|my_center|LOCUS_06660 179894 178899 gene locus_tag LOCUS_06670 179894 178899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 180245 179940 gene locus_tag LOCUS_06680 180245 179940 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391577.1 protein_id gnl|my_center|LOCUS_06680 181907 180315 gene locus_tag LOCUS_06690 181907 180315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 181906 183420 gene locus_tag LOCUS_06700 181906 183420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 183712 183335 gene locus_tag LOCUS_06710 183712 183335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 183772 184635 gene locus_tag LOCUS_06720 183772 184635 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977279.1 protein_id gnl|my_center|LOCUS_06720 184708 185751 gene locus_tag LOCUS_06730 184708 185751 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_06730 185863 187629 gene locus_tag LOCUS_06740 gene ptsP 185863 187629 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152804487.1 protein_id gnl|my_center|LOCUS_06740 188938 187682 gene locus_tag LOCUS_06750 188938 187682 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344468.1 protein_id gnl|my_center|LOCUS_06750 189055 189426 gene locus_tag LOCUS_06760 189055 189426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 189852 190487 gene locus_tag LOCUS_06770 189852 190487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 191109 191336 gene locus_tag LOCUS_06780 191109 191336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 191499 199067 gene locus_tag LOCUS_06790 191499 199067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 199067 199459 gene locus_tag LOCUS_06800 199067 199459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 199927 201954 gene locus_tag LOCUS_06810 199927 201954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 201965 202429 gene locus_tag LOCUS_06820 201965 202429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 203135 204667 gene locus_tag LOCUS_06830 203135 204667 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706263.1 protein_id gnl|my_center|LOCUS_06830 204739 207873 gene locus_tag LOCUS_06840 204739 207873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 207973 209394 gene locus_tag LOCUS_06850 207973 209394 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583129.1 protein_id gnl|my_center|LOCUS_06850 210252 209410 gene locus_tag LOCUS_06860 gene gluQRS 210252 209410 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391481.1 protein_id gnl|my_center|LOCUS_06860 210359 210889 gene locus_tag LOCUS_06870 210359 210889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 211036 213117 gene locus_tag LOCUS_06880 211036 213117 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403904.1 protein_id gnl|my_center|LOCUS_06880 213261 214970 gene locus_tag LOCUS_06890 213261 214970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 215020 215610 gene locus_tag LOCUS_06900 215020 215610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 216449 215709 gene locus_tag LOCUS_06910 216449 215709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 >Feature sequence05 1664 339 gene locus_tag LOCUS_06920 1664 339 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922453.1 protein_id gnl|my_center|LOCUS_06920 2567 1830 gene locus_tag LOCUS_06930 2567 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 3918 2569 gene locus_tag LOCUS_06940 3918 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 4525 3923 gene locus_tag LOCUS_06950 4525 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 5826 4522 gene locus_tag LOCUS_06960 5826 4522 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921850.1 protein_id gnl|my_center|LOCUS_06960 7338 5977 gene locus_tag LOCUS_06970 7338 5977 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_06970 7913 7416 gene locus_tag LOCUS_06980 7913 7416 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_06980 8001 9113 gene locus_tag LOCUS_06990 gene rsgA 8001 9113 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143435.1 protein_id gnl|my_center|LOCUS_06990 9656 9441 gene locus_tag LOCUS_07000 9656 9441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 9888 16820 gene locus_tag LOCUS_07010 9888 16820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 16869 18854 gene locus_tag LOCUS_07020 16869 18854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 21120 18919 gene locus_tag LOCUS_07030 gene recQ 21120 18919 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929065.1 protein_id gnl|my_center|LOCUS_07030 21703 21173 gene locus_tag LOCUS_07040 21703 21173 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043551827.1 protein_id gnl|my_center|LOCUS_07040 22252 21773 gene locus_tag LOCUS_07050 22252 21773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 22845 22381 gene locus_tag LOCUS_07060 gene ispF 22845 22381 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583827.1 protein_id gnl|my_center|LOCUS_07060 23682 22933 gene locus_tag LOCUS_07070 23682 22933 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_07070 24427 23783 gene locus_tag LOCUS_07080 24427 23783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 30932 24534 gene locus_tag LOCUS_07090 30932 24534 CDS product autotransporter-associated beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126622031.1 protein_id gnl|my_center|LOCUS_07090 31053 31217 gene locus_tag LOCUS_07100 31053 31217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 36772 31322 gene locus_tag LOCUS_07110 36772 31322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 37117 38226 gene locus_tag LOCUS_07120 37117 38226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 39918 38311 gene locus_tag LOCUS_07130 gene lidL 39918 38311 CDS product Dot/Icm type IV secretion system effector LidL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946906.1 protein_id gnl|my_center|LOCUS_07130 41121 39961 gene locus_tag LOCUS_07140 41121 39961 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110716881.1 protein_id gnl|my_center|LOCUS_07140 41187 41705 gene locus_tag LOCUS_07150 41187 41705 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439149.1 protein_id gnl|my_center|LOCUS_07150 43248 41713 gene locus_tag LOCUS_07160 43248 41713 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767764.1 protein_id gnl|my_center|LOCUS_07160 45490 43337 gene locus_tag LOCUS_07170 45490 43337 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230224.1 protein_id gnl|my_center|LOCUS_07170 45742 47190 gene locus_tag LOCUS_07180 gene mpl 45742 47190 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933145.1 protein_id gnl|my_center|LOCUS_07180 47265 48101 gene locus_tag LOCUS_07190 47265 48101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 48666 48196 gene locus_tag LOCUS_07200 48666 48196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 49064 48663 gene locus_tag LOCUS_07210 49064 48663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 50316 49069 gene locus_tag LOCUS_07220 gene fabF 50316 49069 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_07220 50634 50395 gene locus_tag LOCUS_07230 50634 50395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 51388 50615 gene locus_tag LOCUS_07240 51388 50615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 51858 51406 gene locus_tag LOCUS_07250 51858 51406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 52565 51855 gene locus_tag LOCUS_07260 52565 51855 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_07260 52596 53549 gene locus_tag LOCUS_07270 52596 53549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 54286 53507 gene locus_tag LOCUS_07280 54286 53507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 54379 55398 gene locus_tag LOCUS_07290 54379 55398 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893529.1 protein_id gnl|my_center|LOCUS_07290 55465 55956 gene locus_tag LOCUS_07300 gene nrdR 55465 55956 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223586.1 protein_id gnl|my_center|LOCUS_07300 56023 56595 gene locus_tag LOCUS_07310 56023 56595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 56647 58656 gene locus_tag LOCUS_07320 56647 58656 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_07320 59716 58670 gene locus_tag LOCUS_07330 59716 58670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 59795 60097 gene locus_tag LOCUS_07340 59795 60097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 63640 60512 gene locus_tag LOCUS_07350 63640 60512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 63881 64402 gene locus_tag LOCUS_07360 63881 64402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 64481 64870 gene locus_tag LOCUS_07370 64481 64870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974119.1 protein_id gnl|my_center|LOCUS_07370 64904 65362 gene locus_tag LOCUS_07380 64904 65362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 65359 66360 gene locus_tag LOCUS_07390 65359 66360 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226301.1 protein_id gnl|my_center|LOCUS_07390 66601 67245 gene locus_tag LOCUS_07400 66601 67245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 68240 67263 gene locus_tag LOCUS_07410 68240 67263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 70907 68439 gene locus_tag LOCUS_07420 70907 68439 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_07420 71549 70995 gene locus_tag LOCUS_07430 71549 70995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 72687 71605 gene locus_tag LOCUS_07440 72687 71605 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_07440 72798 73121 gene locus_tag LOCUS_07450 72798 73121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 73118 73996 gene locus_tag LOCUS_07460 gene rfbD 73118 73996 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266715.1 protein_id gnl|my_center|LOCUS_07460 74134 75429 gene locus_tag LOCUS_07470 74134 75429 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921850.1 protein_id gnl|my_center|LOCUS_07470 75518 77284 gene locus_tag LOCUS_07480 75518 77284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 77335 78669 gene locus_tag LOCUS_07490 77335 78669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 79580 78681 gene locus_tag LOCUS_07500 79580 78681 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 protein_id gnl|my_center|LOCUS_07500 79937 80212 gene locus_tag LOCUS_07510 79937 80212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 81247 82401 gene locus_tag LOCUS_07520 81247 82401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 82774 83448 gene locus_tag LOCUS_07530 82774 83448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 86162 83463 gene locus_tag LOCUS_07540 86162 83463 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267302.1 protein_id gnl|my_center|LOCUS_07540 86592 86197 gene locus_tag LOCUS_07550 86592 86197 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049863.1 protein_id gnl|my_center|LOCUS_07550 86759 88189 gene locus_tag LOCUS_07560 gene rseP 86759 88189 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103593.1 protein_id gnl|my_center|LOCUS_07560 89639 88230 gene locus_tag LOCUS_07570 89639 88230 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118279.1 protein_id gnl|my_center|LOCUS_07570 90422 89664 gene locus_tag LOCUS_07580 90422 89664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 92032 90587 gene locus_tag LOCUS_07590 92032 90587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 92632 92075 gene locus_tag LOCUS_07600 92632 92075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 93186 92716 gene locus_tag LOCUS_07610 93186 92716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 93278 94243 gene locus_tag LOCUS_07620 93278 94243 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143600.1 protein_id gnl|my_center|LOCUS_07620 94930 94250 gene locus_tag LOCUS_07630 94930 94250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 95357 94986 gene locus_tag LOCUS_07640 95357 94986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 95527 97452 gene locus_tag LOCUS_07650 95527 97452 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040580.1 protein_id gnl|my_center|LOCUS_07650 99534 97531 gene locus_tag LOCUS_07660 99534 97531 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107187.1 protein_id gnl|my_center|LOCUS_07660 101473 99668 gene locus_tag LOCUS_07670 101473 99668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 102070 102774 gene locus_tag LOCUS_07680 102070 102774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 109034 102819 gene locus_tag LOCUS_07690 109034 102819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 109276 110121 gene locus_tag LOCUS_07700 109276 110121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 111708 110137 gene locus_tag LOCUS_07710 111708 110137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 113999 112008 gene locus_tag LOCUS_07720 113999 112008 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202540.1 protein_id gnl|my_center|LOCUS_07720 115001 114183 gene locus_tag LOCUS_07730 115001 114183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 116188 115091 gene locus_tag LOCUS_07740 gene dprA 116188 115091 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922340.1 protein_id gnl|my_center|LOCUS_07740 116680 116249 gene locus_tag LOCUS_07750 116680 116249 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388845.1 protein_id gnl|my_center|LOCUS_07750 117031 116843 gene locus_tag LOCUS_07760 117031 116843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 118575 117028 gene locus_tag LOCUS_07770 118575 117028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 120170 118770 gene locus_tag LOCUS_07780 120170 118770 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_07780 121597 120167 gene locus_tag LOCUS_07790 121597 120167 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921988.1 protein_id gnl|my_center|LOCUS_07790 122250 121594 gene locus_tag LOCUS_07800 122250 121594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 122299 122553 gene locus_tag LOCUS_07810 122299 122553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 123086 122556 gene locus_tag LOCUS_07820 123086 122556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 123418 124101 gene locus_tag LOCUS_07830 123418 124101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 125009 124107 gene locus_tag LOCUS_07840 125009 124107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 124939 125178 gene locus_tag LOCUS_07850 124939 125178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 125816 125259 gene locus_tag LOCUS_07860 gene def 125816 125259 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_07860 125924 127186 gene locus_tag LOCUS_07870 125924 127186 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257936.1 protein_id gnl|my_center|LOCUS_07870 127339 127415 gene locus_tag LOCUS_t00060 127339 127415 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 127668 129530 gene locus_tag LOCUS_07880 127668 129530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 129583 135315 gene locus_tag LOCUS_07890 gene uvrA 129583 135315 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814283.1 protein_id gnl|my_center|LOCUS_07890 136649 135324 gene locus_tag LOCUS_07900 136649 135324 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384203.1 protein_id gnl|my_center|LOCUS_07900 138215 136695 gene locus_tag LOCUS_07910 138215 136695 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196631.1 protein_id gnl|my_center|LOCUS_07910 138315 139394 gene locus_tag LOCUS_07920 gene mnmA 138315 139394 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268273.1 protein_id gnl|my_center|LOCUS_07920 139566 139892 gene locus_tag LOCUS_07930 139566 139892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 139905 140816 gene locus_tag LOCUS_07940 139905 140816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 140826 141788 gene locus_tag LOCUS_07950 140826 141788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 142796 141807 gene locus_tag LOCUS_07960 142796 141807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 143194 142865 gene locus_tag LOCUS_07970 143194 142865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 143389 144723 gene locus_tag LOCUS_07980 143389 144723 CDS product capsular biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522170.1 protein_id gnl|my_center|LOCUS_07980 144753 146303 gene locus_tag LOCUS_07990 gene xylB 144753 146303 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013398.1 protein_id gnl|my_center|LOCUS_07990 146349 147455 gene locus_tag LOCUS_08000 gene hisC 146349 147455 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_08000 147528 149252 gene locus_tag LOCUS_08010 147528 149252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 149261 150619 gene locus_tag LOCUS_08020 gene mnmE 149261 150619 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880529.1 protein_id gnl|my_center|LOCUS_08020 150762 151367 gene locus_tag LOCUS_08030 150762 151367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265691.1 protein_id gnl|my_center|LOCUS_08030 151722 151501 gene locus_tag LOCUS_08040 151722 151501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 151890 152351 gene locus_tag LOCUS_08050 151890 152351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 152430 153302 gene locus_tag LOCUS_08060 152430 153302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 153320 154672 gene locus_tag LOCUS_08070 gene aroA 153320 154672 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943243.1 protein_id gnl|my_center|LOCUS_08070 154669 155328 gene locus_tag LOCUS_08080 gene cmk 154669 155328 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027958.1 protein_id gnl|my_center|LOCUS_08080 156820 155333 gene locus_tag LOCUS_08090 156820 155333 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022102.1 protein_id gnl|my_center|LOCUS_08090 157444 156947 gene locus_tag LOCUS_08100 157444 156947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 158633 157437 gene locus_tag LOCUS_08110 158633 157437 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065470411.1 protein_id gnl|my_center|LOCUS_08110 159630 158665 gene locus_tag LOCUS_08120 159630 158665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 160764 160402 gene locus_tag LOCUS_08130 160764 160402 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_08130 161257 160835 gene locus_tag LOCUS_08140 161257 160835 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 protein_id gnl|my_center|LOCUS_08140 161517 161254 gene locus_tag LOCUS_08150 161517 161254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 164497 161708 gene locus_tag LOCUS_08160 164497 161708 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022108.1 protein_id gnl|my_center|LOCUS_08160 165489 164674 gene locus_tag LOCUS_08170 gene menB 165489 164674 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927101.1 protein_id gnl|my_center|LOCUS_08170 166359 165571 gene locus_tag LOCUS_08180 166359 165571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 167267 166368 gene locus_tag LOCUS_08190 167267 166368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 168043 167351 gene locus_tag LOCUS_08200 168043 167351 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216122.1 protein_id gnl|my_center|LOCUS_08200 169152 168040 gene locus_tag LOCUS_08210 169152 168040 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876334.1 protein_id gnl|my_center|LOCUS_08210 171741 169312 gene locus_tag LOCUS_08220 171741 169312 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942207.1 protein_id gnl|my_center|LOCUS_08220 171827 172939 gene locus_tag LOCUS_08230 171827 172939 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056272.1 protein_id gnl|my_center|LOCUS_08230 172991 173073 gene locus_tag LOCUS_t00070 172991 173073 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 173337 175664 gene locus_tag LOCUS_08240 173337 175664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 177153 175666 gene locus_tag LOCUS_08250 177153 175666 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_08250 177339 178145 gene locus_tag LOCUS_08260 177339 178145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 178318 179340 gene locus_tag LOCUS_08270 gene gpsA 178318 179340 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070467.1 protein_id gnl|my_center|LOCUS_08270 179380 179781 gene locus_tag LOCUS_08280 gene tagD 179380 179781 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227921.1 protein_id gnl|my_center|LOCUS_08280 179782 181155 gene locus_tag LOCUS_08290 179782 181155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 181247 185800 gene locus_tag LOCUS_08300 181247 185800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 185816 188689 gene locus_tag LOCUS_08310 185816 188689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 188700 189569 gene locus_tag LOCUS_08320 188700 189569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 190687 189560 gene locus_tag LOCUS_08330 190687 189560 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862709.1 protein_id gnl|my_center|LOCUS_08330 191876 190743 gene locus_tag LOCUS_08340 191876 190743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 192703 191888 gene locus_tag LOCUS_08350 192703 191888 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590233.1 protein_id gnl|my_center|LOCUS_08350 193514 192723 gene locus_tag LOCUS_08360 193514 192723 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930466.1 protein_id gnl|my_center|LOCUS_08360 194681 193614 gene locus_tag LOCUS_08370 194681 193614 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261018.1 protein_id gnl|my_center|LOCUS_08370 194859 196907 gene locus_tag LOCUS_08380 194859 196907 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224756.1 protein_id gnl|my_center|LOCUS_08380 198113 196923 gene locus_tag LOCUS_08390 198113 196923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 198781 198110 gene locus_tag LOCUS_08400 198781 198110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 198907 201543 gene locus_tag LOCUS_08410 198907 201543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 201583 202332 gene locus_tag LOCUS_08420 201583 202332 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_08420 203067 202345 gene locus_tag LOCUS_08430 203067 202345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 204371 203142 gene locus_tag LOCUS_08440 204371 203142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 204568 205749 gene locus_tag LOCUS_08450 204568 205749 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920725.1 protein_id gnl|my_center|LOCUS_08450 206659 205757 gene locus_tag LOCUS_08460 gene thiL 206659 205757 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392671.1 protein_id gnl|my_center|LOCUS_08460 207576 206656 gene locus_tag LOCUS_08470 207576 206656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 207886 209076 gene locus_tag LOCUS_08480 207886 209076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 209472 209089 gene locus_tag LOCUS_08490 209472 209089 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015129.1 protein_id gnl|my_center|LOCUS_08490 209579 210796 gene locus_tag LOCUS_08500 209579 210796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 210803 211627 gene locus_tag LOCUS_08510 gene hpnD 210803 211627 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_08510 211669 212103 gene locus_tag LOCUS_08520 211669 212103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 212252 212674 gene locus_tag LOCUS_08530 212252 212674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 214097 213096 gene locus_tag LOCUS_08540 214097 213096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 215095 214439 gene locus_tag LOCUS_08550 215095 214439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 216125 215112 gene locus_tag LOCUS_08560 216125 215112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 >Feature sequence06 17007 5200 gene locus_tag LOCUS_08570 17007 5200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 18137 17019 gene locus_tag LOCUS_08580 18137 17019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 19342 18251 gene locus_tag LOCUS_08590 19342 18251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 20568 19393 gene locus_tag LOCUS_08600 20568 19393 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931819.1 protein_id gnl|my_center|LOCUS_08600 21437 20565 gene locus_tag LOCUS_08610 21437 20565 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480221.1 protein_id gnl|my_center|LOCUS_08610 21622 22110 gene locus_tag LOCUS_08620 21622 22110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 24192 22192 gene locus_tag LOCUS_08630 24192 22192 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028675.1 protein_id gnl|my_center|LOCUS_08630 24369 26351 gene locus_tag LOCUS_08640 24369 26351 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091514757.1 protein_id gnl|my_center|LOCUS_08640 27306 26851 gene locus_tag LOCUS_08650 27306 26851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 28301 27750 gene locus_tag LOCUS_08660 28301 27750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118772.1 protein_id gnl|my_center|LOCUS_08660 29576 29112 gene locus_tag LOCUS_08670 29576 29112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 30801 29728 gene locus_tag LOCUS_08680 30801 29728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 31616 30915 gene locus_tag LOCUS_08690 31616 30915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 31995 32339 gene locus_tag LOCUS_08700 31995 32339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 32511 32759 gene locus_tag LOCUS_08710 32511 32759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 34493 32793 gene locus_tag LOCUS_08720 34493 32793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109095.1 protein_id gnl|my_center|LOCUS_08720 37659 34498 gene locus_tag LOCUS_08730 37659 34498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 39016 37700 gene locus_tag LOCUS_08740 39016 37700 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798159.1 protein_id gnl|my_center|LOCUS_08740 40107 39013 gene locus_tag LOCUS_08750 40107 39013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 42290 40104 gene locus_tag LOCUS_08760 42290 40104 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_08760 44650 42299 gene locus_tag LOCUS_08770 44650 42299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 46203 44647 gene locus_tag LOCUS_08780 46203 44647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 48288 46387 gene locus_tag LOCUS_08790 48288 46387 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222851.1 protein_id gnl|my_center|LOCUS_08790 48601 52569 gene locus_tag LOCUS_08800 48601 52569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 53723 52650 gene locus_tag LOCUS_08810 gene prfA 53723 52650 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940174.1 protein_id gnl|my_center|LOCUS_08810 53884 55245 gene locus_tag LOCUS_08820 53884 55245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 57144 55270 gene locus_tag LOCUS_08830 gene thrS 57144 55270 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228977.1 protein_id gnl|my_center|LOCUS_08830 57249 58412 gene locus_tag LOCUS_08840 57249 58412 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528103.1 protein_id gnl|my_center|LOCUS_08840 60864 58396 gene locus_tag LOCUS_08850 60864 58396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 61954 60965 gene locus_tag LOCUS_08860 61954 60965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 65092 62078 gene locus_tag LOCUS_08870 65092 62078 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055064929.1 protein_id gnl|my_center|LOCUS_08870 65720 65199 gene locus_tag LOCUS_08880 65720 65199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 66884 65724 gene locus_tag LOCUS_08890 66884 65724 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140271.1 protein_id gnl|my_center|LOCUS_08890 66826 67194 gene locus_tag LOCUS_08900 66826 67194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 67213 67386 gene locus_tag LOCUS_08910 67213 67386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552967.1 protein_id gnl|my_center|LOCUS_08910 67742 67599 gene locus_tag LOCUS_08920 67742 67599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 69359 67761 gene locus_tag LOCUS_08930 69359 67761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 70070 69615 gene locus_tag LOCUS_08940 gene tnpA 70070 69615 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_08940 72541 70208 gene locus_tag LOCUS_08950 72541 70208 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350101.1 protein_id gnl|my_center|LOCUS_08950 75580 72671 gene locus_tag LOCUS_08960 75580 72671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 76415 75621 gene locus_tag LOCUS_08970 76415 75621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 77809 76412 gene locus_tag LOCUS_08980 gene der 77809 76412 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426959.1 protein_id gnl|my_center|LOCUS_08980 77966 77890 gene locus_tag LOCUS_t00080 77966 77890 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 78977 78051 gene locus_tag LOCUS_08990 gene fabD 78977 78051 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_08990 79109 79684 gene locus_tag LOCUS_09000 79109 79684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 81229 79757 gene locus_tag LOCUS_09010 81229 79757 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_09010 81403 81774 gene locus_tag LOCUS_09020 81403 81774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 81845 82372 gene locus_tag LOCUS_09030 81845 82372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 82359 82844 gene locus_tag LOCUS_09040 82359 82844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 82846 83610 gene locus_tag LOCUS_09050 82846 83610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 83683 85521 gene locus_tag LOCUS_09060 83683 85521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 85685 86983 gene locus_tag LOCUS_09070 gene eno 85685 86983 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985288.1 protein_id gnl|my_center|LOCUS_09070 87172 88347 gene locus_tag LOCUS_09080 87172 88347 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_09080 88344 89126 gene locus_tag LOCUS_09090 88344 89126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 89197 90798 gene locus_tag LOCUS_09100 89197 90798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 92297 90990 gene locus_tag LOCUS_09110 92297 90990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 93251 92340 gene locus_tag LOCUS_09120 93251 92340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 93759 93244 gene locus_tag LOCUS_09130 gene ribH 93759 93244 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249384.1 protein_id gnl|my_center|LOCUS_09130 94185 94964 gene locus_tag LOCUS_09140 94185 94964 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123273.1 protein_id gnl|my_center|LOCUS_09140 96503 94971 gene locus_tag LOCUS_09150 96503 94971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 96616 97980 gene locus_tag LOCUS_09160 96616 97980 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_09160 98818 97988 gene locus_tag LOCUS_09170 98818 97988 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222792.1 protein_id gnl|my_center|LOCUS_09170 99395 100852 gene locus_tag LOCUS_09180 99395 100852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 100855 102594 gene locus_tag LOCUS_09190 100855 102594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 102647 103801 gene locus_tag LOCUS_09200 102647 103801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 104313 103810 gene locus_tag LOCUS_09210 104313 103810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 105876 104392 gene locus_tag LOCUS_09220 105876 104392 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403981.1 protein_id gnl|my_center|LOCUS_09220 106833 105922 gene locus_tag LOCUS_09230 gene deoC 106833 105922 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 protein_id gnl|my_center|LOCUS_09230 106997 107368 gene locus_tag LOCUS_09240 gene mscL 106997 107368 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889048.1 protein_id gnl|my_center|LOCUS_09240 107532 107879 gene locus_tag LOCUS_09250 107532 107879 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384997.1 protein_id gnl|my_center|LOCUS_09250 109440 107944 gene locus_tag LOCUS_09260 109440 107944 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142234.1 protein_id gnl|my_center|LOCUS_09260 110088 109486 gene locus_tag LOCUS_09270 110088 109486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 111055 110183 gene locus_tag LOCUS_09280 111055 110183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 114437 111108 gene locus_tag LOCUS_09290 114437 111108 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616068.1 protein_id gnl|my_center|LOCUS_09290 115315 114446 gene locus_tag LOCUS_09300 115315 114446 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259049.1 protein_id gnl|my_center|LOCUS_09300 117781 115334 gene locus_tag LOCUS_09310 117781 115334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 119730 117787 gene locus_tag LOCUS_09320 119730 117787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 120756 119740 gene locus_tag LOCUS_09330 120756 119740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 121262 120753 gene locus_tag LOCUS_09340 121262 120753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 122163 121270 gene locus_tag LOCUS_09350 122163 121270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 123179 122202 gene locus_tag LOCUS_09360 123179 122202 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330234.1 protein_id gnl|my_center|LOCUS_09360 123831 123280 gene locus_tag LOCUS_09370 gene coaC 123831 123280 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922347.1 protein_id gnl|my_center|LOCUS_09370 125263 123848 gene locus_tag LOCUS_09380 125263 123848 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964478.1 protein_id gnl|my_center|LOCUS_09380 125189 126616 gene locus_tag LOCUS_09390 125189 126616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 126636 127487 gene locus_tag LOCUS_09400 126636 127487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 127539 128792 gene locus_tag LOCUS_09410 127539 128792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 129927 128803 gene locus_tag LOCUS_09420 gene rlmN 129927 128803 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450540.1 protein_id gnl|my_center|LOCUS_09420 131504 129924 gene locus_tag LOCUS_09430 131504 129924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 131616 132239 gene locus_tag LOCUS_09440 131616 132239 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339235.1 protein_id gnl|my_center|LOCUS_09440 135512 132330 gene locus_tag LOCUS_09450 gene secA 135512 132330 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932908.1 protein_id gnl|my_center|LOCUS_09450 136425 135637 gene locus_tag LOCUS_09460 136425 135637 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332279.1 protein_id gnl|my_center|LOCUS_09460 137145 136486 gene locus_tag LOCUS_09470 137145 136486 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038464.1 protein_id gnl|my_center|LOCUS_09470 137924 137142 gene locus_tag LOCUS_09480 137924 137142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 138822 137968 gene locus_tag LOCUS_09490 138822 137968 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074021.1 protein_id gnl|my_center|LOCUS_09490 138948 139709 gene locus_tag LOCUS_09500 138948 139709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 139743 141272 gene locus_tag LOCUS_09510 139743 141272 CDS product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457220.1 protein_id gnl|my_center|LOCUS_09510 141313 142257 gene locus_tag LOCUS_09520 141313 142257 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705412.1 protein_id gnl|my_center|LOCUS_09520 142254 143156 gene locus_tag LOCUS_09530 142254 143156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 144014 143157 gene locus_tag LOCUS_09540 144014 143157 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937909.1 protein_id gnl|my_center|LOCUS_09540 144131 145327 gene locus_tag LOCUS_09550 gene metK 144131 145327 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053346.1 protein_id gnl|my_center|LOCUS_09550 145433 146845 gene locus_tag LOCUS_09560 gene ahcY 145433 146845 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035988.1 protein_id gnl|my_center|LOCUS_09560 146947 147390 gene locus_tag LOCUS_09570 146947 147390 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095512524.1 protein_id gnl|my_center|LOCUS_09570 147394 147864 gene locus_tag LOCUS_09580 147394 147864 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266690.1 protein_id gnl|my_center|LOCUS_09580 148318 147848 gene locus_tag LOCUS_09590 148318 147848 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161960933.1 protein_id gnl|my_center|LOCUS_09590 149328 148318 gene locus_tag LOCUS_09600 gene lipA 149328 148318 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166373.1 protein_id gnl|my_center|LOCUS_09600 149774 149454 gene locus_tag LOCUS_09610 149774 149454 CDS product high-potential iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197194.1 protein_id gnl|my_center|LOCUS_09610 149988 150797 gene locus_tag LOCUS_09620 gene murI 149988 150797 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_09620 151081 152352 gene locus_tag LOCUS_09630 gene glmM 151081 152352 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_09630 152363 153199 gene locus_tag LOCUS_09640 152363 153199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 153233 155074 gene locus_tag LOCUS_09650 gene glmS 153233 155074 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931824.1 protein_id gnl|my_center|LOCUS_09650 155662 155087 gene locus_tag LOCUS_09660 155662 155087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 155775 158372 gene locus_tag LOCUS_09670 155775 158372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 158836 158384 gene locus_tag LOCUS_09680 158836 158384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 160842 158866 gene locus_tag LOCUS_09690 160842 158866 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_09690 161605 160889 gene locus_tag LOCUS_09700 161605 160889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345920.1 protein_id gnl|my_center|LOCUS_09700 161825 163261 gene locus_tag LOCUS_09710 161825 163261 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257880.1 protein_id gnl|my_center|LOCUS_09710 163271 164311 gene locus_tag LOCUS_09720 163271 164311 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_09720 164308 165180 gene locus_tag LOCUS_09730 164308 165180 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888626.1 protein_id gnl|my_center|LOCUS_09730 165655 165185 gene locus_tag LOCUS_09740 165655 165185 CDS product YidB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369693.1 protein_id gnl|my_center|LOCUS_09740 166076 165744 gene locus_tag LOCUS_09750 166076 165744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 166181 167665 gene locus_tag LOCUS_09760 166181 167665 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121409.1 protein_id gnl|my_center|LOCUS_09760 167998 171930 gene locus_tag LOCUS_09770 167998 171930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 173008 171944 gene locus_tag LOCUS_09780 173008 171944 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943872.1 protein_id gnl|my_center|LOCUS_09780 173903 173022 gene locus_tag LOCUS_09790 gene dapA 173903 173022 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880718.1 protein_id gnl|my_center|LOCUS_09790 174886 174059 gene locus_tag LOCUS_09800 gene dapF 174886 174059 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927135.1 protein_id gnl|my_center|LOCUS_09800 175253 175870 gene locus_tag LOCUS_09810 175253 175870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 175979 176869 gene locus_tag LOCUS_09820 175979 176869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 177446 176871 gene locus_tag LOCUS_09830 177446 176871 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739343.1 protein_id gnl|my_center|LOCUS_09830 177766 178239 gene locus_tag LOCUS_09840 gene rplI 177766 178239 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_09840 178987 178331 gene locus_tag LOCUS_09850 178987 178331 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244073.1 protein_id gnl|my_center|LOCUS_09850 180993 178984 gene locus_tag LOCUS_09860 180993 178984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 182092 181094 gene locus_tag LOCUS_09870 182092 181094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 182644 182186 gene locus_tag LOCUS_09880 182644 182186 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_09880 183176 182553 gene locus_tag LOCUS_09890 183176 182553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 183743 183180 gene locus_tag LOCUS_09900 183743 183180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 185442 183856 gene locus_tag LOCUS_09910 185442 183856 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121702.1 protein_id gnl|my_center|LOCUS_09910 185528 186895 gene locus_tag LOCUS_09920 185528 186895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 187311 186892 gene locus_tag LOCUS_09930 187311 186892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 187419 188402 gene locus_tag LOCUS_09940 187419 188402 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937445.1 protein_id gnl|my_center|LOCUS_09940 188474 188941 gene locus_tag LOCUS_09950 188474 188941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 189374 190069 gene locus_tag LOCUS_09960 gene psrA 189374 190069 CDS product transcriptional regulator PsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091195.1 protein_id gnl|my_center|LOCUS_09960 190174 190638 gene locus_tag LOCUS_09970 190174 190638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 191675 190653 gene locus_tag LOCUS_09980 191675 190653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 192676 191672 gene locus_tag LOCUS_09990 gene fabF 192676 191672 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227920.1 protein_id gnl|my_center|LOCUS_09990 192567 192941 gene locus_tag LOCUS_10000 192567 192941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 192968 194149 gene locus_tag LOCUS_10010 192968 194149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 194166 195206 gene locus_tag LOCUS_10020 gene dinB 194166 195206 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086018.1 protein_id gnl|my_center|LOCUS_10020 196237 195284 gene locus_tag LOCUS_10030 196237 195284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 199929 196450 gene locus_tag LOCUS_10040 199929 196450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037251825.1 protein_id gnl|my_center|LOCUS_10040 201261 200023 gene locus_tag LOCUS_10050 201261 200023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 202270 201593 gene locus_tag LOCUS_10060 202270 201593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 202450 203280 gene locus_tag LOCUS_10070 202450 203280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 205098 203287 gene locus_tag LOCUS_10080 gene sppA 205098 203287 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_10080 205638 205281 gene locus_tag LOCUS_tm00010 205638 205281 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 206344 205679 gene locus_tag LOCUS_10090 gene can 206344 205679 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 protein_id gnl|my_center|LOCUS_10090 207091 206420 gene locus_tag LOCUS_10100 207091 206420 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125221.1 protein_id gnl|my_center|LOCUS_10100 207448 207101 gene locus_tag LOCUS_10110 207448 207101 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_10110 <210721 207560 gene locus_tag LOCUS_10120 <210721 207560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921441.1:cadherin domain-containing protein >Feature sequence07 360 1277 gene locus_tag LOCUS_10130 360 1277 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658736.1 protein_id gnl|my_center|LOCUS_10130 1562 1287 gene locus_tag LOCUS_10140 1562 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 3057 1594 gene locus_tag LOCUS_10150 3057 1594 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258814.1 protein_id gnl|my_center|LOCUS_10150 5473 3113 gene locus_tag LOCUS_10160 5473 3113 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920407.1 protein_id gnl|my_center|LOCUS_10160 6764 5526 gene locus_tag LOCUS_10170 6764 5526 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037978.1 protein_id gnl|my_center|LOCUS_10170 6799 7002 gene locus_tag LOCUS_10180 6799 7002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 7145 13231 gene locus_tag LOCUS_10190 7145 13231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 13240 14796 gene locus_tag LOCUS_10200 13240 14796 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920272.1 protein_id gnl|my_center|LOCUS_10200 15111 15419 gene locus_tag LOCUS_10210 15111 15419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 16166 15408 gene locus_tag LOCUS_10220 16166 15408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 16307 17236 gene locus_tag LOCUS_10230 16307 17236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 17388 18413 gene locus_tag LOCUS_10240 17388 18413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 18483 19667 gene locus_tag LOCUS_10250 gene purT 18483 19667 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938024.1 protein_id gnl|my_center|LOCUS_10250 20863 19685 gene locus_tag LOCUS_10260 20863 19685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 21199 21930 gene locus_tag LOCUS_10270 21199 21930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 28045 22016 gene locus_tag LOCUS_10280 28045 22016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 28222 34371 gene locus_tag LOCUS_10290 28222 34371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 34434 34751 gene locus_tag LOCUS_10300 34434 34751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 34797 36329 gene locus_tag LOCUS_10310 34797 36329 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479713.1 protein_id gnl|my_center|LOCUS_10310 36382 37074 gene locus_tag LOCUS_10320 gene blrA 36382 37074 CDS product beta-lactam response regulator transcription factor BlrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707903.1 protein_id gnl|my_center|LOCUS_10320 37075 38511 gene locus_tag LOCUS_10330 gene creC 37075 38511 CDS product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113267.1 protein_id gnl|my_center|LOCUS_10330 38572 40581 gene locus_tag LOCUS_10340 38572 40581 CDS product VIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122418.1 protein_id gnl|my_center|LOCUS_10340 40594 41967 gene locus_tag LOCUS_10350 40594 41967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 41967 42380 gene locus_tag LOCUS_10360 41967 42380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 42341 43384 gene locus_tag LOCUS_10370 42341 43384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 43381 43953 gene locus_tag LOCUS_10380 43381 43953 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941350.1 protein_id gnl|my_center|LOCUS_10380 44735 43971 gene locus_tag LOCUS_10390 44735 43971 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136496851.1 protein_id gnl|my_center|LOCUS_10390 44997 44779 gene locus_tag LOCUS_10400 44997 44779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 45219 45019 gene locus_tag LOCUS_10410 45219 45019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 45622 45260 gene locus_tag LOCUS_10420 45622 45260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10420 47296 45671 gene locus_tag LOCUS_10430 47296 45671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 49249 47348 gene locus_tag LOCUS_10440 49249 47348 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_10440 50204 49428 gene locus_tag LOCUS_10450 50204 49428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 50938 50234 gene locus_tag LOCUS_10460 50938 50234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 52471 50978 gene locus_tag LOCUS_10470 52471 50978 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403101.1 protein_id gnl|my_center|LOCUS_10470 53257 52502 gene locus_tag LOCUS_10480 53257 52502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 54586 53276 gene locus_tag LOCUS_10490 54586 53276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062436.1 protein_id gnl|my_center|LOCUS_10490 55239 54592 gene locus_tag LOCUS_10500 55239 54592 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421545.1 protein_id gnl|my_center|LOCUS_10500 55835 55281 gene locus_tag LOCUS_10510 55835 55281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10510 57345 55879 gene locus_tag LOCUS_10520 gene nrfD 57345 55879 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328378.1 protein_id gnl|my_center|LOCUS_10520 60804 57388 gene locus_tag LOCUS_10530 60804 57388 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256518.1 protein_id gnl|my_center|LOCUS_10530 61551 60850 gene locus_tag LOCUS_10540 61551 60850 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404835.1 protein_id gnl|my_center|LOCUS_10540 62036 61728 gene locus_tag LOCUS_10550 62036 61728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 63051 62095 gene locus_tag LOCUS_10560 63051 62095 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140017877.1 protein_id gnl|my_center|LOCUS_10560 64934 63048 gene locus_tag LOCUS_10570 64934 63048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 66554 64992 gene locus_tag LOCUS_10580 66554 64992 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108902.1 protein_id gnl|my_center|LOCUS_10580 66734 66823 gene locus_tag LOCUS_t00090 66734 66823 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 67888 67157 gene locus_tag LOCUS_10590 67888 67157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870226.1 protein_id gnl|my_center|LOCUS_10590 69867 67888 gene locus_tag LOCUS_10600 gene pglZ 69867 67888 CDS product BREX-3 system phosphatase PglZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870227.1 protein_id gnl|my_center|LOCUS_10600 72652 69860 gene locus_tag LOCUS_10610 72652 69860 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870228.1 protein_id gnl|my_center|LOCUS_10610 73691 72642 gene locus_tag LOCUS_10620 73691 72642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 74016 73684 gene locus_tag LOCUS_10630 74016 73684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 74101 74400 gene locus_tag LOCUS_10640 74101 74400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 78438 75586 gene locus_tag LOCUS_10650 78438 75586 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280509.1 protein_id gnl|my_center|LOCUS_10650 82157 78453 gene locus_tag LOCUS_10660 82157 78453 CDS product DUF6079 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870232.1 protein_id gnl|my_center|LOCUS_10660 83820 82969 gene locus_tag LOCUS_10670 83820 82969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 85042 83957 gene locus_tag LOCUS_10680 85042 83957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 85443 86462 gene locus_tag LOCUS_10690 85443 86462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 86459 87460 gene locus_tag LOCUS_10700 86459 87460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 87465 87890 gene locus_tag LOCUS_10710 87465 87890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 87877 88080 gene locus_tag LOCUS_10720 87877 88080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 88077 89597 gene locus_tag LOCUS_10730 88077 89597 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922064.1 protein_id gnl|my_center|LOCUS_10730 89613 91631 gene locus_tag LOCUS_10740 89613 91631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 91863 92411 gene locus_tag LOCUS_10750 91863 92411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 92408 93013 gene locus_tag LOCUS_10760 92408 93013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 93104 93331 gene locus_tag LOCUS_10770 93104 93331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 93395 93757 gene locus_tag LOCUS_10780 93395 93757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 93983 93705 gene locus_tag LOCUS_10790 93983 93705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024889622.1 protein_id gnl|my_center|LOCUS_10790 94268 93990 gene locus_tag LOCUS_10800 94268 93990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 95068 94277 gene locus_tag LOCUS_10810 95068 94277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 95373 96110 gene locus_tag LOCUS_10820 95373 96110 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225694.1 protein_id gnl|my_center|LOCUS_10820 96138 96839 gene locus_tag LOCUS_10830 96138 96839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 96908 97138 gene locus_tag LOCUS_10840 96908 97138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 97146 97664 gene locus_tag LOCUS_10850 97146 97664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 97661 97996 gene locus_tag LOCUS_10860 97661 97996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 97996 98235 gene locus_tag LOCUS_10870 97996 98235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 98162 98818 gene locus_tag LOCUS_10880 98162 98818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 98815 99060 gene locus_tag LOCUS_10890 98815 99060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 99050 99706 gene locus_tag LOCUS_10900 99050 99706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 99703 101217 gene locus_tag LOCUS_10910 99703 101217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 101214 101666 gene locus_tag LOCUS_10920 101214 101666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 101683 102405 gene locus_tag LOCUS_10930 gene cmoA 101683 102405 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019583.1 protein_id gnl|my_center|LOCUS_10930 102432 103013 gene locus_tag LOCUS_10940 102432 103013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 103163 104830 gene locus_tag LOCUS_10950 103163 104830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 104827 105204 gene locus_tag LOCUS_10960 104827 105204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 105201 105809 gene locus_tag LOCUS_10970 105201 105809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 105834 106094 gene locus_tag LOCUS_10980 105834 106094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 106091 107536 gene locus_tag LOCUS_10990 106091 107536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 107508 108791 gene locus_tag LOCUS_11000 107508 108791 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190275052.1 protein_id gnl|my_center|LOCUS_11000 108798 109694 gene locus_tag LOCUS_11010 108798 109694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 109913 110515 gene locus_tag LOCUS_11020 109913 110515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 110555 111877 gene locus_tag LOCUS_11030 110555 111877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 112223 112513 gene locus_tag LOCUS_11040 112223 112513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 112485 112796 gene locus_tag LOCUS_11050 112485 112796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 112789 113571 gene locus_tag LOCUS_11060 112789 113571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 113590 114021 gene locus_tag LOCUS_11070 113590 114021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 114049 114432 gene locus_tag LOCUS_11080 114049 114432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 114461 114862 gene locus_tag LOCUS_11090 114461 114862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 114869 115288 gene locus_tag LOCUS_11100 114869 115288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 115297 115506 gene locus_tag LOCUS_11110 115297 115506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 115808 116275 gene locus_tag LOCUS_11120 115808 116275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 116645 116394 gene locus_tag LOCUS_11130 116645 116394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 116819 118567 gene locus_tag LOCUS_11140 116819 118567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 118608 119036 gene locus_tag LOCUS_11150 118608 119036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 119055 119777 gene locus_tag LOCUS_11160 119055 119777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 119783 120379 gene locus_tag LOCUS_11170 119783 120379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 120384 121694 gene locus_tag LOCUS_11180 120384 121694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 121850 122671 gene locus_tag LOCUS_11190 121850 122671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 122679 123689 gene locus_tag LOCUS_11200 122679 123689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 123713 124603 gene locus_tag LOCUS_11210 123713 124603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 124600 125205 gene locus_tag LOCUS_11220 124600 125205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 125222 125416 gene locus_tag LOCUS_11230 125222 125416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 125676 125479 gene locus_tag LOCUS_11240 125676 125479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 126968 125679 gene locus_tag LOCUS_11250 126968 125679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 127463 127786 gene locus_tag LOCUS_11260 127463 127786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 127790 128821 gene locus_tag LOCUS_11270 127790 128821 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017159.1 protein_id gnl|my_center|LOCUS_11270 128818 129150 gene locus_tag LOCUS_11280 128818 129150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 129338 130162 gene locus_tag LOCUS_11290 129338 130162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 130104 130688 gene locus_tag LOCUS_11300 130104 130688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 130754 131161 gene locus_tag LOCUS_11310 130754 131161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 131980 131249 gene locus_tag LOCUS_11320 131980 131249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 132174 131986 gene locus_tag LOCUS_11330 132174 131986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 132872 134986 gene locus_tag LOCUS_11340 132872 134986 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108456.1 protein_id gnl|my_center|LOCUS_11340 135319 134999 gene locus_tag LOCUS_11350 135319 134999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 136812 135394 gene locus_tag LOCUS_11360 136812 135394 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110815093.1 protein_id gnl|my_center|LOCUS_11360 137761 136856 gene locus_tag LOCUS_11370 137761 136856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 140134 137909 gene locus_tag LOCUS_11380 gene katG 140134 137909 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963840.1 protein_id gnl|my_center|LOCUS_11380 140399 141835 gene locus_tag LOCUS_11390 140399 141835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 144576 141832 gene locus_tag LOCUS_11400 144576 141832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 144650 145081 gene locus_tag LOCUS_11410 144650 145081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 145180 146568 gene locus_tag LOCUS_11420 145180 146568 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119838.1 protein_id gnl|my_center|LOCUS_11420 146565 147248 gene locus_tag LOCUS_11430 146565 147248 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941823.1 protein_id gnl|my_center|LOCUS_11430 147252 148400 gene locus_tag LOCUS_11440 147252 148400 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922783.1 protein_id gnl|my_center|LOCUS_11440 148402 149553 gene locus_tag LOCUS_11450 148402 149553 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922784.1 protein_id gnl|my_center|LOCUS_11450 149579 150118 gene locus_tag LOCUS_11460 149579 150118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 150912 150139 gene locus_tag LOCUS_11470 150912 150139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 151355 150963 gene locus_tag LOCUS_11480 151355 150963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 152254 151460 gene locus_tag LOCUS_11490 152254 151460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 153842 152244 gene locus_tag LOCUS_11500 153842 152244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 154634 153927 gene locus_tag LOCUS_11510 154634 153927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 158236 154637 gene locus_tag LOCUS_11520 158236 154637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 158410 158709 gene locus_tag LOCUS_11530 158410 158709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 159258 158710 gene locus_tag LOCUS_11540 159258 158710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 166020 159298 gene locus_tag LOCUS_11550 166020 159298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 169363 166133 gene locus_tag LOCUS_11560 169363 166133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 169896 169390 gene locus_tag LOCUS_11570 169896 169390 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892873.1 protein_id gnl|my_center|LOCUS_11570 170177 171367 gene locus_tag LOCUS_11580 gene rhaT 170177 171367 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762702.1 protein_id gnl|my_center|LOCUS_11580 171431 172456 gene locus_tag LOCUS_11590 gene hflK 171431 172456 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_11590 172485 173459 gene locus_tag LOCUS_11600 gene hflC 172485 173459 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678885.1 protein_id gnl|my_center|LOCUS_11600 174926 173478 gene locus_tag LOCUS_11610 174926 173478 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966975.1 protein_id gnl|my_center|LOCUS_11610 175110 176135 gene locus_tag LOCUS_11620 175110 176135 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_11620 176144 176596 gene locus_tag LOCUS_11630 gene dtd 176144 176596 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108726.1 protein_id gnl|my_center|LOCUS_11630 176643 177794 gene locus_tag LOCUS_11640 gene carA 176643 177794 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940372.1 protein_id gnl|my_center|LOCUS_11640 177834 179105 gene locus_tag LOCUS_11650 177834 179105 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943920.1 protein_id gnl|my_center|LOCUS_11650 179117 179827 gene locus_tag LOCUS_11660 179117 179827 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_11660 179843 181939 gene locus_tag LOCUS_11670 179843 181939 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814149.1 protein_id gnl|my_center|LOCUS_11670 183316 182162 gene locus_tag LOCUS_11680 183316 182162 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_11680 183592 183518 gene locus_tag LOCUS_t00100 183592 183518 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 183729 184250 gene locus_tag LOCUS_11690 gene coaD 183729 184250 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218149.1 protein_id gnl|my_center|LOCUS_11690 185663 184260 gene locus_tag LOCUS_11700 185663 184260 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921850.1 protein_id gnl|my_center|LOCUS_11700 187099 185699 gene locus_tag LOCUS_11710 187099 185699 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767657.1 protein_id gnl|my_center|LOCUS_11710 187692 191777 gene locus_tag LOCUS_11720 187692 191777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 195707 191799 gene locus_tag LOCUS_11730 195707 191799 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227523.1 protein_id gnl|my_center|LOCUS_11730 196818 195751 gene locus_tag LOCUS_11740 196818 195751 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383387.1 protein_id gnl|my_center|LOCUS_11740 196867 197418 gene locus_tag LOCUS_11750 196867 197418 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535019.1 protein_id gnl|my_center|LOCUS_11750 197415 198461 gene locus_tag LOCUS_11760 gene queG 197415 198461 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067729.1 protein_id gnl|my_center|LOCUS_11760 198518 199885 gene locus_tag LOCUS_11770 198518 199885 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109157.1 protein_id gnl|my_center|LOCUS_11770 200966 199911 gene locus_tag LOCUS_11780 200966 199911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 201553 200963 gene locus_tag LOCUS_11790 201553 200963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 >Feature sequence08 <1 11097 gene locus_tag LOCUS_11800 <1 11097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003147216.1:filamentous hemagglutinin family protein 11119 12027 gene locus_tag LOCUS_11810 11119 12027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 12750 12031 gene locus_tag LOCUS_11820 12750 12031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 14225 12906 gene locus_tag LOCUS_11830 14225 12906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 15120 14269 gene locus_tag LOCUS_11840 15120 14269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 15480 16718 gene locus_tag LOCUS_11850 15480 16718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 16927 18822 gene locus_tag LOCUS_11860 16927 18822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 21456 18913 gene locus_tag LOCUS_11870 21456 18913 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040782.1 protein_id gnl|my_center|LOCUS_11870 21660 22628 gene locus_tag LOCUS_11880 gene moaA 21660 22628 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257065.1 protein_id gnl|my_center|LOCUS_11880 22625 23833 gene locus_tag LOCUS_11890 22625 23833 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057204.1 protein_id gnl|my_center|LOCUS_11890 23895 24335 gene locus_tag LOCUS_11900 gene moaC 23895 24335 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036201.1 protein_id gnl|my_center|LOCUS_11900 24362 24934 gene locus_tag LOCUS_11910 24362 24934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11910 24931 25170 gene locus_tag LOCUS_11920 24931 25170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 25180 26118 gene locus_tag LOCUS_11930 25180 26118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 26810 26109 gene locus_tag LOCUS_11940 26810 26109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 27687 26884 gene locus_tag LOCUS_11950 gene pstB 27687 26884 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722628.1 protein_id gnl|my_center|LOCUS_11950 28484 27708 gene locus_tag LOCUS_11960 gene pstB 28484 27708 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460191.1 protein_id gnl|my_center|LOCUS_11960 29605 28478 gene locus_tag LOCUS_11970 29605 28478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 31516 29609 gene locus_tag LOCUS_11980 31516 29609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 32432 31632 gene locus_tag LOCUS_11990 32432 31632 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868851.1 protein_id gnl|my_center|LOCUS_11990 33799 32474 gene locus_tag LOCUS_12000 33799 32474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 36170 34089 gene locus_tag LOCUS_12010 36170 34089 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071046.1 protein_id gnl|my_center|LOCUS_12010 36244 36693 gene locus_tag LOCUS_12020 36244 36693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 36887 37549 gene locus_tag LOCUS_12030 36887 37549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 37561 38484 gene locus_tag LOCUS_12040 37561 38484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 38547 39362 gene locus_tag LOCUS_12050 38547 39362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 41002 39395 gene locus_tag LOCUS_12060 41002 39395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 41104 41790 gene locus_tag LOCUS_12070 41104 41790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 42293 41766 gene locus_tag LOCUS_12080 42293 41766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 42421 43260 gene locus_tag LOCUS_12090 42421 43260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 43264 45735 gene locus_tag LOCUS_12100 43264 45735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 45722 46474 gene locus_tag LOCUS_12110 45722 46474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 46619 46786 gene locus_tag LOCUS_12120 46619 46786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 48411 47092 gene locus_tag LOCUS_12130 48411 47092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 49330 48476 gene locus_tag LOCUS_12140 49330 48476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 50184 49378 gene locus_tag LOCUS_12150 50184 49378 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265901.1 protein_id gnl|my_center|LOCUS_12150 51764 50181 gene locus_tag LOCUS_12160 51764 50181 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121575.1 protein_id gnl|my_center|LOCUS_12160 53631 51802 gene locus_tag LOCUS_12170 53631 51802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 54634 53729 gene locus_tag LOCUS_12180 54634 53729 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026311868.1 protein_id gnl|my_center|LOCUS_12180 56386 54905 gene locus_tag LOCUS_12190 gene nuoN 56386 54905 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975095.1 protein_id gnl|my_center|LOCUS_12190 57872 56439 gene locus_tag LOCUS_12200 57872 56439 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813230.1 protein_id gnl|my_center|LOCUS_12200 59724 57877 gene locus_tag LOCUS_12210 gene nuoL 59724 57877 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_12210 60085 59768 gene locus_tag LOCUS_12220 gene nuoK 60085 59768 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258758.1 protein_id gnl|my_center|LOCUS_12220 60680 60120 gene locus_tag LOCUS_12230 60680 60120 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185672.1 protein_id gnl|my_center|LOCUS_12230 61304 60738 gene locus_tag LOCUS_12240 61304 60738 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537600.1 protein_id gnl|my_center|LOCUS_12240 62607 61348 gene locus_tag LOCUS_12250 gene nuoH 62607 61348 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944046.1 protein_id gnl|my_center|LOCUS_12250 64397 62640 gene locus_tag LOCUS_12260 64397 62640 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403178.1 protein_id gnl|my_center|LOCUS_12260 64729 74763 gene locus_tag LOCUS_12270 64729 74763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 74869 75555 gene locus_tag LOCUS_12280 74869 75555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 75565 76470 gene locus_tag LOCUS_12290 75565 76470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 76467 77606 gene locus_tag LOCUS_12300 76467 77606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 78508 77624 gene locus_tag LOCUS_12310 gene xerD 78508 77624 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390080.1 protein_id gnl|my_center|LOCUS_12310 78637 80655 gene locus_tag LOCUS_12320 78637 80655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 80678 81445 gene locus_tag LOCUS_12330 80678 81445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 81589 82488 gene locus_tag LOCUS_12340 81589 82488 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763004.1 protein_id gnl|my_center|LOCUS_12340 82492 83223 gene locus_tag LOCUS_12350 82492 83223 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479643.1 protein_id gnl|my_center|LOCUS_12350 85315 83237 gene locus_tag LOCUS_12360 85315 83237 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615720.1 protein_id gnl|my_center|LOCUS_12360 88973 85398 gene locus_tag LOCUS_12370 88973 85398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 89137 91488 gene locus_tag LOCUS_12380 89137 91488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 91523 92497 gene locus_tag LOCUS_12390 91523 92497 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083685838.1 protein_id gnl|my_center|LOCUS_12390 93698 92514 gene locus_tag LOCUS_12400 93698 92514 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_12400 94097 95119 gene locus_tag LOCUS_12410 94097 95119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 95130 96221 gene locus_tag LOCUS_12420 gene mutY 95130 96221 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056920.1 protein_id gnl|my_center|LOCUS_12420 96249 97043 gene locus_tag LOCUS_12430 96249 97043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 97048 97482 gene locus_tag LOCUS_12440 97048 97482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 97569 99647 gene locus_tag LOCUS_12450 97569 99647 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206290416.1 protein_id gnl|my_center|LOCUS_12450 99878 100582 gene locus_tag LOCUS_12460 99878 100582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 100688 101134 gene locus_tag LOCUS_12470 100688 101134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 101665 101210 gene locus_tag LOCUS_12480 101665 101210 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082056.1 protein_id gnl|my_center|LOCUS_12480 101774 102619 gene locus_tag LOCUS_12490 101774 102619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 104169 102625 gene locus_tag LOCUS_12500 gene ilvA 104169 102625 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074001.1 protein_id gnl|my_center|LOCUS_12500 105388 104204 gene locus_tag LOCUS_12510 105388 104204 CDS product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963947.1 protein_id gnl|my_center|LOCUS_12510 105498 106016 gene locus_tag LOCUS_12520 105498 106016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 106006 106416 gene locus_tag LOCUS_12530 106006 106416 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035740.1 protein_id gnl|my_center|LOCUS_12530 106468 107220 gene locus_tag LOCUS_12540 gene pdxJ 106468 107220 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297412.1 protein_id gnl|my_center|LOCUS_12540 107217 107600 gene locus_tag LOCUS_12550 107217 107600 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393656.1 protein_id gnl|my_center|LOCUS_12550 107620 108603 gene locus_tag LOCUS_12560 gene hemB 107620 108603 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124398.1 protein_id gnl|my_center|LOCUS_12560 108659 110977 gene locus_tag LOCUS_12570 108659 110977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 113676 110980 gene locus_tag LOCUS_12580 113676 110980 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258469.1 protein_id gnl|my_center|LOCUS_12580 115462 113690 gene locus_tag LOCUS_12590 115462 113690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 116353 115472 gene locus_tag LOCUS_12600 116353 115472 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259037.1 protein_id gnl|my_center|LOCUS_12600 117804 116350 gene locus_tag LOCUS_12610 117804 116350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 118808 117825 gene locus_tag LOCUS_12620 118808 117825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 120600 118873 gene locus_tag LOCUS_12630 120600 118873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 121645 120635 gene locus_tag LOCUS_12640 121645 120635 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582647.1 protein_id gnl|my_center|LOCUS_12640 121773 124199 gene locus_tag LOCUS_12650 121773 124199 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121001.1 protein_id gnl|my_center|LOCUS_12650 124650 124222 gene locus_tag LOCUS_12660 gene mntR 124650 124222 CDS product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725831.1 protein_id gnl|my_center|LOCUS_12660 125364 124663 gene locus_tag LOCUS_12670 125364 124663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 125987 125382 gene locus_tag LOCUS_12680 125987 125382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 127945 126239 gene locus_tag LOCUS_12690 127945 126239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 129111 128035 gene locus_tag LOCUS_12700 129111 128035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 129582 129178 gene locus_tag LOCUS_12710 129582 129178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 130722 129940 gene locus_tag LOCUS_12720 130722 129940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 130951 132648 gene locus_tag LOCUS_12730 130951 132648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 133611 132655 gene locus_tag LOCUS_12740 133611 132655 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889019.1 protein_id gnl|my_center|LOCUS_12740 135425 133623 gene locus_tag LOCUS_12750 135425 133623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 136207 135455 gene locus_tag LOCUS_12760 136207 135455 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869672.1 protein_id gnl|my_center|LOCUS_12760 136566 137396 gene locus_tag LOCUS_12770 136566 137396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 137393 138265 gene locus_tag LOCUS_12780 137393 138265 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172234.1 protein_id gnl|my_center|LOCUS_12780 138262 139104 gene locus_tag LOCUS_12790 138262 139104 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141472.1 protein_id gnl|my_center|LOCUS_12790 139154 140896 gene locus_tag LOCUS_12800 139154 140896 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941861.1 protein_id gnl|my_center|LOCUS_12800 140939 141958 gene locus_tag LOCUS_12810 gene tsaD 140939 141958 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393644.1 protein_id gnl|my_center|LOCUS_12810 141993 142619 gene locus_tag LOCUS_12820 141993 142619 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025687389.1 protein_id gnl|my_center|LOCUS_12820 142696 143853 gene locus_tag LOCUS_12830 142696 143853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 143859 144710 gene locus_tag LOCUS_12840 143859 144710 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873583.1 protein_id gnl|my_center|LOCUS_12840 144760 146604 gene locus_tag LOCUS_12850 144760 146604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 147669 146611 gene locus_tag LOCUS_12860 gene recF 147669 146611 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142400.1 protein_id gnl|my_center|LOCUS_12860 149926 147800 gene locus_tag LOCUS_12870 149926 147800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 <150748 149988 gene locus_tag LOCUS_12880 <150748 149988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942715.1:putative Ig domain-containing protein >Feature sequence09 4936 6798 gene locus_tag LOCUS_12890 4936 6798 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121854.1 protein_id gnl|my_center|LOCUS_12890 9178 6890 gene locus_tag LOCUS_12900 9178 6890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 9702 9169 gene locus_tag LOCUS_12910 9702 9169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 10480 10394 gene locus_tag LOCUS_t00110 10480 10394 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10596 13580 gene locus_tag LOCUS_12920 10596 13580 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920490.1 protein_id gnl|my_center|LOCUS_12920 16309 13685 gene locus_tag LOCUS_12930 16309 13685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 16749 19163 gene locus_tag LOCUS_12940 16749 19163 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941123.1 protein_id gnl|my_center|LOCUS_12940 19827 19120 gene locus_tag LOCUS_12950 19827 19120 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 protein_id gnl|my_center|LOCUS_12950 20613 19834 gene locus_tag LOCUS_12960 20613 19834 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773590.1 protein_id gnl|my_center|LOCUS_12960 21559 20618 gene locus_tag LOCUS_12970 21559 20618 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583299.1 protein_id gnl|my_center|LOCUS_12970 22472 21561 gene locus_tag LOCUS_12980 22472 21561 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262676.1 protein_id gnl|my_center|LOCUS_12980 23733 22528 gene locus_tag LOCUS_12990 23733 22528 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_12990 24383 23817 gene locus_tag LOCUS_13000 24383 23817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 26533 24767 gene locus_tag LOCUS_13010 26533 24767 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 protein_id gnl|my_center|LOCUS_13010 27452 26565 gene locus_tag LOCUS_13020 27452 26565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 27547 28440 gene locus_tag LOCUS_13030 27547 28440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 30708 28528 gene locus_tag LOCUS_13040 gene mrdA 30708 28528 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583753.1 protein_id gnl|my_center|LOCUS_13040 31374 30712 gene locus_tag LOCUS_13050 31374 30712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 31346 32614 gene locus_tag LOCUS_13060 31346 32614 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927265.1 protein_id gnl|my_center|LOCUS_13060 32681 33670 gene locus_tag LOCUS_13070 gene mgrA 32681 33670 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098184.1 protein_id gnl|my_center|LOCUS_13070 34575 33667 gene locus_tag LOCUS_13080 34575 33667 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554743.1 protein_id gnl|my_center|LOCUS_13080 34679 36283 gene locus_tag LOCUS_13090 34679 36283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 36732 36292 gene locus_tag LOCUS_13100 36732 36292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 37066 36824 gene locus_tag LOCUS_13110 37066 36824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 37248 37075 gene locus_tag LOCUS_13120 gene rpmG 37248 37075 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963553.1 protein_id gnl|my_center|LOCUS_13120 38318 37275 gene locus_tag LOCUS_13130 38318 37275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 38523 39254 gene locus_tag LOCUS_13140 38523 39254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 39271 40341 gene locus_tag LOCUS_13150 gene pheA 39271 40341 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_13150 40427 41710 gene locus_tag LOCUS_13160 40427 41710 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852462.1 protein_id gnl|my_center|LOCUS_13160 42559 41756 gene locus_tag LOCUS_13170 42559 41756 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057728.1 protein_id gnl|my_center|LOCUS_13170 42680 43147 gene locus_tag LOCUS_13180 42680 43147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 45330 43198 gene locus_tag LOCUS_13190 45330 43198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 52241 45444 gene locus_tag LOCUS_13200 52241 45444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 52852 52271 gene locus_tag LOCUS_13210 52852 52271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 53862 52867 gene locus_tag LOCUS_13220 gene pelA 53862 52867 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427768.1 protein_id gnl|my_center|LOCUS_13220 58580 53874 gene locus_tag LOCUS_13230 58580 53874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 61188 58756 gene locus_tag LOCUS_13240 61188 58756 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_13240 62701 61238 gene locus_tag LOCUS_13250 62701 61238 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922252.1 protein_id gnl|my_center|LOCUS_13250 64653 62755 gene locus_tag LOCUS_13260 64653 62755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 67378 64658 gene locus_tag LOCUS_13270 67378 64658 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201960.1 protein_id gnl|my_center|LOCUS_13270 70902 67375 gene locus_tag LOCUS_13280 70902 67375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 75804 70963 gene locus_tag LOCUS_13290 75804 70963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 81557 75840 gene locus_tag LOCUS_13300 81557 75840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 83865 81607 gene locus_tag LOCUS_13310 83865 81607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 84921 83875 gene locus_tag LOCUS_13320 84921 83875 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118564.1 protein_id gnl|my_center|LOCUS_13320 85017 86153 gene locus_tag LOCUS_13330 85017 86153 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530208.1 protein_id gnl|my_center|LOCUS_13330 86269 86700 gene locus_tag LOCUS_13340 86269 86700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 88770 86860 gene locus_tag LOCUS_13350 88770 86860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 88925 88999 gene locus_tag LOCUS_t00120 88925 88999 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 89124 89387 gene locus_tag LOCUS_13360 89124 89387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 89778 90179 gene locus_tag LOCUS_13370 89778 90179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 90744 90544 gene locus_tag LOCUS_13380 90744 90544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 90829 91545 gene locus_tag LOCUS_13390 90829 91545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 91625 92743 gene locus_tag LOCUS_13400 91625 92743 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974604.1 protein_id gnl|my_center|LOCUS_13400 92767 93306 gene locus_tag LOCUS_13410 92767 93306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 95257 93383 gene locus_tag LOCUS_13420 95257 93383 CDS product nuclease-related domain-containing DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263035.1 protein_id gnl|my_center|LOCUS_13420 96622 95756 gene locus_tag LOCUS_13430 96622 95756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 98827 96803 gene locus_tag LOCUS_13440 98827 96803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 100132 99344 gene locus_tag LOCUS_13450 gene trpC 100132 99344 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975565.1 protein_id gnl|my_center|LOCUS_13450 100242 100316 gene locus_tag LOCUS_t00130 100242 100316 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 100375 101238 gene locus_tag LOCUS_13460 100375 101238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 102057 101242 gene locus_tag LOCUS_13470 gene mutM 102057 101242 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039216.1 protein_id gnl|my_center|LOCUS_13470 102670 102068 gene locus_tag LOCUS_13480 102670 102068 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037985.1 protein_id gnl|my_center|LOCUS_13480 102833 103723 gene locus_tag LOCUS_13490 102833 103723 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140474.1 protein_id gnl|my_center|LOCUS_13490 103811 104476 gene locus_tag LOCUS_13500 103811 104476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 104478 105194 gene locus_tag LOCUS_13510 104478 105194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 107321 105204 gene locus_tag LOCUS_13520 107321 105204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 107498 108466 gene locus_tag LOCUS_13530 gene cyoE 107498 108466 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062574.1 protein_id gnl|my_center|LOCUS_13530 108471 109190 gene locus_tag LOCUS_13540 108471 109190 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922324.1 protein_id gnl|my_center|LOCUS_13540 110044 109193 gene locus_tag LOCUS_13550 110044 109193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 111338 110130 gene locus_tag LOCUS_13560 111338 110130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 112864 111335 gene locus_tag LOCUS_13570 112864 111335 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334293.1 protein_id gnl|my_center|LOCUS_13570 113067 114653 gene locus_tag LOCUS_13580 113067 114653 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108979.1 protein_id gnl|my_center|LOCUS_13580 114650 115951 gene locus_tag LOCUS_13590 114650 115951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 116046 116120 gene locus_tag LOCUS_t00140 116046 116120 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 117449 116145 gene locus_tag LOCUS_13600 117449 116145 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027795.1 protein_id gnl|my_center|LOCUS_13600 117588 117758 gene locus_tag LOCUS_13610 117588 117758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 119284 117773 gene locus_tag LOCUS_13620 119284 117773 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921302.1 protein_id gnl|my_center|LOCUS_13620 122582 119331 gene locus_tag LOCUS_13630 122582 119331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 124019 122685 gene locus_tag LOCUS_13640 124019 122685 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921659.1 protein_id gnl|my_center|LOCUS_13640 128395 124064 gene locus_tag LOCUS_13650 128395 124064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 129923 128913 gene locus_tag LOCUS_13660 129923 128913 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707193.1 protein_id gnl|my_center|LOCUS_13660 130915 129920 gene locus_tag LOCUS_13670 130915 129920 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024318146.1 protein_id gnl|my_center|LOCUS_13670 133041 130912 gene locus_tag LOCUS_13680 133041 130912 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706661.1 protein_id gnl|my_center|LOCUS_13680 134573 133038 gene locus_tag LOCUS_13690 134573 133038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 135976 134603 gene locus_tag LOCUS_13700 135976 134603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 136158 137120 gene locus_tag LOCUS_13710 136158 137120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 137117 137746 gene locus_tag LOCUS_13720 137117 137746 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184839.1 protein_id gnl|my_center|LOCUS_13720 138077 143878 gene locus_tag LOCUS_13730 138077 143878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 143997 144773 gene locus_tag LOCUS_13740 143997 144773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 144770 145489 gene locus_tag LOCUS_13750 144770 145489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 145498 146106 gene locus_tag LOCUS_13760 145498 146106 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_13760 146144 146719 gene locus_tag LOCUS_13770 146144 146719 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036993.1 protein_id gnl|my_center|LOCUS_13770 >Feature sequence10 2373 505 gene locus_tag LOCUS_13780 2373 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 2399 2325 gene locus_tag LOCUS_t00150 2399 2325 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2648 3928 gene locus_tag LOCUS_13790 gene nusA 2648 3928 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309913.1 protein_id gnl|my_center|LOCUS_13790 3973 6117 gene locus_tag LOCUS_13800 gene infB 3973 6117 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546130.1 protein_id gnl|my_center|LOCUS_13800 6219 6587 gene locus_tag LOCUS_13810 6219 6587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 6696 8330 gene locus_tag LOCUS_13820 gene fumA 6696 8330 CDS product class I fumarate hydratase FumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167385.1 protein_id gnl|my_center|LOCUS_13820 12950 8358 gene locus_tag LOCUS_13830 12950 8358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 13151 13840 gene locus_tag LOCUS_13840 13151 13840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922325.1 protein_id gnl|my_center|LOCUS_13840 13892 15805 gene locus_tag LOCUS_13850 13892 15805 CDS product OPT family oligopeptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768135.1 protein_id gnl|my_center|LOCUS_13850 15883 16206 gene locus_tag LOCUS_13860 15883 16206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 16922 16203 gene locus_tag LOCUS_13870 16922 16203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 17692 16919 gene locus_tag LOCUS_13880 17692 16919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 18312 17689 gene locus_tag LOCUS_13890 18312 17689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 19598 18309 gene locus_tag LOCUS_13900 gene hisD 19598 18309 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974419.1 protein_id gnl|my_center|LOCUS_13900 20572 19688 gene locus_tag LOCUS_13910 20572 19688 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 protein_id gnl|my_center|LOCUS_13910 21024 20686 gene locus_tag LOCUS_13920 21024 20686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 20918 21241 gene locus_tag LOCUS_13930 20918 21241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 21551 21249 gene locus_tag LOCUS_13940 21551 21249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 23319 21613 gene locus_tag LOCUS_13950 23319 21613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 23446 24078 gene locus_tag LOCUS_13960 23446 24078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 24078 24446 gene locus_tag LOCUS_13970 24078 24446 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522276.1 protein_id gnl|my_center|LOCUS_13970 24525 27173 gene locus_tag LOCUS_13980 24525 27173 CDS product DUF3160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177619.1 protein_id gnl|my_center|LOCUS_13980 27248 27403 gene locus_tag LOCUS_13990 27248 27403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 28354 27566 gene locus_tag LOCUS_14000 28354 27566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815935.1 protein_id gnl|my_center|LOCUS_14000 28848 28489 gene locus_tag LOCUS_14010 28848 28489 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632829.1 protein_id gnl|my_center|LOCUS_14010 28892 30067 gene locus_tag LOCUS_14020 28892 30067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 30105 31472 gene locus_tag LOCUS_14030 30105 31472 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_14030 31502 33328 gene locus_tag LOCUS_14040 31502 33328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 33325 33660 gene locus_tag LOCUS_14050 33325 33660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 33641 35533 gene locus_tag LOCUS_14060 gene dxs 33641 35533 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_14060 35594 36409 gene locus_tag LOCUS_14070 35594 36409 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150234528.1 protein_id gnl|my_center|LOCUS_14070 36406 37818 gene locus_tag LOCUS_14080 36406 37818 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061914.1 protein_id gnl|my_center|LOCUS_14080 37964 39487 gene locus_tag LOCUS_14090 37964 39487 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162305080.1 protein_id gnl|my_center|LOCUS_14090 39629 40921 gene locus_tag LOCUS_14100 39629 40921 CDS product bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114564.1 protein_id gnl|my_center|LOCUS_14100 40946 41566 gene locus_tag LOCUS_14110 40946 41566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 43639 41840 gene locus_tag LOCUS_14120 gene lepA 43639 41840 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030952.1 protein_id gnl|my_center|LOCUS_14120 43542 43772 gene locus_tag LOCUS_14130 43542 43772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 43782 44729 gene locus_tag LOCUS_14140 gene waaF 43782 44729 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_14140 45125 44745 gene locus_tag LOCUS_14150 45125 44745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 46018 45137 gene locus_tag LOCUS_14160 gene oxyR 46018 45137 CDS product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368909.1 protein_id gnl|my_center|LOCUS_14160 46328 49348 gene locus_tag LOCUS_14170 46328 49348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 50351 49833 gene locus_tag LOCUS_14180 50351 49833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 51412 50399 gene locus_tag LOCUS_14190 gene floA 51412 50399 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173128.1 protein_id gnl|my_center|LOCUS_14190 51896 51420 gene locus_tag LOCUS_14200 51896 51420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 53284 51893 gene locus_tag LOCUS_14210 53284 51893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 53478 54635 gene locus_tag LOCUS_14220 gene nifS 53478 54635 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_14220 55267 54641 gene locus_tag LOCUS_14230 55267 54641 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143956.1 protein_id gnl|my_center|LOCUS_14230 55439 56170 gene locus_tag LOCUS_14240 55439 56170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 56217 56948 gene locus_tag LOCUS_14250 56217 56948 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_14250 56987 58903 gene locus_tag LOCUS_14260 56987 58903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 58943 60331 gene locus_tag LOCUS_14270 58943 60331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 60449 60859 gene locus_tag LOCUS_14280 60449 60859 CDS product peptide chain release factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945928.1 protein_id gnl|my_center|LOCUS_14280 60911 61678 gene locus_tag LOCUS_14290 60911 61678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 61678 62688 gene locus_tag LOCUS_14300 gene hemA 61678 62688 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_14300 62846 63355 gene locus_tag LOCUS_14310 62846 63355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 65249 63384 gene locus_tag LOCUS_14320 65249 63384 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962807.1 protein_id gnl|my_center|LOCUS_14320 65579 65316 gene locus_tag LOCUS_14330 65579 65316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 66500 65676 gene locus_tag LOCUS_14340 66500 65676 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927143.1 protein_id gnl|my_center|LOCUS_14340 66813 66953 gene locus_tag LOCUS_14350 66813 66953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 66946 68115 gene locus_tag LOCUS_14360 66946 68115 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259270.1 protein_id gnl|my_center|LOCUS_14360 68259 68828 gene locus_tag LOCUS_14370 68259 68828 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159676.1 protein_id gnl|my_center|LOCUS_14370 69041 68835 gene locus_tag LOCUS_14380 69041 68835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 69423 69133 gene locus_tag LOCUS_14390 69423 69133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 69308 70060 gene locus_tag LOCUS_14400 69308 70060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 70150 71829 gene locus_tag LOCUS_14410 70150 71829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 71826 72440 gene locus_tag LOCUS_14420 71826 72440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 72424 73572 gene locus_tag LOCUS_14430 72424 73572 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402885.1 protein_id gnl|my_center|LOCUS_14430 73666 75444 gene locus_tag LOCUS_14440 gene dnaK 73666 75444 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 protein_id gnl|my_center|LOCUS_14440 76705 75587 gene locus_tag LOCUS_14450 76705 75587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 77824 76751 gene locus_tag LOCUS_14460 77824 76751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 78028 78672 gene locus_tag LOCUS_14470 78028 78672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 78686 79198 gene locus_tag LOCUS_14480 78686 79198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 79439 80194 gene locus_tag LOCUS_14490 79439 80194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 81032 80574 gene locus_tag LOCUS_14500 81032 80574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 81887 81033 gene locus_tag LOCUS_14510 81887 81033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 82646 81915 gene locus_tag LOCUS_14520 82646 81915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 83760 82741 gene locus_tag LOCUS_14530 83760 82741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 84910 83951 gene locus_tag LOCUS_14540 gene cysK 84910 83951 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324150.1 protein_id gnl|my_center|LOCUS_14540 85722 84985 gene locus_tag LOCUS_14550 85722 84985 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477371.1 protein_id gnl|my_center|LOCUS_14550 87454 85733 gene locus_tag LOCUS_14560 gene cysI 87454 85733 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470366.1 protein_id gnl|my_center|LOCUS_14560 89254 87494 gene locus_tag LOCUS_14570 89254 87494 CDS product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243259.1 protein_id gnl|my_center|LOCUS_14570 89413 91404 gene locus_tag LOCUS_14580 89413 91404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 91831 91424 gene locus_tag LOCUS_14590 91831 91424 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405004.1 protein_id gnl|my_center|LOCUS_14590 94397 91851 gene locus_tag LOCUS_14600 94397 91851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 95058 94387 gene locus_tag LOCUS_14610 95058 94387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 95293 95910 gene locus_tag LOCUS_14620 95293 95910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 95910 96911 gene locus_tag LOCUS_14630 95910 96911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 97088 101212 gene locus_tag LOCUS_14640 97088 101212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 101406 103379 gene locus_tag LOCUS_14650 101406 103379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 105084 103372 gene locus_tag LOCUS_14660 105084 103372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 107352 105163 gene locus_tag LOCUS_14670 107352 105163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 107429 109747 gene locus_tag LOCUS_14680 107429 109747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227787.1 protein_id gnl|my_center|LOCUS_14680 109824 110303 gene locus_tag LOCUS_14690 109824 110303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 113180 110391 gene locus_tag LOCUS_14700 gene rapA 113180 110391 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005692755.1 protein_id gnl|my_center|LOCUS_14700 113210 114244 gene locus_tag LOCUS_14710 113210 114244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 114734 114273 gene locus_tag LOCUS_14720 114734 114273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 115591 114920 gene locus_tag LOCUS_14730 115591 114920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 115794 116024 gene locus_tag LOCUS_14740 115794 116024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 116979 116038 gene locus_tag LOCUS_14750 116979 116038 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480764.1 protein_id gnl|my_center|LOCUS_14750 119028 117040 gene locus_tag LOCUS_14760 119028 117040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 119034 119777 gene locus_tag LOCUS_14770 119034 119777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 119993 122758 gene locus_tag LOCUS_14780 119993 122758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 123675 122779 gene locus_tag LOCUS_14790 123675 122779 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246573.1 protein_id gnl|my_center|LOCUS_14790 124174 123686 gene locus_tag LOCUS_14800 124174 123686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 124830 124195 gene locus_tag LOCUS_14810 124830 124195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 125072 126214 gene locus_tag LOCUS_14820 125072 126214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 127139 126225 gene locus_tag LOCUS_14830 127139 126225 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207718.1 protein_id gnl|my_center|LOCUS_14830 127234 128040 gene locus_tag LOCUS_14840 127234 128040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 128115 128711 gene locus_tag LOCUS_14850 128115 128711 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405414.1 protein_id gnl|my_center|LOCUS_14850 128752 130740 gene locus_tag LOCUS_14860 128752 130740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 130737 131807 gene locus_tag LOCUS_14870 130737 131807 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210196.1 protein_id gnl|my_center|LOCUS_14870 131835 133127 gene locus_tag LOCUS_14880 131835 133127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 133378 136131 gene locus_tag LOCUS_14890 133378 136131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 136185 137345 gene locus_tag LOCUS_14900 136185 137345 CDS product XylR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764391.1 protein_id gnl|my_center|LOCUS_14900 137342 139078 gene locus_tag LOCUS_14910 137342 139078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 139172 139888 gene locus_tag LOCUS_14920 139172 139888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 139897 141894 gene locus_tag LOCUS_14930 139897 141894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 142564 142869 gene locus_tag LOCUS_14940 142564 142869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 >Feature sequence11 266 892 gene locus_tag LOCUS_14950 266 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 918 5894 gene locus_tag LOCUS_14960 918 5894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 5912 7381 gene locus_tag LOCUS_14970 5912 7381 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920272.1 protein_id gnl|my_center|LOCUS_14970 8379 7435 gene locus_tag LOCUS_14980 8379 7435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 9153 8401 gene locus_tag LOCUS_14990 9153 8401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 9915 9157 gene locus_tag LOCUS_15000 9915 9157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 11014 9989 gene locus_tag LOCUS_15010 gene galE 11014 9989 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929113.1 protein_id gnl|my_center|LOCUS_15010 11164 11946 gene locus_tag LOCUS_15020 11164 11946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 12601 11963 gene locus_tag LOCUS_15030 12601 11963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 13317 12748 gene locus_tag LOCUS_15040 13317 12748 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546804.1 protein_id gnl|my_center|LOCUS_15040 13905 13333 gene locus_tag LOCUS_15050 13905 13333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 14850 13969 gene locus_tag LOCUS_15060 14850 13969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 16242 14893 gene locus_tag LOCUS_15070 16242 14893 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921601.1 protein_id gnl|my_center|LOCUS_15070 17371 16391 gene locus_tag LOCUS_15080 17371 16391 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 protein_id gnl|my_center|LOCUS_15080 17495 17806 gene locus_tag LOCUS_15090 17495 17806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 18937 17912 gene locus_tag LOCUS_15100 18937 17912 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048017.1 protein_id gnl|my_center|LOCUS_15100 19049 19528 gene locus_tag LOCUS_15110 19049 19528 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965933.1 protein_id gnl|my_center|LOCUS_15110 19611 20729 gene locus_tag LOCUS_15120 19611 20729 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510611.1 protein_id gnl|my_center|LOCUS_15120 21114 20713 gene locus_tag LOCUS_15130 21114 20713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 21827 21114 gene locus_tag LOCUS_15140 21827 21114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 21948 22841 gene locus_tag LOCUS_15150 21948 22841 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922152.1 protein_id gnl|my_center|LOCUS_15150 22878 25637 gene locus_tag LOCUS_15160 22878 25637 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970834.1 protein_id gnl|my_center|LOCUS_15160 28956 25642 gene locus_tag LOCUS_15170 28956 25642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 29090 29731 gene locus_tag LOCUS_15180 29090 29731 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992379.1 protein_id gnl|my_center|LOCUS_15180 29728 30588 gene locus_tag LOCUS_15190 29728 30588 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338368.1 protein_id gnl|my_center|LOCUS_15190 30600 30995 gene locus_tag LOCUS_15200 30600 30995 CDS product ketosteroid isomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972626.1 protein_id gnl|my_center|LOCUS_15200 31331 31008 gene locus_tag LOCUS_15210 31331 31008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 32292 31414 gene locus_tag LOCUS_15220 32292 31414 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921962.1 protein_id gnl|my_center|LOCUS_15220 32431 33006 gene locus_tag LOCUS_15230 32431 33006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 34964 33042 gene locus_tag LOCUS_15240 gene pgcA 34964 33042 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244986.1 protein_id gnl|my_center|LOCUS_15240 35822 35046 gene locus_tag LOCUS_15250 gene pyrF 35822 35046 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839147.1 protein_id gnl|my_center|LOCUS_15250 35941 37305 gene locus_tag LOCUS_15260 35941 37305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 37427 37990 gene locus_tag LOCUS_15270 37427 37990 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395060.1 protein_id gnl|my_center|LOCUS_15270 38056 38727 gene locus_tag LOCUS_15280 38056 38727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 38797 39747 gene locus_tag LOCUS_15290 38797 39747 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939162.1 protein_id gnl|my_center|LOCUS_15290 39744 40010 gene locus_tag LOCUS_15300 39744 40010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 40016 40783 gene locus_tag LOCUS_15310 40016 40783 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009567369.1 protein_id gnl|my_center|LOCUS_15310 41226 40846 gene locus_tag LOCUS_15320 gene rplT 41226 40846 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776197.1 protein_id gnl|my_center|LOCUS_15320 41575 41366 gene locus_tag LOCUS_15330 gene rpmI 41575 41366 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125970.1 protein_id gnl|my_center|LOCUS_15330 41694 42260 gene locus_tag LOCUS_15340 41694 42260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 42304 43713 gene locus_tag LOCUS_15350 42304 43713 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405167.1 protein_id gnl|my_center|LOCUS_15350 43823 44485 gene locus_tag LOCUS_15360 43823 44485 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921845.1 protein_id gnl|my_center|LOCUS_15360 44478 45065 gene locus_tag LOCUS_15370 gene nadD 44478 45065 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223158.1 protein_id gnl|my_center|LOCUS_15370 45406 48936 gene locus_tag LOCUS_15380 45406 48936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 48951 49622 gene locus_tag LOCUS_15390 48951 49622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 50660 49635 gene locus_tag LOCUS_15400 50660 49635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 50896 56172 gene locus_tag LOCUS_15410 50896 56172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 56638 57294 gene locus_tag LOCUS_15420 56638 57294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 57392 58324 gene locus_tag LOCUS_15430 57392 58324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 58453 58818 gene locus_tag LOCUS_15440 58453 58818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 60658 59135 gene locus_tag LOCUS_15450 gene guaA 60658 59135 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_15450 62077 60764 gene locus_tag LOCUS_15460 gene guaB 62077 60764 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081543.1 protein_id gnl|my_center|LOCUS_15460 65344 62306 gene locus_tag LOCUS_15470 65344 62306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 66336 65452 gene locus_tag LOCUS_15480 66336 65452 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407851.1 protein_id gnl|my_center|LOCUS_15480 68789 66351 gene locus_tag LOCUS_15490 68789 66351 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266502.1 protein_id gnl|my_center|LOCUS_15490 72225 68851 gene locus_tag LOCUS_15500 72225 68851 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188267.1 protein_id gnl|my_center|LOCUS_15500 73229 72441 gene locus_tag LOCUS_15510 73229 72441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 74076 73378 gene locus_tag LOCUS_15520 74076 73378 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839974.1 protein_id gnl|my_center|LOCUS_15520 74911 74348 gene locus_tag LOCUS_15530 74911 74348 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_15530 76509 75040 gene locus_tag LOCUS_15540 gene trpE 76509 75040 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_15540 80003 76599 gene locus_tag LOCUS_15550 80003 76599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 88301 80022 gene locus_tag LOCUS_15560 88301 80022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 88469 89095 gene locus_tag LOCUS_15570 88469 89095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 89141 92329 gene locus_tag LOCUS_15580 89141 92329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 92405 92902 gene locus_tag LOCUS_15590 92405 92902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615583.1 protein_id gnl|my_center|LOCUS_15590 93598 92915 gene locus_tag LOCUS_15600 93598 92915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 94468 93680 gene locus_tag LOCUS_15610 gene tpiA 94468 93680 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927032.1 protein_id gnl|my_center|LOCUS_15610 95747 94497 gene locus_tag LOCUS_15620 95747 94497 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_15620 98486 95826 gene locus_tag LOCUS_15630 98486 95826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 98948 98541 gene locus_tag LOCUS_15640 98948 98541 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060786.1 protein_id gnl|my_center|LOCUS_15640 99343 99074 gene locus_tag LOCUS_15650 99343 99074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 99403 100626 gene locus_tag LOCUS_15660 99403 100626 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943264.1 protein_id gnl|my_center|LOCUS_15660 100968 100648 gene locus_tag LOCUS_15670 100968 100648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 101784 100993 gene locus_tag LOCUS_15680 101784 100993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 105329 101781 gene locus_tag LOCUS_15690 105329 101781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 105380 106048 gene locus_tag LOCUS_15700 105380 106048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 106801 106070 gene locus_tag LOCUS_15710 106801 106070 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943290.1 protein_id gnl|my_center|LOCUS_15710 107567 106791 gene locus_tag LOCUS_15720 107567 106791 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943289.1 protein_id gnl|my_center|LOCUS_15720 108384 107578 gene locus_tag LOCUS_15730 108384 107578 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943288.1 protein_id gnl|my_center|LOCUS_15730 109355 108414 gene locus_tag LOCUS_15740 109355 108414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 111027 109417 gene locus_tag LOCUS_15750 111027 109417 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226064.1 protein_id gnl|my_center|LOCUS_15750 111187 113523 gene locus_tag LOCUS_15760 111187 113523 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766169.1 protein_id gnl|my_center|LOCUS_15760 113938 114438 gene locus_tag LOCUS_15770 113938 114438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 114508 115365 gene locus_tag LOCUS_15780 gene purU 114508 115365 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222381.1 protein_id gnl|my_center|LOCUS_15780 115437 115526 gene locus_tag LOCUS_t00160 115437 115526 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 115788 116072 gene locus_tag LOCUS_15790 115788 116072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 116069 116446 gene locus_tag LOCUS_15800 116069 116446 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403246.1 protein_id gnl|my_center|LOCUS_15800 116740 117753 gene locus_tag LOCUS_15810 116740 117753 CDS product DUF2891 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922099.1 protein_id gnl|my_center|LOCUS_15810 119971 118280 gene locus_tag LOCUS_15820 119971 118280 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038020.1 protein_id gnl|my_center|LOCUS_15820 123022 120827 gene locus_tag LOCUS_15830 123022 120827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 123195 123542 gene locus_tag LOCUS_15840 123195 123542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 124148 123552 gene locus_tag LOCUS_15850 124148 123552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 124559 124176 gene locus_tag LOCUS_15860 124559 124176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 124936 126507 gene locus_tag LOCUS_15870 gene metG 124936 126507 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939333.1 protein_id gnl|my_center|LOCUS_15870 127354 126545 gene locus_tag LOCUS_15880 127354 126545 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886780.1 protein_id gnl|my_center|LOCUS_15880 127480 129039 gene locus_tag LOCUS_15890 127480 129039 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329914.1 protein_id gnl|my_center|LOCUS_15890 129049 129996 gene locus_tag LOCUS_15900 gene rnhC 129049 129996 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872309.1 protein_id gnl|my_center|LOCUS_15900 130019 130429 gene locus_tag LOCUS_15910 130019 130429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 130452 130988 gene locus_tag LOCUS_15920 130452 130988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 131084 131383 gene locus_tag LOCUS_15930 131084 131383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 131545 132489 gene locus_tag LOCUS_15940 131545 132489 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933689.1 protein_id gnl|my_center|LOCUS_15940 132523 133821 gene locus_tag LOCUS_15950 gene thrC 132523 133821 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_15950 135011 133815 gene locus_tag LOCUS_15960 135011 133815 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858507.1 protein_id gnl|my_center|LOCUS_15960 135151 136161 gene locus_tag LOCUS_15970 135151 136161 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250916.1 protein_id gnl|my_center|LOCUS_15970 136268 136342 gene locus_tag LOCUS_t00170 136268 136342 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 <137537 136369 gene locus_tag LOCUS_15980 <137537 136369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546821.1:replication-associated recombination protein A >Feature sequence12 <1 1347 gene locus_tag LOCUS_15990 <1 1347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932093.1:glutamate synthase subunit beta 1605 2384 gene locus_tag LOCUS_16000 1605 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 2461 2976 gene locus_tag LOCUS_16010 2461 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 5092 3002 gene locus_tag LOCUS_16020 5092 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 5556 6401 gene locus_tag LOCUS_16030 5556 6401 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222998.1 protein_id gnl|my_center|LOCUS_16030 6651 7595 gene locus_tag LOCUS_16040 6651 7595 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103816.1 protein_id gnl|my_center|LOCUS_16040 7692 8729 gene locus_tag LOCUS_16050 7692 8729 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940693.1 protein_id gnl|my_center|LOCUS_16050 8747 9601 gene locus_tag LOCUS_16060 gene pdxA 8747 9601 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384456.1 protein_id gnl|my_center|LOCUS_16060 10344 10589 gene locus_tag LOCUS_16070 10344 10589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 11756 10830 gene locus_tag LOCUS_16080 11756 10830 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035844551.1 protein_id gnl|my_center|LOCUS_16080 14551 11966 gene locus_tag LOCUS_16090 gene hrpB 14551 11966 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294574.1 protein_id gnl|my_center|LOCUS_16090 14741 14935 gene locus_tag LOCUS_16100 gene tatA 14741 14935 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933280.1 protein_id gnl|my_center|LOCUS_16100 14928 16016 gene locus_tag LOCUS_16110 14928 16016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 16187 16990 gene locus_tag LOCUS_16120 16187 16990 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928634.1 protein_id gnl|my_center|LOCUS_16120 18168 17008 gene locus_tag LOCUS_16130 18168 17008 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858484.1 protein_id gnl|my_center|LOCUS_16130 18963 18409 gene locus_tag LOCUS_16140 18963 18409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 19500 19051 gene locus_tag LOCUS_16150 19500 19051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 20475 19606 gene locus_tag LOCUS_16160 20475 19606 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072706.1 protein_id gnl|my_center|LOCUS_16160 22454 20487 gene locus_tag LOCUS_16170 22454 20487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 23722 22508 gene locus_tag LOCUS_16180 gene ftsA 23722 22508 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939770.1 protein_id gnl|my_center|LOCUS_16180 24728 23742 gene locus_tag LOCUS_16190 24728 23742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 25665 24745 gene locus_tag LOCUS_16200 25665 24745 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546449.1 protein_id gnl|my_center|LOCUS_16200 27993 25693 gene locus_tag LOCUS_16210 27993 25693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 29087 27990 gene locus_tag LOCUS_16220 gene murG 29087 27990 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_16220 29699 29226 gene locus_tag LOCUS_16230 29699 29226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 30013 29696 gene locus_tag LOCUS_16240 gene clpS 30013 29696 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011897801.1 protein_id gnl|my_center|LOCUS_16240 31766 29988 gene locus_tag LOCUS_16250 31766 29988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 32117 31821 gene locus_tag LOCUS_16260 32117 31821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 32290 33354 gene locus_tag LOCUS_16270 32290 33354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 33351 34865 gene locus_tag LOCUS_16280 33351 34865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 34936 35544 gene locus_tag LOCUS_16290 34936 35544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 35541 36092 gene locus_tag LOCUS_16300 35541 36092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 36234 39428 gene locus_tag LOCUS_16310 gene carB 36234 39428 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141767.1 protein_id gnl|my_center|LOCUS_16310 39502 42582 gene locus_tag LOCUS_16320 39502 42582 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962208.1 protein_id gnl|my_center|LOCUS_16320 42579 43205 gene locus_tag LOCUS_16330 42579 43205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 43659 43847 gene locus_tag LOCUS_16340 43659 43847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 44022 44396 gene locus_tag LOCUS_16350 44022 44396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 44458 45387 gene locus_tag LOCUS_16360 44458 45387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 45449 46228 gene locus_tag LOCUS_16370 45449 46228 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921905.1 protein_id gnl|my_center|LOCUS_16370 46296 47675 gene locus_tag LOCUS_16380 46296 47675 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921573.1 protein_id gnl|my_center|LOCUS_16380 47769 48446 gene locus_tag LOCUS_16390 47769 48446 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965709.1 protein_id gnl|my_center|LOCUS_16390 48460 49092 gene locus_tag LOCUS_16400 48460 49092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 49089 50792 gene locus_tag LOCUS_16410 49089 50792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 50789 52003 gene locus_tag LOCUS_16420 50789 52003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 53531 52041 gene locus_tag LOCUS_16430 53531 52041 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870209.1 protein_id gnl|my_center|LOCUS_16430 54948 53545 gene locus_tag LOCUS_16440 gene trkA 54948 53545 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459869.1 protein_id gnl|my_center|LOCUS_16440 55076 55609 gene locus_tag LOCUS_16450 55076 55609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 56933 56214 gene locus_tag LOCUS_16460 56933 56214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 58081 56954 gene locus_tag LOCUS_16470 58081 56954 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921453.1 protein_id gnl|my_center|LOCUS_16470 60139 58253 gene locus_tag LOCUS_16480 60139 58253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 60026 60436 gene locus_tag LOCUS_16490 60026 60436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 60614 61417 gene locus_tag LOCUS_16500 60614 61417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 63696 61585 gene locus_tag LOCUS_16510 63696 61585 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215916.1 protein_id gnl|my_center|LOCUS_16510 67718 64086 gene locus_tag LOCUS_16520 67718 64086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 69586 67979 gene locus_tag LOCUS_16530 69586 67979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 69885 69583 gene locus_tag LOCUS_16540 69885 69583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 71892 69988 gene locus_tag LOCUS_16550 71892 69988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 72004 72972 gene locus_tag LOCUS_16560 72004 72972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 72954 74084 gene locus_tag LOCUS_16570 72954 74084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 74081 74692 gene locus_tag LOCUS_16580 74081 74692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 75735 74698 gene locus_tag LOCUS_16590 75735 74698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 76205 75732 gene locus_tag LOCUS_16600 76205 75732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 78578 76338 gene locus_tag LOCUS_16610 78578 76338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 78820 78575 gene locus_tag LOCUS_16620 78820 78575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 78737 79528 gene locus_tag LOCUS_16630 gene tcdA 78737 79528 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482313.1 protein_id gnl|my_center|LOCUS_16630 79772 79611 gene locus_tag LOCUS_16640 gene ykgO 79772 79611 CDS product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208618.1 protein_id gnl|my_center|LOCUS_16640 80063 79827 gene locus_tag LOCUS_16650 80063 79827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 79962 81401 gene locus_tag LOCUS_16660 79962 81401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 81445 81609 gene locus_tag LOCUS_16670 81445 81609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 81668 82264 gene locus_tag LOCUS_16680 81668 82264 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545392.1 protein_id gnl|my_center|LOCUS_16680 83011 82433 gene locus_tag LOCUS_16690 83011 82433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 83701 83165 gene locus_tag LOCUS_16700 gene ilvN 83701 83165 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_16700 85545 83818 gene locus_tag LOCUS_16710 gene ilvB 85545 83818 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398643.1 protein_id gnl|my_center|LOCUS_16710 85831 87015 gene locus_tag LOCUS_16720 85831 87015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 87018 87689 gene locus_tag LOCUS_16730 87018 87689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 87686 88123 gene locus_tag LOCUS_16740 87686 88123 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317468.1 protein_id gnl|my_center|LOCUS_16740 88890 88588 gene locus_tag LOCUS_16750 88890 88588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 88901 89194 gene locus_tag LOCUS_16760 88901 89194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 90299 89304 gene locus_tag LOCUS_16770 90299 89304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 90998 91840 gene locus_tag LOCUS_16780 90998 91840 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457108.1 protein_id gnl|my_center|LOCUS_16780 94241 91929 gene locus_tag LOCUS_16790 94241 91929 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_16790 95753 94299 gene locus_tag LOCUS_16800 95753 94299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 97189 95750 gene locus_tag LOCUS_16810 97189 95750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 97859 97257 gene locus_tag LOCUS_16820 97859 97257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 97968 98753 gene locus_tag LOCUS_16830 97968 98753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 98812 100131 gene locus_tag LOCUS_16840 98812 100131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 100160 102604 gene locus_tag LOCUS_16850 100160 102604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 102630 103640 gene locus_tag LOCUS_16860 102630 103640 CDS product CPBP family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928573.1 protein_id gnl|my_center|LOCUS_16860 104385 103621 gene locus_tag LOCUS_16870 104385 103621 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970080.1 protein_id gnl|my_center|LOCUS_16870 105349 104363 gene locus_tag LOCUS_16880 105349 104363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 105468 106319 gene locus_tag LOCUS_16890 105468 106319 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164690802.1 protein_id gnl|my_center|LOCUS_16890 106303 106725 gene locus_tag LOCUS_16900 106303 106725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 106781 107554 gene locus_tag LOCUS_16910 106781 107554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 107570 108322 gene locus_tag LOCUS_16920 107570 108322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 108382 110172 gene locus_tag LOCUS_16930 108382 110172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 110781 111326 gene locus_tag LOCUS_16940 110781 111326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 111551 113743 gene locus_tag LOCUS_16950 111551 113743 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166217565.1 protein_id gnl|my_center|LOCUS_16950 113766 117212 gene locus_tag LOCUS_16960 113766 117212 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016371.1 protein_id gnl|my_center|LOCUS_16960 117239 117529 gene locus_tag LOCUS_16970 117239 117529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 117595 121659 gene locus_tag LOCUS_16980 117595 121659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 121708 121866 gene locus_tag LOCUS_16990 121708 121866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 122321 122070 gene locus_tag LOCUS_17000 122321 122070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 123067 123777 gene locus_tag LOCUS_17010 123067 123777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 123818 124207 gene locus_tag LOCUS_17020 123818 124207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 124204 124410 gene locus_tag LOCUS_17030 124204 124410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 124407 124652 gene locus_tag LOCUS_17040 124407 124652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 124649 126166 gene locus_tag LOCUS_17050 124649 126166 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921199.1 protein_id gnl|my_center|LOCUS_17050 126554 126955 gene locus_tag LOCUS_17060 126554 126955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 127385 128449 gene locus_tag LOCUS_17070 gene clpX 127385 128449 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932095.1 protein_id gnl|my_center|LOCUS_17070 128521 128937 gene locus_tag LOCUS_17080 128521 128937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 129367 129870 gene locus_tag LOCUS_17090 129367 129870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 129883 131709 gene locus_tag LOCUS_17100 129883 131709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 132736 133275 gene locus_tag LOCUS_17110 132736 133275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 134229 133363 gene locus_tag LOCUS_17120 134229 133363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 135041 134226 gene locus_tag LOCUS_17130 135041 134226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 135405 135034 gene locus_tag LOCUS_17140 135405 135034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 >Feature sequence13 459 97 gene locus_tag LOCUS_17150 459 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 897 667 gene locus_tag LOCUS_17160 897 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 2999 1413 gene locus_tag LOCUS_17170 2999 1413 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767764.1 protein_id gnl|my_center|LOCUS_17170 4087 3062 gene locus_tag LOCUS_17180 4087 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 5424 4141 gene locus_tag LOCUS_17190 5424 4141 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545761.1 protein_id gnl|my_center|LOCUS_17190 5673 7955 gene locus_tag LOCUS_17200 5673 7955 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970720.1 protein_id gnl|my_center|LOCUS_17200 8007 8930 gene locus_tag LOCUS_17210 8007 8930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 8991 10868 gene locus_tag LOCUS_17220 8991 10868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 11675 10905 gene locus_tag LOCUS_17230 11675 10905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 11800 12408 gene locus_tag LOCUS_17240 gene lexA 11800 12408 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554100.1 protein_id gnl|my_center|LOCUS_17240 12771 14012 gene locus_tag LOCUS_17250 12771 14012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 14445 13987 gene locus_tag LOCUS_17260 14445 13987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 15125 14442 gene locus_tag LOCUS_17270 15125 14442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 15645 15145 gene locus_tag LOCUS_17280 15645 15145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 16244 15642 gene locus_tag LOCUS_17290 16244 15642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 16887 16225 gene locus_tag LOCUS_17300 gene rpoE 16887 16225 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813797.1 protein_id gnl|my_center|LOCUS_17300 18148 17156 gene locus_tag LOCUS_17310 18148 17156 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_17310 21745 18155 gene locus_tag LOCUS_17320 gene nifJ 21745 18155 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_237703763.1 protein_id gnl|my_center|LOCUS_17320 22048 23550 gene locus_tag LOCUS_17330 gene oadA 22048 23550 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870743.1 protein_id gnl|my_center|LOCUS_17330 23708 24085 gene locus_tag LOCUS_17340 23708 24085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 24706 24107 gene locus_tag LOCUS_17350 24706 24107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 25267 24749 gene locus_tag LOCUS_17360 25267 24749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 26211 25264 gene locus_tag LOCUS_17370 26211 25264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 27025 26255 gene locus_tag LOCUS_17380 gene proC 27025 26255 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943177.1 protein_id gnl|my_center|LOCUS_17380 27130 28830 gene locus_tag LOCUS_17390 27130 28830 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142357.1 protein_id gnl|my_center|LOCUS_17390 29088 29381 gene locus_tag LOCUS_17400 gene gatC 29088 29381 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_17400 29410 30816 gene locus_tag LOCUS_17410 gene gatA 29410 30816 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943992.1 protein_id gnl|my_center|LOCUS_17410 30921 32462 gene locus_tag LOCUS_17420 gene purH 30921 32462 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909162.1 protein_id gnl|my_center|LOCUS_17420 33177 32500 gene locus_tag LOCUS_17430 33177 32500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 34094 33171 gene locus_tag LOCUS_17440 34094 33171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 34238 35029 gene locus_tag LOCUS_17450 34238 35029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 35222 35037 gene locus_tag LOCUS_17460 35222 35037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 35252 36247 gene locus_tag LOCUS_17470 35252 36247 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326973.1 protein_id gnl|my_center|LOCUS_17470 36276 37301 gene locus_tag LOCUS_17480 36276 37301 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036148.1 protein_id gnl|my_center|LOCUS_17480 37308 37727 gene locus_tag LOCUS_17490 37308 37727 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972106.1 protein_id gnl|my_center|LOCUS_17490 37744 38592 gene locus_tag LOCUS_17500 gene nadC 37744 38592 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_17500 38612 39373 gene locus_tag LOCUS_17510 38612 39373 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403305.1 protein_id gnl|my_center|LOCUS_17510 39582 40034 gene locus_tag LOCUS_17520 39582 40034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 40167 41120 gene locus_tag LOCUS_17530 gene hprK 40167 41120 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958224.1 protein_id gnl|my_center|LOCUS_17530 41733 41122 gene locus_tag LOCUS_17540 41733 41122 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185693707.1 protein_id gnl|my_center|LOCUS_17540 42005 46675 gene locus_tag LOCUS_17550 gene gltB 42005 46675 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926853.1 protein_id gnl|my_center|LOCUS_17550 46725 48218 gene locus_tag LOCUS_17560 46725 48218 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_17560 50071 48281 gene locus_tag LOCUS_17570 50071 48281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 51138 50176 gene locus_tag LOCUS_17580 51138 50176 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_17580 51239 51802 gene locus_tag LOCUS_17590 51239 51802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 51867 52604 gene locus_tag LOCUS_17600 gene pyrH 51867 52604 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392548.1 protein_id gnl|my_center|LOCUS_17600 52649 53215 gene locus_tag LOCUS_17610 gene frr 52649 53215 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259405.1 protein_id gnl|my_center|LOCUS_17610 55042 53294 gene locus_tag LOCUS_17620 55042 53294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 55206 55039 gene locus_tag LOCUS_17630 55206 55039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 56605 55226 gene locus_tag LOCUS_17640 56605 55226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921337.1 protein_id gnl|my_center|LOCUS_17640 57904 56639 gene locus_tag LOCUS_17650 57904 56639 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258147.1 protein_id gnl|my_center|LOCUS_17650 57998 58861 gene locus_tag LOCUS_17660 57998 58861 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099264237.1 protein_id gnl|my_center|LOCUS_17660 58914 59969 gene locus_tag LOCUS_17670 58914 59969 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766598.1 protein_id gnl|my_center|LOCUS_17670 60816 60001 gene locus_tag LOCUS_17680 60816 60001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 60960 62240 gene locus_tag LOCUS_17690 60960 62240 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_17690 62259 63392 gene locus_tag LOCUS_17700 62259 63392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 63458 64210 gene locus_tag LOCUS_17710 63458 64210 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109792089.1 protein_id gnl|my_center|LOCUS_17710 64227 65768 gene locus_tag LOCUS_17720 64227 65768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 65776 67659 gene locus_tag LOCUS_17730 65776 67659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 67825 68994 gene locus_tag LOCUS_17740 67825 68994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 70336 69053 gene locus_tag LOCUS_17750 70336 69053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 71493 70573 gene locus_tag LOCUS_17760 gene panC 71493 70573 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533318.1 protein_id gnl|my_center|LOCUS_17760 71571 72608 gene locus_tag LOCUS_17770 gene gcvT 71571 72608 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631769.1 protein_id gnl|my_center|LOCUS_17770 72638 73015 gene locus_tag LOCUS_17780 gene gcvH 72638 73015 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069578.1 protein_id gnl|my_center|LOCUS_17780 73382 76582 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcatccccacgcgtgtggggaatgc 76988 76677 gene locus_tag LOCUS_17790 gene cas2e 76988 76677 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933634.1 protein_id gnl|my_center|LOCUS_17790 77881 76985 gene locus_tag LOCUS_17800 gene cas1e 77881 76985 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933633.1 protein_id gnl|my_center|LOCUS_17800 78360 77944 gene locus_tag LOCUS_17810 78360 77944 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680499.1 protein_id gnl|my_center|LOCUS_17810 78581 78363 gene locus_tag LOCUS_17820 78581 78363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 79344 78613 gene locus_tag LOCUS_17830 79344 78613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 80503 79337 gene locus_tag LOCUS_17840 gene cas7e 80503 79337 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933631.1 protein_id gnl|my_center|LOCUS_17840 81185 80544 gene locus_tag LOCUS_17850 gene cas6e 81185 80544 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933630.1 protein_id gnl|my_center|LOCUS_17850 81715 81185 gene locus_tag LOCUS_17860 gene casB 81715 81185 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933629.1 protein_id gnl|my_center|LOCUS_17860 82989 81712 gene locus_tag LOCUS_17870 82989 81712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 83232 83156 gene locus_tag LOCUS_t00180 83232 83156 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 84100 83450 gene locus_tag LOCUS_17880 84100 83450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 84152 84568 gene locus_tag LOCUS_17890 84152 84568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 85016 85276 gene locus_tag LOCUS_17900 85016 85276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 86442 87131 gene locus_tag LOCUS_17910 gene ispD 86442 87131 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393964.1 protein_id gnl|my_center|LOCUS_17910 87152 88360 gene locus_tag LOCUS_17920 87152 88360 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_17920 88377 89069 gene locus_tag LOCUS_17930 88377 89069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 89079 89852 gene locus_tag LOCUS_17940 89079 89852 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257316.1 protein_id gnl|my_center|LOCUS_17940 89918 91477 gene locus_tag LOCUS_17950 89918 91477 CDS product glucan biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921572.1 protein_id gnl|my_center|LOCUS_17950 91453 92043 gene locus_tag LOCUS_17960 91453 92043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 92043 94190 gene locus_tag LOCUS_17970 92043 94190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 94205 95383 gene locus_tag LOCUS_17980 gene galK 94205 95383 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456582.1 protein_id gnl|my_center|LOCUS_17980 95605 96300 gene locus_tag LOCUS_17990 95605 96300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 96939 96304 gene locus_tag LOCUS_18000 96939 96304 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244073.1 protein_id gnl|my_center|LOCUS_18000 99491 96951 gene locus_tag LOCUS_18010 99491 96951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 102832 99581 gene locus_tag LOCUS_18020 102832 99581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 103821 102994 gene locus_tag LOCUS_18030 103821 102994 CDS product heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722373.1 protein_id gnl|my_center|LOCUS_18030 104963 103827 gene locus_tag LOCUS_18040 104963 103827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 105101 105337 gene locus_tag LOCUS_18050 105101 105337 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764038.1 protein_id gnl|my_center|LOCUS_18050 105334 105729 gene locus_tag LOCUS_18060 105334 105729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 105757 106809 gene locus_tag LOCUS_18070 105757 106809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 106796 107158 gene locus_tag LOCUS_18080 106796 107158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 107178 107636 gene locus_tag LOCUS_18090 107178 107636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 107633 109792 gene locus_tag LOCUS_18100 107633 109792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 111032 109944 gene locus_tag LOCUS_18110 gene corA 111032 109944 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141025.1 protein_id gnl|my_center|LOCUS_18110 111128 111964 gene locus_tag LOCUS_18120 111128 111964 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015835.1 protein_id gnl|my_center|LOCUS_18120 111961 112734 gene locus_tag LOCUS_18130 111961 112734 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081576.1 protein_id gnl|my_center|LOCUS_18130 113641 112715 gene locus_tag LOCUS_18140 113641 112715 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037769.1 protein_id gnl|my_center|LOCUS_18140 114992 113646 gene locus_tag LOCUS_18150 gene lysA 114992 113646 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_18150 116221 115013 gene locus_tag LOCUS_18160 116221 115013 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726980.1 protein_id gnl|my_center|LOCUS_18160 116427 116218 gene locus_tag LOCUS_18170 116427 116218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 116698 118209 gene locus_tag LOCUS_18180 116698 118209 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117896.1 protein_id gnl|my_center|LOCUS_18180 119509 121665 gene locus_tag LOCUS_18190 119509 121665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 >Feature sequence14 279 851 gene locus_tag LOCUS_18200 279 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 1663 869 gene locus_tag LOCUS_18210 1663 869 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_18210 1831 2820 gene locus_tag LOCUS_18220 gene pta 1831 2820 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722362.1 protein_id gnl|my_center|LOCUS_18220 3740 2868 gene locus_tag LOCUS_18230 3740 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 5275 3824 gene locus_tag LOCUS_18240 5275 3824 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122596.1 protein_id gnl|my_center|LOCUS_18240 8435 5292 gene locus_tag LOCUS_18250 8435 5292 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122595.1 protein_id gnl|my_center|LOCUS_18250 9715 8504 gene locus_tag LOCUS_18260 gene lpxK 9715 8504 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626176.1 protein_id gnl|my_center|LOCUS_18260 10888 9803 gene locus_tag LOCUS_18270 10888 9803 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963770.1 protein_id gnl|my_center|LOCUS_18270 12865 10940 gene locus_tag LOCUS_18280 12865 10940 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_18280 13880 12885 gene locus_tag LOCUS_18290 gene purM 13880 12885 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222409.1 protein_id gnl|my_center|LOCUS_18290 14172 14822 gene locus_tag LOCUS_18300 14172 14822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 14826 15590 gene locus_tag LOCUS_18310 14826 15590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 15602 16513 gene locus_tag LOCUS_18320 15602 16513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 16526 17803 gene locus_tag LOCUS_18330 16526 17803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 17920 18333 gene locus_tag LOCUS_18340 17920 18333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 18461 20248 gene locus_tag LOCUS_18350 18461 20248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 20254 20790 gene locus_tag LOCUS_18360 20254 20790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 20826 21614 gene locus_tag LOCUS_18370 20826 21614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 21628 23436 gene locus_tag LOCUS_18380 21628 23436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 23433 24113 gene locus_tag LOCUS_18390 23433 24113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 24110 25807 gene locus_tag LOCUS_18400 24110 25807 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869802.1 protein_id gnl|my_center|LOCUS_18400 25800 26945 gene locus_tag LOCUS_18410 25800 26945 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002231344.1 protein_id gnl|my_center|LOCUS_18410 26993 27406 gene locus_tag LOCUS_18420 26993 27406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 27453 27863 gene locus_tag LOCUS_18430 27453 27863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 27860 28330 gene locus_tag LOCUS_18440 27860 28330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 28327 29118 gene locus_tag LOCUS_18450 28327 29118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 29115 29939 gene locus_tag LOCUS_18460 29115 29939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 29936 30436 gene locus_tag LOCUS_18470 29936 30436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 30467 31267 gene locus_tag LOCUS_18480 30467 31267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 31280 32005 gene locus_tag LOCUS_18490 31280 32005 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928634.1 protein_id gnl|my_center|LOCUS_18490 32269 32015 gene locus_tag LOCUS_18500 32269 32015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 32631 32266 gene locus_tag LOCUS_18510 32631 32266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 36939 32728 gene locus_tag LOCUS_18520 gene rpoC 36939 32728 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871661.1 protein_id gnl|my_center|LOCUS_18520 40940 36987 gene locus_tag LOCUS_18530 gene rpoB 40940 36987 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012263639.1 protein_id gnl|my_center|LOCUS_18530 41511 41137 gene locus_tag LOCUS_18540 gene rplL 41511 41137 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531413.1 protein_id gnl|my_center|LOCUS_18540 42175 41645 gene locus_tag LOCUS_18550 gene rplJ 42175 41645 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235042.1 protein_id gnl|my_center|LOCUS_18550 42904 42197 gene locus_tag LOCUS_18560 gene rplA 42904 42197 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811658.1 protein_id gnl|my_center|LOCUS_18560 43423 42995 gene locus_tag LOCUS_18570 gene rplK 43423 42995 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085792.1 protein_id gnl|my_center|LOCUS_18570 44058 43489 gene locus_tag LOCUS_18580 gene nusG 44058 43489 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390510.1 protein_id gnl|my_center|LOCUS_18580 44421 44098 gene locus_tag LOCUS_18590 44421 44098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 44529 44454 gene locus_tag LOCUS_t00190 44529 44454 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 45812 44628 gene locus_tag LOCUS_18600 gene tuf 45812 44628 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919120.1 protein_id gnl|my_center|LOCUS_18600 45929 45855 gene locus_tag LOCUS_t00200 45929 45855 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 47050 46232 gene locus_tag LOCUS_18610 47050 46232 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_18610 47126 48427 gene locus_tag LOCUS_18620 47126 48427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 54857 48432 gene locus_tag LOCUS_18630 54857 48432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 58762 54899 gene locus_tag LOCUS_18640 58762 54899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 60146 58839 gene locus_tag LOCUS_18650 60146 58839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 60760 60164 gene locus_tag LOCUS_18660 60760 60164 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327230.1 protein_id gnl|my_center|LOCUS_18660 61352 60798 gene locus_tag LOCUS_18670 61352 60798 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329717.1 protein_id gnl|my_center|LOCUS_18670 61446 61763 gene locus_tag LOCUS_18680 61446 61763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 62573 61770 gene locus_tag LOCUS_18690 62573 61770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 62934 62548 gene locus_tag LOCUS_18700 62934 62548 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383039.1 protein_id gnl|my_center|LOCUS_18700 63723 63094 gene locus_tag LOCUS_18710 gene gmk 63723 63094 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008153.1 protein_id gnl|my_center|LOCUS_18710 63834 64472 gene locus_tag LOCUS_18720 63834 64472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 64520 66601 gene locus_tag LOCUS_18730 64520 66601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 66673 67878 gene locus_tag LOCUS_18740 66673 67878 CDS product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037245.1 protein_id gnl|my_center|LOCUS_18740 68947 68057 gene locus_tag LOCUS_18750 68947 68057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 69028 69948 gene locus_tag LOCUS_18760 69028 69948 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216918.1 protein_id gnl|my_center|LOCUS_18760 69945 70745 gene locus_tag LOCUS_18770 gene mazG 69945 70745 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941834.1 protein_id gnl|my_center|LOCUS_18770 71083 71009 gene locus_tag LOCUS_t00210 71083 71009 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 72358 71162 gene locus_tag LOCUS_18780 gene kbl 72358 71162 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036153.1 protein_id gnl|my_center|LOCUS_18780 73231 72422 gene locus_tag LOCUS_18790 73231 72422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 74092 73370 gene locus_tag LOCUS_18800 74092 73370 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583447.1 protein_id gnl|my_center|LOCUS_18800 75148 74165 gene locus_tag LOCUS_18810 75148 74165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 76079 75153 gene locus_tag LOCUS_18820 76079 75153 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057759.1 protein_id gnl|my_center|LOCUS_18820 76939 76082 gene locus_tag LOCUS_18830 76939 76082 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325468.1 protein_id gnl|my_center|LOCUS_18830 77061 77894 gene locus_tag LOCUS_18840 77061 77894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927025.1 protein_id gnl|my_center|LOCUS_18840 77917 78210 gene locus_tag LOCUS_18850 77917 78210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 78207 80252 gene locus_tag LOCUS_18860 78207 80252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 81727 80270 gene locus_tag LOCUS_18870 81727 80270 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404676.1 protein_id gnl|my_center|LOCUS_18870 82503 81739 gene locus_tag LOCUS_18880 gene truA 82503 81739 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393903.1 protein_id gnl|my_center|LOCUS_18880 83929 82850 gene locus_tag LOCUS_18890 gene recA 83929 82850 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933587.1 protein_id gnl|my_center|LOCUS_18890 84064 85878 gene locus_tag LOCUS_18900 84064 85878 CDS product OPT family oligopeptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768135.1 protein_id gnl|my_center|LOCUS_18900 86727 85879 gene locus_tag LOCUS_18910 86727 85879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 87883 86795 gene locus_tag LOCUS_18920 87883 86795 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163568.1 protein_id gnl|my_center|LOCUS_18920 88634 87921 gene locus_tag LOCUS_18930 88634 87921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 88737 89957 gene locus_tag LOCUS_18940 88737 89957 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_18940 89981 90904 gene locus_tag LOCUS_18950 89981 90904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140563.1 protein_id gnl|my_center|LOCUS_18950 90988 94518 gene locus_tag LOCUS_18960 90988 94518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 95405 94524 gene locus_tag LOCUS_18970 95405 94524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 96830 95418 gene locus_tag LOCUS_18980 96830 95418 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804150.1 protein_id gnl|my_center|LOCUS_18980 97046 98422 gene locus_tag LOCUS_18990 gene miaB 97046 98422 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809403.1 protein_id gnl|my_center|LOCUS_18990 99231 98461 gene locus_tag LOCUS_19000 99231 98461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969420.1 protein_id gnl|my_center|LOCUS_19000 100952 99276 gene locus_tag LOCUS_19010 gene atsA 100952 99276 CDS product arylsulfatase AtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106692.1 protein_id gnl|my_center|LOCUS_19010 101738 101190 gene locus_tag LOCUS_19020 gene gspG 101738 101190 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038520.1 protein_id gnl|my_center|LOCUS_19020 103210 101924 gene locus_tag LOCUS_19030 103210 101924 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_19030 104967 103297 gene locus_tag LOCUS_19040 104967 103297 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332509.1 protein_id gnl|my_center|LOCUS_19040 106695 105016 gene locus_tag LOCUS_19050 106695 105016 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922562.1 protein_id gnl|my_center|LOCUS_19050 107812 106883 gene locus_tag LOCUS_19060 107812 106883 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615678.1 protein_id gnl|my_center|LOCUS_19060 109159 107864 gene locus_tag LOCUS_19070 109159 107864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922607.1 protein_id gnl|my_center|LOCUS_19070 110018 109176 gene locus_tag LOCUS_19080 110018 109176 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932752.1 protein_id gnl|my_center|LOCUS_19080 111529 110015 gene locus_tag LOCUS_19090 111529 110015 CDS product TIGR03663 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878256.1 protein_id gnl|my_center|LOCUS_19090 111591 112322 gene locus_tag LOCUS_19100 111591 112322 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_19100 112378 112677 gene locus_tag LOCUS_19110 112378 112677 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953396.1 protein_id gnl|my_center|LOCUS_19110 112740 113462 gene locus_tag LOCUS_19120 112740 113462 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121737.1 protein_id gnl|my_center|LOCUS_19120 113518 113952 gene locus_tag LOCUS_19130 gene fucU 113518 113952 CDS product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920829.1 protein_id gnl|my_center|LOCUS_19130 115607 113985 gene locus_tag LOCUS_19140 115607 113985 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530132.1 protein_id gnl|my_center|LOCUS_19140 115697 116254 gene locus_tag LOCUS_19150 gene grpE 115697 116254 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392711.1 protein_id gnl|my_center|LOCUS_19150 116261 117403 gene locus_tag LOCUS_19160 gene dnaJ 116261 117403 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482993.1 protein_id gnl|my_center|LOCUS_19160 117434 118150 gene locus_tag LOCUS_19170 117434 118150 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194189.1 protein_id gnl|my_center|LOCUS_19170 118214 119317 gene locus_tag LOCUS_19180 118214 119317 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119313.1 protein_id gnl|my_center|LOCUS_19180 119425 120384 gene locus_tag LOCUS_19190 119425 120384 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938705.1 protein_id gnl|my_center|LOCUS_19190 >Feature sequence15 1104 109 gene locus_tag LOCUS_19200 1104 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 5007 1216 gene locus_tag LOCUS_19210 gene smc 5007 1216 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460497.1 protein_id gnl|my_center|LOCUS_19210 5335 6564 gene locus_tag LOCUS_19220 5335 6564 CDS product pyrophosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922349.1 protein_id gnl|my_center|LOCUS_19220 8186 6639 gene locus_tag LOCUS_19230 8186 6639 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941965.1 protein_id gnl|my_center|LOCUS_19230 8716 8192 gene locus_tag LOCUS_19240 8716 8192 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085277.1 protein_id gnl|my_center|LOCUS_19240 9332 8916 gene locus_tag LOCUS_19250 9332 8916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 9657 9322 gene locus_tag LOCUS_19260 9657 9322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 10723 9788 gene locus_tag LOCUS_19270 gene nadA 10723 9788 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140196.1 protein_id gnl|my_center|LOCUS_19270 11595 10768 gene locus_tag LOCUS_19280 11595 10768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 12270 11635 gene locus_tag LOCUS_19290 12270 11635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 13142 12270 gene locus_tag LOCUS_19300 13142 12270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 13241 14443 gene locus_tag LOCUS_19310 gene lpxB 13241 14443 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_19310 14491 14682 gene locus_tag LOCUS_19320 14491 14682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 15314 14676 gene locus_tag LOCUS_19330 15314 14676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 15356 17287 gene locus_tag LOCUS_19340 15356 17287 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339215.1 protein_id gnl|my_center|LOCUS_19340 17786 17277 gene locus_tag LOCUS_19350 17786 17277 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084789.1 protein_id gnl|my_center|LOCUS_19350 17931 20006 gene locus_tag LOCUS_19360 17931 20006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 20041 21327 gene locus_tag LOCUS_19370 gene nuoD 20041 21327 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_19370 21346 21918 gene locus_tag LOCUS_19380 21346 21918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 21951 22253 gene locus_tag LOCUS_19390 21951 22253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 22241 22642 gene locus_tag LOCUS_19400 22241 22642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 22652 24046 gene locus_tag LOCUS_19410 gene nuoF 22652 24046 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964317.1 protein_id gnl|my_center|LOCUS_19410 24121 25146 gene locus_tag LOCUS_19420 24121 25146 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_19420 25143 25652 gene locus_tag LOCUS_19430 25143 25652 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577036.1 protein_id gnl|my_center|LOCUS_19430 25649 26953 gene locus_tag LOCUS_19440 25649 26953 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378953.1 protein_id gnl|my_center|LOCUS_19440 26996 27460 gene locus_tag LOCUS_19450 26996 27460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 28272 27472 gene locus_tag LOCUS_19460 28272 27472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 29447 28287 gene locus_tag LOCUS_19470 29447 28287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 29449 29733 gene locus_tag LOCUS_19480 29449 29733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 30922 29738 gene locus_tag LOCUS_19490 30922 29738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 31103 31987 gene locus_tag LOCUS_19500 gene hisG 31103 31987 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_19500 32205 33002 gene locus_tag LOCUS_19510 32205 33002 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017868968.1 protein_id gnl|my_center|LOCUS_19510 33011 33766 gene locus_tag LOCUS_19520 33011 33766 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480305.1 protein_id gnl|my_center|LOCUS_19520 33971 34044 gene locus_tag LOCUS_t00220 33971 34044 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 34075 34698 gene locus_tag LOCUS_19530 34075 34698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 34867 36015 gene locus_tag LOCUS_19540 34867 36015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 36147 38327 gene locus_tag LOCUS_19550 36147 38327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 38384 38911 gene locus_tag LOCUS_19560 38384 38911 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389241.1 protein_id gnl|my_center|LOCUS_19560 39003 39653 gene locus_tag LOCUS_19570 39003 39653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 39741 41981 gene locus_tag LOCUS_19580 39741 41981 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329904.1 protein_id gnl|my_center|LOCUS_19580 41978 42709 gene locus_tag LOCUS_19590 41978 42709 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880129.1 protein_id gnl|my_center|LOCUS_19590 42710 43036 gene locus_tag LOCUS_19600 42710 43036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 43061 45112 gene locus_tag LOCUS_19610 gene recG 43061 45112 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545417.1 protein_id gnl|my_center|LOCUS_19610 45190 46392 gene locus_tag LOCUS_19620 gene rodA 45190 46392 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392081.1 protein_id gnl|my_center|LOCUS_19620 46470 48008 gene locus_tag LOCUS_19630 gene gpmI 46470 48008 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943825.1 protein_id gnl|my_center|LOCUS_19630 50762 48030 gene locus_tag LOCUS_19640 50762 48030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 51040 51798 gene locus_tag LOCUS_19650 51040 51798 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364422.1 protein_id gnl|my_center|LOCUS_19650 51834 52364 gene locus_tag LOCUS_19660 gene msrB 51834 52364 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894168.1 protein_id gnl|my_center|LOCUS_19660 52407 53447 gene locus_tag LOCUS_19670 52407 53447 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_19670 55474 53471 gene locus_tag LOCUS_19680 55474 53471 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327900.1 protein_id gnl|my_center|LOCUS_19680 55641 55726 gene locus_tag LOCUS_t00230 55641 55726 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 59071 56006 gene locus_tag LOCUS_19690 gene secA 59071 56006 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932908.1 protein_id gnl|my_center|LOCUS_19690 59615 59277 gene locus_tag LOCUS_19700 59615 59277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 59968 59687 gene locus_tag LOCUS_19710 59968 59687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 62292 60010 gene locus_tag LOCUS_19720 62292 60010 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939521.1 protein_id gnl|my_center|LOCUS_19720 62404 63108 gene locus_tag LOCUS_19730 62404 63108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 63112 64512 gene locus_tag LOCUS_19740 63112 64512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 64621 65634 gene locus_tag LOCUS_19750 64621 65634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 68065 65693 gene locus_tag LOCUS_19760 68065 65693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 69138 68062 gene locus_tag LOCUS_19770 69138 68062 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035469.1 protein_id gnl|my_center|LOCUS_19770 70022 69267 gene locus_tag LOCUS_19780 70022 69267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 71323 70145 gene locus_tag LOCUS_19790 gene hsdS 71323 70145 CDS product type I restriction-modification system specificity subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014003.1 protein_id gnl|my_center|LOCUS_19790 72777 71320 gene locus_tag LOCUS_19800 72777 71320 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728610.1 protein_id gnl|my_center|LOCUS_19800 73075 72988 gene locus_tag LOCUS_t00240 73075 72988 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 73289 74431 gene locus_tag LOCUS_19810 73289 74431 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393758.1 protein_id gnl|my_center|LOCUS_19810 74504 74575 gene locus_tag LOCUS_t00250 74504 74575 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 74715 75146 gene locus_tag LOCUS_19820 74715 75146 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170040.1 protein_id gnl|my_center|LOCUS_19820 76035 75154 gene locus_tag LOCUS_19830 76035 75154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 76282 77112 gene locus_tag LOCUS_19840 76282 77112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 77173 77673 gene locus_tag LOCUS_19850 77173 77673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 77704 78729 gene locus_tag LOCUS_19860 77704 78729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 80139 78751 gene locus_tag LOCUS_19870 80139 78751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 80357 80656 gene locus_tag LOCUS_19880 80357 80656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 81484 80705 gene locus_tag LOCUS_19890 81484 80705 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_19890 81590 83233 gene locus_tag LOCUS_19900 81590 83233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 84151 83252 gene locus_tag LOCUS_19910 gene metF 84151 83252 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933036.1 protein_id gnl|my_center|LOCUS_19910 84272 85117 gene locus_tag LOCUS_19920 84272 85117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 87731 85293 gene locus_tag LOCUS_19930 gene secDF 87731 85293 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971714.1 protein_id gnl|my_center|LOCUS_19930 88123 87785 gene locus_tag LOCUS_19940 88123 87785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 89340 88120 gene locus_tag LOCUS_19950 gene tgt 89340 88120 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_19950 89833 90054 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gactgcgacaaggagaagaaggaagaaggcaccctc 90207 90587 gene locus_tag LOCUS_19960 gene mutT 90207 90587 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932370.1 protein_id gnl|my_center|LOCUS_19960 90653 92554 gene locus_tag LOCUS_19970 90653 92554 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816805.1 protein_id gnl|my_center|LOCUS_19970 92559 93860 gene locus_tag LOCUS_19980 92559 93860 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327912.1 protein_id gnl|my_center|LOCUS_19980 94524 93871 gene locus_tag LOCUS_19990 94524 93871 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071971.1 protein_id gnl|my_center|LOCUS_19990 95542 94538 gene locus_tag LOCUS_20000 95542 94538 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357312.1 protein_id gnl|my_center|LOCUS_20000 96278 95559 gene locus_tag LOCUS_20010 gene plsY 96278 95559 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880403.1 protein_id gnl|my_center|LOCUS_20010 96957 96328 gene locus_tag LOCUS_20020 96957 96328 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191635.1 protein_id gnl|my_center|LOCUS_20020 98685 97099 gene locus_tag LOCUS_20030 98685 97099 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921665.1 protein_id gnl|my_center|LOCUS_20030 100159 98855 gene locus_tag LOCUS_20040 100159 98855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 100301 101083 gene locus_tag LOCUS_20050 100301 101083 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123462.1 protein_id gnl|my_center|LOCUS_20050 101083 102756 gene locus_tag LOCUS_20060 101083 102756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 102776 104149 gene locus_tag LOCUS_20070 102776 104149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 104140 104361 gene locus_tag LOCUS_20080 104140 104361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 104483 104557 gene locus_tag LOCUS_t00260 104483 104557 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 106012 104621 gene locus_tag LOCUS_20090 106012 104621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 108373 106106 gene locus_tag LOCUS_20100 108373 106106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 109904 108453 gene locus_tag LOCUS_20110 109904 108453 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121095.1 protein_id gnl|my_center|LOCUS_20110 111217 109901 gene locus_tag LOCUS_20120 111217 109901 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118279.1 protein_id gnl|my_center|LOCUS_20120 111339 111758 gene locus_tag LOCUS_20130 gene queF 111339 111758 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689837.1 protein_id gnl|my_center|LOCUS_20130 111755 112435 gene locus_tag LOCUS_20140 gene queC 111755 112435 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533307.1 protein_id gnl|my_center|LOCUS_20140 114834 112453 gene locus_tag LOCUS_20150 114834 112453 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 protein_id gnl|my_center|LOCUS_20150 115436 114831 gene locus_tag LOCUS_20160 115436 114831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 116008 115433 gene locus_tag LOCUS_20170 116008 115433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 >Feature sequence16 1947 673 gene locus_tag LOCUS_20180 1947 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 2787 1969 gene locus_tag LOCUS_20190 gene kdsA 2787 1969 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_20190 3092 2820 gene locus_tag LOCUS_20200 3092 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 3384 5030 gene locus_tag LOCUS_20210 3384 5030 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143151.1 protein_id gnl|my_center|LOCUS_20210 5087 6079 gene locus_tag LOCUS_20220 5087 6079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 6079 7314 gene locus_tag LOCUS_20230 6079 7314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 7380 10943 gene locus_tag LOCUS_20240 7380 10943 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121781.1 protein_id gnl|my_center|LOCUS_20240 10978 11817 gene locus_tag LOCUS_20250 10978 11817 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159609.1 protein_id gnl|my_center|LOCUS_20250 13100 11823 gene locus_tag LOCUS_20260 13100 11823 CDS product DUF3472 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121875.1 protein_id gnl|my_center|LOCUS_20260 13241 13600 gene locus_tag LOCUS_20270 13241 13600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 13602 14180 gene locus_tag LOCUS_20280 13602 14180 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398496.1 protein_id gnl|my_center|LOCUS_20280 18198 14170 gene locus_tag LOCUS_20290 18198 14170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 20099 18324 gene locus_tag LOCUS_20300 20099 18324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 20370 21293 gene locus_tag LOCUS_20310 20370 21293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 22037 21336 gene locus_tag LOCUS_20320 22037 21336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 23970 22270 gene locus_tag LOCUS_20330 gene lnt 23970 22270 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527902.1 protein_id gnl|my_center|LOCUS_20330 24566 24060 gene locus_tag LOCUS_20340 24566 24060 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223545.1 protein_id gnl|my_center|LOCUS_20340 24705 25670 gene locus_tag LOCUS_20350 gene pfkB 24705 25670 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256696.1 protein_id gnl|my_center|LOCUS_20350 28367 25899 gene locus_tag LOCUS_20360 28367 25899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 30854 28608 gene locus_tag LOCUS_20370 30854 28608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 30951 32210 gene locus_tag LOCUS_20380 30951 32210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 32656 32207 gene locus_tag LOCUS_20390 32656 32207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 32762 34009 gene locus_tag LOCUS_20400 32762 34009 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921846.1 protein_id gnl|my_center|LOCUS_20400 34764 34006 gene locus_tag LOCUS_20410 34764 34006 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921845.1 protein_id gnl|my_center|LOCUS_20410 34851 35807 gene locus_tag LOCUS_20420 34851 35807 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114954.1 protein_id gnl|my_center|LOCUS_20420 35829 36734 gene locus_tag LOCUS_20430 35829 36734 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037553.1 protein_id gnl|my_center|LOCUS_20430 36895 38448 gene locus_tag LOCUS_20440 36895 38448 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178932430.1 protein_id gnl|my_center|LOCUS_20440 39961 38555 gene locus_tag LOCUS_20450 39961 38555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 41188 39965 gene locus_tag LOCUS_20460 41188 39965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 41682 41269 gene locus_tag LOCUS_20470 41682 41269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 42205 41735 gene locus_tag LOCUS_20480 42205 41735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 42738 42202 gene locus_tag LOCUS_20490 42738 42202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 42817 43311 gene locus_tag LOCUS_20500 42817 43311 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567255.1 protein_id gnl|my_center|LOCUS_20500 44071 43256 gene locus_tag LOCUS_20510 44071 43256 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112481.1 protein_id gnl|my_center|LOCUS_20510 44201 45115 gene locus_tag LOCUS_20520 44201 45115 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_20520 45180 47513 gene locus_tag LOCUS_20530 45180 47513 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942207.1 protein_id gnl|my_center|LOCUS_20530 47578 49287 gene locus_tag LOCUS_20540 47578 49287 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918141.1 protein_id gnl|my_center|LOCUS_20540 50361 49321 gene locus_tag LOCUS_20550 50361 49321 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460176.1 protein_id gnl|my_center|LOCUS_20550 51220 50429 gene locus_tag LOCUS_20560 51220 50429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 52040 51252 gene locus_tag LOCUS_20570 52040 51252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 52179 52838 gene locus_tag LOCUS_20580 52179 52838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 52881 53684 gene locus_tag LOCUS_20590 52881 53684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 53689 55071 gene locus_tag LOCUS_20600 53689 55071 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943829.1 protein_id gnl|my_center|LOCUS_20600 56106 55132 gene locus_tag LOCUS_20610 56106 55132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 58843 56138 gene locus_tag LOCUS_20620 58843 56138 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931302.1 protein_id gnl|my_center|LOCUS_20620 60809 59346 gene locus_tag LOCUS_20630 60809 59346 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153442001.1 protein_id gnl|my_center|LOCUS_20630 64047 60880 gene locus_tag LOCUS_20640 64047 60880 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020677315.1 protein_id gnl|my_center|LOCUS_20640 65162 64383 gene locus_tag LOCUS_20650 65162 64383 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922761.1 protein_id gnl|my_center|LOCUS_20650 66568 65159 gene locus_tag LOCUS_20660 66568 65159 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303131.1 protein_id gnl|my_center|LOCUS_20660 68750 66588 gene locus_tag LOCUS_20670 68750 66588 CDS product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228212.1 protein_id gnl|my_center|LOCUS_20670 71720 68769 gene locus_tag LOCUS_20680 71720 68769 CDS product DUF4982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108444.1 protein_id gnl|my_center|LOCUS_20680 74296 71735 gene locus_tag LOCUS_20690 74296 71735 CDS product glycosyl hydrolase 115 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639999.1 protein_id gnl|my_center|LOCUS_20690 76534 74444 gene locus_tag LOCUS_20700 gene fusA 76534 74444 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774533.1 protein_id gnl|my_center|LOCUS_20700 76772 77983 gene locus_tag LOCUS_20710 76772 77983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 78041 79288 gene locus_tag LOCUS_20720 78041 79288 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205413.1 protein_id gnl|my_center|LOCUS_20720 80321 79305 gene locus_tag LOCUS_20730 80321 79305 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545040.1 protein_id gnl|my_center|LOCUS_20730 80575 80318 gene locus_tag LOCUS_20740 80575 80318 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 protein_id gnl|my_center|LOCUS_20740 81323 80598 gene locus_tag LOCUS_20750 81323 80598 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258270.1 protein_id gnl|my_center|LOCUS_20750 83661 81370 gene locus_tag LOCUS_20760 83661 81370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 84308 83718 gene locus_tag LOCUS_20770 84308 83718 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_20770 84395 85519 gene locus_tag LOCUS_20780 gene moeB 84395 85519 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_20780 86707 85520 gene locus_tag LOCUS_20790 86707 85520 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109136.1 protein_id gnl|my_center|LOCUS_20790 88017 86788 gene locus_tag LOCUS_20800 88017 86788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 91412 88014 gene locus_tag LOCUS_20810 91412 88014 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392027.1 protein_id gnl|my_center|LOCUS_20810 92086 91409 gene locus_tag LOCUS_20820 92086 91409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 93556 92102 gene locus_tag LOCUS_20830 93556 92102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 96201 93577 gene locus_tag LOCUS_20840 gene gyrA 96201 93577 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282864.1 protein_id gnl|my_center|LOCUS_20840 96604 96230 gene locus_tag LOCUS_20850 96604 96230 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404040.1 protein_id gnl|my_center|LOCUS_20850 99200 96654 gene locus_tag LOCUS_20860 gene gyrB 99200 96654 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704050.1 protein_id gnl|my_center|LOCUS_20860 99499 99323 gene locus_tag LOCUS_20870 99499 99323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 99450 99623 gene locus_tag LOCUS_20880 99450 99623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 100772 99711 gene locus_tag LOCUS_20890 100772 99711 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941112.1 protein_id gnl|my_center|LOCUS_20890 102160 100937 gene locus_tag LOCUS_20900 102160 100937 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943175.1 protein_id gnl|my_center|LOCUS_20900 102339 102776 gene locus_tag LOCUS_20910 gene gspG 102339 102776 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880232.1 protein_id gnl|my_center|LOCUS_20910 102751 103311 gene locus_tag LOCUS_20920 102751 103311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 103356 103724 gene locus_tag LOCUS_20930 103356 103724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 103721 104533 gene locus_tag LOCUS_20940 103721 104533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 104538 105476 gene locus_tag LOCUS_20950 104538 105476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 105473 106717 gene locus_tag LOCUS_20960 105473 106717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 106772 107308 gene locus_tag LOCUS_20970 106772 107308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 107328 107996 gene locus_tag LOCUS_20980 107328 107996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 108033 110612 gene locus_tag LOCUS_20990 108033 110612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 >Feature sequence17 540 103 gene locus_tag LOCUS_21000 540 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 1157 645 gene locus_tag LOCUS_21010 1157 645 CDS product DUF4494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005806131.1 protein_id gnl|my_center|LOCUS_21010 1777 2076 gene locus_tag LOCUS_21020 1777 2076 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390816.1 protein_id gnl|my_center|LOCUS_21020 5105 3324 gene locus_tag LOCUS_21030 5105 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 7623 5107 gene locus_tag LOCUS_21040 7623 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 9551 7620 gene locus_tag LOCUS_21050 9551 7620 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222767.1 protein_id gnl|my_center|LOCUS_21050 12823 9575 gene locus_tag LOCUS_21060 12823 9575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 15190 13382 gene locus_tag LOCUS_21070 15190 13382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 17499 15340 gene locus_tag LOCUS_21080 17499 15340 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767035.1 protein_id gnl|my_center|LOCUS_21080 23114 17502 gene locus_tag LOCUS_21090 23114 17502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 24023 23370 gene locus_tag LOCUS_21100 24023 23370 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_21100 26698 24035 gene locus_tag LOCUS_21110 26698 24035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 28230 27076 gene locus_tag LOCUS_21120 28230 27076 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203436.1 protein_id gnl|my_center|LOCUS_21120 31531 28259 gene locus_tag LOCUS_21130 31531 28259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 34652 31722 gene locus_tag LOCUS_21140 34652 31722 CDS product family 78 glycoside hydrolase catalytic domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226935.1 protein_id gnl|my_center|LOCUS_21140 36696 34735 gene locus_tag LOCUS_21150 36696 34735 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265628.1 protein_id gnl|my_center|LOCUS_21150 37759 36932 gene locus_tag LOCUS_21160 37759 36932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 40194 37792 gene locus_tag LOCUS_21170 40194 37792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 42826 40613 gene locus_tag LOCUS_21180 42826 40613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 43392 42826 gene locus_tag LOCUS_21190 43392 42826 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336412.1 protein_id gnl|my_center|LOCUS_21190 45501 43480 gene locus_tag LOCUS_21200 45501 43480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 48546 45664 gene locus_tag LOCUS_21210 48546 45664 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203206.1 protein_id gnl|my_center|LOCUS_21210 50138 48699 gene locus_tag LOCUS_21220 50138 48699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 53848 50135 gene locus_tag LOCUS_21230 53848 50135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 56505 53845 gene locus_tag LOCUS_21240 56505 53845 CDS product DUF5703 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765773.1 protein_id gnl|my_center|LOCUS_21240 59781 56965 gene locus_tag LOCUS_21250 59781 56965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 62992 60056 gene locus_tag LOCUS_21260 62992 60056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 65044 63002 gene locus_tag LOCUS_21270 65044 63002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 68124 65065 gene locus_tag LOCUS_21280 68124 65065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 73779 68230 gene locus_tag LOCUS_21290 73779 68230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 74654 73956 gene locus_tag LOCUS_21300 74654 73956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 77337 74710 gene locus_tag LOCUS_21310 77337 74710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 77502 78410 gene locus_tag LOCUS_21320 77502 78410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 80756 78507 gene locus_tag LOCUS_21330 80756 78507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 81581 80772 gene locus_tag LOCUS_21340 81581 80772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 81645 82484 gene locus_tag LOCUS_21350 81645 82484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 85540 82466 gene locus_tag LOCUS_21360 85540 82466 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108336.1 protein_id gnl|my_center|LOCUS_21360 90809 85554 gene locus_tag LOCUS_21370 90809 85554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 93148 90818 gene locus_tag LOCUS_21380 93148 90818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 94829 93300 gene locus_tag LOCUS_21390 94829 93300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 96259 94877 gene locus_tag LOCUS_21400 96259 94877 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767711.1 protein_id gnl|my_center|LOCUS_21400 98103 96256 gene locus_tag LOCUS_21410 98103 96256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 97993 98202 gene locus_tag LOCUS_21420 97993 98202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 100306 98411 gene locus_tag LOCUS_21430 100306 98411 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038270.1 protein_id gnl|my_center|LOCUS_21430 103349 100338 gene locus_tag LOCUS_21440 103349 100338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 108214 103370 gene locus_tag LOCUS_21450 108214 103370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 <110049 108520 gene locus_tag LOCUS_21460 <110049 108520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_126622031.1:autotransporter-associated beta strand repeat-containing protein >Feature sequence18 1199 327 gene locus_tag LOCUS_21470 1199 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 4682 1302 gene locus_tag LOCUS_21480 4682 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 5399 4752 gene locus_tag LOCUS_21490 5399 4752 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_21490 7363 5396 gene locus_tag LOCUS_21500 7363 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 7537 8691 gene locus_tag LOCUS_21510 7537 8691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 11404 8675 gene locus_tag LOCUS_21520 11404 8675 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467010.1 protein_id gnl|my_center|LOCUS_21520 11562 12113 gene locus_tag LOCUS_21530 11562 12113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 12179 12790 gene locus_tag LOCUS_21540 12179 12790 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921338.1 protein_id gnl|my_center|LOCUS_21540 13895 12843 gene locus_tag LOCUS_21550 13895 12843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 15162 13933 gene locus_tag LOCUS_21560 15162 13933 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704054.1 protein_id gnl|my_center|LOCUS_21560 15280 15771 gene locus_tag LOCUS_21570 15280 15771 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224001.1 protein_id gnl|my_center|LOCUS_21570 15909 16397 gene locus_tag LOCUS_21580 15909 16397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 16457 17212 gene locus_tag LOCUS_21590 gene truA 16457 17212 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 protein_id gnl|my_center|LOCUS_21590 17282 17818 gene locus_tag LOCUS_21600 17282 17818 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459677.1 protein_id gnl|my_center|LOCUS_21600 18387 17815 gene locus_tag LOCUS_21610 gene purN 18387 17815 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942403.1 protein_id gnl|my_center|LOCUS_21610 18429 19586 gene locus_tag LOCUS_21620 18429 19586 CDS product M29 family aminopeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729641.1 protein_id gnl|my_center|LOCUS_21620 20730 19600 gene locus_tag LOCUS_21630 20730 19600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 22684 20798 gene locus_tag LOCUS_21640 22684 20798 CDS product POT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922508.1 protein_id gnl|my_center|LOCUS_21640 23850 22711 gene locus_tag LOCUS_21650 23850 22711 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085828.1 protein_id gnl|my_center|LOCUS_21650 25362 23932 gene locus_tag LOCUS_21660 25362 23932 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118059.1 protein_id gnl|my_center|LOCUS_21660 25548 25474 gene locus_tag LOCUS_t00270 25548 25474 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 26478 25738 gene locus_tag LOCUS_21670 26478 25738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 27610 26633 gene locus_tag LOCUS_21680 27610 26633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 28129 27665 gene locus_tag LOCUS_21690 28129 27665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 29034 28222 gene locus_tag LOCUS_21700 29034 28222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 29697 29038 gene locus_tag LOCUS_21710 29697 29038 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619689.1 protein_id gnl|my_center|LOCUS_21710 29788 30189 gene locus_tag LOCUS_21720 29788 30189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 30202 31977 gene locus_tag LOCUS_21730 30202 31977 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223485.1 protein_id gnl|my_center|LOCUS_21730 32083 33846 gene locus_tag LOCUS_21740 32083 33846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 35151 33874 gene locus_tag LOCUS_21750 35151 33874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 36762 35158 gene locus_tag LOCUS_21760 36762 35158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 37569 36847 gene locus_tag LOCUS_21770 37569 36847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 37890 38279 gene locus_tag LOCUS_21780 37890 38279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 40406 38307 gene locus_tag LOCUS_21790 gene vpsO 40406 38307 CDS product exopolysaccharide regulatory tyrosine autokinase VpsO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_21790 41318 40479 gene locus_tag LOCUS_21800 41318 40479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 42599 41325 gene locus_tag LOCUS_21810 42599 41325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 42833 43279 gene locus_tag LOCUS_21820 42833 43279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 43704 43327 gene locus_tag LOCUS_21830 43704 43327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 43648 44520 gene locus_tag LOCUS_21840 43648 44520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 45509 46015 gene locus_tag LOCUS_21850 45509 46015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 46231 47760 gene locus_tag LOCUS_21860 46231 47760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202254.1 protein_id gnl|my_center|LOCUS_21860 47757 49025 gene locus_tag LOCUS_21870 47757 49025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 49033 50358 gene locus_tag LOCUS_21880 49033 50358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 50355 51338 gene locus_tag LOCUS_21890 50355 51338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 51368 51928 gene locus_tag LOCUS_21900 51368 51928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 51925 53181 gene locus_tag LOCUS_21910 51925 53181 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213498758.1 protein_id gnl|my_center|LOCUS_21910 53204 54433 gene locus_tag LOCUS_21920 53204 54433 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118864.1 protein_id gnl|my_center|LOCUS_21920 54482 55021 gene locus_tag LOCUS_21930 54482 55021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 55012 55560 gene locus_tag LOCUS_21940 gene wcaF 55012 55560 CDS product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153583.1 protein_id gnl|my_center|LOCUS_21940 55557 56381 gene locus_tag LOCUS_21950 55557 56381 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_21950 56403 56696 gene locus_tag LOCUS_21960 56403 56696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 56736 57206 gene locus_tag LOCUS_21970 56736 57206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 57246 58454 gene locus_tag LOCUS_21980 57246 58454 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019809.1 protein_id gnl|my_center|LOCUS_21980 58478 60478 gene locus_tag LOCUS_21990 58478 60478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 60785 62506 gene locus_tag LOCUS_22000 60785 62506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 62889 63728 gene locus_tag LOCUS_22010 62889 63728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 63818 65353 gene locus_tag LOCUS_22020 63818 65353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 65780 65325 gene locus_tag LOCUS_22030 65780 65325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 66162 67157 gene locus_tag LOCUS_22040 66162 67157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 67154 69688 gene locus_tag LOCUS_22050 67154 69688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 69952 69683 gene locus_tag LOCUS_22060 69952 69683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 71072 70041 gene locus_tag LOCUS_22070 71072 70041 CDS product nitric oxide synthase oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086848418.1 protein_id gnl|my_center|LOCUS_22070 71555 71073 gene locus_tag LOCUS_22080 71555 71073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 72094 71561 gene locus_tag LOCUS_22090 72094 71561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 74835 72628 gene locus_tag LOCUS_22100 74835 72628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 76075 74873 gene locus_tag LOCUS_22110 76075 74873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 76299 77789 gene locus_tag LOCUS_22120 76299 77789 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546410.1 protein_id gnl|my_center|LOCUS_22120 77821 78807 gene locus_tag LOCUS_22130 77821 78807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 81612 78829 gene locus_tag LOCUS_22140 81612 78829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 83174 81687 gene locus_tag LOCUS_22150 83174 81687 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057361.1 protein_id gnl|my_center|LOCUS_22150 85238 83196 gene locus_tag LOCUS_22160 85238 83196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 86621 85245 gene locus_tag LOCUS_22170 86621 85245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 90237 86614 gene locus_tag LOCUS_22180 90237 86614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 91034 90375 gene locus_tag LOCUS_22190 91034 90375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 91115 92212 gene locus_tag LOCUS_22200 91115 92212 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061882.1 protein_id gnl|my_center|LOCUS_22200 92217 93362 gene locus_tag LOCUS_22210 92217 93362 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975545.1 protein_id gnl|my_center|LOCUS_22210 93359 94501 gene locus_tag LOCUS_22220 93359 94501 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533015.1 protein_id gnl|my_center|LOCUS_22220 94521 95585 gene locus_tag LOCUS_22230 gene rhaT 94521 95585 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209111.1 protein_id gnl|my_center|LOCUS_22230 95590 96609 gene locus_tag LOCUS_22240 95590 96609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 96615 97130 gene locus_tag LOCUS_22250 96615 97130 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533014.1 protein_id gnl|my_center|LOCUS_22250 97134 97970 gene locus_tag LOCUS_22260 97134 97970 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533022.1 protein_id gnl|my_center|LOCUS_22260 98011 99030 gene locus_tag LOCUS_22270 98011 99030 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119992.1 protein_id gnl|my_center|LOCUS_22270 99039 99659 gene locus_tag LOCUS_22280 99039 99659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 99666 100121 gene locus_tag LOCUS_22290 99666 100121 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163926.1 protein_id gnl|my_center|LOCUS_22290 101640 100996 gene locus_tag LOCUS_22300 101640 100996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 >Feature sequence19 1599 199 gene locus_tag LOCUS_22310 1599 199 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927472.1 protein_id gnl|my_center|LOCUS_22310 2229 1603 gene locus_tag LOCUS_22320 2229 1603 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886490.1 protein_id gnl|my_center|LOCUS_22320 3182 2226 gene locus_tag LOCUS_22330 3182 2226 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187814.1 protein_id gnl|my_center|LOCUS_22330 3964 3218 gene locus_tag LOCUS_22340 3964 3218 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525001.1 protein_id gnl|my_center|LOCUS_22340 5121 3961 gene locus_tag LOCUS_22350 5121 3961 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529170.1 protein_id gnl|my_center|LOCUS_22350 5278 5805 gene locus_tag LOCUS_22360 5278 5805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 7181 5817 gene locus_tag LOCUS_22370 7181 5817 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124559.1 protein_id gnl|my_center|LOCUS_22370 7546 8319 gene locus_tag LOCUS_22380 7546 8319 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_22380 8869 9327 gene locus_tag LOCUS_22390 8869 9327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 11083 10043 gene locus_tag LOCUS_22400 11083 10043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 12964 11276 gene locus_tag LOCUS_22410 12964 11276 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108511.1 protein_id gnl|my_center|LOCUS_22410 15903 13051 gene locus_tag LOCUS_22420 15903 13051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 16717 15956 gene locus_tag LOCUS_22430 16717 15956 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037253881.1 protein_id gnl|my_center|LOCUS_22430 18376 16796 gene locus_tag LOCUS_22440 18376 16796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 19853 18558 gene locus_tag LOCUS_22450 19853 18558 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_22450 22308 19930 gene locus_tag LOCUS_22460 22308 19930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 32208 22321 gene locus_tag LOCUS_22470 32208 22321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 33860 32253 gene locus_tag LOCUS_22480 33860 32253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 34390 33857 gene locus_tag LOCUS_22490 34390 33857 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331069.1 protein_id gnl|my_center|LOCUS_22490 37307 34491 gene locus_tag LOCUS_22500 37307 34491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 40671 37483 gene locus_tag LOCUS_22510 40671 37483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 41958 40819 gene locus_tag LOCUS_22520 41958 40819 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126014666.1 protein_id gnl|my_center|LOCUS_22520 43144 42080 gene locus_tag LOCUS_22530 43144 42080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 43330 51054 gene locus_tag LOCUS_22540 43330 51054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 51065 53212 gene locus_tag LOCUS_22550 51065 53212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 53209 53841 gene locus_tag LOCUS_22560 53209 53841 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227223.1 protein_id gnl|my_center|LOCUS_22560 53998 57600 gene locus_tag LOCUS_22570 53998 57600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 57676 59889 gene locus_tag LOCUS_22580 57676 59889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 59886 60545 gene locus_tag LOCUS_22590 59886 60545 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230184.1 protein_id gnl|my_center|LOCUS_22590 60643 64542 gene locus_tag LOCUS_22600 60643 64542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 66369 64546 gene locus_tag LOCUS_22610 66369 64546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 65358 65444 gene locus_tag LOCUS_t00280 65358 65444 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 67979 66450 gene locus_tag LOCUS_22620 67979 66450 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108604.1 protein_id gnl|my_center|LOCUS_22620 69015 68023 gene locus_tag LOCUS_22630 69015 68023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 69884 69012 gene locus_tag LOCUS_22640 gene cysE 69884 69012 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704210.1 protein_id gnl|my_center|LOCUS_22640 70012 70296 gene locus_tag LOCUS_22650 70012 70296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 70406 71038 gene locus_tag LOCUS_22660 70406 71038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 71057 71380 gene locus_tag LOCUS_22670 71057 71380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 71986 71390 gene locus_tag LOCUS_22680 71986 71390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 72646 71993 gene locus_tag LOCUS_22690 72646 71993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 72803 73444 gene locus_tag LOCUS_22700 72803 73444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 73728 77177 gene locus_tag LOCUS_22710 73728 77177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 77203 77907 gene locus_tag LOCUS_22720 77203 77907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 79903 77936 gene locus_tag LOCUS_22730 79903 77936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 80235 82151 gene locus_tag LOCUS_22740 80235 82151 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266921.1 protein_id gnl|my_center|LOCUS_22740 83854 82220 gene locus_tag LOCUS_22750 83854 82220 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086957.1 protein_id gnl|my_center|LOCUS_22750 85122 84007 gene locus_tag LOCUS_22760 85122 84007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088279.1 protein_id gnl|my_center|LOCUS_22760 86435 85119 gene locus_tag LOCUS_22770 86435 85119 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_22770 86540 88972 gene locus_tag LOCUS_22780 gene bamA 86540 88972 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546857.1 protein_id gnl|my_center|LOCUS_22780 89410 89093 gene locus_tag LOCUS_22790 89410 89093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 89792 89421 gene locus_tag LOCUS_22800 89792 89421 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_22800 90224 89907 gene locus_tag LOCUS_22810 90224 89907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 90430 90699 gene locus_tag LOCUS_22820 90430 90699 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882762.1 protein_id gnl|my_center|LOCUS_22820 90808 91578 gene locus_tag LOCUS_22830 gene hisF 90808 91578 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067464.1 protein_id gnl|my_center|LOCUS_22830 92021 95584 gene locus_tag LOCUS_22840 92021 95584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 95690 97273 gene locus_tag LOCUS_22850 95690 97273 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391431.1 protein_id gnl|my_center|LOCUS_22850 98100 97261 gene locus_tag LOCUS_22860 98100 97261 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_22860 99233 98160 gene locus_tag LOCUS_22870 99233 98160 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256406.1 protein_id gnl|my_center|LOCUS_22870 99406 102156 gene locus_tag LOCUS_22880 99406 102156 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259718.1 protein_id gnl|my_center|LOCUS_22880 103190 102966 gene locus_tag LOCUS_22890 103190 102966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 103501 103253 gene locus_tag LOCUS_22900 103501 103253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 >Feature sequence20 5671 6267 gene locus_tag LOCUS_22910 5671 6267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 7217 6279 gene locus_tag LOCUS_22920 7217 6279 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529363.1 protein_id gnl|my_center|LOCUS_22920 8599 7631 gene locus_tag LOCUS_22930 8599 7631 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140077.1 protein_id gnl|my_center|LOCUS_22930 8638 11019 gene locus_tag LOCUS_22940 8638 11019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 15049 11033 gene locus_tag LOCUS_22950 15049 11033 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615995.1 protein_id gnl|my_center|LOCUS_22950 16162 15224 gene locus_tag LOCUS_22960 16162 15224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814201.1 protein_id gnl|my_center|LOCUS_22960 16272 17186 gene locus_tag LOCUS_22970 16272 17186 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117757.1 protein_id gnl|my_center|LOCUS_22970 18443 17211 gene locus_tag LOCUS_22980 18443 17211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 19085 18456 gene locus_tag LOCUS_22990 19085 18456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 19742 19146 gene locus_tag LOCUS_23000 gene raiA 19742 19146 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942531.1 protein_id gnl|my_center|LOCUS_23000 21466 19907 gene locus_tag LOCUS_23010 21466 19907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 23896 21476 gene locus_tag LOCUS_23020 23896 21476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 25094 24120 gene locus_tag LOCUS_23030 25094 24120 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390713.1 protein_id gnl|my_center|LOCUS_23030 25456 25091 gene locus_tag LOCUS_23040 25456 25091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 26258 25503 gene locus_tag LOCUS_23050 26258 25503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 27183 26458 gene locus_tag LOCUS_23060 27183 26458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 27568 29127 gene locus_tag LOCUS_23070 27568 29127 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163308.1 protein_id gnl|my_center|LOCUS_23070 29201 29686 gene locus_tag LOCUS_23080 29201 29686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 29689 30429 gene locus_tag LOCUS_23090 29689 30429 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_23090 30511 31458 gene locus_tag LOCUS_23100 30511 31458 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058188.1 protein_id gnl|my_center|LOCUS_23100 31492 32232 gene locus_tag LOCUS_23110 31492 32232 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339235.1 protein_id gnl|my_center|LOCUS_23110 32232 32690 gene locus_tag LOCUS_23120 32232 32690 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_23120 33398 32700 gene locus_tag LOCUS_23130 33398 32700 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480270.1 protein_id gnl|my_center|LOCUS_23130 33499 34287 gene locus_tag LOCUS_23140 33499 34287 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920880.1 protein_id gnl|my_center|LOCUS_23140 34752 34294 gene locus_tag LOCUS_23150 34752 34294 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877456.1 protein_id gnl|my_center|LOCUS_23150 36367 34775 gene locus_tag LOCUS_23160 36367 34775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 37235 36435 gene locus_tag LOCUS_23170 37235 36435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 38020 37232 gene locus_tag LOCUS_23180 38020 37232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 38579 38037 gene locus_tag LOCUS_23190 38579 38037 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061383.1 protein_id gnl|my_center|LOCUS_23190 38788 39651 gene locus_tag LOCUS_23200 38788 39651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 39666 40463 gene locus_tag LOCUS_23210 39666 40463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 41426 40491 gene locus_tag LOCUS_23220 41426 40491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 41625 42527 gene locus_tag LOCUS_23230 41625 42527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 42634 42707 gene locus_tag LOCUS_t00290 42634 42707 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 43005 43220 gene locus_tag LOCUS_23240 43005 43220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 43925 44137 gene locus_tag LOCUS_23250 43925 44137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 44991 45914 gene locus_tag LOCUS_23260 44991 45914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 47141 54478 gene locus_tag LOCUS_23270 47141 54478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 54941 61774 gene locus_tag LOCUS_23280 54941 61774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 61817 63370 gene locus_tag LOCUS_23290 61817 63370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 63426 68912 gene locus_tag LOCUS_23300 63426 68912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 70005 75638 gene locus_tag LOCUS_23310 70005 75638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 75642 77651 gene locus_tag LOCUS_23320 75642 77651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 77673 88454 gene locus_tag LOCUS_23330 77673 88454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 88463 92041 gene locus_tag LOCUS_23340 88463 92041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 92155 92958 gene locus_tag LOCUS_23350 92155 92958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 >Feature sequence21 1316 93 gene locus_tag LOCUS_23360 1316 93 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942444.1 protein_id gnl|my_center|LOCUS_23360 1751 1392 gene locus_tag LOCUS_23370 1751 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 2560 1748 gene locus_tag LOCUS_23380 2560 1748 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812797.1 protein_id gnl|my_center|LOCUS_23380 3869 2586 gene locus_tag LOCUS_23390 3869 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 5042 3951 gene locus_tag LOCUS_23400 5042 3951 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405202.1 protein_id gnl|my_center|LOCUS_23400 6047 5133 gene locus_tag LOCUS_23410 6047 5133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 6279 6872 gene locus_tag LOCUS_23420 6279 6872 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963973.1 protein_id gnl|my_center|LOCUS_23420 6931 7410 gene locus_tag LOCUS_23430 6931 7410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 8216 7407 gene locus_tag LOCUS_23440 8216 7407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 9574 8246 gene locus_tag LOCUS_23450 9574 8246 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338470.1 protein_id gnl|my_center|LOCUS_23450 9736 9811 gene locus_tag LOCUS_t00300 9736 9811 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 16139 10155 gene locus_tag LOCUS_23460 16139 10155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 19094 16194 gene locus_tag LOCUS_23470 19094 16194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23470 19520 19846 gene locus_tag LOCUS_23480 19520 19846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 22607 19890 gene locus_tag LOCUS_23490 22607 19890 CDS product DUF5703 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765773.1 protein_id gnl|my_center|LOCUS_23490 25445 22704 gene locus_tag LOCUS_23500 25445 22704 CDS product DUF5703 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765773.1 protein_id gnl|my_center|LOCUS_23500 26467 25739 gene locus_tag LOCUS_23510 26467 25739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 29944 26522 gene locus_tag LOCUS_23520 29944 26522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 30727 30083 gene locus_tag LOCUS_23530 30727 30083 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_23530 32961 30724 gene locus_tag LOCUS_23540 32961 30724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 33605 33042 gene locus_tag LOCUS_23550 33605 33042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 37924 33788 gene locus_tag LOCUS_23560 37924 33788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 39998 38079 gene locus_tag LOCUS_23570 39998 38079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 43424 40137 gene locus_tag LOCUS_23580 43424 40137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 50644 43655 gene locus_tag LOCUS_23590 50644 43655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 50993 53947 gene locus_tag LOCUS_23600 50993 53947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 54232 57363 gene locus_tag LOCUS_23610 54232 57363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 57494 59152 gene locus_tag LOCUS_23620 57494 59152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 59460 62303 gene locus_tag LOCUS_23630 59460 62303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 62336 62998 gene locus_tag LOCUS_23640 62336 62998 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039897.1 protein_id gnl|my_center|LOCUS_23640 63195 66416 gene locus_tag LOCUS_23650 63195 66416 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202548.1 protein_id gnl|my_center|LOCUS_23650 66498 69248 gene locus_tag LOCUS_23660 66498 69248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 69359 72889 gene locus_tag LOCUS_23670 69359 72889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 72946 75207 gene locus_tag LOCUS_23680 72946 75207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 75477 77585 gene locus_tag LOCUS_23690 75477 77585 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121109.1 protein_id gnl|my_center|LOCUS_23690 79026 77602 gene locus_tag LOCUS_23700 79026 77602 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202206.1 protein_id gnl|my_center|LOCUS_23700 82339 79040 gene locus_tag LOCUS_23710 82339 79040 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_23710 82507 83313 gene locus_tag LOCUS_23720 82507 83313 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729459.1 protein_id gnl|my_center|LOCUS_23720 83428 85821 gene locus_tag LOCUS_23730 83428 85821 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_23730 86134 86061 gene locus_tag LOCUS_t00310 86134 86061 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 86292 86864 gene locus_tag LOCUS_23740 86292 86864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 87297 86932 gene locus_tag LOCUS_23750 87297 86932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 87490 90513 gene locus_tag LOCUS_23760 gene addA 87490 90513 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982184.1 protein_id gnl|my_center|LOCUS_23760 >Feature sequence22 357 1463 gene locus_tag LOCUS_23770 357 1463 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328620.1 protein_id gnl|my_center|LOCUS_23770 1475 2581 gene locus_tag LOCUS_23780 1475 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123815508.1 protein_id gnl|my_center|LOCUS_23780 3878 2589 gene locus_tag LOCUS_23790 3878 2589 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_23790 5301 4006 gene locus_tag LOCUS_23800 gene hflX 5301 4006 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121200.1 protein_id gnl|my_center|LOCUS_23800 5712 5371 gene locus_tag LOCUS_23810 5712 5371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 6100 5696 gene locus_tag LOCUS_23820 6100 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 6442 7923 gene locus_tag LOCUS_23830 gene lysS 6442 7923 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001833056.1 protein_id gnl|my_center|LOCUS_23830 8050 8622 gene locus_tag LOCUS_23840 8050 8622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 9592 8651 gene locus_tag LOCUS_23850 9592 8651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 10660 9608 gene locus_tag LOCUS_23860 10660 9608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 13387 10712 gene locus_tag LOCUS_23870 gene valS 13387 10712 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398606.1 protein_id gnl|my_center|LOCUS_23870 13523 14254 gene locus_tag LOCUS_23880 13523 14254 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_23880 14309 16630 gene locus_tag LOCUS_23890 14309 16630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 16768 17346 gene locus_tag LOCUS_23900 16768 17346 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258745.1 protein_id gnl|my_center|LOCUS_23900 18824 17424 gene locus_tag LOCUS_23910 gene rimO 18824 17424 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_23910 19591 18929 gene locus_tag LOCUS_23920 19591 18929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 19729 21801 gene locus_tag LOCUS_23930 19729 21801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 22833 21808 gene locus_tag LOCUS_23940 22833 21808 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338084.1 protein_id gnl|my_center|LOCUS_23940 23856 22843 gene locus_tag LOCUS_23950 23856 22843 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404343.1 protein_id gnl|my_center|LOCUS_23950 24485 23853 gene locus_tag LOCUS_23960 24485 23853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 24670 25434 gene locus_tag LOCUS_23970 24670 25434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 25431 26213 gene locus_tag LOCUS_23980 gene menH 25431 26213 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933504.1 protein_id gnl|my_center|LOCUS_23980 26305 27543 gene locus_tag LOCUS_23990 26305 27543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 27540 27938 gene locus_tag LOCUS_24000 27540 27938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 27935 29734 gene locus_tag LOCUS_24010 27935 29734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 30723 29926 gene locus_tag LOCUS_24020 30723 29926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 32008 30746 gene locus_tag LOCUS_24030 32008 30746 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_24030 32133 34139 gene locus_tag LOCUS_24040 32133 34139 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932948.1 protein_id gnl|my_center|LOCUS_24040 35741 34170 gene locus_tag LOCUS_24050 35741 34170 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613941.1 protein_id gnl|my_center|LOCUS_24050 36110 35763 gene locus_tag LOCUS_24060 36110 35763 CDS product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932426.1 protein_id gnl|my_center|LOCUS_24060 36588 36115 gene locus_tag LOCUS_24070 36588 36115 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090958.1 protein_id gnl|my_center|LOCUS_24070 37055 36588 gene locus_tag LOCUS_24080 37055 36588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 37535 37086 gene locus_tag LOCUS_24090 37535 37086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 37656 38777 gene locus_tag LOCUS_24100 37656 38777 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326127.1 protein_id gnl|my_center|LOCUS_24100 38844 40601 gene locus_tag LOCUS_24110 38844 40601 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229498.1 protein_id gnl|my_center|LOCUS_24110 40621 40815 gene locus_tag LOCUS_24120 40621 40815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 41001 42863 gene locus_tag LOCUS_24130 41001 42863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 42860 50080 gene locus_tag LOCUS_24140 42860 50080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 50141 51940 gene locus_tag LOCUS_24150 50141 51940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 53323 51950 gene locus_tag LOCUS_24160 53323 51950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 53852 53697 gene locus_tag LOCUS_24170 53852 53697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 57754 54092 gene locus_tag LOCUS_24180 57754 54092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 58992 57751 gene locus_tag LOCUS_24190 58992 57751 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694560.1 protein_id gnl|my_center|LOCUS_24190 59735 59010 gene locus_tag LOCUS_24200 gene allE 59735 59010 CDS product (S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887795.1 protein_id gnl|my_center|LOCUS_24200 60986 59748 gene locus_tag LOCUS_24210 60986 59748 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887796.1 protein_id gnl|my_center|LOCUS_24210 62245 61025 gene locus_tag LOCUS_24220 62245 61025 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966724.1 protein_id gnl|my_center|LOCUS_24220 62575 62252 gene locus_tag LOCUS_24230 gene uraH 62575 62252 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053237.1 protein_id gnl|my_center|LOCUS_24230 62663 63820 gene locus_tag LOCUS_24240 62663 63820 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_24240 63851 64948 gene locus_tag LOCUS_24250 63851 64948 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481009.1 protein_id gnl|my_center|LOCUS_24250 66010 64958 gene locus_tag LOCUS_24260 66010 64958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 66091 66528 gene locus_tag LOCUS_24270 66091 66528 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393272.1 protein_id gnl|my_center|LOCUS_24270 67203 66532 gene locus_tag LOCUS_24280 67203 66532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 68099 67209 gene locus_tag LOCUS_24290 gene xerC 68099 67209 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_24290 68283 69137 gene locus_tag LOCUS_24300 68283 69137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 69140 70438 gene locus_tag LOCUS_24310 69140 70438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 71101 70460 gene locus_tag LOCUS_24320 71101 70460 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263747.1 protein_id gnl|my_center|LOCUS_24320 71920 71237 gene locus_tag LOCUS_24330 gene rnc 71920 71237 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_24330 72058 71984 gene locus_tag LOCUS_t00320 72058 71984 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 72216 73820 gene locus_tag LOCUS_24340 72216 73820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 73830 75017 gene locus_tag LOCUS_24350 gene tyrS 73830 75017 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881135.1 protein_id gnl|my_center|LOCUS_24350 75075 77429 gene locus_tag LOCUS_24360 75075 77429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 77436 79565 gene locus_tag LOCUS_24370 77436 79565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 79567 79932 gene locus_tag LOCUS_24380 79567 79932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 79950 80816 gene locus_tag LOCUS_24390 79950 80816 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928717.1 protein_id gnl|my_center|LOCUS_24390 80830 81174 gene locus_tag LOCUS_24400 80830 81174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 81174 81809 gene locus_tag LOCUS_24410 81174 81809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 81722 82009 gene locus_tag LOCUS_24420 81722 82009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 83364 82027 gene locus_tag LOCUS_24430 83364 82027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 85695 83419 gene locus_tag LOCUS_24440 85695 83419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 86600 85794 gene locus_tag LOCUS_24450 86600 85794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 >Feature sequence23 106 1182 gene locus_tag LOCUS_24460 gene nagZ 106 1182 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887975.1 protein_id gnl|my_center|LOCUS_24460 1276 1764 gene locus_tag LOCUS_24470 1276 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 1841 2977 gene locus_tag LOCUS_24480 1841 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 4138 2987 gene locus_tag LOCUS_24490 4138 2987 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918413.1 protein_id gnl|my_center|LOCUS_24490 7004 4194 gene locus_tag LOCUS_24500 7004 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 10079 7128 gene locus_tag LOCUS_24510 10079 7128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 10892 10173 gene locus_tag LOCUS_24520 10892 10173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 14481 10942 gene locus_tag LOCUS_24530 14481 10942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 14879 17551 gene locus_tag LOCUS_24540 14879 17551 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141113.1 protein_id gnl|my_center|LOCUS_24540 17634 17975 gene locus_tag LOCUS_24550 17634 17975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 18097 19326 gene locus_tag LOCUS_24560 18097 19326 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244563.1 protein_id gnl|my_center|LOCUS_24560 19346 20542 gene locus_tag LOCUS_24570 19346 20542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 20546 23677 gene locus_tag LOCUS_24580 20546 23677 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_24580 23703 24146 gene locus_tag LOCUS_24590 23703 24146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 24214 24732 gene locus_tag LOCUS_24600 24214 24732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 25794 24766 gene locus_tag LOCUS_24610 gene ribD 25794 24766 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483035.1 protein_id gnl|my_center|LOCUS_24610 28175 25791 gene locus_tag LOCUS_24620 28175 25791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 29526 28201 gene locus_tag LOCUS_24630 29526 28201 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259655.1 protein_id gnl|my_center|LOCUS_24630 30607 29573 gene locus_tag LOCUS_24640 30607 29573 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257987.1 protein_id gnl|my_center|LOCUS_24640 33252 30607 gene locus_tag LOCUS_24650 33252 30607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 33333 34049 gene locus_tag LOCUS_24660 33333 34049 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892786.1 protein_id gnl|my_center|LOCUS_24660 34037 36133 gene locus_tag LOCUS_24670 34037 36133 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_24670 38368 36152 gene locus_tag LOCUS_24680 38368 36152 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706412.1 protein_id gnl|my_center|LOCUS_24680 39229 38453 gene locus_tag LOCUS_24690 39229 38453 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529662.1 protein_id gnl|my_center|LOCUS_24690 39567 39316 gene locus_tag LOCUS_24700 gene rpmA 39567 39316 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327901.1 protein_id gnl|my_center|LOCUS_24700 39913 39602 gene locus_tag LOCUS_24710 gene rplU 39913 39602 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691838.1 protein_id gnl|my_center|LOCUS_24710 40112 41419 gene locus_tag LOCUS_24720 gene bioA 40112 41419 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942227.1 protein_id gnl|my_center|LOCUS_24720 41445 41519 gene locus_tag LOCUS_t00330 41445 41519 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 41556 42419 gene locus_tag LOCUS_24730 41556 42419 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933177.1 protein_id gnl|my_center|LOCUS_24730 43768 42392 gene locus_tag LOCUS_24740 43768 42392 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368546.1 protein_id gnl|my_center|LOCUS_24740 43900 44946 gene locus_tag LOCUS_24750 43900 44946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 45735 44953 gene locus_tag LOCUS_24760 45735 44953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 46014 47699 gene locus_tag LOCUS_24770 gene leuA 46014 47699 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930223.1 protein_id gnl|my_center|LOCUS_24770 48132 47716 gene locus_tag LOCUS_24780 48132 47716 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918320.1 protein_id gnl|my_center|LOCUS_24780 50107 48269 gene locus_tag LOCUS_24790 50107 48269 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258194.1 protein_id gnl|my_center|LOCUS_24790 51031 50195 gene locus_tag LOCUS_24800 51031 50195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 52058 51033 gene locus_tag LOCUS_24810 52058 51033 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225414074.1 protein_id gnl|my_center|LOCUS_24810 52153 52836 gene locus_tag LOCUS_24820 52153 52836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 53292 52879 gene locus_tag LOCUS_24830 53292 52879 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388982.1 protein_id gnl|my_center|LOCUS_24830 54847 53384 gene locus_tag LOCUS_24840 gene atpD 54847 53384 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_24840 55860 54967 gene locus_tag LOCUS_24850 55860 54967 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144299.1 protein_id gnl|my_center|LOCUS_24850 57503 55962 gene locus_tag LOCUS_24860 gene atpA 57503 55962 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_24860 57949 57557 gene locus_tag LOCUS_24870 57949 57557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 58537 57977 gene locus_tag LOCUS_24880 58537 57977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 58835 58647 gene locus_tag LOCUS_24890 58835 58647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 59796 58912 gene locus_tag LOCUS_24900 gene atpB 59796 58912 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315954.1 protein_id gnl|my_center|LOCUS_24900 61232 59925 gene locus_tag LOCUS_24910 61232 59925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 61448 61723 gene locus_tag LOCUS_24920 gene hupB 61448 61723 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081127.1 protein_id gnl|my_center|LOCUS_24920 62112 61852 gene locus_tag LOCUS_24930 62112 61852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 62164 62841 gene locus_tag LOCUS_24940 62164 62841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 62883 64292 gene locus_tag LOCUS_24950 62883 64292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 64324 65499 gene locus_tag LOCUS_24960 64324 65499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117732.1 protein_id gnl|my_center|LOCUS_24960 65519 65950 gene locus_tag LOCUS_24970 gene ruvX 65519 65950 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057628.1 protein_id gnl|my_center|LOCUS_24970 66141 66305 gene locus_tag LOCUS_24980 66141 66305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 66449 66667 gene locus_tag LOCUS_24990 66449 66667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 66765 68189 gene locus_tag LOCUS_25000 gene leuC 66765 68189 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173294.1 protein_id gnl|my_center|LOCUS_25000 68211 68813 gene locus_tag LOCUS_25010 gene leuD 68211 68813 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228533.1 protein_id gnl|my_center|LOCUS_25010 68904 70331 gene locus_tag LOCUS_25020 gene ccoG 68904 70331 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120871.1 protein_id gnl|my_center|LOCUS_25020 70337 70489 gene locus_tag LOCUS_25030 70337 70489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 70503 71210 gene locus_tag LOCUS_25040 70503 71210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 71386 72582 gene locus_tag LOCUS_25050 71386 72582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 72617 73639 gene locus_tag LOCUS_25060 72617 73639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 73752 74483 gene locus_tag LOCUS_25070 73752 74483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 75738 74500 gene locus_tag LOCUS_25080 75738 74500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 76232 75771 gene locus_tag LOCUS_25090 76232 75771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 76323 77138 gene locus_tag LOCUS_25100 76323 77138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 78560 77487 gene locus_tag LOCUS_25110 78560 77487 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324364.1 protein_id gnl|my_center|LOCUS_25110 79027 78719 gene locus_tag LOCUS_25120 79027 78719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 79360 79106 gene locus_tag LOCUS_25130 79360 79106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 80884 79397 gene locus_tag LOCUS_25140 80884 79397 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333579.1 protein_id gnl|my_center|LOCUS_25140 81374 80967 gene locus_tag LOCUS_25150 81374 80967 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_25150 81744 81436 gene locus_tag LOCUS_25160 81744 81436 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324359.1 protein_id gnl|my_center|LOCUS_25160 82138 81833 gene locus_tag LOCUS_25170 gene pduJ 82138 81833 CDS product propanediol utilization microcompartment protein PduJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057752.1 protein_id gnl|my_center|LOCUS_25170 83358 82183 gene locus_tag LOCUS_25180 83358 82183 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118936.1 protein_id gnl|my_center|LOCUS_25180 83738 83460 gene locus_tag LOCUS_25190 83738 83460 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324356.1 protein_id gnl|my_center|LOCUS_25190 84065 83793 gene locus_tag LOCUS_25200 84065 83793 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868831.1 protein_id gnl|my_center|LOCUS_25200 84779 84099 gene locus_tag LOCUS_25210 84779 84099 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333582.1 protein_id gnl|my_center|LOCUS_25210 84868 85629 gene locus_tag LOCUS_25220 84868 85629 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029949.1 protein_id gnl|my_center|LOCUS_25220 85946 86431 gene locus_tag LOCUS_25230 85946 86431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 >Feature sequence24 <1 6054 gene locus_tag LOCUS_25240 <1 6054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104543246.1:autotransporter-associated beta strand repeat-containing protein 7233 6073 gene locus_tag LOCUS_25250 7233 6073 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 protein_id gnl|my_center|LOCUS_25250 7388 8992 gene locus_tag LOCUS_25260 7388 8992 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038682.1 protein_id gnl|my_center|LOCUS_25260 9021 10052 gene locus_tag LOCUS_25270 9021 10052 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082403.1 protein_id gnl|my_center|LOCUS_25270 10129 11334 gene locus_tag LOCUS_25280 10129 11334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 11331 13106 gene locus_tag LOCUS_25290 11331 13106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 14455 13220 gene locus_tag LOCUS_25300 14455 13220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 17192 14715 gene locus_tag LOCUS_25310 17192 14715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 24612 17293 gene locus_tag LOCUS_25320 24612 17293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 27770 24684 gene locus_tag LOCUS_25330 27770 24684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 28599 27934 gene locus_tag LOCUS_25340 28599 27934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 28905 29852 gene locus_tag LOCUS_25350 28905 29852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 30693 29902 gene locus_tag LOCUS_25360 gene xdhC 30693 29902 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083344.1 protein_id gnl|my_center|LOCUS_25360 30800 31306 gene locus_tag LOCUS_25370 gene uraD 30800 31306 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552526.1 protein_id gnl|my_center|LOCUS_25370 31340 32557 gene locus_tag LOCUS_25380 31340 32557 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920461.1 protein_id gnl|my_center|LOCUS_25380 32598 33386 gene locus_tag LOCUS_25390 32598 33386 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 protein_id gnl|my_center|LOCUS_25390 33845 33393 gene locus_tag LOCUS_25400 33845 33393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 33923 35218 gene locus_tag LOCUS_25410 33923 35218 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120796.1 protein_id gnl|my_center|LOCUS_25410 35279 35752 gene locus_tag LOCUS_25420 gene bcp 35279 35752 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220392.1 protein_id gnl|my_center|LOCUS_25420 36443 35763 gene locus_tag LOCUS_25430 36443 35763 CDS product protocatechuate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922892.1 protein_id gnl|my_center|LOCUS_25430 36897 36505 gene locus_tag LOCUS_25440 36897 36505 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403014.1 protein_id gnl|my_center|LOCUS_25440 37160 36894 gene locus_tag LOCUS_25450 37160 36894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 37748 37227 gene locus_tag LOCUS_25460 37748 37227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 40296 37801 gene locus_tag LOCUS_25470 gene mutS 40296 37801 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_25470 40417 41268 gene locus_tag LOCUS_25480 40417 41268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142083.1 protein_id gnl|my_center|LOCUS_25480 41455 42432 gene locus_tag LOCUS_25490 41455 42432 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 protein_id gnl|my_center|LOCUS_25490 42503 43234 gene locus_tag LOCUS_25500 42503 43234 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817006.1 protein_id gnl|my_center|LOCUS_25500 43318 44085 gene locus_tag LOCUS_25510 43318 44085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 44932 44114 gene locus_tag LOCUS_25520 44932 44114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 45939 44929 gene locus_tag LOCUS_25530 45939 44929 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964900.1 protein_id gnl|my_center|LOCUS_25530 46221 46781 gene locus_tag LOCUS_25540 46221 46781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 46795 48075 gene locus_tag LOCUS_25550 46795 48075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 48416 48153 gene locus_tag LOCUS_25560 gene rpmB 48416 48153 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556947.1 protein_id gnl|my_center|LOCUS_25560 49472 48498 gene locus_tag LOCUS_25570 49472 48498 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142701.1 protein_id gnl|my_center|LOCUS_25570 49707 50303 gene locus_tag LOCUS_25580 49707 50303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 50423 56158 gene locus_tag LOCUS_25590 50423 56158 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625869.1 protein_id gnl|my_center|LOCUS_25590 56449 58014 gene locus_tag LOCUS_25600 56449 58014 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337137.1 protein_id gnl|my_center|LOCUS_25600 58156 58500 gene locus_tag LOCUS_25610 58156 58500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 59283 59077 gene locus_tag LOCUS_25620 59283 59077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 59521 62757 gene locus_tag LOCUS_25630 59521 62757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 63034 62849 gene locus_tag LOCUS_25640 63034 62849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 63083 63346 gene locus_tag LOCUS_25650 63083 63346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 63343 63720 gene locus_tag LOCUS_25660 63343 63720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 64183 63764 gene locus_tag LOCUS_25670 64183 63764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 67238 64449 gene locus_tag LOCUS_25680 67238 64449 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120679.1 protein_id gnl|my_center|LOCUS_25680 69053 67287 gene locus_tag LOCUS_25690 69053 67287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 70464 69127 gene locus_tag LOCUS_25700 70464 69127 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968790.1 protein_id gnl|my_center|LOCUS_25700 72469 70529 gene locus_tag LOCUS_25710 72469 70529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 75878 72516 gene locus_tag LOCUS_25720 75878 72516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214212.1 protein_id gnl|my_center|LOCUS_25720 77643 75907 gene locus_tag LOCUS_25730 77643 75907 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920652.1 protein_id gnl|my_center|LOCUS_25730 78483 77872 gene locus_tag LOCUS_25740 gene rpsD 78483 77872 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963446.1 protein_id gnl|my_center|LOCUS_25740 79029 78508 gene locus_tag LOCUS_25750 79029 78508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 79416 79048 gene locus_tag LOCUS_25760 gene rpsM 79416 79048 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810116.1 protein_id gnl|my_center|LOCUS_25760 79692 80714 gene locus_tag LOCUS_25770 79692 80714 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122095.1 protein_id gnl|my_center|LOCUS_25770 80711 81604 gene locus_tag LOCUS_25780 80711 81604 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324190.1 protein_id gnl|my_center|LOCUS_25780 81662 83653 gene locus_tag LOCUS_25790 81662 83653 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122098.1 protein_id gnl|my_center|LOCUS_25790 83693 85897 gene locus_tag LOCUS_25800 83693 85897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922195.1 protein_id gnl|my_center|LOCUS_25800 >Feature sequence25 593 862 gene locus_tag LOCUS_25810 593 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 1179 1775 gene locus_tag LOCUS_25820 1179 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 1884 2573 gene locus_tag LOCUS_25830 1884 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 2857 3321 gene locus_tag LOCUS_25840 2857 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 4934 3522 gene locus_tag LOCUS_25850 4934 3522 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259342.1 protein_id gnl|my_center|LOCUS_25850 5263 5000 gene locus_tag LOCUS_25860 5263 5000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 5516 6598 gene locus_tag LOCUS_25870 5516 6598 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_25870 6629 7111 gene locus_tag LOCUS_25880 6629 7111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 7231 7590 gene locus_tag LOCUS_25890 7231 7590 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293844.1 protein_id gnl|my_center|LOCUS_25890 8319 7591 gene locus_tag LOCUS_25900 8319 7591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 8451 11204 gene locus_tag LOCUS_25910 8451 11204 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203461.1 protein_id gnl|my_center|LOCUS_25910 11301 12479 gene locus_tag LOCUS_25920 gene sucC 11301 12479 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244732.1 protein_id gnl|my_center|LOCUS_25920 12498 13028 gene locus_tag LOCUS_25930 12498 13028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 13054 13950 gene locus_tag LOCUS_25940 gene sucD 13054 13950 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238566.1 protein_id gnl|my_center|LOCUS_25940 14079 15059 gene locus_tag LOCUS_25950 14079 15059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 16211 15069 gene locus_tag LOCUS_25960 16211 15069 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081574.1 protein_id gnl|my_center|LOCUS_25960 16934 16248 gene locus_tag LOCUS_25970 16934 16248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 18026 16941 gene locus_tag LOCUS_25980 18026 16941 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880449.1 protein_id gnl|my_center|LOCUS_25980 19106 18039 gene locus_tag LOCUS_25990 19106 18039 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880449.1 protein_id gnl|my_center|LOCUS_25990 20418 19183 gene locus_tag LOCUS_26000 20418 19183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 21098 20415 gene locus_tag LOCUS_26010 21098 20415 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_26010 22065 21160 gene locus_tag LOCUS_26020 22065 21160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 22567 22181 gene locus_tag LOCUS_26030 22567 22181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 23686 22580 gene locus_tag LOCUS_26040 23686 22580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 25057 23723 gene locus_tag LOCUS_26050 25057 23723 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_26050 25734 25054 gene locus_tag LOCUS_26060 gene ubiE 25734 25054 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228961.1 protein_id gnl|my_center|LOCUS_26060 25733 27067 gene locus_tag LOCUS_26070 25733 27067 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_26070 27225 29126 gene locus_tag LOCUS_26080 27225 29126 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942985.1 protein_id gnl|my_center|LOCUS_26080 29188 30357 gene locus_tag LOCUS_26090 29188 30357 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028856.1 protein_id gnl|my_center|LOCUS_26090 30488 31171 gene locus_tag LOCUS_26100 30488 31171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 31808 31275 gene locus_tag LOCUS_26110 31808 31275 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980098.1 protein_id gnl|my_center|LOCUS_26110 34607 31839 gene locus_tag LOCUS_26120 gene gcvP 34607 31839 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140250.1 protein_id gnl|my_center|LOCUS_26120 35631 34852 gene locus_tag LOCUS_26130 35631 34852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 35695 36867 gene locus_tag LOCUS_26140 gene nagA 35695 36867 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292242.1 protein_id gnl|my_center|LOCUS_26140 36932 38848 gene locus_tag LOCUS_26150 36932 38848 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706272.1 protein_id gnl|my_center|LOCUS_26150 39481 38876 gene locus_tag LOCUS_26160 39481 38876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 39847 39494 gene locus_tag LOCUS_26170 39847 39494 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001971937.1 protein_id gnl|my_center|LOCUS_26170 39952 40410 gene locus_tag LOCUS_26180 39952 40410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112531.1 protein_id gnl|my_center|LOCUS_26180 40455 41831 gene locus_tag LOCUS_26190 gene xseA 40455 41831 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113813.1 protein_id gnl|my_center|LOCUS_26190 42044 45661 gene locus_tag LOCUS_26200 42044 45661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 45748 48273 gene locus_tag LOCUS_26210 45748 48273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 48312 51293 gene locus_tag LOCUS_26220 48312 51293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 51300 52004 gene locus_tag LOCUS_26230 51300 52004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 52264 56646 gene locus_tag LOCUS_26240 52264 56646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 56731 60384 gene locus_tag LOCUS_26250 56731 60384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 61373 60450 gene locus_tag LOCUS_26260 61373 60450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 61407 62834 gene locus_tag LOCUS_26270 61407 62834 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976070.1 protein_id gnl|my_center|LOCUS_26270 62909 64975 gene locus_tag LOCUS_26280 gene cstA 62909 64975 CDS product carbon starvation protein CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047792095.1 protein_id gnl|my_center|LOCUS_26280 65073 66236 gene locus_tag LOCUS_26290 65073 66236 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201856.1 protein_id gnl|my_center|LOCUS_26290 66256 67353 gene locus_tag LOCUS_26300 66256 67353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 67728 68246 gene locus_tag LOCUS_26310 67728 68246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 68349 70406 gene locus_tag LOCUS_26320 gene kdpB 68349 70406 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816820.1 protein_id gnl|my_center|LOCUS_26320 70425 72080 gene locus_tag LOCUS_26330 gene kdpA 70425 72080 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963802.1 protein_id gnl|my_center|LOCUS_26330 72103 72648 gene locus_tag LOCUS_26340 gene kdpC 72103 72648 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391518.1 protein_id gnl|my_center|LOCUS_26340 72660 75269 gene locus_tag LOCUS_26350 72660 75269 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943120.1 protein_id gnl|my_center|LOCUS_26350 75266 75946 gene locus_tag LOCUS_26360 75266 75946 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943121.1 protein_id gnl|my_center|LOCUS_26360 76013 77545 gene locus_tag LOCUS_26370 76013 77545 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_26370 <78734 77955 gene locus_tag LOCUS_26380 <78734 77955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767406.1:right-handed parallel beta-helix repeat-containing protein >Feature sequence26 316 618 gene locus_tag LOCUS_26390 316 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 1021 1857 gene locus_tag LOCUS_26400 1021 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 1918 3078 gene locus_tag LOCUS_26410 gene glf 1918 3078 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525129.1 protein_id gnl|my_center|LOCUS_26410 3098 4060 gene locus_tag LOCUS_26420 3098 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 4113 4991 gene locus_tag LOCUS_26430 4113 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 5029 6267 gene locus_tag LOCUS_26440 5029 6267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 6264 7409 gene locus_tag LOCUS_26450 6264 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 7412 8083 gene locus_tag LOCUS_26460 7412 8083 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_26460 8187 12002 gene locus_tag LOCUS_26470 8187 12002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 12056 12841 gene locus_tag LOCUS_26480 12056 12841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 12861 13625 gene locus_tag LOCUS_26490 12861 13625 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878191.1 protein_id gnl|my_center|LOCUS_26490 13622 15049 gene locus_tag LOCUS_26500 13622 15049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 15156 17477 gene locus_tag LOCUS_26510 15156 17477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 17482 18267 gene locus_tag LOCUS_26520 17482 18267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 18264 19124 gene locus_tag LOCUS_26530 18264 19124 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122211.1 protein_id gnl|my_center|LOCUS_26530 19135 19872 gene locus_tag LOCUS_26540 19135 19872 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_26540 19916 22264 gene locus_tag LOCUS_26550 19916 22264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 22294 22920 gene locus_tag LOCUS_26560 22294 22920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 22917 24047 gene locus_tag LOCUS_26570 22917 24047 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391758.1 protein_id gnl|my_center|LOCUS_26570 24056 25255 gene locus_tag LOCUS_26580 24056 25255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 25323 26120 gene locus_tag LOCUS_26590 25323 26120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 26160 27074 gene locus_tag LOCUS_26600 26160 27074 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228270.1 protein_id gnl|my_center|LOCUS_26600 28261 27068 gene locus_tag LOCUS_26610 28261 27068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 28398 29804 gene locus_tag LOCUS_26620 28398 29804 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583255.1 protein_id gnl|my_center|LOCUS_26620 29883 32078 gene locus_tag LOCUS_26630 29883 32078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 32807 32079 gene locus_tag LOCUS_26640 32807 32079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 33814 32804 gene locus_tag LOCUS_26650 33814 32804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 33916 34842 gene locus_tag LOCUS_26660 33916 34842 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546354.1 protein_id gnl|my_center|LOCUS_26660 34968 35558 gene locus_tag LOCUS_26670 34968 35558 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722740.1 protein_id gnl|my_center|LOCUS_26670 35669 36286 gene locus_tag LOCUS_26680 gene pth 35669 36286 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140541.1 protein_id gnl|my_center|LOCUS_26680 36252 36539 gene locus_tag LOCUS_26690 36252 36539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 36572 37099 gene locus_tag LOCUS_26700 36572 37099 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_26700 37285 39009 gene locus_tag LOCUS_26710 37285 39009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 40348 39017 gene locus_tag LOCUS_26720 40348 39017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 41565 40348 gene locus_tag LOCUS_26730 41565 40348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 41720 42448 gene locus_tag LOCUS_26740 41720 42448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 43791 42469 gene locus_tag LOCUS_26750 43791 42469 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921570.1 protein_id gnl|my_center|LOCUS_26750 44002 44433 gene locus_tag LOCUS_26760 gene rplM 44002 44433 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583377.1 protein_id gnl|my_center|LOCUS_26760 44454 44849 gene locus_tag LOCUS_26770 gene rpsI 44454 44849 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390000.1 protein_id gnl|my_center|LOCUS_26770 44980 49215 gene locus_tag LOCUS_26780 44980 49215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 49338 53246 gene locus_tag LOCUS_26790 49338 53246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 54278 53412 gene locus_tag LOCUS_26800 gene tsf 54278 53412 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938172.1 protein_id gnl|my_center|LOCUS_26800 55038 54358 gene locus_tag LOCUS_26810 gene rpsB 55038 54358 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_26810 55578 55237 gene locus_tag LOCUS_26820 55578 55237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 55725 56324 gene locus_tag LOCUS_26830 gene rpoE 55725 56324 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554912.1 protein_id gnl|my_center|LOCUS_26830 56379 56771 gene locus_tag LOCUS_26840 56379 56771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 56887 57696 gene locus_tag LOCUS_26850 56887 57696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 58728 57760 gene locus_tag LOCUS_26860 gene dusB 58728 57760 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_26860 59150 58836 gene locus_tag LOCUS_26870 59150 58836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 60473 61714 gene locus_tag LOCUS_26880 60473 61714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 61975 63636 gene locus_tag LOCUS_26890 61975 63636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 63667 64413 gene locus_tag LOCUS_26900 63667 64413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 64604 65164 gene locus_tag LOCUS_26910 64604 65164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 65172 68165 gene locus_tag LOCUS_26920 65172 68165 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391010.1 protein_id gnl|my_center|LOCUS_26920 68257 69219 gene locus_tag LOCUS_26930 68257 69219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 69308 71110 gene locus_tag LOCUS_26940 69308 71110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 71167 72915 gene locus_tag LOCUS_26950 71167 72915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 73321 76656 gene locus_tag LOCUS_26960 73321 76656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 77633 77145 gene locus_tag LOCUS_26970 77633 77145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 >Feature sequence27 138 968 gene locus_tag LOCUS_26980 138 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 1753 2841 gene locus_tag LOCUS_26990 1753 2841 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903779.1 protein_id gnl|my_center|LOCUS_26990 2998 6258 gene locus_tag LOCUS_27000 2998 6258 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873439.1 protein_id gnl|my_center|LOCUS_27000 5466 5371 gene locus_tag LOCUS_t00340 5466 5371 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 6627 7454 gene locus_tag LOCUS_27010 6627 7454 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947828.1 protein_id gnl|my_center|LOCUS_27010 8035 7487 gene locus_tag LOCUS_27020 8035 7487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 8476 8877 gene locus_tag LOCUS_27030 8476 8877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 8961 9281 gene locus_tag LOCUS_27040 8961 9281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 9278 10858 gene locus_tag LOCUS_27050 9278 10858 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939561.1 protein_id gnl|my_center|LOCUS_27050 10855 11448 gene locus_tag LOCUS_27060 10855 11448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27060 11334 11810 gene locus_tag LOCUS_27070 11334 11810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27070 12421 14052 gene locus_tag LOCUS_27080 12421 14052 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118026.1 protein_id gnl|my_center|LOCUS_27080 14899 14210 gene locus_tag LOCUS_27090 14899 14210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 16926 15007 gene locus_tag LOCUS_27100 16926 15007 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031492.1 protein_id gnl|my_center|LOCUS_27100 17168 18142 gene locus_tag LOCUS_27110 17168 18142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 19315 18416 gene locus_tag LOCUS_27120 19315 18416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 21420 19312 gene locus_tag LOCUS_27130 21420 19312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 22136 22786 gene locus_tag LOCUS_27140 22136 22786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 23116 24099 gene locus_tag LOCUS_27150 23116 24099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 24104 26086 gene locus_tag LOCUS_27160 24104 26086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 26108 26455 gene locus_tag LOCUS_27170 26108 26455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 26632 27420 gene locus_tag LOCUS_27180 26632 27420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 27530 28858 gene locus_tag LOCUS_27190 27530 28858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 29045 31504 gene locus_tag LOCUS_27200 29045 31504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 31601 31999 gene locus_tag LOCUS_27210 31601 31999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 33516 32050 gene locus_tag LOCUS_27220 33516 32050 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921302.1 protein_id gnl|my_center|LOCUS_27220 36756 33523 gene locus_tag LOCUS_27230 36756 33523 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_27230 38235 36844 gene locus_tag LOCUS_27240 38235 36844 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027550.1 protein_id gnl|my_center|LOCUS_27240 38225 38881 gene locus_tag LOCUS_27250 38225 38881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 39113 38892 gene locus_tag LOCUS_27260 39113 38892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 39143 40714 gene locus_tag LOCUS_27270 gene menD 39143 40714 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055985.1 protein_id gnl|my_center|LOCUS_27270 41174 40701 gene locus_tag LOCUS_27280 41174 40701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 41173 42600 gene locus_tag LOCUS_27290 gene argH 41173 42600 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_27290 44047 42626 gene locus_tag LOCUS_27300 44047 42626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 44307 47786 gene locus_tag LOCUS_27310 44307 47786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 48170 49210 gene locus_tag LOCUS_27320 48170 49210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 49351 50424 gene locus_tag LOCUS_27330 49351 50424 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338937.1 protein_id gnl|my_center|LOCUS_27330 51905 50520 gene locus_tag LOCUS_27340 51905 50520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 52271 51969 gene locus_tag LOCUS_27350 52271 51969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 52855 52277 gene locus_tag LOCUS_27360 52855 52277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 53336 52917 gene locus_tag LOCUS_27370 53336 52917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 53480 53554 gene locus_tag LOCUS_t00350 53480 53554 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 53595 54392 gene locus_tag LOCUS_27380 53595 54392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 55803 54574 gene locus_tag LOCUS_27390 55803 54574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 56619 55813 gene locus_tag LOCUS_27400 56619 55813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 56683 57078 gene locus_tag LOCUS_27410 56683 57078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 57092 57490 gene locus_tag LOCUS_27420 57092 57490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 57507 57965 gene locus_tag LOCUS_27430 gene smpB 57507 57965 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259157.1 protein_id gnl|my_center|LOCUS_27430 58310 57966 gene locus_tag LOCUS_27440 58310 57966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 58407 59000 gene locus_tag LOCUS_27450 gene yihA 58407 59000 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794469.1 protein_id gnl|my_center|LOCUS_27450 60255 59005 gene locus_tag LOCUS_27460 60255 59005 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930602.1 protein_id gnl|my_center|LOCUS_27460 60752 60423 gene locus_tag LOCUS_27470 60752 60423 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957599.1 protein_id gnl|my_center|LOCUS_27470 60892 62805 gene locus_tag LOCUS_27480 60892 62805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 63026 65146 gene locus_tag LOCUS_27490 63026 65146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 65143 65841 gene locus_tag LOCUS_27500 65143 65841 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268769.1 protein_id gnl|my_center|LOCUS_27500 66399 65830 gene locus_tag LOCUS_27510 gene pyrE 66399 65830 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942282.1 protein_id gnl|my_center|LOCUS_27510 66491 68959 gene locus_tag LOCUS_27520 66491 68959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 68959 69615 gene locus_tag LOCUS_27530 68959 69615 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058035.1 protein_id gnl|my_center|LOCUS_27530 70095 69640 gene locus_tag LOCUS_27540 70095 69640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 70144 72657 gene locus_tag LOCUS_27550 70144 72657 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938723.1 protein_id gnl|my_center|LOCUS_27550 >Feature sequence28 <1 714 gene locus_tag LOCUS_27560 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114586.1:transposase 795 2390 gene locus_tag LOCUS_27570 gene murJ 795 2390 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946821.1 protein_id gnl|my_center|LOCUS_27570 3473 2394 gene locus_tag LOCUS_27580 3473 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 3673 4689 gene locus_tag LOCUS_27590 3673 4689 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038722.1 protein_id gnl|my_center|LOCUS_27590 9966 4696 gene locus_tag LOCUS_27600 9966 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 10111 10875 gene locus_tag LOCUS_27610 10111 10875 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066563253.1 protein_id gnl|my_center|LOCUS_27610 10912 11604 gene locus_tag LOCUS_27620 10912 11604 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836735.1 protein_id gnl|my_center|LOCUS_27620 11601 12353 gene locus_tag LOCUS_27630 11601 12353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 12423 14198 gene locus_tag LOCUS_27640 gene msbA 12423 14198 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_27640 15093 14215 gene locus_tag LOCUS_27650 gene folD 15093 14215 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_27650 15800 15126 gene locus_tag LOCUS_27660 15800 15126 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367246.1 protein_id gnl|my_center|LOCUS_27660 17321 15822 gene locus_tag LOCUS_27670 gene xylB 17321 15822 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267678.1 protein_id gnl|my_center|LOCUS_27670 17937 17485 gene locus_tag LOCUS_27680 17937 17485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 18498 18037 gene locus_tag LOCUS_27690 18498 18037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 18575 19168 gene locus_tag LOCUS_27700 18575 19168 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_27700 19212 19733 gene locus_tag LOCUS_27710 19212 19733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 20387 19746 gene locus_tag LOCUS_27720 20387 19746 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245030.1 protein_id gnl|my_center|LOCUS_27720 22695 20443 gene locus_tag LOCUS_27730 22695 20443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 22811 23299 gene locus_tag LOCUS_27740 22811 23299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 23405 24106 gene locus_tag LOCUS_27750 23405 24106 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038721.1 protein_id gnl|my_center|LOCUS_27750 24988 24236 gene locus_tag LOCUS_27760 24988 24236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 25775 25104 gene locus_tag LOCUS_27770 25775 25104 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763153.1 protein_id gnl|my_center|LOCUS_27770 26755 25772 gene locus_tag LOCUS_27780 26755 25772 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258345.1 protein_id gnl|my_center|LOCUS_27780 28014 26968 gene locus_tag LOCUS_27790 gene ilvC 28014 26968 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392863.1 protein_id gnl|my_center|LOCUS_27790 28226 29332 gene locus_tag LOCUS_27800 gene thiH 28226 29332 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008477.1 protein_id gnl|my_center|LOCUS_27800 30655 29384 gene locus_tag LOCUS_27810 30655 29384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 30756 31079 gene locus_tag LOCUS_27820 30756 31079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 31113 32474 gene locus_tag LOCUS_27830 31113 32474 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039535.1 protein_id gnl|my_center|LOCUS_27830 33164 33003 gene locus_tag LOCUS_27840 33164 33003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 34612 33272 gene locus_tag LOCUS_27850 34612 33272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 35229 34900 gene locus_tag LOCUS_27860 35229 34900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 35652 35299 gene locus_tag LOCUS_27870 35652 35299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 36406 36125 gene locus_tag LOCUS_27880 36406 36125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 37567 36782 gene locus_tag LOCUS_27890 37567 36782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 38776 37760 gene locus_tag LOCUS_27900 38776 37760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 39443 38904 gene locus_tag LOCUS_27910 39443 38904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 40060 41067 gene locus_tag LOCUS_27920 40060 41067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 41087 41461 gene locus_tag LOCUS_27930 41087 41461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 41971 41651 gene locus_tag LOCUS_27940 41971 41651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 42044 42481 gene locus_tag LOCUS_27950 42044 42481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 42512 43279 gene locus_tag LOCUS_27960 gene fabG 42512 43279 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_27960 43299 43805 gene locus_tag LOCUS_27970 gene sixA 43299 43805 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141750.1 protein_id gnl|my_center|LOCUS_27970 43901 44695 gene locus_tag LOCUS_27980 43901 44695 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870446.1 protein_id gnl|my_center|LOCUS_27980 44934 44707 gene locus_tag LOCUS_27990 44934 44707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 45224 46252 gene locus_tag LOCUS_28000 45224 46252 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938090.1 protein_id gnl|my_center|LOCUS_28000 46278 47090 gene locus_tag LOCUS_28010 46278 47090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 47096 47683 gene locus_tag LOCUS_28020 47096 47683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 47690 49873 gene locus_tag LOCUS_28030 gene mrdA 47690 49873 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388232.1 protein_id gnl|my_center|LOCUS_28030 49921 51507 gene locus_tag LOCUS_28040 gene rng 49921 51507 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_28040 51549 52952 gene locus_tag LOCUS_28050 gene pyk 51549 52952 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834388.1 protein_id gnl|my_center|LOCUS_28050 53052 53882 gene locus_tag LOCUS_28060 53052 53882 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871021.1 protein_id gnl|my_center|LOCUS_28060 53980 55311 gene locus_tag LOCUS_28070 53980 55311 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335517.1 protein_id gnl|my_center|LOCUS_28070 55321 57783 gene locus_tag LOCUS_28080 55321 57783 CDS product PPC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260401.1 protein_id gnl|my_center|LOCUS_28080 59246 57876 gene locus_tag LOCUS_28090 59246 57876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 60598 59243 gene locus_tag LOCUS_28100 60598 59243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 62087 60585 gene locus_tag LOCUS_28110 62087 60585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 63091 62084 gene locus_tag LOCUS_28120 63091 62084 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122104.1 protein_id gnl|my_center|LOCUS_28120 63711 63088 gene locus_tag LOCUS_28130 63711 63088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 66347 63708 gene locus_tag LOCUS_28140 66347 63708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 66520 67173 gene locus_tag LOCUS_28150 66520 67173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 67548 67108 gene locus_tag LOCUS_28160 67548 67108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 68477 67545 gene locus_tag LOCUS_28170 68477 67545 CDS product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943321.1 protein_id gnl|my_center|LOCUS_28170 69542 68493 gene locus_tag LOCUS_28180 69542 68493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 69652 70374 gene locus_tag LOCUS_28190 69652 70374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 70388 71173 gene locus_tag LOCUS_28200 70388 71173 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222128.1 protein_id gnl|my_center|LOCUS_28200 71232 71867 gene locus_tag LOCUS_28210 gene pdxH 71232 71867 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282319.1 protein_id gnl|my_center|LOCUS_28210 72080 71901 gene locus_tag LOCUS_28220 72080 71901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 >Feature sequence29 2007 3179 gene locus_tag LOCUS_28230 2007 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 3363 6566 gene locus_tag LOCUS_28240 3363 6566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 6626 7192 gene locus_tag LOCUS_28250 6626 7192 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 protein_id gnl|my_center|LOCUS_28250 7265 8470 gene locus_tag LOCUS_28260 7265 8470 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392434.1 protein_id gnl|my_center|LOCUS_28260 9799 8891 gene locus_tag LOCUS_28270 9799 8891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 13052 9867 gene locus_tag LOCUS_28280 13052 9867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 15225 13072 gene locus_tag LOCUS_28290 15225 13072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 18476 15342 gene locus_tag LOCUS_28300 18476 15342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 19235 18522 gene locus_tag LOCUS_28310 19235 18522 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_28310 20917 19766 gene locus_tag LOCUS_28320 gene phnW 20917 19766 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786490.1 protein_id gnl|my_center|LOCUS_28320 22382 20952 gene locus_tag LOCUS_28330 gene phnY 22382 20952 CDS product phosphonoacetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194628.1 protein_id gnl|my_center|LOCUS_28330 23614 22388 gene locus_tag LOCUS_28340 gene phnA 23614 22388 CDS product phosphonoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040446.1 protein_id gnl|my_center|LOCUS_28340 24761 23631 gene locus_tag LOCUS_28350 24761 23631 CDS product TIGR03364 family FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073077526.1 protein_id gnl|my_center|LOCUS_28350 26647 24758 gene locus_tag LOCUS_28360 26647 24758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 28035 26713 gene locus_tag LOCUS_28370 28035 26713 CDS product DUF5690 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918537.1 protein_id gnl|my_center|LOCUS_28370 30430 28142 gene locus_tag LOCUS_28380 30430 28142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 30600 31769 gene locus_tag LOCUS_28390 30600 31769 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 protein_id gnl|my_center|LOCUS_28390 35636 31776 gene locus_tag LOCUS_28400 35636 31776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 40168 35729 gene locus_tag LOCUS_28410 40168 35729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 40282 40560 gene locus_tag LOCUS_28420 40282 40560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 40582 40854 gene locus_tag LOCUS_28430 40582 40854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 40857 41240 gene locus_tag LOCUS_28440 40857 41240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 41317 42279 gene locus_tag LOCUS_28450 41317 42279 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056320.1 protein_id gnl|my_center|LOCUS_28450 44268 42292 gene locus_tag LOCUS_28460 44268 42292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 45566 44367 gene locus_tag LOCUS_28470 45566 44367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 45766 49443 gene locus_tag LOCUS_28480 45766 49443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 49440 50162 gene locus_tag LOCUS_28490 49440 50162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 50215 52026 gene locus_tag LOCUS_28500 50215 52026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 52319 58027 gene locus_tag LOCUS_28510 52319 58027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 58119 61652 gene locus_tag LOCUS_28520 58119 61652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 62761 61718 gene locus_tag LOCUS_28530 62761 61718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 62936 64003 gene locus_tag LOCUS_28540 62936 64003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 64000 65259 gene locus_tag LOCUS_28550 64000 65259 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793004.1 protein_id gnl|my_center|LOCUS_28550 65279 66235 gene locus_tag LOCUS_28560 65279 66235 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921630.1 protein_id gnl|my_center|LOCUS_28560 66235 67386 gene locus_tag LOCUS_28570 66235 67386 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119310.1 protein_id gnl|my_center|LOCUS_28570 67731 69131 gene locus_tag LOCUS_28580 gene rpoN 67731 69131 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054367.1 protein_id gnl|my_center|LOCUS_28580 70448 69165 gene locus_tag LOCUS_28590 70448 69165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 >Feature sequence30 2334 1018 gene locus_tag LOCUS_28600 2334 1018 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922160.1 protein_id gnl|my_center|LOCUS_28600 7040 2520 gene locus_tag LOCUS_28610 7040 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 7265 8353 gene locus_tag LOCUS_28620 7265 8353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 8387 9289 gene locus_tag LOCUS_28630 8387 9289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 10542 9268 gene locus_tag LOCUS_28640 10542 9268 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932712.1 protein_id gnl|my_center|LOCUS_28640 11757 10852 gene locus_tag LOCUS_28650 11757 10852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 11957 13270 gene locus_tag LOCUS_28660 11957 13270 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963124.1 protein_id gnl|my_center|LOCUS_28660 15283 13283 gene locus_tag LOCUS_28670 15283 13283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28670 16499 15276 gene locus_tag LOCUS_28680 16499 15276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 17147 16536 gene locus_tag LOCUS_28690 17147 16536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 17325 18197 gene locus_tag LOCUS_28700 17325 18197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 19365 18211 gene locus_tag LOCUS_28710 gene nifS 19365 18211 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_28710 20324 19425 gene locus_tag LOCUS_28720 20324 19425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 21857 20457 gene locus_tag LOCUS_28730 21857 20457 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921825.1 protein_id gnl|my_center|LOCUS_28730 23744 21885 gene locus_tag LOCUS_28740 23744 21885 CDS product DUF1588 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615747.1 protein_id gnl|my_center|LOCUS_28740 24701 23781 gene locus_tag LOCUS_28750 gene fmt 24701 23781 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392417.1 protein_id gnl|my_center|LOCUS_28750 25408 24713 gene locus_tag LOCUS_28760 25408 24713 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114385.1 protein_id gnl|my_center|LOCUS_28760 26292 25405 gene locus_tag LOCUS_28770 26292 25405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 26848 26315 gene locus_tag LOCUS_28780 26848 26315 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_28780 27843 26866 gene locus_tag LOCUS_28790 gene trpS 27843 26866 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120916.1 protein_id gnl|my_center|LOCUS_28790 28598 27885 gene locus_tag LOCUS_28800 28598 27885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 28704 29273 gene locus_tag LOCUS_28810 28704 29273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 29339 30154 gene locus_tag LOCUS_28820 29339 30154 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902785.1 protein_id gnl|my_center|LOCUS_28820 30198 30878 gene locus_tag LOCUS_28830 30198 30878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 31856 31002 gene locus_tag LOCUS_28840 31856 31002 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770450.1 protein_id gnl|my_center|LOCUS_28840 33285 31966 gene locus_tag LOCUS_28850 33285 31966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 33470 34184 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tccgtcgtcgtcgtcgtct 35626 34577 gene locus_tag LOCUS_28860 gene bioB 35626 34577 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973491.1 protein_id gnl|my_center|LOCUS_28860 35830 36780 gene locus_tag LOCUS_28870 35830 36780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 36777 37592 gene locus_tag LOCUS_28880 36777 37592 CDS product FeoB small GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392919.1 protein_id gnl|my_center|LOCUS_28880 37602 39011 gene locus_tag LOCUS_28890 37602 39011 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392918.1 protein_id gnl|my_center|LOCUS_28890 39101 39679 gene locus_tag LOCUS_28900 39101 39679 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123671.1 protein_id gnl|my_center|LOCUS_28900 39676 41955 gene locus_tag LOCUS_28910 39676 41955 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118002.1 protein_id gnl|my_center|LOCUS_28910 42101 47020 gene locus_tag LOCUS_28920 42101 47020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 47209 50124 gene locus_tag LOCUS_28930 47209 50124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 50616 51215 gene locus_tag LOCUS_28940 50616 51215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 51246 51644 gene locus_tag LOCUS_28950 51246 51644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 51667 52371 gene locus_tag LOCUS_28960 51667 52371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 52799 52960 gene locus_tag LOCUS_28970 52799 52960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 53064 54344 gene locus_tag LOCUS_28980 53064 54344 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118023.1 protein_id gnl|my_center|LOCUS_28980 54396 55793 gene locus_tag LOCUS_28990 gene mgtE 54396 55793 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870202.1 protein_id gnl|my_center|LOCUS_28990 59450 55803 gene locus_tag LOCUS_29000 gene hrpA 59450 55803 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228749.1 protein_id gnl|my_center|LOCUS_29000 >Feature sequence31 1579 251 gene locus_tag LOCUS_29010 1579 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 2644 1652 gene locus_tag LOCUS_29020 2644 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 5090 2829 gene locus_tag LOCUS_29030 5090 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 5949 5701 gene locus_tag LOCUS_29040 5949 5701 CDS product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479911.1 protein_id gnl|my_center|LOCUS_29040 6758 6072 gene locus_tag LOCUS_29050 6758 6072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 8224 6833 gene locus_tag LOCUS_29060 8224 6833 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964731.1 protein_id gnl|my_center|LOCUS_29060 8489 8229 gene locus_tag LOCUS_29070 8489 8229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 8822 8553 gene locus_tag LOCUS_29080 gene rpsN 8822 8553 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085703.1 protein_id gnl|my_center|LOCUS_29080 9485 8937 gene locus_tag LOCUS_29090 9485 8937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 9667 10689 gene locus_tag LOCUS_29100 9667 10689 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207999.1 protein_id gnl|my_center|LOCUS_29100 11888 10686 gene locus_tag LOCUS_29110 11888 10686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 12039 12824 gene locus_tag LOCUS_29120 12039 12824 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986856.1 protein_id gnl|my_center|LOCUS_29120 14026 12899 gene locus_tag LOCUS_29130 14026 12899 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_29130 14890 14033 gene locus_tag LOCUS_29140 14890 14033 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339518.1 protein_id gnl|my_center|LOCUS_29140 16381 15020 gene locus_tag LOCUS_29150 gene asnS 16381 15020 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937318.1 protein_id gnl|my_center|LOCUS_29150 16493 19183 gene locus_tag LOCUS_29160 16493 19183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 19448 19194 gene locus_tag LOCUS_29170 19448 19194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 19670 19476 gene locus_tag LOCUS_29180 19670 19476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 19858 20688 gene locus_tag LOCUS_29190 gene accD 19858 20688 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223544.1 protein_id gnl|my_center|LOCUS_29190 23575 20705 gene locus_tag LOCUS_29200 23575 20705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109257.1 protein_id gnl|my_center|LOCUS_29200 24401 23664 gene locus_tag LOCUS_29210 24401 23664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 24749 24417 gene locus_tag LOCUS_29220 24749 24417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 24803 25246 gene locus_tag LOCUS_29230 24803 25246 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227792.1 protein_id gnl|my_center|LOCUS_29230 25283 25873 gene locus_tag LOCUS_29240 25283 25873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 26080 25886 gene locus_tag LOCUS_29250 26080 25886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 26965 26156 gene locus_tag LOCUS_29260 26965 26156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 27804 27010 gene locus_tag LOCUS_29270 27804 27010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 27953 29686 gene locus_tag LOCUS_29280 27953 29686 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582658.1 protein_id gnl|my_center|LOCUS_29280 29774 29956 gene locus_tag LOCUS_29290 29774 29956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 30630 30034 gene locus_tag LOCUS_29300 30630 30034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 30761 31531 gene locus_tag LOCUS_29310 30761 31531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 31528 32313 gene locus_tag LOCUS_29320 31528 32313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 32453 33061 gene locus_tag LOCUS_29330 32453 33061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 33132 33698 gene locus_tag LOCUS_29340 33132 33698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 33712 35214 gene locus_tag LOCUS_29350 33712 35214 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764424.1 protein_id gnl|my_center|LOCUS_29350 35419 36429 gene locus_tag LOCUS_29360 gene prfB 35419 36429 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881199.1 protein_id gnl|my_center|LOCUS_29360 36426 36932 gene locus_tag LOCUS_29370 36426 36932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 37886 36900 gene locus_tag LOCUS_29380 37886 36900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 39001 37883 gene locus_tag LOCUS_29390 39001 37883 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975709.1 protein_id gnl|my_center|LOCUS_29390 39076 39615 gene locus_tag LOCUS_29400 39076 39615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 41175 39643 gene locus_tag LOCUS_29410 41175 39643 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_29410 42382 41501 gene locus_tag LOCUS_29420 42382 41501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 42582 43559 gene locus_tag LOCUS_29430 42582 43559 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_29430 43556 46798 gene locus_tag LOCUS_29440 43556 46798 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663427.1 protein_id gnl|my_center|LOCUS_29440 46912 47931 gene locus_tag LOCUS_29450 46912 47931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 47939 49036 gene locus_tag LOCUS_29460 47939 49036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528388.1 protein_id gnl|my_center|LOCUS_29460 49101 50102 gene locus_tag LOCUS_29470 49101 50102 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_29470 50146 51465 gene locus_tag LOCUS_29480 50146 51465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328450.1 protein_id gnl|my_center|LOCUS_29480 51596 52744 gene locus_tag LOCUS_29490 51596 52744 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_29490 53397 52807 gene locus_tag LOCUS_29500 53397 52807 CDS product DUF4234 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112490.1 protein_id gnl|my_center|LOCUS_29500 54280 53390 gene locus_tag LOCUS_29510 gene plcA 54280 53390 CDS product phosphatidylinositol diacylglycerol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066288.1 protein_id gnl|my_center|LOCUS_29510 54359 57946 gene locus_tag LOCUS_29520 54359 57946 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099263823.1 protein_id gnl|my_center|LOCUS_29520 58987 57956 gene locus_tag LOCUS_29530 58987 57956 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119735.1 protein_id gnl|my_center|LOCUS_29530 59925 58987 gene locus_tag LOCUS_29540 59925 58987 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921278.1 protein_id gnl|my_center|LOCUS_29540 60724 59927 gene locus_tag LOCUS_29550 60724 59927 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817305.1 protein_id gnl|my_center|LOCUS_29550 62716 60788 gene locus_tag LOCUS_29560 62716 60788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 63117 62713 gene locus_tag LOCUS_29570 63117 62713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 65069 63270 gene locus_tag LOCUS_29580 65069 63270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 65642 65148 gene locus_tag LOCUS_29590 65642 65148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 65754 67505 gene locus_tag LOCUS_29600 65754 67505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 67531 68547 gene locus_tag LOCUS_29610 67531 68547 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970070.1 protein_id gnl|my_center|LOCUS_29610 >Feature sequence32 3276 4382 gene locus_tag LOCUS_29620 3276 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 4939 9444 gene locus_tag LOCUS_29630 4939 9444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 9677 11050 gene locus_tag LOCUS_29640 9677 11050 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767199.1 protein_id gnl|my_center|LOCUS_29640 11086 12462 gene locus_tag LOCUS_29650 11086 12462 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922306.1 protein_id gnl|my_center|LOCUS_29650 12472 13884 gene locus_tag LOCUS_29660 12472 13884 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922975.1 protein_id gnl|my_center|LOCUS_29660 14037 16961 gene locus_tag LOCUS_29670 14037 16961 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118988.1 protein_id gnl|my_center|LOCUS_29670 16966 18444 gene locus_tag LOCUS_29680 16966 18444 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118989.1 protein_id gnl|my_center|LOCUS_29680 18613 19944 gene locus_tag LOCUS_29690 18613 19944 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922160.1 protein_id gnl|my_center|LOCUS_29690 21648 20044 gene locus_tag LOCUS_29700 21648 20044 CDS product putative Ig domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202440.1 protein_id gnl|my_center|LOCUS_29700 22570 23991 gene locus_tag LOCUS_29710 22570 23991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 24641 25213 gene locus_tag LOCUS_29720 24641 25213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 26117 25290 gene locus_tag LOCUS_29730 26117 25290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 32381 26160 gene locus_tag LOCUS_29740 32381 26160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 32748 32912 gene locus_tag LOCUS_29750 32748 32912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 33211 33462 gene locus_tag LOCUS_29760 33211 33462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 33470 35350 gene locus_tag LOCUS_29770 gene feoB 33470 35350 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640041.1 protein_id gnl|my_center|LOCUS_29770 35653 35904 gene locus_tag LOCUS_29780 35653 35904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 35965 37188 gene locus_tag LOCUS_29790 gene rlmD 35965 37188 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_29790 38041 37196 gene locus_tag LOCUS_29800 38041 37196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 39219 38047 gene locus_tag LOCUS_29810 39219 38047 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258073.1 protein_id gnl|my_center|LOCUS_29810 39564 39247 gene locus_tag LOCUS_29820 39564 39247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 39649 40611 gene locus_tag LOCUS_29830 39649 40611 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529258.1 protein_id gnl|my_center|LOCUS_29830 41216 41647 gene locus_tag LOCUS_29840 41216 41647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 41800 44586 gene locus_tag LOCUS_29850 41800 44586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 44595 45266 gene locus_tag LOCUS_29860 44595 45266 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_29860 45442 50457 gene locus_tag LOCUS_29870 45442 50457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 51083 54898 gene locus_tag LOCUS_29880 51083 54898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29880 56647 55043 gene locus_tag LOCUS_29890 gene serA 56647 55043 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_29890 58266 56848 gene locus_tag LOCUS_29900 gene gndA 58266 56848 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230365.1 protein_id gnl|my_center|LOCUS_29900 58314 58946 gene locus_tag LOCUS_29910 gene pgsA 58314 58946 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939132.1 protein_id gnl|my_center|LOCUS_29910 59706 58960 gene locus_tag LOCUS_29920 59706 58960 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211996.1 protein_id gnl|my_center|LOCUS_29920 61106 59703 gene locus_tag LOCUS_29930 61106 59703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 62483 61137 gene locus_tag LOCUS_29940 62483 61137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 63354 62536 gene locus_tag LOCUS_29950 63354 62536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 64328 63441 gene locus_tag LOCUS_29960 64328 63441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 65103 64435 gene locus_tag LOCUS_29970 65103 64435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 >Feature sequence33 <1 1215 gene locus_tag LOCUS_29980 <1 1215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243665.1:tRNA nuclease WapA 1216 1497 gene locus_tag LOCUS_29990 1216 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 1657 2250 gene locus_tag LOCUS_30000 1657 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 2282 2956 gene locus_tag LOCUS_30010 2282 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 3551 3997 gene locus_tag LOCUS_30020 3551 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 5171 4551 gene locus_tag LOCUS_30030 gene nth 5171 4551 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778932.1 protein_id gnl|my_center|LOCUS_30030 5259 7409 gene locus_tag LOCUS_30040 5259 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 7406 8221 gene locus_tag LOCUS_30050 7406 8221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 8241 9515 gene locus_tag LOCUS_30060 8241 9515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 9512 10621 gene locus_tag LOCUS_30070 9512 10621 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208294.1 protein_id gnl|my_center|LOCUS_30070 11919 10636 gene locus_tag LOCUS_30080 11919 10636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 12569 11916 gene locus_tag LOCUS_30090 12569 11916 CDS product PhoP regulatory network YrbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813249.1 protein_id gnl|my_center|LOCUS_30090 12719 13729 gene locus_tag LOCUS_30100 12719 13729 CDS product mitochondrial fission ELM1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920689.1 protein_id gnl|my_center|LOCUS_30100 15520 14006 gene locus_tag LOCUS_30110 15520 14006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 16185 15550 gene locus_tag LOCUS_30120 16185 15550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 16318 17157 gene locus_tag LOCUS_30130 16318 17157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 18085 17159 gene locus_tag LOCUS_30140 18085 17159 CDS product ELM1/GtrOC1 family putative glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207641.1 protein_id gnl|my_center|LOCUS_30140 18141 18797 gene locus_tag LOCUS_30150 18141 18797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 19562 18792 gene locus_tag LOCUS_30160 19562 18792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 21046 19559 gene locus_tag LOCUS_30170 21046 19559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 21193 21831 gene locus_tag LOCUS_30180 21193 21831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 21839 22300 gene locus_tag LOCUS_30190 21839 22300 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941854.1 protein_id gnl|my_center|LOCUS_30190 22310 23410 gene locus_tag LOCUS_30200 22310 23410 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651665.1 protein_id gnl|my_center|LOCUS_30200 23827 25845 gene locus_tag LOCUS_30210 23827 25845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 26208 25873 gene locus_tag LOCUS_30220 26208 25873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 26475 29369 gene locus_tag LOCUS_30230 26475 29369 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286652.1 protein_id gnl|my_center|LOCUS_30230 29674 30609 gene locus_tag LOCUS_30240 29674 30609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 30521 31321 gene locus_tag LOCUS_30250 30521 31321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 31420 31590 gene locus_tag LOCUS_30260 31420 31590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 31665 31892 gene locus_tag LOCUS_30270 31665 31892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 31882 32199 gene locus_tag LOCUS_30280 31882 32199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 32512 32751 gene locus_tag LOCUS_30290 32512 32751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 32741 33160 gene locus_tag LOCUS_30300 32741 33160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 33423 33860 gene locus_tag LOCUS_30310 33423 33860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 34918 34130 gene locus_tag LOCUS_30320 34918 34130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 34799 35041 gene locus_tag LOCUS_30330 34799 35041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 35638 36531 gene locus_tag LOCUS_30340 35638 36531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 36528 37598 gene locus_tag LOCUS_30350 36528 37598 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_30350 37625 38125 gene locus_tag LOCUS_30360 37625 38125 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061729.1 protein_id gnl|my_center|LOCUS_30360 38122 39240 gene locus_tag LOCUS_30370 38122 39240 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061731.1 protein_id gnl|my_center|LOCUS_30370 39282 41549 gene locus_tag LOCUS_30380 39282 41549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 41594 42625 gene locus_tag LOCUS_30390 41594 42625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 42639 44048 gene locus_tag LOCUS_30400 42639 44048 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_30400 44066 44524 gene locus_tag LOCUS_30410 gene pssD 44066 44524 CDS product PssD/Cps14F family polysaccharide biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065325.1 protein_id gnl|my_center|LOCUS_30410 44521 45012 gene locus_tag LOCUS_30420 gene pssE 44521 45012 CDS product PssE/Cps14G family polysaccharide biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990828.1 protein_id gnl|my_center|LOCUS_30420 45026 46048 gene locus_tag LOCUS_30430 45026 46048 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_30430 46109 47323 gene locus_tag LOCUS_30440 46109 47323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 47546 49885 gene locus_tag LOCUS_30450 47546 49885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 49929 50645 gene locus_tag LOCUS_30460 49929 50645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 50703 52019 gene locus_tag LOCUS_30470 50703 52019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 52030 52632 gene locus_tag LOCUS_30480 52030 52632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 52648 53571 gene locus_tag LOCUS_30490 52648 53571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 53611 54426 gene locus_tag LOCUS_30500 53611 54426 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942150.1 protein_id gnl|my_center|LOCUS_30500 54484 55746 gene locus_tag LOCUS_30510 54484 55746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 55793 57025 gene locus_tag LOCUS_30520 55793 57025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 >Feature sequence34 1845 1576 gene locus_tag LOCUS_30530 1845 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 3100 2012 gene locus_tag LOCUS_30540 3100 2012 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873440.1 protein_id gnl|my_center|LOCUS_30540 4672 3614 gene locus_tag LOCUS_30550 4672 3614 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064463.1 protein_id gnl|my_center|LOCUS_30550 4842 5333 gene locus_tag LOCUS_30560 4842 5333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 5348 5530 gene locus_tag LOCUS_30570 gene rpmF 5348 5530 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888992.1 protein_id gnl|my_center|LOCUS_30570 5640 6668 gene locus_tag LOCUS_30580 gene plsX 5640 6668 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_30580 6736 7737 gene locus_tag LOCUS_30590 6736 7737 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_30590 8514 7759 gene locus_tag LOCUS_30600 8514 7759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 10550 8562 gene locus_tag LOCUS_30610 10550 8562 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787605.1 protein_id gnl|my_center|LOCUS_30610 11460 10603 gene locus_tag LOCUS_30620 11460 10603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 11519 13204 gene locus_tag LOCUS_30630 11519 13204 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121424.1 protein_id gnl|my_center|LOCUS_30630 13709 15037 gene locus_tag LOCUS_30640 gene dnaA 13709 15037 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815138.1 protein_id gnl|my_center|LOCUS_30640 15140 16237 gene locus_tag LOCUS_30650 gene dnaN 15140 16237 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725022.1 protein_id gnl|my_center|LOCUS_30650 17870 16329 gene locus_tag LOCUS_30660 gene rhaB 17870 16329 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108961.1 protein_id gnl|my_center|LOCUS_30660 17954 19231 gene locus_tag LOCUS_30670 17954 19231 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097691.1 protein_id gnl|my_center|LOCUS_30670 19228 21303 gene locus_tag LOCUS_30680 19228 21303 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640158.1 protein_id gnl|my_center|LOCUS_30680 23286 21835 gene locus_tag LOCUS_30690 gene gatB 23286 21835 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393504.1 protein_id gnl|my_center|LOCUS_30690 24232 23435 gene locus_tag LOCUS_30700 24232 23435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 25336 24248 gene locus_tag LOCUS_30710 gene aroC 25336 24248 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_30710 25428 26288 gene locus_tag LOCUS_30720 gene folP 25428 26288 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644433.1 protein_id gnl|my_center|LOCUS_30720 26578 26312 gene locus_tag LOCUS_30730 26578 26312 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918130.1 protein_id gnl|my_center|LOCUS_30730 26677 27309 gene locus_tag LOCUS_30740 gene ruvA 26677 27309 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086122.1 protein_id gnl|my_center|LOCUS_30740 27437 28915 gene locus_tag LOCUS_30750 27437 28915 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_30750 28935 30281 gene locus_tag LOCUS_30760 gene gltX 28935 30281 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082426.1 protein_id gnl|my_center|LOCUS_30760 30285 31187 gene locus_tag LOCUS_30770 30285 31187 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_30770 32311 31184 gene locus_tag LOCUS_30780 32311 31184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 33535 32324 gene locus_tag LOCUS_30790 33535 32324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 34765 33614 gene locus_tag LOCUS_30800 gene meaB 34765 33614 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258366.1 protein_id gnl|my_center|LOCUS_30800 34883 36046 gene locus_tag LOCUS_30810 34883 36046 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667343.1 protein_id gnl|my_center|LOCUS_30810 36043 36855 gene locus_tag LOCUS_30820 36043 36855 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930914.1 protein_id gnl|my_center|LOCUS_30820 37146 36859 gene locus_tag LOCUS_30830 37146 36859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 38001 37228 gene locus_tag LOCUS_30840 38001 37228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 39078 38146 gene locus_tag LOCUS_30850 39078 38146 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_30850 39221 41995 gene locus_tag LOCUS_30860 39221 41995 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943088.1 protein_id gnl|my_center|LOCUS_30860 42035 43483 gene locus_tag LOCUS_30870 42035 43483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 43599 44264 gene locus_tag LOCUS_30880 43599 44264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 45238 44321 gene locus_tag LOCUS_30890 45238 44321 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024341.1 protein_id gnl|my_center|LOCUS_30890 45673 45269 gene locus_tag LOCUS_30900 45673 45269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 46823 45708 gene locus_tag LOCUS_30910 46823 45708 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_30910 47753 46845 gene locus_tag LOCUS_30920 47753 46845 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_30920 49349 47889 gene locus_tag LOCUS_30930 49349 47889 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119131.1 protein_id gnl|my_center|LOCUS_30930 51630 49321 gene locus_tag LOCUS_30940 51630 49321 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119132.1 protein_id gnl|my_center|LOCUS_30940 52690 51716 gene locus_tag LOCUS_30950 52690 51716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 53983 52775 gene locus_tag LOCUS_30960 53983 52775 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069319778.1 protein_id gnl|my_center|LOCUS_30960 54701 54009 gene locus_tag LOCUS_30970 54701 54009 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140371.1 protein_id gnl|my_center|LOCUS_30970 56050 54698 gene locus_tag LOCUS_30980 56050 54698 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924854.1 protein_id gnl|my_center|LOCUS_30980 57481 56078 gene locus_tag LOCUS_30990 57481 56078 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530684.1 protein_id gnl|my_center|LOCUS_30990 59246 57945 gene locus_tag LOCUS_31000 59246 57945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 59866 61125 gene locus_tag LOCUS_31010 59866 61125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 61141 63141 gene locus_tag LOCUS_31020 61141 63141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 63672 63316 gene locus_tag LOCUS_31030 63672 63316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 >Feature sequence35 92 1135 gene locus_tag LOCUS_31040 92 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 1116 2159 gene locus_tag LOCUS_31050 1116 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393763.1 protein_id gnl|my_center|LOCUS_31050 2223 2417 gene locus_tag LOCUS_31060 2223 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 2552 3412 gene locus_tag LOCUS_31070 2552 3412 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974282.1 protein_id gnl|my_center|LOCUS_31070 3956 3450 gene locus_tag LOCUS_31080 3956 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 4608 3970 gene locus_tag LOCUS_31090 4608 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 4806 4648 gene locus_tag LOCUS_31100 4806 4648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 5311 4862 gene locus_tag LOCUS_31110 5311 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 6723 5422 gene locus_tag LOCUS_31120 6723 5422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 8410 7514 gene locus_tag LOCUS_31130 8410 7514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 8977 8477 gene locus_tag LOCUS_31140 8977 8477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 9478 9002 gene locus_tag LOCUS_31150 9478 9002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 10924 9644 gene locus_tag LOCUS_31160 10924 9644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 11634 11506 gene locus_tag LOCUS_31170 11634 11506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 12641 11814 gene locus_tag LOCUS_31180 12641 11814 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922282.1 protein_id gnl|my_center|LOCUS_31180 13896 12646 gene locus_tag LOCUS_31190 13896 12646 CDS product tagaturonate epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119734.1 protein_id gnl|my_center|LOCUS_31190 15181 13997 gene locus_tag LOCUS_31200 gene nspC 15181 13997 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943174.1 protein_id gnl|my_center|LOCUS_31200 16066 15185 gene locus_tag LOCUS_31210 16066 15185 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_31210 17141 16143 gene locus_tag LOCUS_31220 17141 16143 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460383.1 protein_id gnl|my_center|LOCUS_31220 17661 18329 gene locus_tag LOCUS_31230 17661 18329 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445444.1 protein_id gnl|my_center|LOCUS_31230 19023 18337 gene locus_tag LOCUS_31240 19023 18337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 19226 18987 gene locus_tag LOCUS_31250 19226 18987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 19348 21717 gene locus_tag LOCUS_31260 19348 21717 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090710.1 protein_id gnl|my_center|LOCUS_31260 21794 22504 gene locus_tag LOCUS_31270 21794 22504 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780603.1 protein_id gnl|my_center|LOCUS_31270 23493 22516 gene locus_tag LOCUS_31280 23493 22516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 25377 23623 gene locus_tag LOCUS_31290 25377 23623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 25669 25388 gene locus_tag LOCUS_31300 25669 25388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 26094 25723 gene locus_tag LOCUS_31310 26094 25723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331848.1 protein_id gnl|my_center|LOCUS_31310 26736 26104 gene locus_tag LOCUS_31320 26736 26104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 27092 26733 gene locus_tag LOCUS_31330 27092 26733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 30064 27905 gene locus_tag LOCUS_31340 gene pnp 30064 27905 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257913.1 protein_id gnl|my_center|LOCUS_31340 30525 30268 gene locus_tag LOCUS_31350 gene rpsO 30525 30268 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_31350 31390 30731 gene locus_tag LOCUS_31360 31390 30731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 31726 32046 gene locus_tag LOCUS_31370 31726 32046 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532548.1 protein_id gnl|my_center|LOCUS_31370 32081 33718 gene locus_tag LOCUS_31380 32081 33718 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390062.1 protein_id gnl|my_center|LOCUS_31380 34115 33855 gene locus_tag LOCUS_31390 34115 33855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 34177 34374 gene locus_tag LOCUS_31400 34177 34374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31400 34381 34851 gene locus_tag LOCUS_31410 34381 34851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 34936 35847 gene locus_tag LOCUS_31420 34936 35847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 39504 37126 gene locus_tag LOCUS_31430 gene pheT 39504 37126 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_31430 39952 39557 gene locus_tag LOCUS_31440 39952 39557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 41029 39995 gene locus_tag LOCUS_31450 gene pheS 41029 39995 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114409.1 protein_id gnl|my_center|LOCUS_31450 41711 41106 gene locus_tag LOCUS_31460 41711 41106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 41881 42570 gene locus_tag LOCUS_31470 gene rsmI 41881 42570 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815011.1 protein_id gnl|my_center|LOCUS_31470 42574 44226 gene locus_tag LOCUS_31480 42574 44226 CDS product glucan biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095915.1 protein_id gnl|my_center|LOCUS_31480 44292 48188 gene locus_tag LOCUS_31490 44292 48188 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203260.1 protein_id gnl|my_center|LOCUS_31490 48264 49142 gene locus_tag LOCUS_31500 48264 49142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 49277 49705 gene locus_tag LOCUS_31510 49277 49705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 49741 50493 gene locus_tag LOCUS_31520 gene sufC 49741 50493 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722442.1 protein_id gnl|my_center|LOCUS_31520 50547 51986 gene locus_tag LOCUS_31530 gene sufB 50547 51986 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259322.1 protein_id gnl|my_center|LOCUS_31530 52040 53305 gene locus_tag LOCUS_31540 gene sufD 52040 53305 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173864.1 protein_id gnl|my_center|LOCUS_31540 53470 55194 gene locus_tag LOCUS_31550 53470 55194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 55228 56004 gene locus_tag LOCUS_31560 55228 56004 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391312.1 protein_id gnl|my_center|LOCUS_31560 56016 57353 gene locus_tag LOCUS_31570 56016 57353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 57411 57836 gene locus_tag LOCUS_31580 gene ndk 57411 57836 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770040.1 protein_id gnl|my_center|LOCUS_31580 57876 58655 gene locus_tag LOCUS_31590 57876 58655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 58696 60138 gene locus_tag LOCUS_31600 gene cls 58696 60138 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144064.1 protein_id gnl|my_center|LOCUS_31600 60319 60804 gene locus_tag LOCUS_31610 60319 60804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 60804 61640 gene locus_tag LOCUS_31620 60804 61640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 >Feature sequence36 2799 109 gene locus_tag LOCUS_31630 gene hrpB 2799 109 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942482.1 protein_id gnl|my_center|LOCUS_31630 4087 2792 gene locus_tag LOCUS_31640 4087 2792 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_31640 4450 4109 gene locus_tag LOCUS_31650 4450 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 8387 4590 gene locus_tag LOCUS_31660 8387 4590 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_31660 11200 8468 gene locus_tag LOCUS_31670 11200 8468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 12514 11255 gene locus_tag LOCUS_31680 12514 11255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 14478 12601 gene locus_tag LOCUS_31690 14478 12601 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706813.1 protein_id gnl|my_center|LOCUS_31690 15507 14512 gene locus_tag LOCUS_31700 15507 14512 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121074.1 protein_id gnl|my_center|LOCUS_31700 17105 15570 gene locus_tag LOCUS_31710 17105 15570 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454162.1 protein_id gnl|my_center|LOCUS_31710 17869 17141 gene locus_tag LOCUS_31720 gene aqpZ 17869 17141 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140371.1 protein_id gnl|my_center|LOCUS_31720 18730 17951 gene locus_tag LOCUS_31730 gene kduD 18730 17951 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482916.1 protein_id gnl|my_center|LOCUS_31730 19590 18754 gene locus_tag LOCUS_31740 gene kduI 19590 18754 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061674.1 protein_id gnl|my_center|LOCUS_31740 19922 19731 gene locus_tag LOCUS_31750 19922 19731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 19822 20904 gene locus_tag LOCUS_31760 19822 20904 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 protein_id gnl|my_center|LOCUS_31760 20973 24413 gene locus_tag LOCUS_31770 20973 24413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 24818 24567 gene locus_tag LOCUS_31780 gene rpsP 24818 24567 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081979.1 protein_id gnl|my_center|LOCUS_31780 25069 25144 gene locus_tag LOCUS_t00360 25069 25144 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 25282 26109 gene locus_tag LOCUS_31790 25282 26109 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762343.1 protein_id gnl|my_center|LOCUS_31790 28595 26124 gene locus_tag LOCUS_31800 28595 26124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 29379 28639 gene locus_tag LOCUS_31810 gene radC 29379 28639 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816793.1 protein_id gnl|my_center|LOCUS_31810 29515 29862 gene locus_tag LOCUS_31820 29515 29862 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228839.1 protein_id gnl|my_center|LOCUS_31820 29917 31212 gene locus_tag LOCUS_31830 gene hisS 29917 31212 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431277.1 protein_id gnl|my_center|LOCUS_31830 31261 33060 gene locus_tag LOCUS_31840 gene aspS 31261 33060 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_31840 33409 34455 gene locus_tag LOCUS_31850 gene gap 33409 34455 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668968.1 protein_id gnl|my_center|LOCUS_31850 38151 35263 gene locus_tag LOCUS_31860 38151 35263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 38492 38574 gene locus_tag LOCUS_t00370 38492 38574 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 39640 38975 gene locus_tag LOCUS_31870 39640 38975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 39728 39976 gene locus_tag LOCUS_31880 39728 39976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 39989 40294 gene locus_tag LOCUS_31890 39989 40294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 40376 41581 gene locus_tag LOCUS_31900 40376 41581 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121299.1 protein_id gnl|my_center|LOCUS_31900 41669 43147 gene locus_tag LOCUS_31910 41669 43147 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401672.1 protein_id gnl|my_center|LOCUS_31910 43165 44109 gene locus_tag LOCUS_31920 43165 44109 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530262.1 protein_id gnl|my_center|LOCUS_31920 44106 45047 gene locus_tag LOCUS_31930 44106 45047 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969895.1 protein_id gnl|my_center|LOCUS_31930 45155 45424 gene locus_tag LOCUS_31940 45155 45424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 45746 45399 gene locus_tag LOCUS_31950 45746 45399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 47459 45771 gene locus_tag LOCUS_31960 47459 45771 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_31960 47604 48506 gene locus_tag LOCUS_31970 47604 48506 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404319.1 protein_id gnl|my_center|LOCUS_31970 49065 48706 gene locus_tag LOCUS_31980 49065 48706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 50166 49099 gene locus_tag LOCUS_31990 50166 49099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 50368 51057 gene locus_tag LOCUS_32000 gene lolD 50368 51057 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925702.1 protein_id gnl|my_center|LOCUS_32000 51104 51922 gene locus_tag LOCUS_32010 51104 51922 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222950.1 protein_id gnl|my_center|LOCUS_32010 52788 51940 gene locus_tag LOCUS_32020 52788 51940 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_32020 <53902 52842 gene locus_tag LOCUS_32030 <53902 52842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387744.1:transposase >Feature sequence37 2201 312 gene locus_tag LOCUS_32040 2201 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 2872 2315 gene locus_tag LOCUS_32050 2872 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 4576 2885 gene locus_tag LOCUS_32060 gene pqiB 4576 2885 CDS product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445550.1 protein_id gnl|my_center|LOCUS_32060 5170 4589 gene locus_tag LOCUS_32070 5170 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32070 5859 5227 gene locus_tag LOCUS_32080 5859 5227 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107436.1 protein_id gnl|my_center|LOCUS_32080 6749 5889 gene locus_tag LOCUS_32090 6749 5889 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061879.1 protein_id gnl|my_center|LOCUS_32090 7058 8812 gene locus_tag LOCUS_32100 gene urtB 7058 8812 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105141.1 protein_id gnl|my_center|LOCUS_32100 8816 9949 gene locus_tag LOCUS_32110 gene urtC 8816 9949 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969813.1 protein_id gnl|my_center|LOCUS_32110 9946 10716 gene locus_tag LOCUS_32120 gene urtD 9946 10716 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056965.1 protein_id gnl|my_center|LOCUS_32120 10754 11479 gene locus_tag LOCUS_32130 gene urtE 10754 11479 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149319367.1 protein_id gnl|my_center|LOCUS_32130 11643 12737 gene locus_tag LOCUS_32140 11643 12737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 12842 14089 gene locus_tag LOCUS_32150 gene urtA 12842 14089 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096636.1 protein_id gnl|my_center|LOCUS_32150 14170 14511 gene locus_tag LOCUS_32160 14170 14511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 14522 14824 gene locus_tag LOCUS_32170 14522 14824 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857708.1 protein_id gnl|my_center|LOCUS_32170 14821 15138 gene locus_tag LOCUS_32180 14821 15138 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066609.1 protein_id gnl|my_center|LOCUS_32180 15135 16856 gene locus_tag LOCUS_32190 gene ureC 15135 16856 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205201.1 protein_id gnl|my_center|LOCUS_32190 17412 16780 gene locus_tag LOCUS_32200 gene pcp 17412 16780 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250786.1 protein_id gnl|my_center|LOCUS_32200 17527 17955 gene locus_tag LOCUS_32210 17527 17955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 17983 18648 gene locus_tag LOCUS_32220 17983 18648 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565254.1 protein_id gnl|my_center|LOCUS_32220 18626 19255 gene locus_tag LOCUS_32230 gene ureG 18626 19255 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537530.1 protein_id gnl|my_center|LOCUS_32230 19271 20113 gene locus_tag LOCUS_32240 19271 20113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 20377 20652 gene locus_tag LOCUS_32250 20377 20652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 20769 22829 gene locus_tag LOCUS_32260 20769 22829 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839960.1 protein_id gnl|my_center|LOCUS_32260 24164 22824 gene locus_tag LOCUS_32270 24164 22824 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541328.1 protein_id gnl|my_center|LOCUS_32270 25117 24161 gene locus_tag LOCUS_32280 25117 24161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 27938 25176 gene locus_tag LOCUS_32290 27938 25176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 28387 27989 gene locus_tag LOCUS_32300 28387 27989 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_32300 29536 28442 gene locus_tag LOCUS_32310 29536 28442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 29766 31679 gene locus_tag LOCUS_32320 29766 31679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 31726 35709 gene locus_tag LOCUS_32330 31726 35709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 35706 36419 gene locus_tag LOCUS_32340 35706 36419 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805196.1 protein_id gnl|my_center|LOCUS_32340 37421 36441 gene locus_tag LOCUS_32350 37421 36441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 40588 37433 gene locus_tag LOCUS_32360 40588 37433 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706758.1 protein_id gnl|my_center|LOCUS_32360 41644 40595 gene locus_tag LOCUS_32370 41644 40595 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 protein_id gnl|my_center|LOCUS_32370 42091 42999 gene locus_tag LOCUS_32380 42091 42999 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928954.1 protein_id gnl|my_center|LOCUS_32380 43095 44510 gene locus_tag LOCUS_32390 43095 44510 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_32390 44952 44572 gene locus_tag LOCUS_32400 44952 44572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 48046 44996 gene locus_tag LOCUS_32410 48046 44996 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275353.1 protein_id gnl|my_center|LOCUS_32410 48384 48533 gene locus_tag LOCUS_32420 48384 48533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 48863 50008 gene locus_tag LOCUS_32430 48863 50008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 50005 50682 gene locus_tag LOCUS_32440 50005 50682 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461976.1 protein_id gnl|my_center|LOCUS_32440 50762 51766 gene locus_tag LOCUS_32450 50762 51766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 51827 52072 gene locus_tag LOCUS_32460 51827 52072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 >Feature sequence38 356 952 gene locus_tag LOCUS_32470 356 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 1417 1091 gene locus_tag LOCUS_32480 1417 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 2236 2012 gene locus_tag LOCUS_32490 2236 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 2460 2233 gene locus_tag LOCUS_32500 2460 2233 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_32500 3316 4125 gene locus_tag LOCUS_32510 3316 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 4888 4391 gene locus_tag LOCUS_32520 4888 4391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 7165 5123 gene locus_tag LOCUS_32530 7165 5123 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080037.1 protein_id gnl|my_center|LOCUS_32530 7562 8626 gene locus_tag LOCUS_32540 7562 8626 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929529.1 protein_id gnl|my_center|LOCUS_32540 9259 8645 gene locus_tag LOCUS_32550 9259 8645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 9405 10871 gene locus_tag LOCUS_32560 9405 10871 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107897.1 protein_id gnl|my_center|LOCUS_32560 11332 10880 gene locus_tag LOCUS_32570 11332 10880 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037987.1 protein_id gnl|my_center|LOCUS_32570 11461 12273 gene locus_tag LOCUS_32580 11461 12273 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691712.1 protein_id gnl|my_center|LOCUS_32580 12308 12754 gene locus_tag LOCUS_32590 12308 12754 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328798.1 protein_id gnl|my_center|LOCUS_32590 14006 12732 gene locus_tag LOCUS_32600 14006 12732 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_32600 14074 14913 gene locus_tag LOCUS_32610 14074 14913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 14987 15391 gene locus_tag LOCUS_32620 14987 15391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 15462 16382 gene locus_tag LOCUS_32630 15462 16382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 16385 17512 gene locus_tag LOCUS_32640 gene bioF 16385 17512 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_32640 18344 17499 gene locus_tag LOCUS_32650 18344 17499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 18481 18843 gene locus_tag LOCUS_32660 18481 18843 CDS product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816150.1 protein_id gnl|my_center|LOCUS_32660 18871 19527 gene locus_tag LOCUS_32670 18871 19527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303162.1 protein_id gnl|my_center|LOCUS_32670 19524 19823 gene locus_tag LOCUS_32680 19524 19823 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639882.1 protein_id gnl|my_center|LOCUS_32680 19877 20809 gene locus_tag LOCUS_32690 19877 20809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 21003 21491 gene locus_tag LOCUS_32700 21003 21491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 21554 22135 gene locus_tag LOCUS_32710 21554 22135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 22538 22164 gene locus_tag LOCUS_32720 gene gloA 22538 22164 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017084654.1 protein_id gnl|my_center|LOCUS_32720 23648 22584 gene locus_tag LOCUS_32730 23648 22584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 23530 24900 gene locus_tag LOCUS_32740 23530 24900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 24897 27755 gene locus_tag LOCUS_32750 gene polA 24897 27755 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796991.1 protein_id gnl|my_center|LOCUS_32750 29238 27799 gene locus_tag LOCUS_32760 29238 27799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 29828 29523 gene locus_tag LOCUS_32770 29828 29523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 30015 30575 gene locus_tag LOCUS_32780 30015 30575 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061383.1 protein_id gnl|my_center|LOCUS_32780 30839 31750 gene locus_tag LOCUS_32790 30839 31750 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_32790 31886 33448 gene locus_tag LOCUS_32800 31886 33448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 33452 34321 gene locus_tag LOCUS_32810 33452 34321 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918386.1 protein_id gnl|my_center|LOCUS_32810 34810 34340 gene locus_tag LOCUS_32820 gene dfrA 34810 34340 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637205.1 protein_id gnl|my_center|LOCUS_32820 35204 34860 gene locus_tag LOCUS_32830 35204 34860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064249.1 protein_id gnl|my_center|LOCUS_32830 36474 35197 gene locus_tag LOCUS_32840 36474 35197 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038851.1 protein_id gnl|my_center|LOCUS_32840 37502 36498 gene locus_tag LOCUS_32850 37502 36498 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037866.1 protein_id gnl|my_center|LOCUS_32850 37616 38377 gene locus_tag LOCUS_32860 37616 38377 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384321.1 protein_id gnl|my_center|LOCUS_32860 38374 40956 gene locus_tag LOCUS_32870 38374 40956 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122437.1 protein_id gnl|my_center|LOCUS_32870 41069 43351 gene locus_tag LOCUS_32880 41069 43351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 43437 44138 gene locus_tag LOCUS_32890 gene tsaA 43437 44138 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706829.1 protein_id gnl|my_center|LOCUS_32890 44388 44771 gene locus_tag LOCUS_32900 44388 44771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 45295 44897 gene locus_tag LOCUS_32910 45295 44897 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219167.1 protein_id gnl|my_center|LOCUS_32910 46350 45298 gene locus_tag LOCUS_32920 gene obgE 46350 45298 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 protein_id gnl|my_center|LOCUS_32920 46336 46965 gene locus_tag LOCUS_32930 46336 46965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 46972 48021 gene locus_tag LOCUS_32940 46972 48021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 48053 48520 gene locus_tag LOCUS_32950 48053 48520 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008130072.1 protein_id gnl|my_center|LOCUS_32950 49382 50299 gene locus_tag LOCUS_32960 49382 50299 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 protein_id gnl|my_center|LOCUS_32960 >Feature sequence39 223 435 gene locus_tag LOCUS_32970 223 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 491 1441 gene locus_tag LOCUS_32980 491 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 1481 3112 gene locus_tag LOCUS_32990 1481 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 5103 3166 gene locus_tag LOCUS_33000 5103 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 5296 6207 gene locus_tag LOCUS_33010 5296 6207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 7509 6220 gene locus_tag LOCUS_33020 gene hemL 7509 6220 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045309.1 protein_id gnl|my_center|LOCUS_33020 7618 8367 gene locus_tag LOCUS_33030 7618 8367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 8421 8864 gene locus_tag LOCUS_33040 8421 8864 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736559.1 protein_id gnl|my_center|LOCUS_33040 8969 9913 gene locus_tag LOCUS_33050 8969 9913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 9932 12052 gene locus_tag LOCUS_33060 9932 12052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 13489 12170 gene locus_tag LOCUS_33070 gene serS 13489 12170 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880145.1 protein_id gnl|my_center|LOCUS_33070 14184 13546 gene locus_tag LOCUS_33080 14184 13546 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918966.1 protein_id gnl|my_center|LOCUS_33080 14355 16571 gene locus_tag LOCUS_33090 14355 16571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 17603 16590 gene locus_tag LOCUS_33100 17603 16590 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776833.1 protein_id gnl|my_center|LOCUS_33100 17695 19617 gene locus_tag LOCUS_33110 17695 19617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 19634 20035 gene locus_tag LOCUS_33120 19634 20035 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225806.1 protein_id gnl|my_center|LOCUS_33120 20032 21054 gene locus_tag LOCUS_33130 gene lgoD 20032 21054 CDS product L-galactonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106033.1 protein_id gnl|my_center|LOCUS_33130 21051 22163 gene locus_tag LOCUS_33140 21051 22163 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973578.1 protein_id gnl|my_center|LOCUS_33140 22168 22926 gene locus_tag LOCUS_33150 22168 22926 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991075.1 protein_id gnl|my_center|LOCUS_33150 22943 23710 gene locus_tag LOCUS_33160 22943 23710 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967027.1 protein_id gnl|my_center|LOCUS_33160 23704 25383 gene locus_tag LOCUS_33170 23704 25383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 25380 26600 gene locus_tag LOCUS_33180 25380 26600 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876247.1 protein_id gnl|my_center|LOCUS_33180 26650 28335 gene locus_tag LOCUS_33190 26650 28335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107132.1 protein_id gnl|my_center|LOCUS_33190 36669 28393 gene locus_tag LOCUS_33200 36669 28393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 38517 36835 gene locus_tag LOCUS_33210 38517 36835 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326733.1 protein_id gnl|my_center|LOCUS_33210 40473 38728 gene locus_tag LOCUS_33220 gene argS 40473 38728 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225071.1 protein_id gnl|my_center|LOCUS_33220 40983 40501 gene locus_tag LOCUS_33230 40983 40501 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963556.1 protein_id gnl|my_center|LOCUS_33230 40986 41198 gene locus_tag LOCUS_33240 40986 41198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 42213 41284 gene locus_tag LOCUS_33250 42213 41284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 43278 42973 gene locus_tag LOCUS_33260 43278 42973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 44244 43783 gene locus_tag LOCUS_33270 44244 43783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 45032 44379 gene locus_tag LOCUS_33280 45032 44379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 45455 45048 gene locus_tag LOCUS_33290 45455 45048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 46134 45559 gene locus_tag LOCUS_33300 46134 45559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 46654 46163 gene locus_tag LOCUS_33310 46654 46163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 46816 47253 gene locus_tag LOCUS_33320 46816 47253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 47571 47164 gene locus_tag LOCUS_33330 47571 47164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 48265 47642 gene locus_tag LOCUS_33340 48265 47642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 48766 48359 gene locus_tag LOCUS_33350 48766 48359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 49125 48895 gene locus_tag LOCUS_33360 49125 48895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 >Feature sequence40 469 287 gene locus_tag LOCUS_33370 469 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 483 2585 gene locus_tag LOCUS_33380 483 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 2689 3003 gene locus_tag LOCUS_33390 2689 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 3195 3797 gene locus_tag LOCUS_33400 3195 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 3849 4454 gene locus_tag LOCUS_33410 3849 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 4600 5214 gene locus_tag LOCUS_33420 4600 5214 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_33420 5211 6014 gene locus_tag LOCUS_33430 5211 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 6026 6457 gene locus_tag LOCUS_33440 6026 6457 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_33440 6500 7579 gene locus_tag LOCUS_33450 6500 7579 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009058447.1 protein_id gnl|my_center|LOCUS_33450 7572 9698 gene locus_tag LOCUS_33460 7572 9698 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888294.1 protein_id gnl|my_center|LOCUS_33460 9744 11225 gene locus_tag LOCUS_33470 9744 11225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 11281 11655 gene locus_tag LOCUS_33480 11281 11655 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329772.1 protein_id gnl|my_center|LOCUS_33480 12732 11659 gene locus_tag LOCUS_33490 12732 11659 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921527.1 protein_id gnl|my_center|LOCUS_33490 13308 13865 gene locus_tag LOCUS_33500 13308 13865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 13925 18784 gene locus_tag LOCUS_33510 13925 18784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 18781 20280 gene locus_tag LOCUS_33520 18781 20280 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037254759.1 protein_id gnl|my_center|LOCUS_33520 20488 22332 gene locus_tag LOCUS_33530 gene typA 20488 22332 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183842.1 protein_id gnl|my_center|LOCUS_33530 23631 22465 gene locus_tag LOCUS_33540 23631 22465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 24053 24466 gene locus_tag LOCUS_33550 24053 24466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 25733 24552 gene locus_tag LOCUS_33560 gene hemW 25733 24552 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 protein_id gnl|my_center|LOCUS_33560 25888 26565 gene locus_tag LOCUS_33570 25888 26565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 27352 26582 gene locus_tag LOCUS_33580 gene panB 27352 26582 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763099.1 protein_id gnl|my_center|LOCUS_33580 27490 27416 gene locus_tag LOCUS_t00380 27490 27416 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 27665 27820 gene locus_tag LOCUS_33590 27665 27820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 27901 28647 gene locus_tag LOCUS_33600 27901 28647 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869526.1 protein_id gnl|my_center|LOCUS_33600 28817 30775 gene locus_tag LOCUS_33610 gene acs 28817 30775 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140163.1 protein_id gnl|my_center|LOCUS_33610 30790 31668 gene locus_tag LOCUS_33620 30790 31668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 32480 31812 gene locus_tag LOCUS_33630 32480 31812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 33168 32509 gene locus_tag LOCUS_33640 33168 32509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 36300 33253 gene locus_tag LOCUS_33650 36300 33253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 37107 36343 gene locus_tag LOCUS_33660 37107 36343 CDS product sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121635.1 protein_id gnl|my_center|LOCUS_33660 37352 37164 gene locus_tag LOCUS_33670 37352 37164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 40249 37430 gene locus_tag LOCUS_33680 gene alaS 40249 37430 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931860.1 protein_id gnl|my_center|LOCUS_33680 41300 40368 gene locus_tag LOCUS_33690 41300 40368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 41452 42966 gene locus_tag LOCUS_33700 41452 42966 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545685.1 protein_id gnl|my_center|LOCUS_33700 43021 44346 gene locus_tag LOCUS_33710 43021 44346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 44781 44356 gene locus_tag LOCUS_33720 44781 44356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 45365 46567 gene locus_tag LOCUS_33730 45365 46567 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964004.1 protein_id gnl|my_center|LOCUS_33730 46842 47054 gene locus_tag LOCUS_33740 46842 47054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 >Feature sequence41 <1 1551 gene locus_tag LOCUS_33750 <1 1551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005477759.1:tandem-95 repeat protein 1573 2307 gene locus_tag LOCUS_33760 1573 2307 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257981.1 protein_id gnl|my_center|LOCUS_33760 2304 3086 gene locus_tag LOCUS_33770 gene rfbF 2304 3086 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257101.1 protein_id gnl|my_center|LOCUS_33770 3104 4198 gene locus_tag LOCUS_33780 gene rfbG 3104 4198 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261039.1 protein_id gnl|my_center|LOCUS_33780 4231 5475 gene locus_tag LOCUS_33790 4231 5475 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974172.1 protein_id gnl|my_center|LOCUS_33790 5483 6781 gene locus_tag LOCUS_33800 5483 6781 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187744700.1 protein_id gnl|my_center|LOCUS_33800 7884 6787 gene locus_tag LOCUS_33810 7884 6787 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046800989.1 protein_id gnl|my_center|LOCUS_33810 7935 8468 gene locus_tag LOCUS_33820 gene rfbC 7935 8468 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142202.1 protein_id gnl|my_center|LOCUS_33820 8444 9412 gene locus_tag LOCUS_33830 8444 9412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 9431 10423 gene locus_tag LOCUS_33840 9431 10423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 10417 11619 gene locus_tag LOCUS_33850 10417 11619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 11616 12548 gene locus_tag LOCUS_33860 11616 12548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 12553 13503 gene locus_tag LOCUS_33870 12553 13503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 13531 14433 gene locus_tag LOCUS_33880 gene rfbD 13531 14433 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242585.1 protein_id gnl|my_center|LOCUS_33880 14500 15576 gene locus_tag LOCUS_33890 gene rfbB 14500 15576 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096179.1 protein_id gnl|my_center|LOCUS_33890 15589 16500 gene locus_tag LOCUS_33900 gene rfbA 15589 16500 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105518.1 protein_id gnl|my_center|LOCUS_33900 16510 17256 gene locus_tag LOCUS_33910 16510 17256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 17291 17941 gene locus_tag LOCUS_33920 17291 17941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 18480 18022 gene locus_tag LOCUS_33930 18480 18022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 20887 18809 gene locus_tag LOCUS_33940 20887 18809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33940 20886 21146 gene locus_tag LOCUS_33950 20886 21146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 21788 21153 gene locus_tag LOCUS_33960 21788 21153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 21982 24144 gene locus_tag LOCUS_33970 21982 24144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 24424 24921 gene locus_tag LOCUS_33980 24424 24921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 26290 25064 gene locus_tag LOCUS_33990 26290 25064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 27169 26315 gene locus_tag LOCUS_34000 27169 26315 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929260.1 protein_id gnl|my_center|LOCUS_34000 27924 27154 gene locus_tag LOCUS_34010 27924 27154 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678718.1 protein_id gnl|my_center|LOCUS_34010 28382 27933 gene locus_tag LOCUS_34020 28382 27933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 29278 28379 gene locus_tag LOCUS_34030 29278 28379 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228054.1 protein_id gnl|my_center|LOCUS_34030 29380 30153 gene locus_tag LOCUS_34040 gene lpxA 29380 30153 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565963.1 protein_id gnl|my_center|LOCUS_34040 30925 30230 gene locus_tag LOCUS_34050 30925 30230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 31531 33873 gene locus_tag LOCUS_34060 31531 33873 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118806.1 protein_id gnl|my_center|LOCUS_34060 33885 34712 gene locus_tag LOCUS_34070 33885 34712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022305.1 protein_id gnl|my_center|LOCUS_34070 34725 36149 gene locus_tag LOCUS_34080 34725 36149 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061798.1 protein_id gnl|my_center|LOCUS_34080 36171 36683 gene locus_tag LOCUS_34090 36171 36683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 36840 37904 gene locus_tag LOCUS_34100 36840 37904 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896850.1 protein_id gnl|my_center|LOCUS_34100 37926 38993 gene locus_tag LOCUS_34110 37926 38993 CDS product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928508.1 protein_id gnl|my_center|LOCUS_34110 39105 40022 gene locus_tag LOCUS_34120 39105 40022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 40036 40815 gene locus_tag LOCUS_34130 40036 40815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969426.1 protein_id gnl|my_center|LOCUS_34130 40861 41370 gene locus_tag LOCUS_34140 40861 41370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 41367 41720 gene locus_tag LOCUS_34150 41367 41720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 41818 42204 gene locus_tag LOCUS_34160 41818 42204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 42197 42985 gene locus_tag LOCUS_34170 42197 42985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 42996 44567 gene locus_tag LOCUS_34180 42996 44567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 44564 45592 gene locus_tag LOCUS_34190 44564 45592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 45607 46191 gene locus_tag LOCUS_34200 45607 46191 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926361.1 protein_id gnl|my_center|LOCUS_34200 >Feature sequence42 1337 162 gene locus_tag LOCUS_34210 1337 162 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402650.1 protein_id gnl|my_center|LOCUS_34210 2327 1440 gene locus_tag LOCUS_34220 2327 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 2504 3343 gene locus_tag LOCUS_34230 2504 3343 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334178.1 protein_id gnl|my_center|LOCUS_34230 3473 6010 gene locus_tag LOCUS_34240 gene leuS 3473 6010 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009461.1 protein_id gnl|my_center|LOCUS_34240 6100 9489 gene locus_tag LOCUS_34250 6100 9489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 10361 9570 gene locus_tag LOCUS_34260 10361 9570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 11925 10459 gene locus_tag LOCUS_34270 11925 10459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 13582 12248 gene locus_tag LOCUS_34280 13582 12248 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144234.1 protein_id gnl|my_center|LOCUS_34280 13954 16317 gene locus_tag LOCUS_34290 13954 16317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 19540 16364 gene locus_tag LOCUS_34300 19540 16364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 21422 19554 gene locus_tag LOCUS_34310 21422 19554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 22617 21439 gene locus_tag LOCUS_34320 22617 21439 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767192.1 protein_id gnl|my_center|LOCUS_34320 23526 22687 gene locus_tag LOCUS_34330 23526 22687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 24565 23564 gene locus_tag LOCUS_34340 24565 23564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 25638 24715 gene locus_tag LOCUS_34350 25638 24715 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099264237.1 protein_id gnl|my_center|LOCUS_34350 27812 26187 gene locus_tag LOCUS_34360 27812 26187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 29187 27895 gene locus_tag LOCUS_34370 29187 27895 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103349.1 protein_id gnl|my_center|LOCUS_34370 30986 29271 gene locus_tag LOCUS_34380 30986 29271 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615922.1 protein_id gnl|my_center|LOCUS_34380 32913 31057 gene locus_tag LOCUS_34390 gene asnB 32913 31057 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089038.1 protein_id gnl|my_center|LOCUS_34390 34109 32898 gene locus_tag LOCUS_34400 34109 32898 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787334.1 protein_id gnl|my_center|LOCUS_34400 35274 34252 gene locus_tag LOCUS_34410 35274 34252 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327684.1 protein_id gnl|my_center|LOCUS_34410 36769 35333 gene locus_tag LOCUS_34420 36769 35333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 36675 36992 gene locus_tag LOCUS_34430 36675 36992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 36992 38260 gene locus_tag LOCUS_34440 36992 38260 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039084.1 protein_id gnl|my_center|LOCUS_34440 38515 38273 gene locus_tag LOCUS_34450 38515 38273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 38885 41119 gene locus_tag LOCUS_34460 38885 41119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 41864 41454 gene locus_tag LOCUS_34470 41864 41454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 42944 43201 gene locus_tag LOCUS_34480 42944 43201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 >Feature sequence43 3311 159 gene locus_tag LOCUS_34490 3311 159 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943334.1 protein_id gnl|my_center|LOCUS_34490 2669 2760 gene locus_tag LOCUS_t00390 2669 2760 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4546 3386 gene locus_tag LOCUS_34500 4546 3386 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 protein_id gnl|my_center|LOCUS_34500 5977 4571 gene locus_tag LOCUS_34510 5977 4571 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927472.1 protein_id gnl|my_center|LOCUS_34510 6076 6654 gene locus_tag LOCUS_34520 6076 6654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 6862 7992 gene locus_tag LOCUS_34530 6862 7992 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967587.1 protein_id gnl|my_center|LOCUS_34530 8224 9222 gene locus_tag LOCUS_34540 gene queA 8224 9222 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460358.1 protein_id gnl|my_center|LOCUS_34540 9289 11376 gene locus_tag LOCUS_34550 9289 11376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 11373 12275 gene locus_tag LOCUS_34560 11373 12275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 12953 12279 gene locus_tag LOCUS_34570 12953 12279 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338989.1 protein_id gnl|my_center|LOCUS_34570 13642 12974 gene locus_tag LOCUS_34580 13642 12974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 13746 14504 gene locus_tag LOCUS_34590 13746 14504 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615807.1 protein_id gnl|my_center|LOCUS_34590 17046 14509 gene locus_tag LOCUS_34600 17046 14509 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075123474.1 protein_id gnl|my_center|LOCUS_34600 17716 17054 gene locus_tag LOCUS_34610 17716 17054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 18415 17747 gene locus_tag LOCUS_34620 18415 17747 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085667.1 protein_id gnl|my_center|LOCUS_34620 19074 18490 gene locus_tag LOCUS_34630 19074 18490 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328559.1 protein_id gnl|my_center|LOCUS_34630 20590 19124 gene locus_tag LOCUS_34640 20590 19124 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887075.1 protein_id gnl|my_center|LOCUS_34640 20827 20754 gene locus_tag LOCUS_t00400 20827 20754 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 21023 20950 gene locus_tag LOCUS_t00410 21023 20950 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 23125 21965 gene locus_tag LOCUS_34650 23125 21965 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223214.1 protein_id gnl|my_center|LOCUS_34650 23169 25901 gene locus_tag LOCUS_34660 gene ileS 23169 25901 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081557.1 protein_id gnl|my_center|LOCUS_34660 25987 26562 gene locus_tag LOCUS_34670 gene lspA 25987 26562 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943757.1 protein_id gnl|my_center|LOCUS_34670 27734 26568 gene locus_tag LOCUS_34680 gene purK 27734 26568 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196812.1 protein_id gnl|my_center|LOCUS_34680 28245 27739 gene locus_tag LOCUS_34690 gene purE 28245 27739 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688684.1 protein_id gnl|my_center|LOCUS_34690 29224 28301 gene locus_tag LOCUS_34700 29224 28301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 29345 30778 gene locus_tag LOCUS_34710 29345 30778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 32063 30792 gene locus_tag LOCUS_34720 gene murA 32063 30792 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393852.1 protein_id gnl|my_center|LOCUS_34720 33039 32125 gene locus_tag LOCUS_34730 gene prmC 33039 32125 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886891.1 protein_id gnl|my_center|LOCUS_34730 33132 34307 gene locus_tag LOCUS_34740 33132 34307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 34304 35053 gene locus_tag LOCUS_34750 34304 35053 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399111.1 protein_id gnl|my_center|LOCUS_34750 35099 35791 gene locus_tag LOCUS_34760 35099 35791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 35905 36567 gene locus_tag LOCUS_34770 35905 36567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 36584 37636 gene locus_tag LOCUS_34780 gene lpxD 36584 37636 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882950.1 protein_id gnl|my_center|LOCUS_34780 38708 38995 gene locus_tag LOCUS_34790 38708 38995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 38992 41367 gene locus_tag LOCUS_34800 38992 41367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 42230 42421 gene locus_tag LOCUS_34810 42230 42421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 >Feature sequence44 2138 771 gene locus_tag LOCUS_34820 2138 771 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838596.1 protein_id gnl|my_center|LOCUS_34820 2255 4258 gene locus_tag LOCUS_34830 2255 4258 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_34830 4962 4255 gene locus_tag LOCUS_34840 4962 4255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 5108 5734 gene locus_tag LOCUS_34850 5108 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 5799 7667 gene locus_tag LOCUS_34860 5799 7667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 7697 8662 gene locus_tag LOCUS_34870 7697 8662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 8685 9737 gene locus_tag LOCUS_34880 8685 9737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 9797 12433 gene locus_tag LOCUS_34890 9797 12433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 12753 16628 gene locus_tag LOCUS_34900 12753 16628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 16784 23368 gene locus_tag LOCUS_34910 16784 23368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 23480 24187 gene locus_tag LOCUS_34920 23480 24187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 24244 26166 gene locus_tag LOCUS_34930 24244 26166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 26310 29165 gene locus_tag LOCUS_34940 gene ppdK 26310 29165 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933346.1 protein_id gnl|my_center|LOCUS_34940 30158 29283 gene locus_tag LOCUS_34950 30158 29283 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_34950 30244 32706 gene locus_tag LOCUS_34960 30244 32706 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140940.1 protein_id gnl|my_center|LOCUS_34960 32764 33672 gene locus_tag LOCUS_34970 32764 33672 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119041.1 protein_id gnl|my_center|LOCUS_34970 34441 33680 gene locus_tag LOCUS_34980 34441 33680 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122515.1 protein_id gnl|my_center|LOCUS_34980 34555 38091 gene locus_tag LOCUS_34990 34555 38091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 40693 38084 gene locus_tag LOCUS_35000 40693 38084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 40769 42121 gene locus_tag LOCUS_35010 40769 42121 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921626.1 protein_id gnl|my_center|LOCUS_35010 >Feature sequence45 <1 493 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccgcgcccctcgtgtgaggggcgac 1008 718 gene locus_tag LOCUS_35020 gene cas2 1008 718 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932801.1 protein_id gnl|my_center|LOCUS_35020 2079 1039 gene locus_tag LOCUS_35030 gene cas1c 2079 1039 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932802.1 protein_id gnl|my_center|LOCUS_35030 2656 2117 gene locus_tag LOCUS_35040 2656 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 3288 2653 gene locus_tag LOCUS_35050 gene cas4 3288 2653 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932803.1 protein_id gnl|my_center|LOCUS_35050 3925 3281 gene locus_tag LOCUS_35060 3925 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 4816 3959 gene locus_tag LOCUS_35070 gene cas7c 4816 3959 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_35070 6631 4856 gene locus_tag LOCUS_35080 gene cas8c 6631 4856 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176708.1 protein_id gnl|my_center|LOCUS_35080 7353 6628 gene locus_tag LOCUS_35090 gene cas5c 7353 6628 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176707.1 protein_id gnl|my_center|LOCUS_35090 9574 7373 gene locus_tag LOCUS_35100 9574 7373 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787402.1 protein_id gnl|my_center|LOCUS_35100 11481 10192 gene locus_tag LOCUS_35110 11481 10192 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038748.1 protein_id gnl|my_center|LOCUS_35110 12956 11481 gene locus_tag LOCUS_35120 12956 11481 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485823.1 protein_id gnl|my_center|LOCUS_35120 13471 12962 gene locus_tag LOCUS_35130 13471 12962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 13385 13654 gene locus_tag LOCUS_35140 13385 13654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 13751 19927 gene locus_tag LOCUS_35150 13751 19927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 19987 21342 gene locus_tag LOCUS_35160 19987 21342 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_35160 22530 21352 gene locus_tag LOCUS_35170 22530 21352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 22411 22812 gene locus_tag LOCUS_35180 22411 22812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 22905 24173 gene locus_tag LOCUS_35190 22905 24173 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_35190 24636 24403 gene locus_tag LOCUS_35200 24636 24403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 24571 25659 gene locus_tag LOCUS_35210 24571 25659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 25781 26878 gene locus_tag LOCUS_35220 25781 26878 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_35220 26985 27497 gene locus_tag LOCUS_35230 26985 27497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 27898 27446 gene locus_tag LOCUS_35240 27898 27446 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933387.1 protein_id gnl|my_center|LOCUS_35240 28993 27935 gene locus_tag LOCUS_35250 gene arsB 28993 27935 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943585.1 protein_id gnl|my_center|LOCUS_35250 29491 29012 gene locus_tag LOCUS_35260 29491 29012 CDS product DUF6428 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 protein_id gnl|my_center|LOCUS_35260 29877 29488 gene locus_tag LOCUS_35270 29877 29488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 30024 31274 gene locus_tag LOCUS_35280 30024 31274 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_35280 31288 32184 gene locus_tag LOCUS_35290 gene argF 31288 32184 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940828.1 protein_id gnl|my_center|LOCUS_35290 32316 32699 gene locus_tag LOCUS_35300 32316 32699 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932479.1 protein_id gnl|my_center|LOCUS_35300 33668 32715 gene locus_tag LOCUS_35310 33668 32715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 35616 33763 gene locus_tag LOCUS_35320 gene rhgW 35616 33763 CDS product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886436.1 protein_id gnl|my_center|LOCUS_35320 36236 37042 gene locus_tag LOCUS_35330 36236 37042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 37080 39311 gene locus_tag LOCUS_35340 37080 39311 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031005.1 protein_id gnl|my_center|LOCUS_35340 40290 39349 gene locus_tag LOCUS_35350 40290 39349 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921630.1 protein_id gnl|my_center|LOCUS_35350 >Feature sequence46 7383 1639 gene locus_tag LOCUS_35360 7383 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 9936 7513 gene locus_tag LOCUS_35370 9936 7513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 12186 10144 gene locus_tag LOCUS_35380 12186 10144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 16230 12439 gene locus_tag LOCUS_35390 16230 12439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 18913 16505 gene locus_tag LOCUS_35400 18913 16505 CDS product DUF5703 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765773.1 protein_id gnl|my_center|LOCUS_35400 17666 17758 gene locus_tag LOCUS_t00420 17666 17758 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 30360 18928 gene locus_tag LOCUS_35410 30360 18928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 31095 30397 gene locus_tag LOCUS_35420 31095 30397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 34633 31109 gene locus_tag LOCUS_35430 34633 31109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 <37483 34965 gene locus_tag LOCUS_35440 <37483 34965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104543246.1:autotransporter-associated beta strand repeat-containing protein >Feature sequence47 <1 756 gene locus_tag LOCUS_35450 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114586.1:transposase 2227 791 gene locus_tag LOCUS_35460 2227 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 2876 2295 gene locus_tag LOCUS_35470 2876 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 4340 2922 gene locus_tag LOCUS_35480 4340 2922 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098999755.1 protein_id gnl|my_center|LOCUS_35480 5240 4656 gene locus_tag LOCUS_35490 5240 4656 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528311.1 protein_id gnl|my_center|LOCUS_35490 5989 5267 gene locus_tag LOCUS_35500 5989 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 7948 5993 gene locus_tag LOCUS_35510 7948 5993 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943579.1 protein_id gnl|my_center|LOCUS_35510 8103 7969 gene locus_tag LOCUS_35520 8103 7969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 9637 8195 gene locus_tag LOCUS_35530 9637 8195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 10311 9634 gene locus_tag LOCUS_35540 10311 9634 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230358.1 protein_id gnl|my_center|LOCUS_35540 11176 10319 gene locus_tag LOCUS_35550 11176 10319 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933176.1 protein_id gnl|my_center|LOCUS_35550 11342 12070 gene locus_tag LOCUS_35560 11342 12070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 12101 13228 gene locus_tag LOCUS_35570 12101 13228 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442833.1 protein_id gnl|my_center|LOCUS_35570 13312 14856 gene locus_tag LOCUS_35580 13312 14856 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767764.1 protein_id gnl|my_center|LOCUS_35580 14988 16943 gene locus_tag LOCUS_35590 14988 16943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 18107 16986 gene locus_tag LOCUS_35600 gene ychF 18107 16986 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225667.1 protein_id gnl|my_center|LOCUS_35600 18218 18760 gene locus_tag LOCUS_35610 18218 18760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 18790 19734 gene locus_tag LOCUS_35620 18790 19734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 19813 20523 gene locus_tag LOCUS_35630 19813 20523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 21070 20486 gene locus_tag LOCUS_35640 21070 20486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 23211 21067 gene locus_tag LOCUS_35650 23211 21067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 23499 26057 gene locus_tag LOCUS_35660 23499 26057 CDS product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119311.1 protein_id gnl|my_center|LOCUS_35660 26054 28300 gene locus_tag LOCUS_35670 26054 28300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 28297 30318 gene locus_tag LOCUS_35680 28297 30318 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764318.1 protein_id gnl|my_center|LOCUS_35680 30315 31913 gene locus_tag LOCUS_35690 30315 31913 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918873.1 protein_id gnl|my_center|LOCUS_35690 31913 33640 gene locus_tag LOCUS_35700 31913 33640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109095.1 protein_id gnl|my_center|LOCUS_35700 33637 36150 gene locus_tag LOCUS_35710 33637 36150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 >Feature sequence48 <1 964 gene locus_tag LOCUS_35720 <1 964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114586.1:transposase 1052 2608 gene locus_tag LOCUS_35730 1052 2608 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 protein_id gnl|my_center|LOCUS_35730 3885 2614 gene locus_tag LOCUS_35740 3885 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 5641 3980 gene locus_tag LOCUS_35750 5641 3980 CDS product beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100342827.1 protein_id gnl|my_center|LOCUS_35750 6362 5730 gene locus_tag LOCUS_35760 6362 5730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 7570 6359 gene locus_tag LOCUS_35770 7570 6359 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337450.1 protein_id gnl|my_center|LOCUS_35770 8861 7578 gene locus_tag LOCUS_35780 8861 7578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 9539 8874 gene locus_tag LOCUS_35790 9539 8874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124055.1 protein_id gnl|my_center|LOCUS_35790 10645 9647 gene locus_tag LOCUS_35800 10645 9647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 11440 10685 gene locus_tag LOCUS_35810 11440 10685 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405214.1 protein_id gnl|my_center|LOCUS_35810 12415 11495 gene locus_tag LOCUS_35820 12415 11495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 12956 12408 gene locus_tag LOCUS_35830 12956 12408 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524578.1 protein_id gnl|my_center|LOCUS_35830 13370 13011 gene locus_tag LOCUS_35840 gene rsfS 13370 13011 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976226.1 protein_id gnl|my_center|LOCUS_35840 13535 14767 gene locus_tag LOCUS_35850 13535 14767 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057937.1 protein_id gnl|my_center|LOCUS_35850 14799 15410 gene locus_tag LOCUS_35860 14799 15410 CDS product YiiX family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683580.1 protein_id gnl|my_center|LOCUS_35860 18789 15412 gene locus_tag LOCUS_35870 18789 15412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 20157 18817 gene locus_tag LOCUS_35880 20157 18817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 20940 20161 gene locus_tag LOCUS_35890 gene rph 20940 20161 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096595.1 protein_id gnl|my_center|LOCUS_35890 21806 20955 gene locus_tag LOCUS_35900 21806 20955 CDS product phthiotriol/phenolphthiotriol dimycocerosates methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414900.1 protein_id gnl|my_center|LOCUS_35900 22527 21820 gene locus_tag LOCUS_35910 gene rpe 22527 21820 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989821.1 protein_id gnl|my_center|LOCUS_35910 22614 23141 gene locus_tag LOCUS_35920 gene tadA 22614 23141 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832295.1 protein_id gnl|my_center|LOCUS_35920 23282 24439 gene locus_tag LOCUS_35930 23282 24439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 24436 24798 gene locus_tag LOCUS_35940 24436 24798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 24957 26231 gene locus_tag LOCUS_35950 24957 26231 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_35950 26318 27241 gene locus_tag LOCUS_35960 26318 27241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 28465 27254 gene locus_tag LOCUS_35970 28465 27254 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_35970 28970 28515 gene locus_tag LOCUS_35980 28970 28515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 30290 29043 gene locus_tag LOCUS_35990 30290 29043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 31371 30295 gene locus_tag LOCUS_36000 31371 30295 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921628.1 protein_id gnl|my_center|LOCUS_36000 32698 31433 gene locus_tag LOCUS_36010 32698 31433 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_36010 33978 32764 gene locus_tag LOCUS_36020 33978 32764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 34492 34034 gene locus_tag LOCUS_36030 34492 34034 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878603.1 protein_id gnl|my_center|LOCUS_36030 >Feature sequence49 <1 4305 gene locus_tag LOCUS_36040 <1 4305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143694.1:Ig-like domain-containing protein 4340 5401 gene locus_tag LOCUS_36050 4340 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 5398 11718 gene locus_tag LOCUS_36060 5398 11718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 11961 19271 gene locus_tag LOCUS_36070 11961 19271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 19532 21550 gene locus_tag LOCUS_36080 19532 21550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 21558 22184 gene locus_tag LOCUS_36090 21558 22184 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141682.1 protein_id gnl|my_center|LOCUS_36090 22387 28590 gene locus_tag LOCUS_36100 22387 28590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 28663 29505 gene locus_tag LOCUS_36110 gene nagB 28663 29505 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119306.1 protein_id gnl|my_center|LOCUS_36110 30044 29613 gene locus_tag LOCUS_36120 30044 29613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 30170 30592 gene locus_tag LOCUS_36130 30170 30592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 30606 31439 gene locus_tag LOCUS_36140 30606 31439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36140 31561 32586 gene locus_tag LOCUS_36150 31561 32586 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530581.1 protein_id gnl|my_center|LOCUS_36150 33801 32707 gene locus_tag LOCUS_36160 33801 32707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 >Feature sequence50 511 1644 gene locus_tag LOCUS_36170 511 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 1741 3021 gene locus_tag LOCUS_36180 1741 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 3606 3037 gene locus_tag LOCUS_36190 3606 3037 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117887.1 protein_id gnl|my_center|LOCUS_36190 5139 3757 gene locus_tag LOCUS_36200 5139 3757 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775783.1 protein_id gnl|my_center|LOCUS_36200 5299 6828 gene locus_tag LOCUS_36210 5299 6828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 6825 8153 gene locus_tag LOCUS_36220 6825 8153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 8203 8979 gene locus_tag LOCUS_36230 gene hisA 8203 8979 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261650.1 protein_id gnl|my_center|LOCUS_36230 9435 10412 gene locus_tag LOCUS_36240 9435 10412 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258973.1 protein_id gnl|my_center|LOCUS_36240 10415 11374 gene locus_tag LOCUS_36250 10415 11374 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258974.1 protein_id gnl|my_center|LOCUS_36250 11419 12657 gene locus_tag LOCUS_36260 11419 12657 CDS product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174158.1 protein_id gnl|my_center|LOCUS_36260 12590 13249 gene locus_tag LOCUS_36270 12590 13249 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121244.1 protein_id gnl|my_center|LOCUS_36270 13279 14529 gene locus_tag LOCUS_36280 13279 14529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 14587 15477 gene locus_tag LOCUS_36290 14587 15477 CDS product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656225.1 protein_id gnl|my_center|LOCUS_36290 15596 16009 gene locus_tag LOCUS_36300 gene mce 15596 16009 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_36300 16042 17595 gene locus_tag LOCUS_36310 16042 17595 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387812.1 protein_id gnl|my_center|LOCUS_36310 17602 17982 gene locus_tag LOCUS_36320 17602 17982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 17997 18398 gene locus_tag LOCUS_36330 17997 18398 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387810.1 protein_id gnl|my_center|LOCUS_36330 18569 20056 gene locus_tag LOCUS_36340 18569 20056 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797086.1 protein_id gnl|my_center|LOCUS_36340 20084 22126 gene locus_tag LOCUS_36350 20084 22126 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258368.1 protein_id gnl|my_center|LOCUS_36350 22171 24348 gene locus_tag LOCUS_36360 gene scpA 22171 24348 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258367.1 protein_id gnl|my_center|LOCUS_36360 24436 29430 gene locus_tag LOCUS_36370 24436 29430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 29515 30420 gene locus_tag LOCUS_36380 29515 30420 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230083.1 protein_id gnl|my_center|LOCUS_36380 30417 31559 gene locus_tag LOCUS_36390 30417 31559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 32380 31577 gene locus_tag LOCUS_36400 32380 31577 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083729.1 protein_id gnl|my_center|LOCUS_36400 33186 32389 gene locus_tag LOCUS_36410 33186 32389 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387887.1 protein_id gnl|my_center|LOCUS_36410 >Feature sequence51 1303 77 gene locus_tag LOCUS_36420 1303 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 1263 1454 gene locus_tag LOCUS_36430 1263 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 1590 2609 gene locus_tag LOCUS_36440 1590 2609 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_36440 2613 3347 gene locus_tag LOCUS_36450 2613 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 3759 3358 gene locus_tag LOCUS_36460 3759 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 4179 3769 gene locus_tag LOCUS_36470 4179 3769 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091833896.1 protein_id gnl|my_center|LOCUS_36470 4497 6725 gene locus_tag LOCUS_36480 4497 6725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 6807 6883 gene locus_tag LOCUS_t00430 6807 6883 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8013 7348 gene locus_tag LOCUS_36490 8013 7348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 8932 8300 gene locus_tag LOCUS_36500 8932 8300 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970026.1 protein_id gnl|my_center|LOCUS_36500 9098 10447 gene locus_tag LOCUS_36510 9098 10447 CDS product putative oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108896.1 protein_id gnl|my_center|LOCUS_36510 11061 10453 gene locus_tag LOCUS_36520 11061 10453 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339334.1 protein_id gnl|my_center|LOCUS_36520 11197 14103 gene locus_tag LOCUS_36530 11197 14103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 14114 14968 gene locus_tag LOCUS_36540 14114 14968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 15005 15799 gene locus_tag LOCUS_36550 15005 15799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 15850 16287 gene locus_tag LOCUS_36560 gene tolR 15850 16287 CDS product colicin uptake protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393306.1 protein_id gnl|my_center|LOCUS_36560 16294 16746 gene locus_tag LOCUS_36570 16294 16746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 16773 18344 gene locus_tag LOCUS_36580 16773 18344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 18475 19314 gene locus_tag LOCUS_36590 18475 19314 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021216.1 protein_id gnl|my_center|LOCUS_36590 19327 19749 gene locus_tag LOCUS_36600 19327 19749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 19788 22154 gene locus_tag LOCUS_36610 19788 22154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 22162 23331 gene locus_tag LOCUS_36620 22162 23331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 23497 25452 gene locus_tag LOCUS_36630 gene speA 23497 25452 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792905.1 protein_id gnl|my_center|LOCUS_36630 26896 25703 gene locus_tag LOCUS_36640 26896 25703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 27393 26941 gene locus_tag LOCUS_36650 27393 26941 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768302.1 protein_id gnl|my_center|LOCUS_36650 27547 27906 gene locus_tag LOCUS_36660 27547 27906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 28193 28732 gene locus_tag LOCUS_36670 28193 28732 CDS product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336412.1 protein_id gnl|my_center|LOCUS_36670 28797 30995 gene locus_tag LOCUS_36680 28797 30995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 >Feature sequence52 26 102 gene locus_tag LOCUS_t00440 26 102 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 976 200 gene locus_tag LOCUS_36690 976 200 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791347.1 protein_id gnl|my_center|LOCUS_36690 2085 1027 gene locus_tag LOCUS_36700 2085 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 2178 3569 gene locus_tag LOCUS_36710 2178 3569 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155594933.1 protein_id gnl|my_center|LOCUS_36710 3615 5117 gene locus_tag LOCUS_36720 3615 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 5519 5124 gene locus_tag LOCUS_36730 5519 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 6167 5583 gene locus_tag LOCUS_36740 6167 5583 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528589.1 protein_id gnl|my_center|LOCUS_36740 8316 6361 gene locus_tag LOCUS_36750 gene mnmG 8316 6361 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944073.1 protein_id gnl|my_center|LOCUS_36750 8736 8335 gene locus_tag LOCUS_36760 8736 8335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 8920 9996 gene locus_tag LOCUS_36770 gene pdhA 8920 9996 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389634.1 protein_id gnl|my_center|LOCUS_36770 10054 11040 gene locus_tag LOCUS_36780 10054 11040 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279894.1 protein_id gnl|my_center|LOCUS_36780 11212 11616 gene locus_tag LOCUS_36790 11212 11616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 11752 13059 gene locus_tag LOCUS_36800 11752 13059 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537612.1 protein_id gnl|my_center|LOCUS_36800 13430 14092 gene locus_tag LOCUS_36810 13430 14092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 14213 14494 gene locus_tag LOCUS_36820 14213 14494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 14631 17345 gene locus_tag LOCUS_36830 14631 17345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 18336 17404 gene locus_tag LOCUS_36840 18336 17404 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_36840 18639 19961 gene locus_tag LOCUS_36850 18639 19961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 20803 20171 gene locus_tag LOCUS_36860 gene thiE 20803 20171 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172766.1 protein_id gnl|my_center|LOCUS_36860 22226 20874 gene locus_tag LOCUS_36870 gene accC 22226 20874 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_36870 22773 22303 gene locus_tag LOCUS_36880 gene accB 22773 22303 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354622.1 protein_id gnl|my_center|LOCUS_36880 22938 23564 gene locus_tag LOCUS_36890 gene trmB 22938 23564 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941189.1 protein_id gnl|my_center|LOCUS_36890 25060 23561 gene locus_tag LOCUS_36900 25060 23561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 26391 25306 gene locus_tag LOCUS_36910 26391 25306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 27188 26394 gene locus_tag LOCUS_36920 27188 26394 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102969.1 protein_id gnl|my_center|LOCUS_36920 28211 27567 gene locus_tag LOCUS_36930 28211 27567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 >Feature sequence53 <1 10659 gene locus_tag LOCUS_36940 <1 10659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003147216.1:filamentous hemagglutinin family protein 11116 11661 gene locus_tag LOCUS_36950 11116 11661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 11762 13591 gene locus_tag LOCUS_36960 11762 13591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 13665 14822 gene locus_tag LOCUS_36970 13665 14822 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_36970 15813 14824 gene locus_tag LOCUS_36980 15813 14824 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942002.1 protein_id gnl|my_center|LOCUS_36980 16781 15849 gene locus_tag LOCUS_36990 gene cysW 16781 15849 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036156.1 protein_id gnl|my_center|LOCUS_36990 17670 16786 gene locus_tag LOCUS_37000 gene cysT 17670 16786 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926820.1 protein_id gnl|my_center|LOCUS_37000 18449 17694 gene locus_tag LOCUS_37010 18449 17694 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941396.1 protein_id gnl|my_center|LOCUS_37010 19533 18499 gene locus_tag LOCUS_37020 19533 18499 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084243.1 protein_id gnl|my_center|LOCUS_37020 20316 19555 gene locus_tag LOCUS_37030 20316 19555 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329973.1 protein_id gnl|my_center|LOCUS_37030 21376 20351 gene locus_tag LOCUS_37040 21376 20351 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928929.1 protein_id gnl|my_center|LOCUS_37040 22623 21418 gene locus_tag LOCUS_37050 22623 21418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 23189 22992 gene locus_tag LOCUS_37060 23189 22992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 23760 23170 gene locus_tag LOCUS_37070 23760 23170 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394313.1 protein_id gnl|my_center|LOCUS_37070 25489 23972 gene locus_tag LOCUS_37080 25489 23972 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173402000.1 protein_id gnl|my_center|LOCUS_37080 26368 25607 gene locus_tag LOCUS_37090 26368 25607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 26494 27069 gene locus_tag LOCUS_37100 26494 27069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 27100 28002 gene locus_tag LOCUS_37110 27100 28002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 >Feature sequence54 1586 144 gene locus_tag LOCUS_37120 1586 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 3153 1615 gene locus_tag LOCUS_37130 3153 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 4256 3558 gene locus_tag LOCUS_37140 4256 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 5593 4319 gene locus_tag LOCUS_37150 5593 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 6292 5657 gene locus_tag LOCUS_37160 6292 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 7034 6441 gene locus_tag LOCUS_37170 7034 6441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 7396 7857 gene locus_tag LOCUS_37180 7396 7857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 7861 8670 gene locus_tag LOCUS_37190 gene folE2 7861 8670 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_37190 8660 9307 gene locus_tag LOCUS_37200 gene aat 8660 9307 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533070.1 protein_id gnl|my_center|LOCUS_37200 9344 9799 gene locus_tag LOCUS_37210 9344 9799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 11541 9814 gene locus_tag LOCUS_37220 11541 9814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 12493 11558 gene locus_tag LOCUS_37230 12493 11558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 13361 12555 gene locus_tag LOCUS_37240 gene thiD 13361 12555 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228119.1 protein_id gnl|my_center|LOCUS_37240 13445 13756 gene locus_tag LOCUS_37250 13445 13756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 13803 15365 gene locus_tag LOCUS_37260 13803 15365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 15451 16422 gene locus_tag LOCUS_37270 15451 16422 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768670.1 protein_id gnl|my_center|LOCUS_37270 16412 17845 gene locus_tag LOCUS_37280 16412 17845 CDS product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112782.1 protein_id gnl|my_center|LOCUS_37280 17842 18954 gene locus_tag LOCUS_37290 17842 18954 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104956.1 protein_id gnl|my_center|LOCUS_37290 18951 19943 gene locus_tag LOCUS_37300 18951 19943 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112780.1 protein_id gnl|my_center|LOCUS_37300 19943 21247 gene locus_tag LOCUS_37310 19943 21247 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104968.1 protein_id gnl|my_center|LOCUS_37310 21518 23098 gene locus_tag LOCUS_37320 gene glgA 21518 23098 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246015.1 protein_id gnl|my_center|LOCUS_37320 24056 23103 gene locus_tag LOCUS_37330 24056 23103 CDS product DUF1460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989071.1 protein_id gnl|my_center|LOCUS_37330 24150 24821 gene locus_tag LOCUS_37340 gene trmD 24150 24821 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_37340 24923 25381 gene locus_tag LOCUS_37350 24923 25381 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926982.1 protein_id gnl|my_center|LOCUS_37350 25612 26043 gene locus_tag LOCUS_37360 25612 26043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 <27404 26128 gene locus_tag LOCUS_37370 <27404 26128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070585.1:tandem-95 repeat protein >Feature sequence55 1182 76 gene locus_tag LOCUS_37380 1182 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 1355 2206 gene locus_tag LOCUS_37390 gene rimK 1355 2206 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261388.1 protein_id gnl|my_center|LOCUS_37390 2260 3375 gene locus_tag LOCUS_37400 gene leuB 2260 3375 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943508.1 protein_id gnl|my_center|LOCUS_37400 4871 3657 gene locus_tag LOCUS_37410 4871 3657 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767198.1 protein_id gnl|my_center|LOCUS_37410 6455 4914 gene locus_tag LOCUS_37420 6455 4914 CDS product ribonuclease inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141613167.1 protein_id gnl|my_center|LOCUS_37420 6746 6513 gene locus_tag LOCUS_37430 6746 6513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 7818 6802 gene locus_tag LOCUS_37440 7818 6802 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919689.1 protein_id gnl|my_center|LOCUS_37440 7985 8443 gene locus_tag LOCUS_37450 gene hisI 7985 8443 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088269.1 protein_id gnl|my_center|LOCUS_37450 8562 8906 gene locus_tag LOCUS_37460 gene rplS 8562 8906 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_37460 8962 9954 gene locus_tag LOCUS_37470 8962 9954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 10016 10783 gene locus_tag LOCUS_37480 10016 10783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 10780 11928 gene locus_tag LOCUS_37490 10780 11928 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123043.1 protein_id gnl|my_center|LOCUS_37490 11954 12490 gene locus_tag LOCUS_37500 11954 12490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 13557 12499 gene locus_tag LOCUS_37510 13557 12499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 14527 13547 gene locus_tag LOCUS_37520 14527 13547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 15183 14566 gene locus_tag LOCUS_37530 15183 14566 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140820.1 protein_id gnl|my_center|LOCUS_37530 17935 15236 gene locus_tag LOCUS_37540 17935 15236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 18070 19227 gene locus_tag LOCUS_37550 18070 19227 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971772.1 protein_id gnl|my_center|LOCUS_37550 23342 19305 gene locus_tag LOCUS_37560 23342 19305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 23915 24454 gene locus_tag LOCUS_37570 23915 24454 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921864.1 protein_id gnl|my_center|LOCUS_37570 24451 25419 gene locus_tag LOCUS_37580 24451 25419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 25721 25461 gene locus_tag LOCUS_37590 25721 25461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 >Feature sequence56 3404 720 gene locus_tag LOCUS_37600 3404 720 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_37600 3559 6108 gene locus_tag LOCUS_37610 3559 6108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 6115 6429 gene locus_tag LOCUS_37620 gene rhaM 6115 6429 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973087.1 protein_id gnl|my_center|LOCUS_37620 6435 7850 gene locus_tag LOCUS_37630 6435 7850 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922487.1 protein_id gnl|my_center|LOCUS_37630 7847 9091 gene locus_tag LOCUS_37640 7847 9091 CDS product glycosyl hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109139.1 protein_id gnl|my_center|LOCUS_37640 10834 9098 gene locus_tag LOCUS_37650 gene polX 10834 9098 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957611.1 protein_id gnl|my_center|LOCUS_37650 11064 12245 gene locus_tag LOCUS_37660 11064 12245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 12316 13815 gene locus_tag LOCUS_37670 12316 13815 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551506.1 protein_id gnl|my_center|LOCUS_37670 13812 15275 gene locus_tag LOCUS_37680 gene hydA 13812 15275 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651148.1 protein_id gnl|my_center|LOCUS_37680 15272 16699 gene locus_tag LOCUS_37690 15272 16699 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920205.1 protein_id gnl|my_center|LOCUS_37690 16712 18046 gene locus_tag LOCUS_37700 16712 18046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 18089 19096 gene locus_tag LOCUS_37710 18089 19096 CDS product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035379.1 protein_id gnl|my_center|LOCUS_37710 19157 22039 gene locus_tag LOCUS_37720 gene uvrA 19157 22039 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389505.1 protein_id gnl|my_center|LOCUS_37720 23351 22095 gene locus_tag LOCUS_37730 23351 22095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 24582 23773 gene locus_tag LOCUS_37740 24582 23773 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222998.1 protein_id gnl|my_center|LOCUS_37740 25916 25506 gene locus_tag LOCUS_37750 25916 25506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 27204 26812 gene locus_tag LOCUS_37760 27204 26812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 >Feature sequence57 1061 204 gene locus_tag LOCUS_37770 1061 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 2268 1390 gene locus_tag LOCUS_37780 2268 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 3574 2354 gene locus_tag LOCUS_37790 3574 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 3699 5045 gene locus_tag LOCUS_37800 3699 5045 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_37800 5157 8195 gene locus_tag LOCUS_37810 5157 8195 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666716.1 protein_id gnl|my_center|LOCUS_37810 8430 8182 gene locus_tag LOCUS_37820 8430 8182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 8344 9651 gene locus_tag LOCUS_37830 8344 9651 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326676.1 protein_id gnl|my_center|LOCUS_37830 12010 9641 gene locus_tag LOCUS_37840 12010 9641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 12178 12855 gene locus_tag LOCUS_37850 12178 12855 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815117.1 protein_id gnl|my_center|LOCUS_37850 12855 14210 gene locus_tag LOCUS_37860 12855 14210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 15263 14220 gene locus_tag LOCUS_37870 gene apbC 15263 14220 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257064.1 protein_id gnl|my_center|LOCUS_37870 15372 16331 gene locus_tag LOCUS_37880 gene trxB 15372 16331 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231058.1 protein_id gnl|my_center|LOCUS_37880 16400 16774 gene locus_tag LOCUS_37890 16400 16774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 16786 17958 gene locus_tag LOCUS_37900 16786 17958 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073912.1 protein_id gnl|my_center|LOCUS_37900 18449 18054 gene locus_tag LOCUS_37910 18449 18054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 19698 18637 gene locus_tag LOCUS_37920 19698 18637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 22479 19759 gene locus_tag LOCUS_37930 22479 19759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 23902 22472 gene locus_tag LOCUS_37940 23902 22472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 25121 24054 gene locus_tag LOCUS_37950 gene aroG 25121 24054 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550019.1 protein_id gnl|my_center|LOCUS_37950 25241 25990 gene locus_tag LOCUS_37960 25241 25990 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081998.1 protein_id gnl|my_center|LOCUS_37960 >Feature sequence58 <1 870 gene locus_tag LOCUS_37970 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121554.1:autotransporter outer membrane beta-barrel domain-containing protein 1028 1783 gene locus_tag LOCUS_37980 1028 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 1791 7985 gene locus_tag LOCUS_37990 1791 7985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 8322 7975 gene locus_tag LOCUS_38000 8322 7975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 8213 9373 gene locus_tag LOCUS_38010 8213 9373 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767015.1 protein_id gnl|my_center|LOCUS_38010 12506 9462 gene locus_tag LOCUS_38020 12506 9462 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123898.1 protein_id gnl|my_center|LOCUS_38020 12949 14319 gene locus_tag LOCUS_38030 12949 14319 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889170.1 protein_id gnl|my_center|LOCUS_38030 15909 14332 gene locus_tag LOCUS_38040 gene cimA 15909 14332 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583555.1 protein_id gnl|my_center|LOCUS_38040 16077 17198 gene locus_tag LOCUS_38050 16077 17198 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404839.1 protein_id gnl|my_center|LOCUS_38050 17905 17225 gene locus_tag LOCUS_38060 17905 17225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 18660 17905 gene locus_tag LOCUS_38070 18660 17905 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921580.1 protein_id gnl|my_center|LOCUS_38070 18812 20992 gene locus_tag LOCUS_38080 18812 20992 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084267.1 protein_id gnl|my_center|LOCUS_38080 21041 22099 gene locus_tag LOCUS_38090 21041 22099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 22116 22709 gene locus_tag LOCUS_38100 gene hisB 22116 22709 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243389.1 protein_id gnl|my_center|LOCUS_38100 22706 23341 gene locus_tag LOCUS_38110 gene hisH 22706 23341 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057376.1 protein_id gnl|my_center|LOCUS_38110 >Feature sequence59 <1 812 gene locus_tag LOCUS_38120 <1 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114586.1:transposase 4325 879 gene locus_tag LOCUS_38130 4325 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 4899 4414 gene locus_tag LOCUS_38140 4899 4414 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_38140 5894 4932 gene locus_tag LOCUS_38150 5894 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 6553 5966 gene locus_tag LOCUS_38160 6553 5966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 7401 6625 gene locus_tag LOCUS_38170 7401 6625 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788045.1 protein_id gnl|my_center|LOCUS_38170 8010 7417 gene locus_tag LOCUS_38180 8010 7417 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532757.1 protein_id gnl|my_center|LOCUS_38180 9152 8007 gene locus_tag LOCUS_38190 9152 8007 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816897.1 protein_id gnl|my_center|LOCUS_38190 9230 10378 gene locus_tag LOCUS_38200 9230 10378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 10395 12575 gene locus_tag LOCUS_38210 10395 12575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 12630 13382 gene locus_tag LOCUS_38220 12630 13382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 13386 14798 gene locus_tag LOCUS_38230 13386 14798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 14809 15357 gene locus_tag LOCUS_38240 gene rsmD 14809 15357 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_38240 16337 15354 gene locus_tag LOCUS_38250 16337 15354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 16452 17753 gene locus_tag LOCUS_38260 gene waaA 16452 17753 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 protein_id gnl|my_center|LOCUS_38260 17782 19506 gene locus_tag LOCUS_38270 17782 19506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 19531 19620 gene locus_tag LOCUS_t00450 19531 19620 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence60 1707 97 gene locus_tag LOCUS_38280 gene zwf 1707 97 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_38280 3406 1733 gene locus_tag LOCUS_38290 3406 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 3606 9791 gene locus_tag LOCUS_38300 3606 9791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 11387 9819 gene locus_tag LOCUS_38310 gene recJ 11387 9819 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_38310 11787 13700 gene locus_tag LOCUS_38320 gene dnaK 11787 13700 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_38320 13831 14121 gene locus_tag LOCUS_38330 gene groES 13831 14121 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918572.1 protein_id gnl|my_center|LOCUS_38330 14267 15898 gene locus_tag LOCUS_38340 gene groL 14267 15898 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545192.1 protein_id gnl|my_center|LOCUS_38340 17332 16391 gene locus_tag LOCUS_38350 17332 16391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 >Feature sequence61 1065 136 gene locus_tag LOCUS_38360 1065 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 2349 1078 gene locus_tag LOCUS_38370 2349 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 2939 2346 gene locus_tag LOCUS_38380 2939 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 3976 2936 gene locus_tag LOCUS_38390 3976 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 4182 3976 gene locus_tag LOCUS_38400 4182 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 4612 4172 gene locus_tag LOCUS_38410 4612 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 4990 4706 gene locus_tag LOCUS_38420 4990 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 6053 5049 gene locus_tag LOCUS_38430 6053 5049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 6589 6092 gene locus_tag LOCUS_38440 6589 6092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 7819 6629 gene locus_tag LOCUS_38450 7819 6629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 9974 7896 gene locus_tag LOCUS_38460 9974 7896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 10189 9971 gene locus_tag LOCUS_38470 10189 9971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 11733 10186 gene locus_tag LOCUS_38480 11733 10186 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889353.1 protein_id gnl|my_center|LOCUS_38480 12341 11733 gene locus_tag LOCUS_38490 12341 11733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 12605 12345 gene locus_tag LOCUS_38500 12605 12345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 13154 12615 gene locus_tag LOCUS_38510 13154 12615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 13396 13151 gene locus_tag LOCUS_38520 13396 13151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 <14087 13393 gene locus_tag LOCUS_38530 <14087 13393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000779891.1:N-acetylmuramoyl-L-alanine amidase >Feature sequence62 <1 1227 gene locus_tag LOCUS_38540 <1 1227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_035257407.1:autotransporter domain-containing protein 2692 1310 gene locus_tag LOCUS_38550 gene lpdA 2692 1310 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_38550 2815 3567 gene locus_tag LOCUS_38560 2815 3567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 4066 3587 gene locus_tag LOCUS_38570 4066 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 4262 5377 gene locus_tag LOCUS_38580 4262 5377 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082051.1 protein_id gnl|my_center|LOCUS_38580 5397 5777 gene locus_tag LOCUS_38590 5397 5777 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387836.1 protein_id gnl|my_center|LOCUS_38590 7321 5804 gene locus_tag LOCUS_38600 7321 5804 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037254759.1 protein_id gnl|my_center|LOCUS_38600 7852 7325 gene locus_tag LOCUS_38610 7852 7325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 8353 7922 gene locus_tag LOCUS_38620 8353 7922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 8513 9241 gene locus_tag LOCUS_38630 8513 9241 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975845.1 protein_id gnl|my_center|LOCUS_38630 9238 10848 gene locus_tag LOCUS_38640 9238 10848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 >Feature sequence63 5104 5340 gene locus_tag LOCUS_38650 5104 5340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 5625 6671 gene locus_tag LOCUS_38660 5625 6671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 7921 7649 gene locus_tag LOCUS_38670 7921 7649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 10752 10600 gene locus_tag LOCUS_38680 10752 10600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 >Feature sequence64 837 2309 gene locus_tag LOCUS_38690 837 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 2371 3492 gene locus_tag LOCUS_38700 2371 3492 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073547.1 protein_id gnl|my_center|LOCUS_38700 3634 6279 gene locus_tag LOCUS_38710 3634 6279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 6709 7401 gene locus_tag LOCUS_38720 6709 7401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 9229 9041 gene locus_tag LOCUS_38730 9229 9041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 9458 9691 gene locus_tag LOCUS_38740 9458 9691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 >Feature sequence65 94 18 gene locus_tag LOCUS_t00460 94 18 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 173 1216 gene locus_tag LOCUS_38750 gene argC 173 1216 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937798.1 protein_id gnl|my_center|LOCUS_38750 1262 2515 gene locus_tag LOCUS_38760 gene argJ 1262 2515 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546755.1 protein_id gnl|my_center|LOCUS_38760 2762 3241 gene locus_tag LOCUS_38770 2762 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 3358 3678 gene locus_tag LOCUS_38780 3358 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 3754 3933 gene locus_tag LOCUS_38790 3754 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 3956 5443 gene locus_tag LOCUS_38800 3956 5443 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121087.1 protein_id gnl|my_center|LOCUS_38800 5522 5594 gene locus_tag LOCUS_t00470 5522 5594 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7582 5606 gene locus_tag LOCUS_38810 7582 5606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 7721 8212 gene locus_tag LOCUS_38820 7721 8212 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 protein_id gnl|my_center|LOCUS_38820 8506 9612 gene locus_tag LOCUS_38830 8506 9612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 9859 9698 gene locus_tag LOCUS_38840 9859 9698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 >Feature sequence66 347 1237 gene locus_tag LOCUS_38850 347 1237 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098061990.1 protein_id gnl|my_center|LOCUS_38850 1285 2172 gene locus_tag LOCUS_38860 1285 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 2919 3518 gene locus_tag LOCUS_38870 2919 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 4546 3566 gene locus_tag LOCUS_38880 4546 3566 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530589.1 protein_id gnl|my_center|LOCUS_38880 4755 5030 gene locus_tag LOCUS_38890 4755 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 5792 5052 gene locus_tag LOCUS_38900 5792 5052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 7143 5785 gene locus_tag LOCUS_38910 7143 5785 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068364.1 protein_id gnl|my_center|LOCUS_38910 <9715 7352 gene locus_tag LOCUS_38920 <9715 7352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_172626010.1:DEAD/DEAH box helicase family protein >Feature sequence67 309 224 gene locus_tag LOCUS_t00480 309 224 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 575 940 gene locus_tag LOCUS_38930 575 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 1053 3191 gene locus_tag LOCUS_38940 1053 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120678.1 protein_id gnl|my_center|LOCUS_38940 >Feature sequence68 <1 1584 gene locus_tag LOCUS_38950 <1 1584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104543246.1:autotransporter-associated beta strand repeat-containing protein 1591 3009 gene locus_tag LOCUS_38960 1591 3009 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929927.1 protein_id gnl|my_center|LOCUS_38960 3034 8331 gene locus_tag LOCUS_38970 3034 8331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 >Feature sequence69 1698 184 gene locus_tag LOCUS_38980 1698 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 2564 1713 gene locus_tag LOCUS_38990 2564 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 2805 3110 gene locus_tag LOCUS_39000 2805 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 3447 3998 gene locus_tag LOCUS_39010 3447 3998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 4187 7900 gene locus_tag LOCUS_39020 4187 7900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 >Feature sequence70 751 14 gene locus_tag LOCUS_39030 751 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 1184 903 gene locus_tag LOCUS_39040 1184 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 2740 2102 gene locus_tag LOCUS_39050 2740 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 2940 2737 gene locus_tag LOCUS_39060 2940 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 5458 2978 gene locus_tag LOCUS_39070 gene ccoN 5458 2978 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_39070 5646 5455 gene locus_tag LOCUS_39080 5646 5455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 6244 5720 gene locus_tag LOCUS_39090 6244 5720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 6466 7158 gene locus_tag LOCUS_39100 6466 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 >Feature sequence71 <1 1355 gene locus_tag LOCUS_39110 <1 1355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_167355187.1:autotransporter domain-containing protein 1533 4028 gene locus_tag LOCUS_39120 1533 4028 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584086.1 protein_id gnl|my_center|LOCUS_39120 4118 6262 gene locus_tag LOCUS_39130 4118 6262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 6259 6879 gene locus_tag LOCUS_39140 6259 6879 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230184.1 protein_id gnl|my_center|LOCUS_39140 >Feature sequence72 <1 1276 gene locus_tag LOCUS_39150 <1 1276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257396.1:glycosyltransferase family 1 protein 1288 2382 gene locus_tag LOCUS_39160 1288 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 2435 3256 gene locus_tag LOCUS_39170 2435 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 3263 4159 gene locus_tag LOCUS_39180 3263 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 4222 5178 gene locus_tag LOCUS_39190 4222 5178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 5533 7164 gene locus_tag LOCUS_39200 5533 7164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 >Feature sequence73 <1 3788 gene locus_tag LOCUS_39210 <1 3788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_126622031.1:autotransporter-associated beta strand repeat-containing protein 3944 5122 gene locus_tag LOCUS_39220 3944 5122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 5554 5153 gene locus_tag LOCUS_39230 5554 5153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 >Feature sequence74 770 1117 gene locus_tag LOCUS_39240 770 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 >Feature sequence75 426 761 gene locus_tag LOCUS_39250 426 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 1109 1939 gene locus_tag LOCUS_39260 1109 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 2988 2005 gene locus_tag LOCUS_39270 2988 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 3134 3541 gene locus_tag LOCUS_39280 3134 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 3538 4143 gene locus_tag LOCUS_39290 gene recR 3538 4143 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_39290 5037 4156 gene locus_tag LOCUS_39300 5037 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 5298 >5581 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccgcgcccctcgtgtgaggggcgac >Feature sequence76 <1 765 gene locus_tag LOCUS_39310 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112717.1:DUF2341 domain-containing protein 791 1198 gene locus_tag LOCUS_39320 791 1198 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085366.1 protein_id gnl|my_center|LOCUS_39320 1234 1935 gene locus_tag LOCUS_39330 1234 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 1968 3836 gene locus_tag LOCUS_39340 1968 3836 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112715.1 protein_id gnl|my_center|LOCUS_39340 3926 4570 gene locus_tag LOCUS_39350 3926 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 >Feature sequence77 205 1011 gene locus_tag LOCUS_39360 205 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 1036 3375 gene locus_tag LOCUS_39370 1036 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 3379 3816 gene locus_tag LOCUS_39380 3379 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 3820 5166 gene locus_tag LOCUS_39390 3820 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 >Feature sequence78 980 1333 gene locus_tag LOCUS_39400 980 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 3152 2010 gene locus_tag LOCUS_39410 3152 2010 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068712904.1 protein_id gnl|my_center|LOCUS_39410 3315 3695 gene locus_tag LOCUS_39420 3315 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116392.1 protein_id gnl|my_center|LOCUS_39420 >Feature sequence79 <4843 813 gene locus_tag LOCUS_39430 <4843 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967015.1:autotransporter outer membrane beta-barrel domain-containing protein >Feature sequence80 <3992 684 gene locus_tag LOCUS_39440 <3992 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104543246.1:autotransporter-associated beta strand repeat-containing protein >Feature sequence81 2444 732 gene locus_tag LOCUS_39450 2444 732 CDS product GxGYxYP family putative glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764130.1 protein_id gnl|my_center|LOCUS_39450 >Feature sequence82 424 221 gene locus_tag LOCUS_39460 424 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 2480 1353 gene locus_tag LOCUS_39470 2480 1353 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040680916.1 protein_id gnl|my_center|LOCUS_39470 3579 2506 gene locus_tag LOCUS_39480 3579 2506 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816295.1 protein_id gnl|my_center|LOCUS_39480 >Feature sequence83 180 434 gene locus_tag LOCUS_39490 180 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 431 751 gene locus_tag LOCUS_39500 431 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 772 990 gene locus_tag LOCUS_39510 772 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 1018 1494 gene locus_tag LOCUS_39520 1018 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 1582 2043 gene locus_tag LOCUS_39530 1582 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 2067 2570 gene locus_tag LOCUS_39540 2067 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 2574 2900 gene locus_tag LOCUS_39550 2574 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 2978 3604 gene locus_tag LOCUS_39560 2978 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 3871 3795 gene locus_tag LOCUS_t00490 3871 3795 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence84 <1 2420 gene locus_tag LOCUS_39570 <1 2420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104543246.1:autotransporter-associated beta strand repeat-containing protein >Feature sequence85 1492 320 gene locus_tag LOCUS_39580 1492 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 >Feature sequence86 459 241 gene locus_tag LOCUS_39590 459 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 1341 994 gene locus_tag LOCUS_39600 1341 994 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142157.1 protein_id gnl|my_center|LOCUS_39600 1697 1341 gene locus_tag LOCUS_39610 1697 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 3318 1918 gene locus_tag LOCUS_39620 3318 1918 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_39620 >Feature sequence87 1727 183 gene locus_tag LOCUS_39630 1727 183 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889353.1 protein_id gnl|my_center|LOCUS_39630 2332 1727 gene locus_tag LOCUS_39640 2332 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 2596 2333 gene locus_tag LOCUS_39650 2596 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 3113 2607 gene locus_tag LOCUS_39660 3113 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660