>Feature sequence01 1352 924 gene locus_tag LOCUS_00010 1352 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1463 2410 gene locus_tag LOCUS_00020 1463 2410 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970230.1 protein_id gnl|my_center|LOCUS_00020 2665 2883 gene locus_tag LOCUS_00030 2665 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2870 3349 gene locus_tag LOCUS_00040 2870 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4444 3518 gene locus_tag LOCUS_00050 4444 3518 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762696.1 protein_id gnl|my_center|LOCUS_00050 4864 4619 gene locus_tag LOCUS_00060 4864 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5777 4896 gene locus_tag LOCUS_00070 5777 4896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 5913 6683 gene locus_tag LOCUS_00080 5913 6683 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867640.1 protein_id gnl|my_center|LOCUS_00080 6673 7479 gene locus_tag LOCUS_00090 6673 7479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 7481 7867 gene locus_tag LOCUS_00100 7481 7867 CDS product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763557.1 protein_id gnl|my_center|LOCUS_00100 8082 9875 gene locus_tag LOCUS_00110 8082 9875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9863 10363 gene locus_tag LOCUS_00120 9863 10363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 11830 10427 gene locus_tag LOCUS_00130 11830 10427 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249525.1 protein_id gnl|my_center|LOCUS_00130 12850 11867 gene locus_tag LOCUS_00140 12850 11867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 13691 13350 gene locus_tag LOCUS_00150 13691 13350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 14676 13708 gene locus_tag LOCUS_00160 14676 13708 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867986.1 protein_id gnl|my_center|LOCUS_00160 15542 14673 gene locus_tag LOCUS_00170 15542 14673 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053679.1 protein_id gnl|my_center|LOCUS_00170 15924 15547 gene locus_tag LOCUS_00180 15924 15547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 16298 15921 gene locus_tag LOCUS_00190 16298 15921 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979516.1 protein_id gnl|my_center|LOCUS_00190 16446 16724 gene locus_tag LOCUS_00200 16446 16724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 16781 17125 gene locus_tag LOCUS_00210 16781 17125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 17318 17983 gene locus_tag LOCUS_00220 17318 17983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 18605 18417 gene locus_tag LOCUS_00230 18605 18417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 19548 18592 gene locus_tag LOCUS_00240 19548 18592 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249955.1 protein_id gnl|my_center|LOCUS_00240 19621 20781 gene locus_tag LOCUS_00250 19621 20781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 20870 22219 gene locus_tag LOCUS_00260 20870 22219 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021092.1 protein_id gnl|my_center|LOCUS_00260 23113 22229 gene locus_tag LOCUS_00270 23113 22229 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598716.1 protein_id gnl|my_center|LOCUS_00270 24092 23166 gene locus_tag LOCUS_00280 24092 23166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 24543 24749 gene locus_tag LOCUS_00290 24543 24749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 24761 25096 gene locus_tag LOCUS_00300 24761 25096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 27815 25167 gene locus_tag LOCUS_00310 gene ppdK 27815 25167 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583674.1 protein_id gnl|my_center|LOCUS_00310 28026 29183 gene locus_tag LOCUS_00320 28026 29183 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939580.1 protein_id gnl|my_center|LOCUS_00320 29960 29172 gene locus_tag LOCUS_00330 29960 29172 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584118.1 protein_id gnl|my_center|LOCUS_00330 30530 30048 gene locus_tag LOCUS_00340 gene tsaA 30530 30048 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978062.1 protein_id gnl|my_center|LOCUS_00340 30789 31508 gene locus_tag LOCUS_00350 30789 31508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 32304 31840 gene locus_tag LOCUS_00360 32304 31840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 32687 32307 gene locus_tag LOCUS_00370 32687 32307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 32756 33097 gene locus_tag LOCUS_00380 32756 33097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 33161 33442 gene locus_tag LOCUS_00390 33161 33442 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868779.1 protein_id gnl|my_center|LOCUS_00390 34129 33461 gene locus_tag LOCUS_00400 34129 33461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 34408 35346 gene locus_tag LOCUS_00410 gene htpX 34408 35346 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980430.1 protein_id gnl|my_center|LOCUS_00410 35395 35751 gene locus_tag LOCUS_00420 35395 35751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 37073 35748 gene locus_tag LOCUS_00430 37073 35748 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762365.1 protein_id gnl|my_center|LOCUS_00430 37369 37106 gene locus_tag LOCUS_00440 37369 37106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 37846 38253 gene locus_tag LOCUS_00450 37846 38253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00450 38280 38513 gene locus_tag LOCUS_00460 38280 38513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00460 38488 39072 gene locus_tag LOCUS_00470 38488 39072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00470 39952 39509 gene locus_tag LOCUS_00480 39952 39509 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180546210.1 protein_id gnl|my_center|LOCUS_00480 40196 39927 gene locus_tag LOCUS_00490 40196 39927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 40738 40361 gene locus_tag LOCUS_00500 40738 40361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 41112 40705 gene locus_tag LOCUS_00510 41112 40705 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846402.1 protein_id gnl|my_center|LOCUS_00510 43144 41330 gene locus_tag LOCUS_00520 43144 41330 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762861.1 protein_id gnl|my_center|LOCUS_00520 43476 43141 gene locus_tag LOCUS_00530 43476 43141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 44301 43486 gene locus_tag LOCUS_00540 44301 43486 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979223.1 protein_id gnl|my_center|LOCUS_00540 45416 44313 gene locus_tag LOCUS_00550 45416 44313 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762209.1 protein_id gnl|my_center|LOCUS_00550 45920 45417 gene locus_tag LOCUS_00560 45920 45417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 46713 45910 gene locus_tag LOCUS_00570 46713 45910 CDS product nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240366.1 protein_id gnl|my_center|LOCUS_00570 47287 46673 gene locus_tag LOCUS_00580 47287 46673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013683780.1 protein_id gnl|my_center|LOCUS_00580 48641 47439 gene locus_tag LOCUS_00590 48641 47439 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761797.1 protein_id gnl|my_center|LOCUS_00590 49398 48622 gene locus_tag LOCUS_00600 49398 48622 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879850.1 protein_id gnl|my_center|LOCUS_00600 50368 49592 gene locus_tag LOCUS_00610 50368 49592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 51596 50439 gene locus_tag LOCUS_00620 51596 50439 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868815.1 protein_id gnl|my_center|LOCUS_00620 53121 51871 gene locus_tag LOCUS_00630 53121 51871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 54019 53309 gene locus_tag LOCUS_00640 54019 53309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228874.1 protein_id gnl|my_center|LOCUS_00640 55599 54109 gene locus_tag LOCUS_00650 55599 54109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 56348 55608 gene locus_tag LOCUS_00660 56348 55608 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251231.1 protein_id gnl|my_center|LOCUS_00660 56452 57342 gene locus_tag LOCUS_00670 gene dapA 56452 57342 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869742.1 protein_id gnl|my_center|LOCUS_00670 59476 57386 gene locus_tag LOCUS_00680 59476 57386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 60251 59568 gene locus_tag LOCUS_00690 60251 59568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 61474 60521 gene locus_tag LOCUS_00700 61474 60521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 62836 61952 gene locus_tag LOCUS_00710 62836 61952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 63083 63598 gene locus_tag LOCUS_00720 63083 63598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 63586 63867 gene locus_tag LOCUS_00730 63586 63867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 63864 64922 gene locus_tag LOCUS_00740 63864 64922 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065409.1 protein_id gnl|my_center|LOCUS_00740 68142 64924 gene locus_tag LOCUS_00750 68142 64924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 68304 69884 gene locus_tag LOCUS_00760 68304 69884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 70035 70709 gene locus_tag LOCUS_00770 70035 70709 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583890.1 protein_id gnl|my_center|LOCUS_00770 70755 71342 gene locus_tag LOCUS_00780 70755 71342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 72657 71329 gene locus_tag LOCUS_00790 72657 71329 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460037.1 protein_id gnl|my_center|LOCUS_00790 72710 73153 gene locus_tag LOCUS_00800 72710 73153 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763410.1 protein_id gnl|my_center|LOCUS_00800 73276 73500 gene locus_tag LOCUS_00810 73276 73500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878112.1 protein_id gnl|my_center|LOCUS_00810 73503 73949 gene locus_tag LOCUS_00820 73503 73949 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846620.1 protein_id gnl|my_center|LOCUS_00820 75575 74046 gene locus_tag LOCUS_00830 75575 74046 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870278.1 protein_id gnl|my_center|LOCUS_00830 76806 75640 gene locus_tag LOCUS_00840 76806 75640 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107704.1 protein_id gnl|my_center|LOCUS_00840 77662 76808 gene locus_tag LOCUS_00850 77662 76808 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729154.1 protein_id gnl|my_center|LOCUS_00850 78645 77686 gene locus_tag LOCUS_00860 78645 77686 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978653.1 protein_id gnl|my_center|LOCUS_00860 80250 78658 gene locus_tag LOCUS_00870 80250 78658 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979926.1 protein_id gnl|my_center|LOCUS_00870 81081 80419 gene locus_tag LOCUS_00880 81081 80419 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948546.1 protein_id gnl|my_center|LOCUS_00880 81386 83962 gene locus_tag LOCUS_00890 81386 83962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 85692 85012 gene locus_tag LOCUS_00900 85692 85012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 86188 85799 gene locus_tag LOCUS_00910 86188 85799 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846810.1 protein_id gnl|my_center|LOCUS_00910 86565 86155 gene locus_tag LOCUS_00920 86565 86155 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980577.1 protein_id gnl|my_center|LOCUS_00920 87195 86887 gene locus_tag LOCUS_00930 87195 86887 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879110.1 protein_id gnl|my_center|LOCUS_00930 87559 87182 gene locus_tag LOCUS_00940 87559 87182 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978742.1 protein_id gnl|my_center|LOCUS_00940 88170 89051 gene locus_tag LOCUS_00950 88170 89051 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259348.1 protein_id gnl|my_center|LOCUS_00950 89354 89722 gene locus_tag LOCUS_00960 89354 89722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 89893 90396 gene locus_tag LOCUS_00970 89893 90396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 91204 90527 gene locus_tag LOCUS_00980 91204 90527 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249697.1 protein_id gnl|my_center|LOCUS_00980 91845 91201 gene locus_tag LOCUS_00990 91845 91201 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060828.1 protein_id gnl|my_center|LOCUS_00990 92742 91849 gene locus_tag LOCUS_01000 92742 91849 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391615.1 protein_id gnl|my_center|LOCUS_01000 93600 92824 gene locus_tag LOCUS_01010 93600 92824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 94971 94165 gene locus_tag LOCUS_01020 94971 94165 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434659.1 protein_id gnl|my_center|LOCUS_01020 95200 96495 gene locus_tag LOCUS_01030 95200 96495 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868396.1 protein_id gnl|my_center|LOCUS_01030 97196 96498 gene locus_tag LOCUS_01040 97196 96498 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022379.1 protein_id gnl|my_center|LOCUS_01040 97249 97404 gene locus_tag LOCUS_01050 97249 97404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 97551 97718 gene locus_tag LOCUS_01060 97551 97718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 97948 98853 gene locus_tag LOCUS_01070 97948 98853 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425747.1 protein_id gnl|my_center|LOCUS_01070 99126 98959 gene locus_tag LOCUS_01080 99126 98959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 99575 99390 gene locus_tag LOCUS_01090 99575 99390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 99724 100128 gene locus_tag LOCUS_01100 99724 100128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 100256 102529 gene locus_tag LOCUS_01110 100256 102529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 102588 103253 gene locus_tag LOCUS_01120 102588 103253 CDS product DUF2848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811063.1 protein_id gnl|my_center|LOCUS_01120 104174 103416 gene locus_tag LOCUS_01130 104174 103416 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879086.1 protein_id gnl|my_center|LOCUS_01130 104203 105411 gene locus_tag LOCUS_01140 104203 105411 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048176563.1 protein_id gnl|my_center|LOCUS_01140 105596 106438 gene locus_tag LOCUS_01150 105596 106438 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806072.1 protein_id gnl|my_center|LOCUS_01150 106536 107063 gene locus_tag LOCUS_01160 106536 107063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 107229 108806 gene locus_tag LOCUS_01170 107229 108806 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_01170 109970 109377 gene locus_tag LOCUS_01180 109970 109377 CDS product DUF3782 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763642.1 protein_id gnl|my_center|LOCUS_01180 111600 110281 gene locus_tag LOCUS_01190 111600 110281 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042680609.1 protein_id gnl|my_center|LOCUS_01190 111933 112397 gene locus_tag LOCUS_01200 111933 112397 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146602.1 protein_id gnl|my_center|LOCUS_01200 112398 113405 gene locus_tag LOCUS_01210 112398 113405 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867784.1 protein_id gnl|my_center|LOCUS_01210 113410 114183 gene locus_tag LOCUS_01220 113410 114183 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250096.1 protein_id gnl|my_center|LOCUS_01220 115019 114453 gene locus_tag LOCUS_01230 115019 114453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 115291 115019 gene locus_tag LOCUS_01240 115291 115019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 115864 115700 gene locus_tag LOCUS_01250 115864 115700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01250 116953 116075 gene locus_tag LOCUS_01260 116953 116075 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868024.1 protein_id gnl|my_center|LOCUS_01260 117595 117074 gene locus_tag LOCUS_01270 117595 117074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 118246 117680 gene locus_tag LOCUS_01280 118246 117680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 120365 118377 gene locus_tag LOCUS_01290 120365 118377 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 protein_id gnl|my_center|LOCUS_01290 121465 120494 gene locus_tag LOCUS_01300 121465 120494 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249654.1 protein_id gnl|my_center|LOCUS_01300 121901 121599 gene locus_tag LOCUS_01310 121901 121599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 122153 121902 gene locus_tag LOCUS_01320 122153 121902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 122264 125056 gene locus_tag LOCUS_01330 122264 125056 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762372.1 protein_id gnl|my_center|LOCUS_01330 125600 125058 gene locus_tag LOCUS_01340 125600 125058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 126291 125590 gene locus_tag LOCUS_01350 126291 125590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 128000 126288 gene locus_tag LOCUS_01360 128000 126288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 128054 128734 gene locus_tag LOCUS_01370 128054 128734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 128931 130691 gene locus_tag LOCUS_01380 128931 130691 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878912.1 protein_id gnl|my_center|LOCUS_01380 131049 131789 gene locus_tag LOCUS_01390 131049 131789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 131786 132196 gene locus_tag LOCUS_01400 131786 132196 CDS product desampylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903329.1 protein_id gnl|my_center|LOCUS_01400 132238 133239 gene locus_tag LOCUS_01410 gene ilvA 132238 133239 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_01410 134032 133244 gene locus_tag LOCUS_01420 134032 133244 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249187.1 protein_id gnl|my_center|LOCUS_01420 134152 134766 gene locus_tag LOCUS_01430 134152 134766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 135466 136605 gene locus_tag LOCUS_01440 135466 136605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 137262 136606 gene locus_tag LOCUS_01450 137262 136606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 137474 138760 gene locus_tag LOCUS_01460 137474 138760 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762402.1 protein_id gnl|my_center|LOCUS_01460 138757 139053 gene locus_tag LOCUS_01470 138757 139053 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762401.1 protein_id gnl|my_center|LOCUS_01470 139066 139869 gene locus_tag LOCUS_01480 139066 139869 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762400.1 protein_id gnl|my_center|LOCUS_01480 139879 140925 gene locus_tag LOCUS_01490 139879 140925 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762399.1 protein_id gnl|my_center|LOCUS_01490 141429 141722 gene locus_tag LOCUS_01500 141429 141722 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546611.1 protein_id gnl|my_center|LOCUS_01500 141795 142064 gene locus_tag LOCUS_01510 141795 142064 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546363.1 protein_id gnl|my_center|LOCUS_01510 142285 142533 gene locus_tag LOCUS_01520 142285 142533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 142637 143029 gene locus_tag LOCUS_01530 142637 143029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01530 143131 143505 gene locus_tag LOCUS_01540 143131 143505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01540 143874 145199 gene locus_tag LOCUS_01550 143874 145199 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809685.1 protein_id gnl|my_center|LOCUS_01550 145235 146101 gene locus_tag LOCUS_01560 145235 146101 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_01560 146098 147060 gene locus_tag LOCUS_01570 146098 147060 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727510.1 protein_id gnl|my_center|LOCUS_01570 147057 147935 gene locus_tag LOCUS_01580 147057 147935 CDS product DUF6282 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007717423.1 protein_id gnl|my_center|LOCUS_01580 148636 147932 gene locus_tag LOCUS_01590 148636 147932 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 protein_id gnl|my_center|LOCUS_01590 149369 148629 gene locus_tag LOCUS_01600 149369 148629 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545387.1 protein_id gnl|my_center|LOCUS_01600 149607 150269 gene locus_tag LOCUS_01610 149607 150269 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435816.1 protein_id gnl|my_center|LOCUS_01610 151439 150330 gene locus_tag LOCUS_01620 151439 150330 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250406.1 protein_id gnl|my_center|LOCUS_01620 151905 151570 gene locus_tag LOCUS_01630 151905 151570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 153661 151907 gene locus_tag LOCUS_01640 153661 151907 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393464.1 protein_id gnl|my_center|LOCUS_01640 155752 153665 gene locus_tag LOCUS_01650 155752 153665 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_01650 156798 155830 gene locus_tag LOCUS_01660 gene appF 156798 155830 CDS product oligopeptide ABC transporter ATP-binding protein AppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232964.1 protein_id gnl|my_center|LOCUS_01660 157783 156803 gene locus_tag LOCUS_01670 157783 156803 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867269.1 protein_id gnl|my_center|LOCUS_01670 158685 157795 gene locus_tag LOCUS_01680 158685 157795 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383587.1 protein_id gnl|my_center|LOCUS_01680 159739 158696 gene locus_tag LOCUS_01690 159739 158696 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311992.1 protein_id gnl|my_center|LOCUS_01690 161610 159847 gene locus_tag LOCUS_01700 161610 159847 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385666.1 protein_id gnl|my_center|LOCUS_01700 161918 162745 gene locus_tag LOCUS_01710 161918 162745 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242998.1 protein_id gnl|my_center|LOCUS_01710 163214 164881 gene locus_tag LOCUS_01720 163214 164881 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762356.1 protein_id gnl|my_center|LOCUS_01720 164924 165934 gene locus_tag LOCUS_01730 164924 165934 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064459.1 protein_id gnl|my_center|LOCUS_01730 165945 166802 gene locus_tag LOCUS_01740 165945 166802 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879265.1 protein_id gnl|my_center|LOCUS_01740 166804 167754 gene locus_tag LOCUS_01750 166804 167754 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879266.1 protein_id gnl|my_center|LOCUS_01750 167761 168738 gene locus_tag LOCUS_01760 167761 168738 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080230.1 protein_id gnl|my_center|LOCUS_01760 169244 170104 gene locus_tag LOCUS_01770 169244 170104 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122036.1 protein_id gnl|my_center|LOCUS_01770 170476 170324 gene locus_tag LOCUS_01780 170476 170324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 170457 171593 gene locus_tag LOCUS_01790 170457 171593 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_01790 171671 172555 gene locus_tag LOCUS_01800 171671 172555 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_01800 172568 173527 gene locus_tag LOCUS_01810 172568 173527 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965773.1 protein_id gnl|my_center|LOCUS_01810 173524 174243 gene locus_tag LOCUS_01820 173524 174243 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003488339.1 protein_id gnl|my_center|LOCUS_01820 174248 174958 gene locus_tag LOCUS_01830 174248 174958 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763250.1 protein_id gnl|my_center|LOCUS_01830 175149 174937 gene locus_tag LOCUS_01840 175149 174937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 175412 177184 gene locus_tag LOCUS_01850 gene aor 175412 177184 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868080.1 protein_id gnl|my_center|LOCUS_01850 177312 178502 gene locus_tag LOCUS_01860 177312 178502 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258523.1 protein_id gnl|my_center|LOCUS_01860 178502 179728 gene locus_tag LOCUS_01870 178502 179728 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870830.1 protein_id gnl|my_center|LOCUS_01870 179725 180156 gene locus_tag LOCUS_01880 179725 180156 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020302.1 protein_id gnl|my_center|LOCUS_01880 181271 180159 gene locus_tag LOCUS_01890 181271 180159 CDS product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972789.1 protein_id gnl|my_center|LOCUS_01890 182811 181489 gene locus_tag LOCUS_01900 182811 181489 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021092.1 protein_id gnl|my_center|LOCUS_01900 183544 183200 gene locus_tag LOCUS_01910 183544 183200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 183826 183581 gene locus_tag LOCUS_01920 183826 183581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 184077 184559 gene locus_tag LOCUS_01930 184077 184559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 184611 185489 gene locus_tag LOCUS_01940 184611 185489 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867974.1 protein_id gnl|my_center|LOCUS_01940 185570 186496 gene locus_tag LOCUS_01950 185570 186496 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021606.1 protein_id gnl|my_center|LOCUS_01950 186501 187310 gene locus_tag LOCUS_01960 186501 187310 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065164.1 protein_id gnl|my_center|LOCUS_01960 187470 188048 gene locus_tag LOCUS_01970 187470 188048 CDS product DUF4125 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065189580.1 protein_id gnl|my_center|LOCUS_01970 189552 188083 gene locus_tag LOCUS_01980 gene pyk 189552 188083 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584142.1 protein_id gnl|my_center|LOCUS_01980 190386 189574 gene locus_tag LOCUS_01990 190386 189574 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250628.1 protein_id gnl|my_center|LOCUS_01990 190683 190946 gene locus_tag LOCUS_02000 190683 190946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02000 191603 191271 gene locus_tag LOCUS_02010 191603 191271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 192020 191709 gene locus_tag LOCUS_02020 192020 191709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 192840 192082 gene locus_tag LOCUS_02030 192840 192082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 193826 193053 gene locus_tag LOCUS_02040 193826 193053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 194394 195488 gene locus_tag LOCUS_02050 194394 195488 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965676.1 protein_id gnl|my_center|LOCUS_02050 196967 195651 gene locus_tag LOCUS_02060 196967 195651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 197408 197626 gene locus_tag LOCUS_02070 197408 197626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 197629 198402 gene locus_tag LOCUS_02080 197629 198402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 198419 200137 gene locus_tag LOCUS_02090 198419 200137 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460552.1 protein_id gnl|my_center|LOCUS_02090 200134 201000 gene locus_tag LOCUS_02100 200134 201000 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148083.1 protein_id gnl|my_center|LOCUS_02100 201616 204306 gene locus_tag LOCUS_02110 201616 204306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 204577 204368 gene locus_tag LOCUS_02120 204577 204368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 206384 206157 gene locus_tag LOCUS_02130 206384 206157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 206479 206973 gene locus_tag LOCUS_02140 206479 206973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 207970 207398 gene locus_tag LOCUS_02150 207970 207398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 209455 208802 gene locus_tag LOCUS_02160 209455 208802 CDS product DUF3782 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763642.1 protein_id gnl|my_center|LOCUS_02160 210452 211759 gene locus_tag LOCUS_02170 210452 211759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 211764 212834 gene locus_tag LOCUS_02180 211764 212834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 213583 212990 gene locus_tag LOCUS_02190 213583 212990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 213683 214000 gene locus_tag LOCUS_02200 213683 214000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 213988 214389 gene locus_tag LOCUS_02210 213988 214389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 215462 214695 gene locus_tag LOCUS_02220 215462 214695 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898500.1 protein_id gnl|my_center|LOCUS_02220 216331 215849 gene locus_tag LOCUS_02230 gene sixA 216331 215849 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878502.1 protein_id gnl|my_center|LOCUS_02230 216447 216779 gene locus_tag LOCUS_02240 216447 216779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 216754 217182 gene locus_tag LOCUS_02250 216754 217182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 217446 218045 gene locus_tag LOCUS_02260 217446 218045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 219104 218112 gene locus_tag LOCUS_02270 219104 218112 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209638.1 protein_id gnl|my_center|LOCUS_02270 219342 219160 gene locus_tag LOCUS_02280 219342 219160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 219509 219339 gene locus_tag LOCUS_02290 219509 219339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 219715 220320 gene locus_tag LOCUS_02300 219715 220320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 220508 221254 gene locus_tag LOCUS_02310 220508 221254 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289375.1 protein_id gnl|my_center|LOCUS_02310 221829 221329 gene locus_tag LOCUS_02320 221829 221329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 223419 222034 gene locus_tag LOCUS_02330 223419 222034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 224014 223421 gene locus_tag LOCUS_02340 224014 223421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 224076 224651 gene locus_tag LOCUS_02350 224076 224651 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979649.1 protein_id gnl|my_center|LOCUS_02350 225553 224885 gene locus_tag LOCUS_02360 225553 224885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 226087 226257 gene locus_tag LOCUS_02370 226087 226257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 226244 226549 gene locus_tag LOCUS_02380 gene crn3 226244 226549 CDS product CRISPR-associated ring nuclease Crn3/Csx3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582986.1 protein_id gnl|my_center|LOCUS_02380 226546 227295 gene locus_tag LOCUS_02390 226546 227295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 227292 227828 gene locus_tag LOCUS_02400 227292 227828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 228177 228665 gene locus_tag LOCUS_02410 gene tsaA 228177 228665 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249662.1 protein_id gnl|my_center|LOCUS_02410 228930 229322 gene locus_tag LOCUS_02420 228930 229322 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878097.1 protein_id gnl|my_center|LOCUS_02420 229309 229692 gene locus_tag LOCUS_02430 229309 229692 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846477.1 protein_id gnl|my_center|LOCUS_02430 229955 230236 gene locus_tag LOCUS_02440 229955 230236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 230626 230423 gene locus_tag LOCUS_02450 230626 230423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 231129 231401 gene locus_tag LOCUS_02460 231129 231401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 231443 231568 gene locus_tag LOCUS_02470 231443 231568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 232215 231850 gene locus_tag LOCUS_02480 232215 231850 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846392.1 protein_id gnl|my_center|LOCUS_02480 232406 232197 gene locus_tag LOCUS_02490 232406 232197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 232863 232699 gene locus_tag LOCUS_02500 232863 232699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 233333 232935 gene locus_tag LOCUS_02510 233333 232935 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980076.1 protein_id gnl|my_center|LOCUS_02510 233638 233339 gene locus_tag LOCUS_02520 233638 233339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 233806 234054 gene locus_tag LOCUS_02530 233806 234054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 234079 234327 gene locus_tag LOCUS_02540 234079 234327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 234315 234761 gene locus_tag LOCUS_02550 234315 234761 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846119.1 protein_id gnl|my_center|LOCUS_02550 235353 234952 gene locus_tag LOCUS_02560 235353 234952 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249949.1 protein_id gnl|my_center|LOCUS_02560 235604 235350 gene locus_tag LOCUS_02570 235604 235350 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013906585.1 protein_id gnl|my_center|LOCUS_02570 235900 236076 gene locus_tag LOCUS_02580 235900 236076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 237335 236370 gene locus_tag LOCUS_02590 237335 236370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 238787 237495 gene locus_tag LOCUS_02600 238787 237495 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875835.1 protein_id gnl|my_center|LOCUS_02600 239820 239389 gene locus_tag LOCUS_02610 239820 239389 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742605.1 protein_id gnl|my_center|LOCUS_02610 240035 239817 gene locus_tag LOCUS_02620 240035 239817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 >Feature sequence02 473 132 gene locus_tag LOCUS_02630 473 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 570 494 gene locus_tag LOCUS_t00010 570 494 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 835 1857 gene locus_tag LOCUS_02640 835 1857 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878796.1 protein_id gnl|my_center|LOCUS_02640 1900 2043 gene locus_tag LOCUS_02650 1900 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 2045 2614 gene locus_tag LOCUS_02660 2045 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 2767 3402 gene locus_tag LOCUS_02670 2767 3402 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742650.1 protein_id gnl|my_center|LOCUS_02670 3481 4578 gene locus_tag LOCUS_02680 gene fbp 3481 4578 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846263.1 protein_id gnl|my_center|LOCUS_02680 5245 4565 gene locus_tag LOCUS_02690 gene tpiA 5245 4565 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868855.1 protein_id gnl|my_center|LOCUS_02690 5357 6163 gene locus_tag LOCUS_02700 5357 6163 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023289.1 protein_id gnl|my_center|LOCUS_02700 6168 6779 gene locus_tag LOCUS_02710 6168 6779 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879461.1 protein_id gnl|my_center|LOCUS_02710 6781 7977 gene locus_tag LOCUS_02720 6781 7977 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066094.1 protein_id gnl|my_center|LOCUS_02720 8447 7971 gene locus_tag LOCUS_02730 8447 7971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 10050 8431 gene locus_tag LOCUS_02740 gene lysS 10050 8431 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583287.1 protein_id gnl|my_center|LOCUS_02740 10412 10131 gene locus_tag LOCUS_02750 gene albA 10412 10131 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879448.1 protein_id gnl|my_center|LOCUS_02750 10769 10500 gene locus_tag LOCUS_02760 10769 10500 CDS product DNA-directed RNA polymerase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846508.1 protein_id gnl|my_center|LOCUS_02760 12409 10766 gene locus_tag LOCUS_02770 gene thsB 12409 10766 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867141.1 protein_id gnl|my_center|LOCUS_02770 12561 15455 gene locus_tag LOCUS_02780 12561 15455 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762372.1 protein_id gnl|my_center|LOCUS_02780 16077 15448 gene locus_tag LOCUS_02790 16077 15448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 16357 16064 gene locus_tag LOCUS_02800 16357 16064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 16593 16354 gene locus_tag LOCUS_02810 16593 16354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 17960 16590 gene locus_tag LOCUS_02820 gene wecB 17960 16590 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060909.1 protein_id gnl|my_center|LOCUS_02820 18040 20436 gene locus_tag LOCUS_02830 18040 20436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 20510 20836 gene locus_tag LOCUS_02840 20510 20836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 21955 20912 gene locus_tag LOCUS_02850 21955 20912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 22572 21955 gene locus_tag LOCUS_02860 22572 21955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 23983 22583 gene locus_tag LOCUS_02870 23983 22583 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_02870 25772 23985 gene locus_tag LOCUS_02880 25772 23985 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250553.1 protein_id gnl|my_center|LOCUS_02880 26417 25773 gene locus_tag LOCUS_02890 26417 25773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 26706 26410 gene locus_tag LOCUS_02900 26706 26410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 27060 26716 gene locus_tag LOCUS_02910 27060 26716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 27123 27210 gene locus_tag LOCUS_t00020 27123 27210 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 27252 27821 gene locus_tag LOCUS_02920 27252 27821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 29120 27798 gene locus_tag LOCUS_02930 29120 27798 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583295.1 protein_id gnl|my_center|LOCUS_02930 29188 30771 gene locus_tag LOCUS_02940 29188 30771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 31641 30754 gene locus_tag LOCUS_02950 31641 30754 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846976.1 protein_id gnl|my_center|LOCUS_02950 32867 31638 gene locus_tag LOCUS_02960 gene porA 32867 31638 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496445.1 protein_id gnl|my_center|LOCUS_02960 33152 32880 gene locus_tag LOCUS_02970 33152 32880 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846589.1 protein_id gnl|my_center|LOCUS_02970 33497 33243 gene locus_tag LOCUS_02980 33497 33243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 33769 34512 gene locus_tag LOCUS_02990 gene speB 33769 34512 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_02990 35052 34420 gene locus_tag LOCUS_03000 35052 34420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 36151 35045 gene locus_tag LOCUS_03010 gene hflX 36151 35045 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762823.1 protein_id gnl|my_center|LOCUS_03010 37556 36222 gene locus_tag LOCUS_03020 37556 36222 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877006.1 protein_id gnl|my_center|LOCUS_03020 37628 38926 gene locus_tag LOCUS_03030 gene asnS 37628 38926 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249710.1 protein_id gnl|my_center|LOCUS_03030 39573 38923 gene locus_tag LOCUS_03040 39573 38923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 41256 39580 gene locus_tag LOCUS_03050 41256 39580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 42331 41249 gene locus_tag LOCUS_03060 gene rtcA 42331 41249 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762505.1 protein_id gnl|my_center|LOCUS_03060 42369 42974 gene locus_tag LOCUS_03070 42369 42974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 42958 44238 gene locus_tag LOCUS_03080 42958 44238 CDS product actin/actin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762638.1 protein_id gnl|my_center|LOCUS_03080 44984 44235 gene locus_tag LOCUS_03090 44984 44235 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318933.1 protein_id gnl|my_center|LOCUS_03090 46030 44963 gene locus_tag LOCUS_03100 46030 44963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 46099 47340 gene locus_tag LOCUS_03110 46099 47340 CDS product Clp1/GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496787.1 protein_id gnl|my_center|LOCUS_03110 47337 48722 gene locus_tag LOCUS_03120 47337 48722 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004069588.1 protein_id gnl|my_center|LOCUS_03120 48789 49097 gene locus_tag LOCUS_03130 48789 49097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 49097 49831 gene locus_tag LOCUS_03140 49097 49831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 49873 50259 gene locus_tag LOCUS_03150 49873 50259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 50240 50611 gene locus_tag LOCUS_03160 50240 50611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 50659 50732 gene locus_tag LOCUS_t00030 50659 50732 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 50942 51340 gene locus_tag LOCUS_03170 50942 51340 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978835.1 protein_id gnl|my_center|LOCUS_03170 51716 52441 gene locus_tag LOCUS_03180 51716 52441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 53111 52446 gene locus_tag LOCUS_03190 53111 52446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 54056 53307 gene locus_tag LOCUS_03200 54056 53307 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867382.1 protein_id gnl|my_center|LOCUS_03200 54117 55499 gene locus_tag LOCUS_03210 54117 55499 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762251.1 protein_id gnl|my_center|LOCUS_03210 56111 55491 gene locus_tag LOCUS_03220 56111 55491 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762690.1 protein_id gnl|my_center|LOCUS_03220 56793 56092 gene locus_tag LOCUS_03230 56793 56092 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258849.1 protein_id gnl|my_center|LOCUS_03230 57464 56904 gene locus_tag LOCUS_03240 57464 56904 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060957.1 protein_id gnl|my_center|LOCUS_03240 57789 57454 gene locus_tag LOCUS_03250 57789 57454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 58638 57793 gene locus_tag LOCUS_03260 58638 57793 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867632.1 protein_id gnl|my_center|LOCUS_03260 59791 58643 gene locus_tag LOCUS_03270 59791 58643 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867631.1 protein_id gnl|my_center|LOCUS_03270 60331 59843 gene locus_tag LOCUS_03280 60331 59843 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061166.1 protein_id gnl|my_center|LOCUS_03280 60942 60286 gene locus_tag LOCUS_03290 60942 60286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 61961 60939 gene locus_tag LOCUS_03300 61961 60939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 62020 63102 gene locus_tag LOCUS_03310 62020 63102 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163568.1 protein_id gnl|my_center|LOCUS_03310 63099 64535 gene locus_tag LOCUS_03320 63099 64535 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877033.1 protein_id gnl|my_center|LOCUS_03320 65279 64572 gene locus_tag LOCUS_03330 65279 64572 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 protein_id gnl|my_center|LOCUS_03330 66009 65263 gene locus_tag LOCUS_03340 66009 65263 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878326.1 protein_id gnl|my_center|LOCUS_03340 66971 66009 gene locus_tag LOCUS_03350 66971 66009 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948215.1 protein_id gnl|my_center|LOCUS_03350 67885 66971 gene locus_tag LOCUS_03360 67885 66971 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_03360 69155 67944 gene locus_tag LOCUS_03370 69155 67944 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_03370 69474 70415 gene locus_tag LOCUS_03380 gene argF 69474 70415 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584136.1 protein_id gnl|my_center|LOCUS_03380 70527 71465 gene locus_tag LOCUS_03390 gene arcC 70527 71465 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251108.1 protein_id gnl|my_center|LOCUS_03390 72767 71481 gene locus_tag LOCUS_03400 72767 71481 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064354.1 protein_id gnl|my_center|LOCUS_03400 73547 73143 gene locus_tag LOCUS_03410 73547 73143 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251148.1 protein_id gnl|my_center|LOCUS_03410 73813 73544 gene locus_tag LOCUS_03420 73813 73544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 74027 74722 gene locus_tag LOCUS_03430 74027 74722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 75916 74702 gene locus_tag LOCUS_03440 gene hisS 75916 74702 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258794.1 protein_id gnl|my_center|LOCUS_03440 76983 75994 gene locus_tag LOCUS_03450 76983 75994 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052886479.1 protein_id gnl|my_center|LOCUS_03450 78422 77157 gene locus_tag LOCUS_03460 gene hisD 78422 77157 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461463.1 protein_id gnl|my_center|LOCUS_03460 78526 78924 gene locus_tag LOCUS_03470 78526 78924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 79435 78890 gene locus_tag LOCUS_03480 79435 78890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 80967 79432 gene locus_tag LOCUS_03490 80967 79432 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869054.1 protein_id gnl|my_center|LOCUS_03490 81110 81811 gene locus_tag LOCUS_03500 81110 81811 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_03500 81888 83396 gene locus_tag LOCUS_03510 81888 83396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 83383 84597 gene locus_tag LOCUS_03520 83383 84597 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256884.1 protein_id gnl|my_center|LOCUS_03520 85014 84622 gene locus_tag LOCUS_03530 85014 84622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 85108 85034 gene locus_tag LOCUS_t00040 85108 85034 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 86476 85175 gene locus_tag LOCUS_03540 86476 85175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 86967 87467 gene locus_tag LOCUS_03550 86967 87467 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197463606.1 protein_id gnl|my_center|LOCUS_03550 88388 87462 gene locus_tag LOCUS_03560 88388 87462 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250104.1 protein_id gnl|my_center|LOCUS_03560 88446 88604 gene locus_tag LOCUS_03570 88446 88604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 88615 88905 gene locus_tag LOCUS_03580 88615 88905 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868393.1 protein_id gnl|my_center|LOCUS_03580 88908 89486 gene locus_tag LOCUS_03590 88908 89486 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583777.1 protein_id gnl|my_center|LOCUS_03590 89470 91002 gene locus_tag LOCUS_03600 89470 91002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 91723 90992 gene locus_tag LOCUS_03610 91723 90992 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763001.1 protein_id gnl|my_center|LOCUS_03610 91997 91689 gene locus_tag LOCUS_03620 91997 91689 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880624.1 protein_id gnl|my_center|LOCUS_03620 92728 92009 gene locus_tag LOCUS_03630 92728 92009 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978563.1 protein_id gnl|my_center|LOCUS_03630 92871 93140 gene locus_tag LOCUS_03640 92871 93140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 93340 93753 gene locus_tag LOCUS_03650 93340 93753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 94042 94299 gene locus_tag LOCUS_03660 94042 94299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 95358 94366 gene locus_tag LOCUS_03670 95358 94366 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582674.1 protein_id gnl|my_center|LOCUS_03670 96593 95355 gene locus_tag LOCUS_03680 96593 95355 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582673.1 protein_id gnl|my_center|LOCUS_03680 96878 96603 gene locus_tag LOCUS_03690 96878 96603 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582672.1 protein_id gnl|my_center|LOCUS_03690 97468 96875 gene locus_tag LOCUS_03700 97468 96875 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250928.1 protein_id gnl|my_center|LOCUS_03700 98279 97677 gene locus_tag LOCUS_03710 98279 97677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 98337 99056 gene locus_tag LOCUS_03720 98337 99056 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867285.1 protein_id gnl|my_center|LOCUS_03720 99060 99953 gene locus_tag LOCUS_03730 gene surE 99060 99953 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020163.1 protein_id gnl|my_center|LOCUS_03730 100346 99933 gene locus_tag LOCUS_03740 100346 99933 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868380.1 protein_id gnl|my_center|LOCUS_03740 101340 100348 gene locus_tag LOCUS_03750 101340 100348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 102182 101415 gene locus_tag LOCUS_03760 102182 101415 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020689.1 protein_id gnl|my_center|LOCUS_03760 102248 103570 gene locus_tag LOCUS_03770 102248 103570 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867775.1 protein_id gnl|my_center|LOCUS_03770 103816 103559 gene locus_tag LOCUS_03780 103816 103559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 104847 103813 gene locus_tag LOCUS_03790 104847 103813 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762127.1 protein_id gnl|my_center|LOCUS_03790 105223 104828 gene locus_tag LOCUS_03800 105223 104828 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250445.1 protein_id gnl|my_center|LOCUS_03800 105962 105198 gene locus_tag LOCUS_03810 105962 105198 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250053.1 protein_id gnl|my_center|LOCUS_03810 106024 107322 gene locus_tag LOCUS_03820 106024 107322 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249817.1 protein_id gnl|my_center|LOCUS_03820 108306 107311 gene locus_tag LOCUS_03830 108306 107311 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021969.1 protein_id gnl|my_center|LOCUS_03830 108520 108272 gene locus_tag LOCUS_03840 108520 108272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 108543 109244 gene locus_tag LOCUS_03850 108543 109244 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763299.1 protein_id gnl|my_center|LOCUS_03850 110125 109241 gene locus_tag LOCUS_03860 gene radA 110125 109241 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762467.1 protein_id gnl|my_center|LOCUS_03860 110798 110379 gene locus_tag LOCUS_03870 110798 110379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 111687 110791 gene locus_tag LOCUS_03880 111687 110791 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320027.1 protein_id gnl|my_center|LOCUS_03880 111738 112331 gene locus_tag LOCUS_03890 gene tmk 111738 112331 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250354.1 protein_id gnl|my_center|LOCUS_03890 112328 113239 gene locus_tag LOCUS_03900 112328 113239 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762863.1 protein_id gnl|my_center|LOCUS_03900 113324 114322 gene locus_tag LOCUS_03910 113324 114322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 114397 115572 gene locus_tag LOCUS_03920 114397 115572 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_03920 115738 115559 gene locus_tag LOCUS_03930 115738 115559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 116839 116114 gene locus_tag LOCUS_03940 116839 116114 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_03940 117173 116841 gene locus_tag LOCUS_03950 117173 116841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 118292 117252 gene locus_tag LOCUS_03960 118292 117252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 120745 118292 gene locus_tag LOCUS_03970 120745 118292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 122080 120803 gene locus_tag LOCUS_03980 gene aspS 122080 120803 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249447.1 protein_id gnl|my_center|LOCUS_03980 125022 122059 gene locus_tag LOCUS_03990 gene ileS 125022 122059 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978404.1 protein_id gnl|my_center|LOCUS_03990 125105 125218 gene locus_tag LOCUS_r00010 125105 125218 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 126344 125355 gene locus_tag LOCUS_04000 gene thiI 126344 125355 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249323.1 protein_id gnl|my_center|LOCUS_04000 126401 128620 gene locus_tag LOCUS_04010 126401 128620 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868838.1 protein_id gnl|my_center|LOCUS_04010 128935 128627 gene locus_tag LOCUS_04020 128935 128627 CDS product 30S ribosomal protein S26e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762572.1 protein_id gnl|my_center|LOCUS_04020 130538 129099 gene locus_tag LOCUS_04030 gene proS 130538 129099 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249505.1 protein_id gnl|my_center|LOCUS_04030 131184 130594 gene locus_tag LOCUS_04040 131184 130594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 131110 131427 gene locus_tag LOCUS_04050 131110 131427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 131396 132028 gene locus_tag LOCUS_04060 131396 132028 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980156.1 protein_id gnl|my_center|LOCUS_04060 133110 132025 gene locus_tag LOCUS_04070 133110 132025 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869669.1 protein_id gnl|my_center|LOCUS_04070 134327 133107 gene locus_tag LOCUS_04080 gene dnaG 134327 133107 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867599.1 protein_id gnl|my_center|LOCUS_04080 134660 134863 gene locus_tag LOCUS_04090 134660 134863 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251242.1 protein_id gnl|my_center|LOCUS_04090 134918 136348 gene locus_tag LOCUS_04100 134918 136348 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876469.1 protein_id gnl|my_center|LOCUS_04100 137430 136345 gene locus_tag LOCUS_04110 137430 136345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 138776 137436 gene locus_tag LOCUS_04120 138776 137436 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930764.1 protein_id gnl|my_center|LOCUS_04120 138848 139948 gene locus_tag LOCUS_04130 gene gcvT 138848 139948 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583865.1 protein_id gnl|my_center|LOCUS_04130 140273 139941 gene locus_tag LOCUS_04140 140273 139941 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846880.1 protein_id gnl|my_center|LOCUS_04140 140479 140270 gene locus_tag LOCUS_04150 140479 140270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 140742 140539 gene locus_tag LOCUS_04160 140742 140539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 141532 140723 gene locus_tag LOCUS_04170 141532 140723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 142002 141529 gene locus_tag LOCUS_04180 gene rplV 142002 141529 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064485.1 protein_id gnl|my_center|LOCUS_04180 142051 142755 gene locus_tag LOCUS_04190 142051 142755 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877951.1 protein_id gnl|my_center|LOCUS_04190 143716 142745 gene locus_tag LOCUS_04200 143716 142745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 143783 146275 gene locus_tag LOCUS_04210 143783 146275 CDS product DNA-directed DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979471.1 protein_id gnl|my_center|LOCUS_04210 148150 146249 gene locus_tag LOCUS_04220 gene gatE 148150 146249 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869511.1 protein_id gnl|my_center|LOCUS_04220 149483 148140 gene locus_tag LOCUS_04230 gene gatD 149483 148140 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249859.1 protein_id gnl|my_center|LOCUS_04230 149934 149524 gene locus_tag LOCUS_04240 149934 149524 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868486.1 protein_id gnl|my_center|LOCUS_04240 151076 149937 gene locus_tag LOCUS_04250 151076 149937 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868485.1 protein_id gnl|my_center|LOCUS_04250 152175 151090 gene locus_tag LOCUS_04260 152175 151090 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249136.1 protein_id gnl|my_center|LOCUS_04260 152883 152407 gene locus_tag LOCUS_04270 152883 152407 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583841.1 protein_id gnl|my_center|LOCUS_04270 153547 152912 gene locus_tag LOCUS_04280 153547 152912 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496597.1 protein_id gnl|my_center|LOCUS_04280 154169 153552 gene locus_tag LOCUS_04290 154169 153552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 155054 154320 gene locus_tag LOCUS_04300 155054 154320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 156130 155264 gene locus_tag LOCUS_04310 gene sdhB 156130 155264 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878185.1 protein_id gnl|my_center|LOCUS_04310 156463 156143 gene locus_tag LOCUS_04320 156463 156143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 156899 156477 gene locus_tag LOCUS_04330 156899 156477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 158627 156909 gene locus_tag LOCUS_04340 158627 156909 CDS product succinate dehydrogenase/fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878184.1 protein_id gnl|my_center|LOCUS_04340 159027 159533 gene locus_tag LOCUS_04350 159027 159533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 159533 160942 gene locus_tag LOCUS_04360 159533 160942 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979726.1 protein_id gnl|my_center|LOCUS_04360 161045 161818 gene locus_tag LOCUS_04370 161045 161818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 161936 162214 gene locus_tag LOCUS_04380 161936 162214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 162276 163904 gene locus_tag LOCUS_04390 gene pyrG 162276 163904 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250144.1 protein_id gnl|my_center|LOCUS_04390 165018 163891 gene locus_tag LOCUS_04400 165018 163891 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_04400 165062 166246 gene locus_tag LOCUS_04410 gene trm14 165062 166246 CDS product tRNA (guanine(6)-N2)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869937.1 protein_id gnl|my_center|LOCUS_04410 166828 166196 gene locus_tag LOCUS_04420 166828 166196 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762488.1 protein_id gnl|my_center|LOCUS_04420 167122 166844 gene locus_tag LOCUS_04430 167122 166844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 167292 167681 gene locus_tag LOCUS_04440 167292 167681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 168455 167937 gene locus_tag LOCUS_04450 168455 167937 CDS product ADP-ribose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880613.1 protein_id gnl|my_center|LOCUS_04450 168788 168507 gene locus_tag LOCUS_04460 168788 168507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 169480 168788 gene locus_tag LOCUS_04470 169480 168788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 169541 169801 gene locus_tag LOCUS_04480 169541 169801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 170480 169749 gene locus_tag LOCUS_04490 170480 169749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 171172 170531 gene locus_tag LOCUS_04500 171172 170531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 171441 171172 gene locus_tag LOCUS_04510 171441 171172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 171479 172444 gene locus_tag LOCUS_04520 171479 172444 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979315.1 protein_id gnl|my_center|LOCUS_04520 172487 173617 gene locus_tag LOCUS_04530 172487 173617 CDS product DUF1512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979465.1 protein_id gnl|my_center|LOCUS_04530 173617 174054 gene locus_tag LOCUS_04540 173617 174054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 174061 174519 gene locus_tag LOCUS_04550 174061 174519 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980328.1 protein_id gnl|my_center|LOCUS_04550 174503 175267 gene locus_tag LOCUS_04560 174503 175267 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761882.1 protein_id gnl|my_center|LOCUS_04560 176417 175242 gene locus_tag LOCUS_04570 176417 175242 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250432.1 protein_id gnl|my_center|LOCUS_04570 177767 176469 gene locus_tag LOCUS_04580 177767 176469 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887571.1 protein_id gnl|my_center|LOCUS_04580 178494 177757 gene locus_tag LOCUS_04590 178494 177757 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546238.1 protein_id gnl|my_center|LOCUS_04590 178554 179753 gene locus_tag LOCUS_04600 178554 179753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 179713 180399 gene locus_tag LOCUS_04610 179713 180399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 180896 180396 gene locus_tag LOCUS_04620 180896 180396 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979561.1 protein_id gnl|my_center|LOCUS_04620 181284 180898 gene locus_tag LOCUS_04630 181284 180898 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250212.1 protein_id gnl|my_center|LOCUS_04630 181370 182464 gene locus_tag LOCUS_04640 181370 182464 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 protein_id gnl|my_center|LOCUS_04640 183624 182461 gene locus_tag LOCUS_04650 183624 182461 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023953.1 protein_id gnl|my_center|LOCUS_04650 183998 183816 gene locus_tag LOCUS_04660 183998 183816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 184323 184084 gene locus_tag LOCUS_04670 184323 184084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 184520 184371 gene locus_tag LOCUS_04680 184520 184371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 184822 185772 gene locus_tag LOCUS_04690 184822 185772 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878506.1 protein_id gnl|my_center|LOCUS_04690 185773 186900 gene locus_tag LOCUS_04700 185773 186900 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393399.1 protein_id gnl|my_center|LOCUS_04700 186902 189391 gene locus_tag LOCUS_04710 186902 189391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 190819 189380 gene locus_tag LOCUS_04720 190819 189380 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249895.1 protein_id gnl|my_center|LOCUS_04720 191196 190972 gene locus_tag LOCUS_04730 gene hpkA 191196 190972 CDS product archaeal histone HpkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250364.1 protein_id gnl|my_center|LOCUS_04730 191387 191827 gene locus_tag LOCUS_04740 191387 191827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04740 192010 192321 gene locus_tag LOCUS_04750 192010 192321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04750 192323 192850 gene locus_tag LOCUS_04760 192323 192850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04760 193813 192851 gene locus_tag LOCUS_04770 193813 192851 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_04770 193904 194716 gene locus_tag LOCUS_04780 gene pheA 193904 194716 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038038884.1 protein_id gnl|my_center|LOCUS_04780 194745 196142 gene locus_tag LOCUS_04790 194745 196142 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249525.1 protein_id gnl|my_center|LOCUS_04790 196703 196209 gene locus_tag LOCUS_04800 196703 196209 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060842.1 protein_id gnl|my_center|LOCUS_04800 196990 196700 gene locus_tag LOCUS_04810 196990 196700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 197238 197441 gene locus_tag LOCUS_04820 197238 197441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 198757 197567 gene locus_tag LOCUS_04830 198757 197567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 200171 198750 gene locus_tag LOCUS_04840 200171 198750 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240545.1 protein_id gnl|my_center|LOCUS_04840 200318 201376 gene locus_tag LOCUS_04850 200318 201376 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920597.1 protein_id gnl|my_center|LOCUS_04850 202639 201377 gene locus_tag LOCUS_04860 202639 201377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 203318 202605 gene locus_tag LOCUS_04870 203318 202605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 204834 203395 gene locus_tag LOCUS_04880 gene guaB 204834 203395 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868777.1 protein_id gnl|my_center|LOCUS_04880 205609 205112 gene locus_tag LOCUS_04890 205609 205112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 206457 205510 gene locus_tag LOCUS_04900 206457 205510 CDS product tRNA (cytosine(49)-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249315.1 protein_id gnl|my_center|LOCUS_04900 206522 208234 gene locus_tag LOCUS_04910 206522 208234 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250359.1 protein_id gnl|my_center|LOCUS_04910 208369 211263 gene locus_tag LOCUS_04920 208369 211263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 214543 211247 gene locus_tag LOCUS_04930 gene rgy 214543 211247 CDS product reverse gyrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878524.1 protein_id gnl|my_center|LOCUS_04930 214637 215008 gene locus_tag LOCUS_04940 214637 215008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 215017 215235 gene locus_tag LOCUS_04950 215017 215235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 216382 215219 gene locus_tag LOCUS_04960 216382 215219 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868809.1 protein_id gnl|my_center|LOCUS_04960 217512 216385 gene locus_tag LOCUS_04970 217512 216385 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965395.1 protein_id gnl|my_center|LOCUS_04970 219163 217685 gene locus_tag LOCUS_04980 219163 217685 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060924.1 protein_id gnl|my_center|LOCUS_04980 219205 219444 gene locus_tag LOCUS_04990 219205 219444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 219660 219445 gene locus_tag LOCUS_05000 219660 219445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 220217 220293 gene locus_tag LOCUS_t00050 220217 220293 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 220331 221533 gene locus_tag LOCUS_05010 220331 221533 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250627.1 protein_id gnl|my_center|LOCUS_05010 222509 221535 gene locus_tag LOCUS_05020 222509 221535 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867665.1 protein_id gnl|my_center|LOCUS_05020 223008 224105 gene locus_tag LOCUS_05030 223008 224105 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881144.1 protein_id gnl|my_center|LOCUS_05030 224325 224095 gene locus_tag LOCUS_05040 224325 224095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 225034 224606 gene locus_tag LOCUS_05050 225034 224606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 226295 225180 gene locus_tag LOCUS_05060 226295 225180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 228292 226301 gene locus_tag LOCUS_05070 228292 226301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 228430 229317 gene locus_tag LOCUS_05080 228430 229317 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944001.1 protein_id gnl|my_center|LOCUS_05080 229663 230529 gene locus_tag LOCUS_05090 229663 230529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 >Feature sequence03 816 1964 gene locus_tag LOCUS_05100 gene cas1 816 1964 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256457.1 protein_id gnl|my_center|LOCUS_05100 2785 2429 gene locus_tag LOCUS_05110 2785 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 3053 2748 gene locus_tag LOCUS_05120 3053 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 3700 4017 gene locus_tag LOCUS_05130 3700 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 3965 4363 gene locus_tag LOCUS_05140 3965 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 5376 4687 gene locus_tag LOCUS_05150 5376 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 5640 5446 gene locus_tag LOCUS_05160 5640 5446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 5561 5887 gene locus_tag LOCUS_05170 5561 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 5968 6192 gene locus_tag LOCUS_05180 5968 6192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 6301 6990 gene locus_tag LOCUS_05190 6301 6990 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249663.1 protein_id gnl|my_center|LOCUS_05190 7195 7569 gene locus_tag LOCUS_05200 7195 7569 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879111.1 protein_id gnl|my_center|LOCUS_05200 7544 7903 gene locus_tag LOCUS_05210 7544 7903 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249177.1 protein_id gnl|my_center|LOCUS_05210 8818 8075 gene locus_tag LOCUS_05220 8818 8075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 9242 9589 gene locus_tag LOCUS_05230 9242 9589 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846402.1 protein_id gnl|my_center|LOCUS_05230 9534 9923 gene locus_tag LOCUS_05240 9534 9923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 10032 10913 gene locus_tag LOCUS_05250 10032 10913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 11860 10919 gene locus_tag LOCUS_05260 11860 10919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 12300 11920 gene locus_tag LOCUS_05270 12300 11920 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846810.1 protein_id gnl|my_center|LOCUS_05270 12679 12269 gene locus_tag LOCUS_05280 12679 12269 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980577.1 protein_id gnl|my_center|LOCUS_05280 13410 12817 gene locus_tag LOCUS_05290 13410 12817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 13301 13510 gene locus_tag LOCUS_05300 13301 13510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 14391 13555 gene locus_tag LOCUS_05310 14391 13555 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902202.1 protein_id gnl|my_center|LOCUS_05310 14998 14492 gene locus_tag LOCUS_05320 14998 14492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05320 15227 14985 gene locus_tag LOCUS_05330 15227 14985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05330 15956 15363 gene locus_tag LOCUS_05340 15956 15363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 17710 16145 gene locus_tag LOCUS_05350 17710 16145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 18294 19172 gene locus_tag LOCUS_05360 gene amrS 18294 19172 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879767.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05360 19289 19927 gene locus_tag LOCUS_05370 19289 19927 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251184.1 protein_id gnl|my_center|LOCUS_05370 20800 20000 gene locus_tag LOCUS_05380 20800 20000 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909160.1 protein_id gnl|my_center|LOCUS_05380 20937 22094 gene locus_tag LOCUS_05390 20937 22094 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503266.1 protein_id gnl|my_center|LOCUS_05390 22178 22558 gene locus_tag LOCUS_05400 22178 22558 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082362.1 protein_id gnl|my_center|LOCUS_05400 22722 23684 gene locus_tag LOCUS_05410 22722 23684 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978653.1 protein_id gnl|my_center|LOCUS_05410 23694 24527 gene locus_tag LOCUS_05420 23694 24527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 25501 24608 gene locus_tag LOCUS_05430 25501 24608 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146742.1 protein_id gnl|my_center|LOCUS_05430 27149 25536 gene locus_tag LOCUS_05440 27149 25536 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979926.1 protein_id gnl|my_center|LOCUS_05440 29735 27507 gene locus_tag LOCUS_05450 29735 27507 CDS product DUF3160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023262.1 protein_id gnl|my_center|LOCUS_05450 30445 29903 gene locus_tag LOCUS_05460 30445 29903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 31548 30454 gene locus_tag LOCUS_05470 31548 30454 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 protein_id gnl|my_center|LOCUS_05470 32711 31545 gene locus_tag LOCUS_05480 32711 31545 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867269.1 protein_id gnl|my_center|LOCUS_05480 33664 32717 gene locus_tag LOCUS_05490 33664 32717 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081440.1 protein_id gnl|my_center|LOCUS_05490 34708 33674 gene locus_tag LOCUS_05500 34708 33674 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081437.1 protein_id gnl|my_center|LOCUS_05500 36454 34781 gene locus_tag LOCUS_05510 36454 34781 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081506.1 protein_id gnl|my_center|LOCUS_05510 36465 36764 gene locus_tag LOCUS_05520 36465 36764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 37125 38258 gene locus_tag LOCUS_05530 37125 38258 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979714.1 protein_id gnl|my_center|LOCUS_05530 39445 38264 gene locus_tag LOCUS_05540 39445 38264 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812206.1 protein_id gnl|my_center|LOCUS_05540 40415 39450 gene locus_tag LOCUS_05550 40415 39450 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878312.1 protein_id gnl|my_center|LOCUS_05550 40727 41146 gene locus_tag LOCUS_05560 40727 41146 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878062.1 protein_id gnl|my_center|LOCUS_05560 41156 41401 gene locus_tag LOCUS_05570 41156 41401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 41520 42659 gene locus_tag LOCUS_05580 41520 42659 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256474.1 protein_id gnl|my_center|LOCUS_05580 42676 43107 gene locus_tag LOCUS_05590 42676 43107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 43788 43318 gene locus_tag LOCUS_05600 43788 43318 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 protein_id gnl|my_center|LOCUS_05600 44477 43857 gene locus_tag LOCUS_05610 44477 43857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 45245 44478 gene locus_tag LOCUS_05620 45245 44478 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762272.1 protein_id gnl|my_center|LOCUS_05620 45678 45920 gene locus_tag LOCUS_05630 45678 45920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 46567 45917 gene locus_tag LOCUS_05640 46567 45917 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902573.1 protein_id gnl|my_center|LOCUS_05640 46681 47031 gene locus_tag LOCUS_05650 46681 47031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 47028 47360 gene locus_tag LOCUS_05660 47028 47360 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022869.1 protein_id gnl|my_center|LOCUS_05660 47417 47713 gene locus_tag LOCUS_05670 47417 47713 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393974.1 protein_id gnl|my_center|LOCUS_05670 48775 47705 gene locus_tag LOCUS_05680 48775 47705 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763350.1 protein_id gnl|my_center|LOCUS_05680 49451 49032 gene locus_tag LOCUS_05690 49451 49032 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763571.1 protein_id gnl|my_center|LOCUS_05690 50363 49527 gene locus_tag LOCUS_05700 50363 49527 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249085.1 protein_id gnl|my_center|LOCUS_05700 51132 50422 gene locus_tag LOCUS_05710 51132 50422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 51871 51143 gene locus_tag LOCUS_05720 51871 51143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 52788 51868 gene locus_tag LOCUS_05730 52788 51868 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156007467.1 protein_id gnl|my_center|LOCUS_05730 53541 52852 gene locus_tag LOCUS_05740 gene alaXM 53541 52852 CDS product alanyl-tRNA editing protein AlaXM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846184.1 protein_id gnl|my_center|LOCUS_05740 53697 55112 gene locus_tag LOCUS_05750 53697 55112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 55198 55326 gene locus_tag LOCUS_05760 55198 55326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 55323 55703 gene locus_tag LOCUS_05770 55323 55703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 55705 55911 gene locus_tag LOCUS_05780 55705 55911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 55992 56288 gene locus_tag LOCUS_05790 55992 56288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 56289 57152 gene locus_tag LOCUS_05800 56289 57152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 57145 57465 gene locus_tag LOCUS_05810 57145 57465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 57581 58381 gene locus_tag LOCUS_05820 57581 58381 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868514.1 protein_id gnl|my_center|LOCUS_05820 58654 59961 gene locus_tag LOCUS_05830 58654 59961 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867786.1 protein_id gnl|my_center|LOCUS_05830 60241 61620 gene locus_tag LOCUS_05840 60241 61620 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942648.1 protein_id gnl|my_center|LOCUS_05840 61658 62548 gene locus_tag LOCUS_05850 61658 62548 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_05850 62550 63518 gene locus_tag LOCUS_05860 62550 63518 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965773.1 protein_id gnl|my_center|LOCUS_05860 63505 64233 gene locus_tag LOCUS_05870 63505 64233 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545387.1 protein_id gnl|my_center|LOCUS_05870 64246 64953 gene locus_tag LOCUS_05880 64246 64953 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763250.1 protein_id gnl|my_center|LOCUS_05880 65981 64968 gene locus_tag LOCUS_05890 65981 64968 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127350626.1 protein_id gnl|my_center|LOCUS_05890 66504 66001 gene locus_tag LOCUS_05900 66504 66001 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083008.1 protein_id gnl|my_center|LOCUS_05900 67757 66501 gene locus_tag LOCUS_05910 gene hacA 67757 66501 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876998.1 protein_id gnl|my_center|LOCUS_05910 69037 67748 gene locus_tag LOCUS_05920 69037 67748 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964288.1 protein_id gnl|my_center|LOCUS_05920 69618 70712 gene locus_tag LOCUS_05930 gene pstS 69618 70712 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582618.1 protein_id gnl|my_center|LOCUS_05930 70709 71608 gene locus_tag LOCUS_05940 gene pstC 70709 71608 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582860.1 protein_id gnl|my_center|LOCUS_05940 71601 72431 gene locus_tag LOCUS_05950 gene pstA 71601 72431 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582861.1 protein_id gnl|my_center|LOCUS_05950 72433 73191 gene locus_tag LOCUS_05960 gene pstB 72433 73191 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079999.1 protein_id gnl|my_center|LOCUS_05960 74820 73183 gene locus_tag LOCUS_05970 74820 73183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 76215 74941 gene locus_tag LOCUS_05980 gene glnA 76215 74941 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979431.1 protein_id gnl|my_center|LOCUS_05980 76508 77533 gene locus_tag LOCUS_05990 76508 77533 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546236.1 protein_id gnl|my_center|LOCUS_05990 78142 77546 gene locus_tag LOCUS_06000 gene udg 78142 77546 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980322.1 protein_id gnl|my_center|LOCUS_06000 78924 78139 gene locus_tag LOCUS_06010 gene nadE 78924 78139 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878500.1 protein_id gnl|my_center|LOCUS_06010 78985 79581 gene locus_tag LOCUS_06020 78985 79581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 79572 79889 gene locus_tag LOCUS_06030 79572 79889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 80658 79882 gene locus_tag LOCUS_06040 80658 79882 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496701.1 protein_id gnl|my_center|LOCUS_06040 81092 80760 gene locus_tag LOCUS_06050 81092 80760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 81312 82796 gene locus_tag LOCUS_06060 81312 82796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 83350 82793 gene locus_tag LOCUS_06070 83350 82793 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879609.1 protein_id gnl|my_center|LOCUS_06070 83518 84513 gene locus_tag LOCUS_06080 83518 84513 CDS product cystathionine gamma-synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050002813.1 protein_id gnl|my_center|LOCUS_06080 84628 86577 gene locus_tag LOCUS_06090 84628 86577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 86785 87843 gene locus_tag LOCUS_06100 86785 87843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 88112 89230 gene locus_tag LOCUS_06110 88112 89230 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979714.1 protein_id gnl|my_center|LOCUS_06110 90510 89353 gene locus_tag LOCUS_06120 gene qmoC 90510 89353 CDS product quinone-interacting membrane-bound oxidoreductase complex subunit QmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878164.1 protein_id gnl|my_center|LOCUS_06120 90788 90507 gene locus_tag LOCUS_06130 90788 90507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 92740 90785 gene locus_tag LOCUS_06140 gene hdrA 92740 90785 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_06140 94113 92755 gene locus_tag LOCUS_06150 94113 92755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 94536 94117 gene locus_tag LOCUS_06160 94536 94117 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842401.1 protein_id gnl|my_center|LOCUS_06160 94811 94551 gene locus_tag LOCUS_06170 94811 94551 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256473.1 protein_id gnl|my_center|LOCUS_06170 95267 94857 gene locus_tag LOCUS_06180 95267 94857 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846667.1 protein_id gnl|my_center|LOCUS_06180 95854 96849 gene locus_tag LOCUS_06190 gene wtpA 95854 96849 CDS product tungstate ABC transporter substrate-binding protein WtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867274.1 protein_id gnl|my_center|LOCUS_06190 96850 97620 gene locus_tag LOCUS_06200 gene wtpB 96850 97620 CDS product tungstate ABC transporter permease WtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870885.1 protein_id gnl|my_center|LOCUS_06200 97623 98684 gene locus_tag LOCUS_06210 gene wtpC 97623 98684 CDS product tungstate ABC transporter ATP-binding protein WtpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867278.1 protein_id gnl|my_center|LOCUS_06210 98820 100457 gene locus_tag LOCUS_06220 98820 100457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 100447 101277 gene locus_tag LOCUS_06230 100447 101277 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868130.1 protein_id gnl|my_center|LOCUS_06230 101262 102332 gene locus_tag LOCUS_06240 101262 102332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 102372 103319 gene locus_tag LOCUS_06250 gene speE 102372 103319 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978308.1 protein_id gnl|my_center|LOCUS_06250 104120 103320 gene locus_tag LOCUS_06260 104120 103320 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760853.1 protein_id gnl|my_center|LOCUS_06260 105451 104105 gene locus_tag LOCUS_06270 105451 104105 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249215.1 protein_id gnl|my_center|LOCUS_06270 106559 105456 gene locus_tag LOCUS_06280 gene aroC 106559 105456 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867581.1 protein_id gnl|my_center|LOCUS_06280 108181 106556 gene locus_tag LOCUS_06290 108181 106556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 109637 108255 gene locus_tag LOCUS_06300 109637 108255 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978229.1 protein_id gnl|my_center|LOCUS_06300 110913 109825 gene locus_tag LOCUS_06310 110913 109825 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966255.1 protein_id gnl|my_center|LOCUS_06310 111116 111289 gene locus_tag LOCUS_06320 111116 111289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 111362 111703 gene locus_tag LOCUS_06330 111362 111703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 111681 112955 gene locus_tag LOCUS_06340 111681 112955 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080628.1 protein_id gnl|my_center|LOCUS_06340 113477 112932 gene locus_tag LOCUS_06350 113477 112932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 114811 113660 gene locus_tag LOCUS_06360 114811 113660 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879038.1 protein_id gnl|my_center|LOCUS_06360 115224 114817 gene locus_tag LOCUS_06370 115224 114817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 117330 115411 gene locus_tag LOCUS_06380 gene thrS 117330 115411 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360261.1 protein_id gnl|my_center|LOCUS_06380 117558 118661 gene locus_tag LOCUS_06390 117558 118661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 118783 120177 gene locus_tag LOCUS_06400 118783 120177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 120217 121611 gene locus_tag LOCUS_06410 120217 121611 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930764.1 protein_id gnl|my_center|LOCUS_06410 122991 121612 gene locus_tag LOCUS_06420 gene serS 122991 121612 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979517.1 protein_id gnl|my_center|LOCUS_06420 123451 123056 gene locus_tag LOCUS_06430 123451 123056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 123621 125318 gene locus_tag LOCUS_06440 123621 125318 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119127.1 protein_id gnl|my_center|LOCUS_06440 125528 126373 gene locus_tag LOCUS_06450 125528 126373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 126366 127073 gene locus_tag LOCUS_06460 126366 127073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 128526 127087 gene locus_tag LOCUS_06470 gene cysS 128526 127087 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249399.1 protein_id gnl|my_center|LOCUS_06470 128748 129428 gene locus_tag LOCUS_06480 128748 129428 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867364.1 protein_id gnl|my_center|LOCUS_06480 129430 129660 gene locus_tag LOCUS_06490 129430 129660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 130135 129686 gene locus_tag LOCUS_06500 130135 129686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 130305 130847 gene locus_tag LOCUS_06510 130305 130847 CDS product DUF4443 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868435.1 protein_id gnl|my_center|LOCUS_06510 131339 132556 gene locus_tag LOCUS_06520 131339 132556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 132706 133578 gene locus_tag LOCUS_06530 gene cysK 132706 133578 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865179.1 protein_id gnl|my_center|LOCUS_06530 133650 134546 gene locus_tag LOCUS_06540 133650 134546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 135561 134581 gene locus_tag LOCUS_06550 gene amrS 135561 134581 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867880.1 protein_id gnl|my_center|LOCUS_06550 135751 136875 gene locus_tag LOCUS_06560 135751 136875 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490874.1 protein_id gnl|my_center|LOCUS_06560 137426 136863 gene locus_tag LOCUS_06570 137426 136863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 137924 137562 gene locus_tag LOCUS_06580 137924 137562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 138057 138695 gene locus_tag LOCUS_06590 138057 138695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 138807 140018 gene locus_tag LOCUS_06600 138807 140018 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867774.1 protein_id gnl|my_center|LOCUS_06600 140015 140887 gene locus_tag LOCUS_06610 140015 140887 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147080.1 protein_id gnl|my_center|LOCUS_06610 143207 141426 gene locus_tag LOCUS_06620 gene aor 143207 141426 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250017.1 protein_id gnl|my_center|LOCUS_06620 144589 143240 gene locus_tag LOCUS_06630 gene glmM 144589 143240 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250059.1 protein_id gnl|my_center|LOCUS_06630 145504 144794 gene locus_tag LOCUS_06640 145504 144794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 145681 146061 gene locus_tag LOCUS_06650 145681 146061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 147226 146150 gene locus_tag LOCUS_06660 147226 146150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 147609 147223 gene locus_tag LOCUS_06670 147609 147223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 148249 147704 gene locus_tag LOCUS_06680 148249 147704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 148972 148526 gene locus_tag LOCUS_06690 148972 148526 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878974.1 protein_id gnl|my_center|LOCUS_06690 150011 149022 gene locus_tag LOCUS_06700 gene ilvC 150011 149022 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762306.1 protein_id gnl|my_center|LOCUS_06700 150319 150041 gene locus_tag LOCUS_06710 150319 150041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 152054 150324 gene locus_tag LOCUS_06720 gene ilvB 152054 150324 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167827711.1 protein_id gnl|my_center|LOCUS_06720 152638 152225 gene locus_tag LOCUS_06730 152638 152225 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812273.1 protein_id gnl|my_center|LOCUS_06730 154023 152653 gene locus_tag LOCUS_06740 154023 152653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 155212 154751 gene locus_tag LOCUS_06750 155212 154751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 156125 155361 gene locus_tag LOCUS_06760 156125 155361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 157665 156220 gene locus_tag LOCUS_06770 157665 156220 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867476.1 protein_id gnl|my_center|LOCUS_06770 157938 159257 gene locus_tag LOCUS_06780 157938 159257 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064221.1 protein_id gnl|my_center|LOCUS_06780 159257 160810 gene locus_tag LOCUS_06790 159257 160810 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979670.1 protein_id gnl|my_center|LOCUS_06790 160959 161981 gene locus_tag LOCUS_06800 gene argC 160959 161981 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978134.1 protein_id gnl|my_center|LOCUS_06800 161990 162781 gene locus_tag LOCUS_06810 161990 162781 CDS product [LysW]-aminoadipate/[LysW]-glutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978133.1 protein_id gnl|my_center|LOCUS_06810 162873 163043 gene locus_tag LOCUS_06820 gene lysW 162873 163043 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101022.1 protein_id gnl|my_center|LOCUS_06820 163040 163879 gene locus_tag LOCUS_06830 gene lysX 163040 163879 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249233.1 protein_id gnl|my_center|LOCUS_06830 163879 165033 gene locus_tag LOCUS_06840 163879 165033 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978129.1 protein_id gnl|my_center|LOCUS_06840 165005 166018 gene locus_tag LOCUS_06850 165005 166018 CDS product N-acetyl-lysine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978128.1 protein_id gnl|my_center|LOCUS_06850 166187 167329 gene locus_tag LOCUS_06860 166187 167329 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761948.1 protein_id gnl|my_center|LOCUS_06860 167355 168155 gene locus_tag LOCUS_06870 167355 168155 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013805.1 protein_id gnl|my_center|LOCUS_06870 168156 169001 gene locus_tag LOCUS_06880 168156 169001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 169368 168973 gene locus_tag LOCUS_06890 169368 168973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 170584 169607 gene locus_tag LOCUS_06900 170584 169607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 171740 170661 gene locus_tag LOCUS_06910 171740 170661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 172019 171819 gene locus_tag LOCUS_06920 172019 171819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 172116 172946 gene locus_tag LOCUS_06930 172116 172946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 173456 173040 gene locus_tag LOCUS_06940 173456 173040 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391729.1 protein_id gnl|my_center|LOCUS_06940 173875 173453 gene locus_tag LOCUS_06950 173875 173453 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250426.1 protein_id gnl|my_center|LOCUS_06950 174297 173965 gene locus_tag LOCUS_06960 174297 173965 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250807.1 protein_id gnl|my_center|LOCUS_06960 174872 174294 gene locus_tag LOCUS_06970 174872 174294 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868100.1 protein_id gnl|my_center|LOCUS_06970 175963 174914 gene locus_tag LOCUS_06980 175963 174914 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870653.1 protein_id gnl|my_center|LOCUS_06980 176955 175954 gene locus_tag LOCUS_06990 176955 175954 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 protein_id gnl|my_center|LOCUS_06990 177264 176965 gene locus_tag LOCUS_07000 177264 176965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 179044 177311 gene locus_tag LOCUS_07010 179044 177311 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249942.1 protein_id gnl|my_center|LOCUS_07010 179957 179415 gene locus_tag LOCUS_07020 179957 179415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 180585 180076 gene locus_tag LOCUS_07030 180585 180076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 180979 180545 gene locus_tag LOCUS_07040 180979 180545 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870821.1 protein_id gnl|my_center|LOCUS_07040 181177 181680 gene locus_tag LOCUS_07050 181177 181680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 181828 182976 gene locus_tag LOCUS_07060 gene sat 181828 182976 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868287.1 protein_id gnl|my_center|LOCUS_07060 182981 184357 gene locus_tag LOCUS_07070 182981 184357 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868288.1 protein_id gnl|my_center|LOCUS_07070 184369 184914 gene locus_tag LOCUS_07080 gene cysC 184369 184914 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763240.1 protein_id gnl|my_center|LOCUS_07080 185068 185895 gene locus_tag LOCUS_07090 185068 185895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 186212 187723 gene locus_tag LOCUS_07100 186212 187723 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980439.1 protein_id gnl|my_center|LOCUS_07100 188487 189620 gene locus_tag LOCUS_07110 188487 189620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 190388 191017 gene locus_tag LOCUS_07120 190388 191017 CDS product DUF3782 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763642.1 protein_id gnl|my_center|LOCUS_07120 191378 192097 gene locus_tag LOCUS_07130 191378 192097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 192424 192708 gene locus_tag LOCUS_07140 192424 192708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 192828 194120 gene locus_tag LOCUS_07150 192828 194120 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460037.1 protein_id gnl|my_center|LOCUS_07150 194305 194910 gene locus_tag LOCUS_07160 194305 194910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 195601 195128 gene locus_tag LOCUS_07170 195601 195128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 196336 195737 gene locus_tag LOCUS_07180 196336 195737 CDS product DUF3782 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763642.1 protein_id gnl|my_center|LOCUS_07180 196451 196284 gene locus_tag LOCUS_07190 196451 196284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 >Feature sequence04 487 1755 gene locus_tag LOCUS_07200 gene gdhA 487 1755 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867693.1 protein_id gnl|my_center|LOCUS_07200 2526 1780 gene locus_tag LOCUS_07210 2526 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 3937 2576 gene locus_tag LOCUS_07220 3937 2576 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064511.1 protein_id gnl|my_center|LOCUS_07220 4389 4817 gene locus_tag LOCUS_07230 4389 4817 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978480.1 protein_id gnl|my_center|LOCUS_07230 5119 6411 gene locus_tag LOCUS_07240 5119 6411 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867316.1 protein_id gnl|my_center|LOCUS_07240 6508 7386 gene locus_tag LOCUS_07250 6508 7386 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250915.1 protein_id gnl|my_center|LOCUS_07250 7399 7998 gene locus_tag LOCUS_07260 7399 7998 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240327.1 protein_id gnl|my_center|LOCUS_07260 8114 8431 gene locus_tag LOCUS_07270 8114 8431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 8641 8402 gene locus_tag LOCUS_07280 8641 8402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 9414 8647 gene locus_tag LOCUS_07290 9414 8647 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240277.1 protein_id gnl|my_center|LOCUS_07290 10805 9411 gene locus_tag LOCUS_07300 10805 9411 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924859.1 protein_id gnl|my_center|LOCUS_07300 11558 10827 gene locus_tag LOCUS_07310 11558 10827 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020802.1 protein_id gnl|my_center|LOCUS_07310 11636 11941 gene locus_tag LOCUS_07320 11636 11941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 11994 12761 gene locus_tag LOCUS_07330 11994 12761 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867812.1 protein_id gnl|my_center|LOCUS_07330 13611 12766 gene locus_tag LOCUS_07340 13611 12766 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868132.1 protein_id gnl|my_center|LOCUS_07340 13753 14595 gene locus_tag LOCUS_07350 13753 14595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 14678 16033 gene locus_tag LOCUS_07360 14678 16033 CDS product RuvB-like helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867485.1 protein_id gnl|my_center|LOCUS_07360 19564 16022 gene locus_tag LOCUS_07370 19564 16022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 20890 19622 gene locus_tag LOCUS_07380 20890 19622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 21116 20877 gene locus_tag LOCUS_07390 21116 20877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 21214 22707 gene locus_tag LOCUS_07400 21214 22707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 23773 22739 gene locus_tag LOCUS_07410 23773 22739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 23996 24979 gene locus_tag LOCUS_07420 23996 24979 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978305.1 protein_id gnl|my_center|LOCUS_07420 25597 25310 gene locus_tag LOCUS_07430 25597 25310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 25803 26060 gene locus_tag LOCUS_07440 25803 26060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 26105 28045 gene locus_tag LOCUS_07450 26105 28045 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763166.1 protein_id gnl|my_center|LOCUS_07450 28270 28064 gene locus_tag LOCUS_07460 28270 28064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 28967 28275 gene locus_tag LOCUS_07470 28967 28275 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249420.1 protein_id gnl|my_center|LOCUS_07470 30733 29456 gene locus_tag LOCUS_07480 30733 29456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 30904 33123 gene locus_tag LOCUS_07490 30904 33123 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846316.1 protein_id gnl|my_center|LOCUS_07490 33703 33143 gene locus_tag LOCUS_07500 gene pgsA 33703 33143 CDS product archaetidylinositol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868695.1 protein_id gnl|my_center|LOCUS_07500 33769 34494 gene locus_tag LOCUS_07510 33769 34494 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064947.1 protein_id gnl|my_center|LOCUS_07510 34485 35009 gene locus_tag LOCUS_07520 34485 35009 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846759.1 protein_id gnl|my_center|LOCUS_07520 34987 35610 gene locus_tag LOCUS_07530 34987 35610 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250883.1 protein_id gnl|my_center|LOCUS_07530 35610 36200 gene locus_tag LOCUS_07540 35610 36200 CDS product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867177.1 protein_id gnl|my_center|LOCUS_07540 36181 36822 gene locus_tag LOCUS_07550 36181 36822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 36824 37120 gene locus_tag LOCUS_07560 36824 37120 CDS product DNA-directed RNA polymerase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763526.1 protein_id gnl|my_center|LOCUS_07560 38448 37156 gene locus_tag LOCUS_07570 38448 37156 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876486.1 protein_id gnl|my_center|LOCUS_07570 39668 38682 gene locus_tag LOCUS_07580 39668 38682 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868866.1 protein_id gnl|my_center|LOCUS_07580 40703 39723 gene locus_tag LOCUS_07590 40703 39723 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868867.1 protein_id gnl|my_center|LOCUS_07590 40794 42545 gene locus_tag LOCUS_07600 40794 42545 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020884.1 protein_id gnl|my_center|LOCUS_07600 42600 43577 gene locus_tag LOCUS_07610 42600 43577 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250710.1 protein_id gnl|my_center|LOCUS_07610 43589 44509 gene locus_tag LOCUS_07620 43589 44509 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860221.1 protein_id gnl|my_center|LOCUS_07620 45812 44514 gene locus_tag LOCUS_07630 45812 44514 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040323.1 protein_id gnl|my_center|LOCUS_07630 46822 45908 gene locus_tag LOCUS_07640 46822 45908 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228258.1 protein_id gnl|my_center|LOCUS_07640 47499 46861 gene locus_tag LOCUS_07650 47499 46861 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231529.1 protein_id gnl|my_center|LOCUS_07650 48179 47547 gene locus_tag LOCUS_07660 48179 47547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 48825 48181 gene locus_tag LOCUS_07670 48825 48181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 49489 48830 gene locus_tag LOCUS_07680 49489 48830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 49821 50120 gene locus_tag LOCUS_07690 49821 50120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 50102 51271 gene locus_tag LOCUS_07700 50102 51271 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903772.1 protein_id gnl|my_center|LOCUS_07700 51277 52314 gene locus_tag LOCUS_07710 gene asd 51277 52314 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876434.1 protein_id gnl|my_center|LOCUS_07710 53090 52668 gene locus_tag LOCUS_07720 53090 52668 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846620.1 protein_id gnl|my_center|LOCUS_07720 53371 53072 gene locus_tag LOCUS_07730 53371 53072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846982.1 protein_id gnl|my_center|LOCUS_07730 53845 53462 gene locus_tag LOCUS_07740 53845 53462 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730388.1 protein_id gnl|my_center|LOCUS_07740 53944 54489 gene locus_tag LOCUS_07750 gene dcd 53944 54489 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763548.1 protein_id gnl|my_center|LOCUS_07750 54629 58468 gene locus_tag LOCUS_07760 54629 58468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 58478 58999 gene locus_tag LOCUS_07770 gene cobO 58478 58999 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442279.1 protein_id gnl|my_center|LOCUS_07770 59071 59367 gene locus_tag LOCUS_07780 59071 59367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 59750 60133 gene locus_tag LOCUS_07790 59750 60133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 60121 60645 gene locus_tag LOCUS_07800 gene nuoB 60121 60645 CDS product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979576.1 protein_id gnl|my_center|LOCUS_07800 60635 61108 gene locus_tag LOCUS_07810 60635 61108 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846746.1 protein_id gnl|my_center|LOCUS_07810 61105 62277 gene locus_tag LOCUS_07820 61105 62277 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980299.1 protein_id gnl|my_center|LOCUS_07820 62274 63281 gene locus_tag LOCUS_07830 gene nuoH 62274 63281 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762083.1 protein_id gnl|my_center|LOCUS_07830 63282 63770 gene locus_tag LOCUS_07840 gene nuoI 63282 63770 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847026.1 protein_id gnl|my_center|LOCUS_07840 63757 64236 gene locus_tag LOCUS_07850 63757 64236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 64241 64546 gene locus_tag LOCUS_07860 gene nuoK 64241 64546 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227704.1 protein_id gnl|my_center|LOCUS_07860 64551 66077 gene locus_tag LOCUS_07870 64551 66077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07870 66082 68184 gene locus_tag LOCUS_07880 66082 68184 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763355.1 protein_id gnl|my_center|LOCUS_07880 68188 69591 gene locus_tag LOCUS_07890 gene fpoN 68188 69591 CDS product F(420)H(2) dehydrogenase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021520.1 protein_id gnl|my_center|LOCUS_07890 71624 71055 gene locus_tag LOCUS_07900 71624 71055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069168210.1 protein_id gnl|my_center|LOCUS_07900 73031 71781 gene locus_tag LOCUS_07910 73031 71781 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763687.1 protein_id gnl|my_center|LOCUS_07910 73879 73091 gene locus_tag LOCUS_07920 73879 73091 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870966.1 protein_id gnl|my_center|LOCUS_07920 74336 73857 gene locus_tag LOCUS_07930 gene pyrI 74336 73857 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846971.1 protein_id gnl|my_center|LOCUS_07930 75226 74333 gene locus_tag LOCUS_07940 gene pyrB 75226 74333 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762814.1 protein_id gnl|my_center|LOCUS_07940 75801 75220 gene locus_tag LOCUS_07950 gene pyrE 75801 75220 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870621.1 protein_id gnl|my_center|LOCUS_07950 76312 75791 gene locus_tag LOCUS_07960 76312 75791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 77816 76518 gene locus_tag LOCUS_07970 77816 76518 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869244.1 protein_id gnl|my_center|LOCUS_07970 79698 77839 gene locus_tag LOCUS_07980 79698 77839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 79769 81037 gene locus_tag LOCUS_07990 79769 81037 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240344.1 protein_id gnl|my_center|LOCUS_07990 81047 81952 gene locus_tag LOCUS_08000 81047 81952 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_08000 82566 83747 gene locus_tag LOCUS_08010 82566 83747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 83744 84841 gene locus_tag LOCUS_08020 83744 84841 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080040.1 protein_id gnl|my_center|LOCUS_08020 85030 85731 gene locus_tag LOCUS_08030 85030 85731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 85892 86473 gene locus_tag LOCUS_08040 85892 86473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 87892 86462 gene locus_tag LOCUS_08050 87892 86462 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978681.1 protein_id gnl|my_center|LOCUS_08050 89330 87933 gene locus_tag LOCUS_08060 gene argH 89330 87933 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979552.1 protein_id gnl|my_center|LOCUS_08060 90522 89323 gene locus_tag LOCUS_08070 90522 89323 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167827706.1 protein_id gnl|my_center|LOCUS_08070 90997 90737 gene locus_tag LOCUS_08080 90997 90737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 91645 90998 gene locus_tag LOCUS_08090 91645 90998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 93347 91926 gene locus_tag LOCUS_08100 93347 91926 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761902.1 protein_id gnl|my_center|LOCUS_08100 94438 93344 gene locus_tag LOCUS_08110 94438 93344 CDS product asparagine synthetase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762509.1 protein_id gnl|my_center|LOCUS_08110 95016 94618 gene locus_tag LOCUS_08120 95016 94618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 95061 95432 gene locus_tag LOCUS_08130 95061 95432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 95422 95841 gene locus_tag LOCUS_08140 95422 95841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 95831 96031 gene locus_tag LOCUS_08150 95831 96031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 96031 96813 gene locus_tag LOCUS_08160 96031 96813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 96817 97926 gene locus_tag LOCUS_08170 96817 97926 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289085.1 protein_id gnl|my_center|LOCUS_08170 98046 100394 gene locus_tag LOCUS_08180 98046 100394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 100654 101733 gene locus_tag LOCUS_08190 100654 101733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 102367 101774 gene locus_tag LOCUS_08200 102367 101774 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966252.1 protein_id gnl|my_center|LOCUS_08200 103364 102387 gene locus_tag LOCUS_08210 103364 102387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 103788 105356 gene locus_tag LOCUS_08220 103788 105356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 106736 105408 gene locus_tag LOCUS_08230 106736 105408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 107395 106901 gene locus_tag LOCUS_08240 107395 106901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 107601 108482 gene locus_tag LOCUS_08250 107601 108482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 108523 109341 gene locus_tag LOCUS_08260 108523 109341 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868103.1 protein_id gnl|my_center|LOCUS_08260 109538 110683 gene locus_tag LOCUS_08270 109538 110683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 111396 110680 gene locus_tag LOCUS_08280 111396 110680 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868218.1 protein_id gnl|my_center|LOCUS_08280 112113 111406 gene locus_tag LOCUS_08290 112113 111406 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942652.1 protein_id gnl|my_center|LOCUS_08290 112835 112113 gene locus_tag LOCUS_08300 112835 112113 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942651.1 protein_id gnl|my_center|LOCUS_08300 113874 112819 gene locus_tag LOCUS_08310 113874 112819 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942650.1 protein_id gnl|my_center|LOCUS_08310 114757 113879 gene locus_tag LOCUS_08320 114757 113879 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 protein_id gnl|my_center|LOCUS_08320 116093 114792 gene locus_tag LOCUS_08330 116093 114792 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965775.1 protein_id gnl|my_center|LOCUS_08330 116240 118285 gene locus_tag LOCUS_08340 116240 118285 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870478.1 protein_id gnl|my_center|LOCUS_08340 118288 120030 gene locus_tag LOCUS_08350 118288 120030 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870477.1 protein_id gnl|my_center|LOCUS_08350 120425 120111 gene locus_tag LOCUS_08360 120425 120111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250284.1 protein_id gnl|my_center|LOCUS_08360 120653 122287 gene locus_tag LOCUS_08370 120653 122287 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053886.1 protein_id gnl|my_center|LOCUS_08370 122382 122999 gene locus_tag LOCUS_08380 122382 122999 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989890.1 protein_id gnl|my_center|LOCUS_08380 123734 122973 gene locus_tag LOCUS_08390 123734 122973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 123841 124758 gene locus_tag LOCUS_08400 123841 124758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 126117 124777 gene locus_tag LOCUS_08410 126117 124777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 126363 126875 gene locus_tag LOCUS_08420 126363 126875 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_08420 127548 126886 gene locus_tag LOCUS_08430 gene rnhB 127548 126886 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021954.1 protein_id gnl|my_center|LOCUS_08430 127760 128734 gene locus_tag LOCUS_08440 gene hisG 127760 128734 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545705.1 protein_id gnl|my_center|LOCUS_08440 128734 129708 gene locus_tag LOCUS_08450 128734 129708 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762954.1 protein_id gnl|my_center|LOCUS_08450 129687 130262 gene locus_tag LOCUS_08460 gene hisB 129687 130262 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932417.1 protein_id gnl|my_center|LOCUS_08460 130259 130825 gene locus_tag LOCUS_08470 gene hisH 130259 130825 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_08470 130822 131514 gene locus_tag LOCUS_08480 gene hisA 130822 131514 CDS product 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249202.1 protein_id gnl|my_center|LOCUS_08480 131502 132275 gene locus_tag LOCUS_08490 gene hisF 131502 132275 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_08490 132266 133237 gene locus_tag LOCUS_08500 132266 133237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 133326 134732 gene locus_tag LOCUS_08510 133326 134732 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082444.1 protein_id gnl|my_center|LOCUS_08510 135174 134716 gene locus_tag LOCUS_08520 135174 134716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 135840 135298 gene locus_tag LOCUS_08530 135840 135298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 135892 136740 gene locus_tag LOCUS_08540 135892 136740 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762992.1 protein_id gnl|my_center|LOCUS_08540 137390 138790 gene locus_tag LOCUS_08550 137390 138790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 140222 138753 gene locus_tag LOCUS_08560 140222 138753 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762889.1 protein_id gnl|my_center|LOCUS_08560 140418 141515 gene locus_tag LOCUS_08570 140418 141515 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879105.1 protein_id gnl|my_center|LOCUS_08570 141525 142352 gene locus_tag LOCUS_08580 141525 142352 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879104.1 protein_id gnl|my_center|LOCUS_08580 142349 143122 gene locus_tag LOCUS_08590 142349 143122 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879103.1 protein_id gnl|my_center|LOCUS_08590 144363 143161 gene locus_tag LOCUS_08600 144363 143161 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052886479.1 protein_id gnl|my_center|LOCUS_08600 144746 144531 gene locus_tag LOCUS_08610 144746 144531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 146749 144809 gene locus_tag LOCUS_08620 146749 144809 CDS product CGP-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251118.1 protein_id gnl|my_center|LOCUS_08620 146911 147390 gene locus_tag LOCUS_08630 146911 147390 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762119.1 protein_id gnl|my_center|LOCUS_08630 148368 147616 gene locus_tag LOCUS_08640 148368 147616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 148428 148580 gene locus_tag LOCUS_08650 148428 148580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 149463 148564 gene locus_tag LOCUS_08660 149463 148564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 149527 150306 gene locus_tag LOCUS_08670 149527 150306 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881009.1 protein_id gnl|my_center|LOCUS_08670 150303 150947 gene locus_tag LOCUS_08680 gene aroD 150303 150947 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876205.1 protein_id gnl|my_center|LOCUS_08680 151539 150928 gene locus_tag LOCUS_08690 151539 150928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 152293 151526 gene locus_tag LOCUS_08700 152293 151526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 153200 152280 gene locus_tag LOCUS_08710 153200 152280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 153981 153190 gene locus_tag LOCUS_08720 gene uppS 153981 153190 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870889.1 protein_id gnl|my_center|LOCUS_08720 154042 154527 gene locus_tag LOCUS_08730 154042 154527 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943780.1 protein_id gnl|my_center|LOCUS_08730 155755 154490 gene locus_tag LOCUS_08740 155755 154490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 155825 156235 gene locus_tag LOCUS_08750 gene lysM 155825 156235 CDS product HTH-type transcriptional regulator LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978132.1 protein_id gnl|my_center|LOCUS_08750 156530 158764 gene locus_tag LOCUS_08760 156530 158764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 158761 159441 gene locus_tag LOCUS_08770 158761 159441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 159398 160777 gene locus_tag LOCUS_08780 159398 160777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 160752 161681 gene locus_tag LOCUS_08790 160752 161681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 161718 164021 gene locus_tag LOCUS_08800 161718 164021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 164018 164557 gene locus_tag LOCUS_08810 164018 164557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 164526 165011 gene locus_tag LOCUS_08820 164526 165011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 165188 165913 gene locus_tag LOCUS_08830 165188 165913 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146595.1 protein_id gnl|my_center|LOCUS_08830 165955 166761 gene locus_tag LOCUS_08840 165955 166761 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980408.1 protein_id gnl|my_center|LOCUS_08840 166761 168956 gene locus_tag LOCUS_08850 166761 168956 CDS product tRNA(Met) cytidine acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868389.1 protein_id gnl|my_center|LOCUS_08850 169721 168924 gene locus_tag LOCUS_08860 169721 168924 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868017.1 protein_id gnl|my_center|LOCUS_08860 169949 171583 gene locus_tag LOCUS_08870 169949 171583 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762019.1 protein_id gnl|my_center|LOCUS_08870 175434 171580 gene locus_tag LOCUS_08880 175434 171580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 175534 177696 gene locus_tag LOCUS_08890 gene topA 175534 177696 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496891.1 protein_id gnl|my_center|LOCUS_08890 177594 178250 gene locus_tag LOCUS_08900 177594 178250 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_08900 178481 178233 gene locus_tag LOCUS_08910 178481 178233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 179134 178709 gene locus_tag LOCUS_08920 179134 178709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 179342 179121 gene locus_tag LOCUS_08930 179342 179121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 179385 179639 gene locus_tag LOCUS_08940 179385 179639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 180516 179602 gene locus_tag LOCUS_08950 180516 179602 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022154.1 protein_id gnl|my_center|LOCUS_08950 180613 183483 gene locus_tag LOCUS_08960 gene leuS 180613 183483 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021621.1 protein_id gnl|my_center|LOCUS_08960 184514 183504 gene locus_tag LOCUS_08970 gene gap 184514 183504 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_08970 <186043 184566 gene locus_tag LOCUS_08980 <186043 184566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878793.1:CDC48 family AAA ATPase >Feature sequence05 885 3320 gene locus_tag LOCUS_08990 885 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 3310 3915 gene locus_tag LOCUS_09000 3310 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 3990 3915 gene locus_tag LOCUS_t00060 3990 3915 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4057 6249 gene locus_tag LOCUS_09010 4057 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 6297 6620 gene locus_tag LOCUS_09020 6297 6620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 6674 9388 gene locus_tag LOCUS_09030 gene alaS 6674 9388 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250518.1 protein_id gnl|my_center|LOCUS_09030 9388 10038 gene locus_tag LOCUS_09040 9388 10038 CDS product DUF434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870449.1 protein_id gnl|my_center|LOCUS_09040 10035 11072 gene locus_tag LOCUS_09050 10035 11072 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064802.1 protein_id gnl|my_center|LOCUS_09050 12067 11069 gene locus_tag LOCUS_09060 gene gyaR 12067 11069 CDS product glyoxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249634.1 protein_id gnl|my_center|LOCUS_09060 12167 13747 gene locus_tag LOCUS_09070 12167 13747 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978536.1 protein_id gnl|my_center|LOCUS_09070 13757 15595 gene locus_tag LOCUS_09080 13757 15595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 15659 15880 gene locus_tag LOCUS_09090 15659 15880 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582917.1 protein_id gnl|my_center|LOCUS_09090 15880 17982 gene locus_tag LOCUS_09100 gene feoB 15880 17982 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249908.1 protein_id gnl|my_center|LOCUS_09100 18030 18530 gene locus_tag LOCUS_09110 18030 18530 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846576.1 protein_id gnl|my_center|LOCUS_09110 19241 18516 gene locus_tag LOCUS_09120 19241 18516 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763153.1 protein_id gnl|my_center|LOCUS_09120 19295 19591 gene locus_tag LOCUS_09130 19295 19591 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980224.1 protein_id gnl|my_center|LOCUS_09130 20774 19593 gene locus_tag LOCUS_09140 20774 19593 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 protein_id gnl|my_center|LOCUS_09140 20883 21533 gene locus_tag LOCUS_09150 20883 21533 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_09150 22466 21519 gene locus_tag LOCUS_09160 22466 21519 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846833.1 protein_id gnl|my_center|LOCUS_09160 22981 22712 gene locus_tag LOCUS_09170 22981 22712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 23742 22993 gene locus_tag LOCUS_09180 23742 22993 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541103.1 protein_id gnl|my_center|LOCUS_09180 23816 24277 gene locus_tag LOCUS_09190 23816 24277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 24324 24749 gene locus_tag LOCUS_09200 24324 24749 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875655.1 protein_id gnl|my_center|LOCUS_09200 24760 25200 gene locus_tag LOCUS_09210 gene rplX 24760 25200 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250481.1 protein_id gnl|my_center|LOCUS_09210 25206 25928 gene locus_tag LOCUS_09220 25206 25928 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867451.1 protein_id gnl|my_center|LOCUS_09220 25938 26495 gene locus_tag LOCUS_09230 25938 26495 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250479.1 protein_id gnl|my_center|LOCUS_09230 26509 26673 gene locus_tag LOCUS_09240 26509 26673 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879404.1 protein_id gnl|my_center|LOCUS_09240 26685 27077 gene locus_tag LOCUS_09250 26685 27077 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867448.1 protein_id gnl|my_center|LOCUS_09250 27088 27639 gene locus_tag LOCUS_09260 gene rpl6p 27088 27639 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021117.1 protein_id gnl|my_center|LOCUS_09260 27641 28009 gene locus_tag LOCUS_09270 27641 28009 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867446.1 protein_id gnl|my_center|LOCUS_09270 28022 28450 gene locus_tag LOCUS_09280 28022 28450 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180546237.1 protein_id gnl|my_center|LOCUS_09280 28452 29048 gene locus_tag LOCUS_09290 28452 29048 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250473.1 protein_id gnl|my_center|LOCUS_09290 29095 29730 gene locus_tag LOCUS_09300 gene rpsE 29095 29730 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879398.1 protein_id gnl|my_center|LOCUS_09300 29853 30314 gene locus_tag LOCUS_09310 29853 30314 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867442.1 protein_id gnl|my_center|LOCUS_09310 30311 30781 gene locus_tag LOCUS_09320 30311 30781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 30793 32190 gene locus_tag LOCUS_09330 gene secY 30793 32190 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867440.1 protein_id gnl|my_center|LOCUS_09330 32198 32704 gene locus_tag LOCUS_09340 32198 32704 CDS product DUF106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869981.1 protein_id gnl|my_center|LOCUS_09340 33179 33511 gene locus_tag LOCUS_09350 33179 33511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 33508 34491 gene locus_tag LOCUS_09360 33508 34491 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250460.1 protein_id gnl|my_center|LOCUS_09360 34575 34662 gene locus_tag LOCUS_t00070 34575 34662 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 34914 35366 gene locus_tag LOCUS_09370 34914 35366 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875675.1 protein_id gnl|my_center|LOCUS_09370 35379 35888 gene locus_tag LOCUS_09380 gene rpsD 35379 35888 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879773.1 protein_id gnl|my_center|LOCUS_09380 35894 36292 gene locus_tag LOCUS_09390 35894 36292 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250455.1 protein_id gnl|my_center|LOCUS_09390 36350 37321 gene locus_tag LOCUS_09400 36350 37321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 37302 38075 gene locus_tag LOCUS_09410 37302 38075 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762451.1 protein_id gnl|my_center|LOCUS_09410 38117 38204 gene locus_tag LOCUS_t00080 38117 38204 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 38254 38616 gene locus_tag LOCUS_09420 38254 38616 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869688.1 protein_id gnl|my_center|LOCUS_09420 38627 39118 gene locus_tag LOCUS_09430 gene rplM 38627 39118 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867656.1 protein_id gnl|my_center|LOCUS_09430 39102 39521 gene locus_tag LOCUS_09440 39102 39521 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061175.1 protein_id gnl|my_center|LOCUS_09440 39551 39955 gene locus_tag LOCUS_09450 39551 39955 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979318.1 protein_id gnl|my_center|LOCUS_09450 39960 41276 gene locus_tag LOCUS_09460 39960 41276 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250437.1 protein_id gnl|my_center|LOCUS_09460 41269 42498 gene locus_tag LOCUS_09470 41269 42498 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496374.1 protein_id gnl|my_center|LOCUS_09470 42499 42801 gene locus_tag LOCUS_09480 42499 42801 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762332.1 protein_id gnl|my_center|LOCUS_09480 42815 43171 gene locus_tag LOCUS_09490 42815 43171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 43193 43762 gene locus_tag LOCUS_09500 43193 43762 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867500.1 protein_id gnl|my_center|LOCUS_09500 44505 43759 gene locus_tag LOCUS_09510 44505 43759 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020652.1 protein_id gnl|my_center|LOCUS_09510 44576 46141 gene locus_tag LOCUS_09520 44576 46141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 46670 46125 gene locus_tag LOCUS_09530 46670 46125 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846254.1 protein_id gnl|my_center|LOCUS_09530 47534 46776 gene locus_tag LOCUS_09540 47534 46776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 48381 47515 gene locus_tag LOCUS_09550 gene coaW 48381 47515 CDS product type II pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446246.1 protein_id gnl|my_center|LOCUS_09550 48962 48387 gene locus_tag LOCUS_09560 48962 48387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 49588 48959 gene locus_tag LOCUS_09570 49588 48959 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877484.1 protein_id gnl|my_center|LOCUS_09570 49646 50662 gene locus_tag LOCUS_09580 49646 50662 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867675.1 protein_id gnl|my_center|LOCUS_09580 50731 52224 gene locus_tag LOCUS_09590 50731 52224 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249872.1 protein_id gnl|my_center|LOCUS_09590 52231 53889 gene locus_tag LOCUS_09600 gene pheT 52231 53889 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868500.1 protein_id gnl|my_center|LOCUS_09600 55060 54011 gene locus_tag LOCUS_09610 55060 54011 CDS product lysyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867499.1 protein_id gnl|my_center|LOCUS_09610 55118 56398 gene locus_tag LOCUS_09620 gene eno 55118 56398 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251056.1 protein_id gnl|my_center|LOCUS_09620 57812 56367 gene locus_tag LOCUS_09630 gene cca 57812 56367 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762324.1 protein_id gnl|my_center|LOCUS_09630 58299 57784 gene locus_tag LOCUS_09640 58299 57784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 58597 59136 gene locus_tag LOCUS_09650 58597 59136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 59118 59837 gene locus_tag LOCUS_09660 gene truA 59118 59837 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249878.1 protein_id gnl|my_center|LOCUS_09660 60096 59818 gene locus_tag LOCUS_09670 60096 59818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 61676 60153 gene locus_tag LOCUS_09680 61676 60153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 61763 61690 gene locus_tag LOCUS_t00090 61763 61690 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 62673 61918 gene locus_tag LOCUS_09690 62673 61918 CDS product DUF2110 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250973.1 protein_id gnl|my_center|LOCUS_09690 63209 62670 gene locus_tag LOCUS_09700 63209 62670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 63259 63334 gene locus_tag LOCUS_t00100 63259 63334 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 63471 63398 gene locus_tag LOCUS_t00110 63471 63398 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 64047 63529 gene locus_tag LOCUS_09710 64047 63529 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146469.1 protein_id gnl|my_center|LOCUS_09710 64398 64048 gene locus_tag LOCUS_09720 64398 64048 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877726.1 protein_id gnl|my_center|LOCUS_09720 64466 65020 gene locus_tag LOCUS_09730 64466 65020 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762824.1 protein_id gnl|my_center|LOCUS_09730 65020 66186 gene locus_tag LOCUS_09740 65020 66186 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867623.1 protein_id gnl|my_center|LOCUS_09740 66191 66865 gene locus_tag LOCUS_09750 gene rpiA 66191 66865 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086536.1 protein_id gnl|my_center|LOCUS_09750 67144 67050 gene locus_tag LOCUS_t00120 67144 67050 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 67522 67295 gene locus_tag LOCUS_09760 67522 67295 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250645.1 protein_id gnl|my_center|LOCUS_09760 68098 67646 gene locus_tag LOCUS_09770 68098 67646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 68156 68680 gene locus_tag LOCUS_09780 68156 68680 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980400.1 protein_id gnl|my_center|LOCUS_09780 70634 68667 gene locus_tag LOCUS_09790 70634 68667 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878431.1 protein_id gnl|my_center|LOCUS_09790 71875 70631 gene locus_tag LOCUS_09800 71875 70631 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878430.1 protein_id gnl|my_center|LOCUS_09800 71934 72752 gene locus_tag LOCUS_09810 gene tatC 71934 72752 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880807.1 protein_id gnl|my_center|LOCUS_09810 73077 72754 gene locus_tag LOCUS_09820 gene tatA 73077 72754 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879548.1 protein_id gnl|my_center|LOCUS_09820 73270 74271 gene locus_tag LOCUS_09830 73270 74271 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871127.1 protein_id gnl|my_center|LOCUS_09830 74265 75641 gene locus_tag LOCUS_09840 74265 75641 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870075.1 protein_id gnl|my_center|LOCUS_09840 75717 75790 gene locus_tag LOCUS_t00130 75717 75790 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 76560 75793 gene locus_tag LOCUS_09850 76560 75793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 76838 76578 gene locus_tag LOCUS_09860 76838 76578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 77049 77459 gene locus_tag LOCUS_09870 77049 77459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 77514 78107 gene locus_tag LOCUS_09880 77514 78107 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_09880 78367 78074 gene locus_tag LOCUS_09890 78367 78074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 80226 78364 gene locus_tag LOCUS_09900 80226 78364 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240328.1 protein_id gnl|my_center|LOCUS_09900 80291 81217 gene locus_tag LOCUS_09910 80291 81217 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846502.1 protein_id gnl|my_center|LOCUS_09910 81192 82016 gene locus_tag LOCUS_09920 81192 82016 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868330.1 protein_id gnl|my_center|LOCUS_09920 83686 82019 gene locus_tag LOCUS_09930 83686 82019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 84783 84409 gene locus_tag LOCUS_09940 84783 84409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 85165 85971 gene locus_tag LOCUS_09950 85165 85971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 88388 86169 gene locus_tag LOCUS_09960 88388 86169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 88958 88581 gene locus_tag LOCUS_09970 88958 88581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 89130 88948 gene locus_tag LOCUS_09980 89130 88948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 89481 89678 gene locus_tag LOCUS_09990 89481 89678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 89703 90848 gene locus_tag LOCUS_10000 89703 90848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 90845 91954 gene locus_tag LOCUS_10010 90845 91954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 92009 92830 gene locus_tag LOCUS_10020 92009 92830 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582908.1 protein_id gnl|my_center|LOCUS_10020 92984 94147 gene locus_tag LOCUS_10030 92984 94147 CDS product citrate synthase/methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978565.1 protein_id gnl|my_center|LOCUS_10030 94395 95927 gene locus_tag LOCUS_10040 94395 95927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 96513 95935 gene locus_tag LOCUS_10050 96513 95935 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879824.1 protein_id gnl|my_center|LOCUS_10050 96897 96628 gene locus_tag LOCUS_10060 96897 96628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 97969 96908 gene locus_tag LOCUS_10070 97969 96908 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978607.1 protein_id gnl|my_center|LOCUS_10070 98364 99572 gene locus_tag LOCUS_10080 98364 99572 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021000.1 protein_id gnl|my_center|LOCUS_10080 102628 99566 gene locus_tag LOCUS_10090 102628 99566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 103110 102634 gene locus_tag LOCUS_10100 103110 102634 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024447.1 protein_id gnl|my_center|LOCUS_10100 105875 103149 gene locus_tag LOCUS_10110 gene rad50 105875 103149 CDS product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846723.1 protein_id gnl|my_center|LOCUS_10110 107052 105877 gene locus_tag LOCUS_10120 107052 105877 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870840.1 protein_id gnl|my_center|LOCUS_10120 108647 107055 gene locus_tag LOCUS_10130 108647 107055 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875946.1 protein_id gnl|my_center|LOCUS_10130 109770 108637 gene locus_tag LOCUS_10140 109770 108637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 109830 111215 gene locus_tag LOCUS_10150 109830 111215 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867476.1 protein_id gnl|my_center|LOCUS_10150 111249 111956 gene locus_tag LOCUS_10160 111249 111956 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021474.1 protein_id gnl|my_center|LOCUS_10160 111964 112362 gene locus_tag LOCUS_10170 111964 112362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 112698 112366 gene locus_tag LOCUS_10180 gene metG 112698 112366 CDS product methionine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762104.1 protein_id gnl|my_center|LOCUS_10180 112810 114081 gene locus_tag LOCUS_10190 112810 114081 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878039.1 protein_id gnl|my_center|LOCUS_10190 114341 114087 gene locus_tag LOCUS_10200 114341 114087 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583113.1 protein_id gnl|my_center|LOCUS_10200 115416 114328 gene locus_tag LOCUS_10210 115416 114328 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146822.1 protein_id gnl|my_center|LOCUS_10210 116651 115413 gene locus_tag LOCUS_10220 gene ahcY 116651 115413 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978302.1 protein_id gnl|my_center|LOCUS_10220 116910 116689 gene locus_tag LOCUS_10230 116910 116689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 117434 116907 gene locus_tag LOCUS_10240 gene rimI 117434 116907 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978207.1 protein_id gnl|my_center|LOCUS_10240 117489 118580 gene locus_tag LOCUS_10250 117489 118580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 118613 119458 gene locus_tag LOCUS_10260 118613 119458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 119499 119762 gene locus_tag LOCUS_10270 119499 119762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 119800 120186 gene locus_tag LOCUS_10280 119800 120186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 120183 120836 gene locus_tag LOCUS_10290 120183 120836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 121791 120817 gene locus_tag LOCUS_10300 gene thiL 121791 120817 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707094.1 protein_id gnl|my_center|LOCUS_10300 121854 123179 gene locus_tag LOCUS_10310 121854 123179 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147002.1 protein_id gnl|my_center|LOCUS_10310 123176 123934 gene locus_tag LOCUS_10320 123176 123934 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124419.1 protein_id gnl|my_center|LOCUS_10320 124660 123941 gene locus_tag LOCUS_10330 124660 123941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 125150 125329 gene locus_tag LOCUS_10340 125150 125329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 125278 125508 gene locus_tag LOCUS_10350 gene hpkA 125278 125508 CDS product archaeal histone HpkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250364.1 protein_id gnl|my_center|LOCUS_10350 125615 125539 gene locus_tag LOCUS_t00140 125615 125539 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 126845 125646 gene locus_tag LOCUS_10360 126845 125646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 126898 127719 gene locus_tag LOCUS_10370 126898 127719 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871139.1 protein_id gnl|my_center|LOCUS_10370 128241 127678 gene locus_tag LOCUS_10380 128241 127678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 128297 129127 gene locus_tag LOCUS_10390 128297 129127 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878129.1 protein_id gnl|my_center|LOCUS_10390 129102 129443 gene locus_tag LOCUS_10400 129102 129443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 129485 129796 gene locus_tag LOCUS_10410 129485 129796 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250833.1 protein_id gnl|my_center|LOCUS_10410 129802 131103 gene locus_tag LOCUS_10420 129802 131103 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251014.1 protein_id gnl|my_center|LOCUS_10420 131446 131078 gene locus_tag LOCUS_10430 gene speD 131446 131078 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460188.1 protein_id gnl|my_center|LOCUS_10430 132113 131436 gene locus_tag LOCUS_10440 132113 131436 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878760.1 protein_id gnl|my_center|LOCUS_10440 132742 132179 gene locus_tag LOCUS_10450 132742 132179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 132901 134634 gene locus_tag LOCUS_10460 132901 134634 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978239.1 protein_id gnl|my_center|LOCUS_10460 134635 135792 gene locus_tag LOCUS_10470 134635 135792 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061129.1 protein_id gnl|my_center|LOCUS_10470 136489 135740 gene locus_tag LOCUS_10480 136489 135740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 138502 136820 gene locus_tag LOCUS_10490 138502 136820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 139215 138499 gene locus_tag LOCUS_10500 139215 138499 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240518.1 protein_id gnl|my_center|LOCUS_10500 139326 139526 gene locus_tag LOCUS_10510 139326 139526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 140087 139527 gene locus_tag LOCUS_10520 gene thpR 140087 139527 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762325.1 protein_id gnl|my_center|LOCUS_10520 140453 140091 gene locus_tag LOCUS_10530 140453 140091 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146466.1 protein_id gnl|my_center|LOCUS_10530 141449 140565 gene locus_tag LOCUS_10540 141449 140565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762184.1 protein_id gnl|my_center|LOCUS_10540 141520 141954 gene locus_tag LOCUS_10550 141520 141954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 142359 141943 gene locus_tag LOCUS_10560 142359 141943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 142471 144153 gene locus_tag LOCUS_10570 gene metG 142471 144153 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762101.1 protein_id gnl|my_center|LOCUS_10570 144872 144150 gene locus_tag LOCUS_10580 144872 144150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 144961 146061 gene locus_tag LOCUS_10590 144961 146061 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876249.1 protein_id gnl|my_center|LOCUS_10590 148401 146716 gene locus_tag LOCUS_10600 148401 146716 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146933.1 protein_id gnl|my_center|LOCUS_10600 149107 148499 gene locus_tag LOCUS_10610 149107 148499 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249090.1 protein_id gnl|my_center|LOCUS_10610 151005 149104 gene locus_tag LOCUS_10620 gene iorA 151005 149104 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868411.1 protein_id gnl|my_center|LOCUS_10620 152449 151154 gene locus_tag LOCUS_10630 gene acdAI 152449 151154 CDS product acetate--CoA ligase II subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867767.1 protein_id gnl|my_center|LOCUS_10630 152982 152461 gene locus_tag LOCUS_10640 152982 152461 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876288.1 protein_id gnl|my_center|LOCUS_10640 153079 153003 gene locus_tag LOCUS_t00150 153079 153003 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 154008 153157 gene locus_tag LOCUS_10650 154008 153157 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060947.1 protein_id gnl|my_center|LOCUS_10650 154352 155407 gene locus_tag LOCUS_10660 154352 155407 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762578.1 protein_id gnl|my_center|LOCUS_10660 155967 155404 gene locus_tag LOCUS_10670 155967 155404 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146776.1 protein_id gnl|my_center|LOCUS_10670 156038 156853 gene locus_tag LOCUS_10680 156038 156853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 157260 156868 gene locus_tag LOCUS_10690 gene speD 157260 156868 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583813.1 protein_id gnl|my_center|LOCUS_10690 158722 157676 gene locus_tag LOCUS_10700 158722 157676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 160037 158814 gene locus_tag LOCUS_10710 gene hisD 160037 158814 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249199.1 protein_id gnl|my_center|LOCUS_10710 160364 160891 gene locus_tag LOCUS_10720 160364 160891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 161011 161430 gene locus_tag LOCUS_10730 161011 161430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 162257 161499 gene locus_tag LOCUS_10740 162257 161499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 163462 162533 gene locus_tag LOCUS_10750 gene rfaD 163462 162533 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880173.1 protein_id gnl|my_center|LOCUS_10750 164794 163511 gene locus_tag LOCUS_10760 gene gabT 164794 163511 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964736.1 protein_id gnl|my_center|LOCUS_10760 165631 164915 gene locus_tag LOCUS_10770 165631 164915 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180546217.1 protein_id gnl|my_center|LOCUS_10770 >Feature sequence06 <1 623 gene locus_tag LOCUS_10780 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249697.1:ABC transporter ATP-binding protein 625 1389 gene locus_tag LOCUS_10790 625 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1657 2835 gene locus_tag LOCUS_10800 1657 2835 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877755.1 protein_id gnl|my_center|LOCUS_10800 4281 2836 gene locus_tag LOCUS_10810 4281 2836 CDS product DNA-directed DNA polymerase II small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879286.1 protein_id gnl|my_center|LOCUS_10810 4862 4278 gene locus_tag LOCUS_10820 4862 4278 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763584.1 protein_id gnl|my_center|LOCUS_10820 5599 4844 gene locus_tag LOCUS_10830 5599 4844 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147021.1 protein_id gnl|my_center|LOCUS_10830 8105 5772 gene locus_tag LOCUS_10840 8105 5772 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762768.1 protein_id gnl|my_center|LOCUS_10840 8708 8154 gene locus_tag LOCUS_10850 8708 8154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 8798 9145 gene locus_tag LOCUS_10860 8798 9145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 9261 10022 gene locus_tag LOCUS_10870 9261 10022 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249977.1 protein_id gnl|my_center|LOCUS_10870 10049 10124 gene locus_tag LOCUS_t00160 10049 10124 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 10312 10236 gene locus_tag LOCUS_t00170 10312 10236 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 11481 10351 gene locus_tag LOCUS_10880 gene sucC 11481 10351 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879675.1 protein_id gnl|my_center|LOCUS_10880 11544 12428 gene locus_tag LOCUS_10890 gene sucD 11544 12428 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762776.1 protein_id gnl|my_center|LOCUS_10890 12716 12423 gene locus_tag LOCUS_10900 12716 12423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 12788 12952 gene locus_tag LOCUS_10910 12788 12952 CDS product 50S ribosomal protein L40e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762234.1 protein_id gnl|my_center|LOCUS_10910 12996 14075 gene locus_tag LOCUS_10920 12996 14075 CDS product cell wall-binding repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249097.1 protein_id gnl|my_center|LOCUS_10920 13002 13080 gene locus_tag LOCUS_t00180 13002 13080 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14382 14651 gene locus_tag LOCUS_10930 14382 14651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 14653 14901 gene locus_tag LOCUS_10940 14653 14901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 15931 14903 gene locus_tag LOCUS_10950 gene fen 15931 14903 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867862.1 protein_id gnl|my_center|LOCUS_10950 16025 17080 gene locus_tag LOCUS_10960 16025 17080 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250274.1 protein_id gnl|my_center|LOCUS_10960 17077 17433 gene locus_tag LOCUS_10970 gene pth2 17077 17433 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251250.1 protein_id gnl|my_center|LOCUS_10970 17430 18524 gene locus_tag LOCUS_10980 gene truD 17430 18524 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251252.1 protein_id gnl|my_center|LOCUS_10980 18935 18525 gene locus_tag LOCUS_10990 18935 18525 CDS product DUF371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980211.1 protein_id gnl|my_center|LOCUS_10990 18948 19622 gene locus_tag LOCUS_11000 18948 19622 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877550.1 protein_id gnl|my_center|LOCUS_11000 19613 20203 gene locus_tag LOCUS_11010 19613 20203 CDS product Kae1-associated kinase Bud32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868707.1 protein_id gnl|my_center|LOCUS_11010 20200 20751 gene locus_tag LOCUS_11020 20200 20751 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879726.1 protein_id gnl|my_center|LOCUS_11020 20796 21251 gene locus_tag LOCUS_11030 20796 21251 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250202.1 protein_id gnl|my_center|LOCUS_11030 21261 22628 gene locus_tag LOCUS_11040 21261 22628 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064974.1 protein_id gnl|my_center|LOCUS_11040 22929 22612 gene locus_tag LOCUS_11050 22929 22612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 23412 22969 gene locus_tag LOCUS_11060 23412 22969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 25107 23755 gene locus_tag LOCUS_11070 25107 23755 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867854.1 protein_id gnl|my_center|LOCUS_11070 25767 26051 gene locus_tag LOCUS_11080 25767 26051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 26618 26887 gene locus_tag LOCUS_11090 26618 26887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 27469 27302 gene locus_tag LOCUS_11100 27469 27302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 27611 27426 gene locus_tag LOCUS_11110 27611 27426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 27957 27646 gene locus_tag LOCUS_11120 27957 27646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 28181 28393 gene locus_tag LOCUS_11130 28181 28393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 29155 28400 gene locus_tag LOCUS_11140 29155 28400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 29480 29719 gene locus_tag LOCUS_11150 29480 29719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 30006 29931 gene locus_tag LOCUS_t00190 30006 29931 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 30193 30363 gene locus_tag LOCUS_11160 30193 30363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 30868 30473 gene locus_tag LOCUS_11170 30868 30473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 31296 30865 gene locus_tag LOCUS_11180 31296 30865 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081206.1 protein_id gnl|my_center|LOCUS_11180 35485 32523 gene locus_tag LOCUS_r00020 35485 32523 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 37145 35681 gene locus_tag LOCUS_r00030 37145 35681 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 38376 37444 gene locus_tag LOCUS_11190 gene argF 38376 37444 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584136.1 protein_id gnl|my_center|LOCUS_11190 39271 38396 gene locus_tag LOCUS_11200 gene ftsY 39271 38396 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867626.1 protein_id gnl|my_center|LOCUS_11200 39659 39261 gene locus_tag LOCUS_11210 39659 39261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 40353 39682 gene locus_tag LOCUS_11220 40353 39682 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250272.1 protein_id gnl|my_center|LOCUS_11220 40635 40363 gene locus_tag LOCUS_11230 40635 40363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 40797 40645 gene locus_tag LOCUS_11240 40797 40645 CDS product 50S ribosomal protein L39e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877221.1 protein_id gnl|my_center|LOCUS_11240 41135 40809 gene locus_tag LOCUS_11250 41135 40809 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250229.1 protein_id gnl|my_center|LOCUS_11250 41599 41132 gene locus_tag LOCUS_11260 41599 41132 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867943.1 protein_id gnl|my_center|LOCUS_11260 42243 41905 gene locus_tag LOCUS_11270 42243 41905 CDS product ribonuclease P protein component 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248986.1 protein_id gnl|my_center|LOCUS_11270 43012 42245 gene locus_tag LOCUS_11280 43012 42245 CDS product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249827.1 protein_id gnl|my_center|LOCUS_11280 42973 43049 gene locus_tag LOCUS_t00200 42973 43049 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 43055 43127 gene locus_tag LOCUS_t00210 43055 43127 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 43262 43187 gene locus_tag LOCUS_t00220 43262 43187 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 43668 44870 gene locus_tag LOCUS_11290 gene ftsZ 43668 44870 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877283.1 protein_id gnl|my_center|LOCUS_11290 44882 45082 gene locus_tag LOCUS_11300 44882 45082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 45091 45585 gene locus_tag LOCUS_11310 45091 45585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 45588 46073 gene locus_tag LOCUS_11320 45588 46073 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877286.1 protein_id gnl|my_center|LOCUS_11320 46066 46761 gene locus_tag LOCUS_11330 46066 46761 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762220.1 protein_id gnl|my_center|LOCUS_11330 46763 47632 gene locus_tag LOCUS_11340 46763 47632 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870010.1 protein_id gnl|my_center|LOCUS_11340 48936 47779 gene locus_tag LOCUS_11350 48936 47779 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878279.1 protein_id gnl|my_center|LOCUS_11350 49508 49017 gene locus_tag LOCUS_11360 49508 49017 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978170.1 protein_id gnl|my_center|LOCUS_11360 49640 49565 gene locus_tag LOCUS_t00230 49640 49565 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 49781 49692 gene locus_tag LOCUS_t00240 49781 49692 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 49859 49782 gene locus_tag LOCUS_t00250 49859 49782 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 51055 49952 gene locus_tag LOCUS_11370 51055 49952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 52583 51018 gene locus_tag LOCUS_11380 52583 51018 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979316.1 protein_id gnl|my_center|LOCUS_11380 53181 52594 gene locus_tag LOCUS_11390 53181 52594 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060946.1 protein_id gnl|my_center|LOCUS_11390 53990 53196 gene locus_tag LOCUS_11400 53990 53196 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846354.1 protein_id gnl|my_center|LOCUS_11400 54367 54014 gene locus_tag LOCUS_11410 54367 54014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 54801 54379 gene locus_tag LOCUS_11420 54801 54379 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869589.1 protein_id gnl|my_center|LOCUS_11420 55459 54806 gene locus_tag LOCUS_11430 55459 54806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 55841 55599 gene locus_tag LOCUS_11440 55841 55599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 56841 55846 gene locus_tag LOCUS_11450 56841 55846 CDS product UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980131.1 protein_id gnl|my_center|LOCUS_11450 56885 57811 gene locus_tag LOCUS_11460 56885 57811 CDS product UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884438.1 protein_id gnl|my_center|LOCUS_11460 59299 57776 gene locus_tag LOCUS_11470 gene gcvPB 59299 57776 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868896.1 protein_id gnl|my_center|LOCUS_11470 60660 59299 gene locus_tag LOCUS_11480 gene gcvPA 60660 59299 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250331.1 protein_id gnl|my_center|LOCUS_11480 61042 61203 gene locus_tag LOCUS_11490 61042 61203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 61203 62453 gene locus_tag LOCUS_11500 61203 62453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 63505 62426 gene locus_tag LOCUS_11510 63505 62426 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979266.1 protein_id gnl|my_center|LOCUS_11510 63657 65363 gene locus_tag LOCUS_11520 63657 65363 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868460.1 protein_id gnl|my_center|LOCUS_11520 65341 65808 gene locus_tag LOCUS_11530 65341 65808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 65801 66283 gene locus_tag LOCUS_11540 65801 66283 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251069.1 protein_id gnl|my_center|LOCUS_11540 66284 67198 gene locus_tag LOCUS_11550 gene radA 66284 67198 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146514.1 protein_id gnl|my_center|LOCUS_11550 67267 67695 gene locus_tag LOCUS_11560 gene gcvH 67267 67695 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723327.1 protein_id gnl|my_center|LOCUS_11560 67696 68880 gene locus_tag LOCUS_11570 67696 68880 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020758.1 protein_id gnl|my_center|LOCUS_11570 69217 69525 gene locus_tag LOCUS_11580 69217 69525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 69865 69482 gene locus_tag LOCUS_11590 69865 69482 CDS product Sjogren's syndrome/scleroderma autoantigen 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240467.1 protein_id gnl|my_center|LOCUS_11590 69957 70241 gene locus_tag LOCUS_11600 69957 70241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 71007 70261 gene locus_tag LOCUS_11610 71007 70261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 71106 71034 gene locus_tag LOCUS_t00260 71106 71034 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 71189 71113 gene locus_tag LOCUS_t00270 71189 71113 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 71514 71323 gene locus_tag LOCUS_11620 71514 71323 CDS product 50S ribosomal protein L37e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978307.1 protein_id gnl|my_center|LOCUS_11620 71792 71541 gene locus_tag LOCUS_11630 71792 71541 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846912.1 protein_id gnl|my_center|LOCUS_11630 72063 72473 gene locus_tag LOCUS_11640 72063 72473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 74392 72491 gene locus_tag LOCUS_11650 74392 72491 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250379.1 protein_id gnl|my_center|LOCUS_11650 75088 74411 gene locus_tag LOCUS_11660 75088 74411 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762844.1 protein_id gnl|my_center|LOCUS_11660 75191 75640 gene locus_tag LOCUS_11670 75191 75640 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876248.1 protein_id gnl|my_center|LOCUS_11670 76348 75641 gene locus_tag LOCUS_11680 76348 75641 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762843.1 protein_id gnl|my_center|LOCUS_11680 79231 76397 gene locus_tag LOCUS_11690 79231 76397 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867684.1 protein_id gnl|my_center|LOCUS_11690 79343 80062 gene locus_tag LOCUS_11700 gene rsmA 79343 80062 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867501.1 protein_id gnl|my_center|LOCUS_11700 80035 80664 gene locus_tag LOCUS_11710 80035 80664 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870442.1 protein_id gnl|my_center|LOCUS_11710 80827 80636 gene locus_tag LOCUS_11720 80827 80636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 80922 80846 gene locus_tag LOCUS_t00280 80922 80846 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 81238 81074 gene locus_tag LOCUS_11730 81238 81074 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869892.1 protein_id gnl|my_center|LOCUS_11730 81528 81235 gene locus_tag LOCUS_11740 81528 81235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 81766 81578 gene locus_tag LOCUS_11750 81766 81578 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868804.1 protein_id gnl|my_center|LOCUS_11750 82319 81759 gene locus_tag LOCUS_11760 gene rpoE 82319 81759 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869896.1 protein_id gnl|my_center|LOCUS_11760 82785 82372 gene locus_tag LOCUS_11770 82785 82372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 82871 82796 gene locus_tag LOCUS_t00290 82871 82796 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 82949 82875 gene locus_tag LOCUS_t00300 82949 82875 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 84229 82991 gene locus_tag LOCUS_11780 gene prf1 84229 82991 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870340.1 protein_id gnl|my_center|LOCUS_11780 84299 85543 gene locus_tag LOCUS_11790 84299 85543 CDS product putative sugar nucleotidyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256908.1 protein_id gnl|my_center|LOCUS_11790 85615 85543 gene locus_tag LOCUS_t00310 85615 85543 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 86084 86266 gene locus_tag LOCUS_11800 86084 86266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 86724 86801 gene locus_tag LOCUS_t00320 86724 86801 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 86804 86879 gene locus_tag LOCUS_t00330 86804 86879 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 87117 87030 gene locus_tag LOCUS_t00340 87117 87030 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 88152 87166 gene locus_tag LOCUS_11810 88152 87166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 89006 88176 gene locus_tag LOCUS_11820 89006 88176 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887563.1 protein_id gnl|my_center|LOCUS_11820 89730 89155 gene locus_tag LOCUS_11830 89730 89155 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868267.1 protein_id gnl|my_center|LOCUS_11830 90715 89741 gene locus_tag LOCUS_11840 90715 89741 CDS product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251076.1 protein_id gnl|my_center|LOCUS_11840 91338 90715 gene locus_tag LOCUS_11850 91338 90715 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869554.1 protein_id gnl|my_center|LOCUS_11850 91400 92302 gene locus_tag LOCUS_11860 gene map 91400 92302 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979464.1 protein_id gnl|my_center|LOCUS_11860 92308 92733 gene locus_tag LOCUS_11870 92308 92733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 93805 92723 gene locus_tag LOCUS_11880 93805 92723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 94748 93816 gene locus_tag LOCUS_11890 94748 93816 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876508.1 protein_id gnl|my_center|LOCUS_11890 94811 95656 gene locus_tag LOCUS_11900 94811 95656 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496450.1 protein_id gnl|my_center|LOCUS_11900 96443 95649 gene locus_tag LOCUS_11910 96443 95649 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060996.1 protein_id gnl|my_center|LOCUS_11910 97263 96430 gene locus_tag LOCUS_11920 97263 96430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 97766 97275 gene locus_tag LOCUS_11930 97766 97275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 99688 97772 gene locus_tag LOCUS_11940 gene rqcH 99688 97772 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879530.1 protein_id gnl|my_center|LOCUS_11940 99805 100623 gene locus_tag LOCUS_11950 99805 100623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 100620 101039 gene locus_tag LOCUS_11960 100620 101039 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978373.1 protein_id gnl|my_center|LOCUS_11960 101195 102202 gene locus_tag LOCUS_11970 101195 102202 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869671.1 protein_id gnl|my_center|LOCUS_11970 102208 102999 gene locus_tag LOCUS_11980 gene rpl4p 102208 102999 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250492.1 protein_id gnl|my_center|LOCUS_11980 102992 103264 gene locus_tag LOCUS_11990 102992 103264 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869673.1 protein_id gnl|my_center|LOCUS_11990 103270 104004 gene locus_tag LOCUS_12000 103270 104004 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762841.1 protein_id gnl|my_center|LOCUS_12000 104061 104459 gene locus_tag LOCUS_12010 gene rpsS 104061 104459 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867460.1 protein_id gnl|my_center|LOCUS_12010 104497 104586 gene locus_tag LOCUS_t00350 104497 104586 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 105837 104596 gene locus_tag LOCUS_12020 gene larA 105837 104596 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062283069.1 protein_id gnl|my_center|LOCUS_12020 106784 105834 gene locus_tag LOCUS_12030 gene pdxA 106784 105834 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086666.1 protein_id gnl|my_center|LOCUS_12030 107857 106781 gene locus_tag LOCUS_12040 107857 106781 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705321.1 protein_id gnl|my_center|LOCUS_12040 108235 107918 gene locus_tag LOCUS_12050 gene rpsJ 108235 107918 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867802.1 protein_id gnl|my_center|LOCUS_12050 109549 108284 gene locus_tag LOCUS_12060 gene tuf 109549 108284 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869821.1 protein_id gnl|my_center|LOCUS_12060 109646 110098 gene locus_tag LOCUS_12070 109646 110098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 111445 110105 gene locus_tag LOCUS_12080 gene glmM 111445 110105 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250059.1 protein_id gnl|my_center|LOCUS_12080 113412 111442 gene locus_tag LOCUS_12090 113412 111442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 114196 113432 gene locus_tag LOCUS_12100 114196 113432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 115398 114193 gene locus_tag LOCUS_12110 115398 114193 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496567.1 protein_id gnl|my_center|LOCUS_12110 116335 115520 gene locus_tag LOCUS_12120 gene mtnP 116335 115520 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868192.1 protein_id gnl|my_center|LOCUS_12120 116461 118122 gene locus_tag LOCUS_12130 gene thsB 116461 118122 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867141.1 protein_id gnl|my_center|LOCUS_12130 118132 119016 gene locus_tag LOCUS_12140 118132 119016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 119032 120351 gene locus_tag LOCUS_12150 119032 120351 CDS product oligosaccharide repeat unit polymerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869918.1 protein_id gnl|my_center|LOCUS_12150 120672 120499 gene locus_tag LOCUS_12160 120672 120499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 120840 120673 gene locus_tag LOCUS_12170 120840 120673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 120809 121492 gene locus_tag LOCUS_12180 120809 121492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 121516 121920 gene locus_tag LOCUS_12190 121516 121920 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250142.1 protein_id gnl|my_center|LOCUS_12190 121910 122206 gene locus_tag LOCUS_12200 gene srp19 121910 122206 CDS product signal recognition particle SRP19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878753.1 protein_id gnl|my_center|LOCUS_12200 122190 122471 gene locus_tag LOCUS_12210 122190 122471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 122988 122449 gene locus_tag LOCUS_12220 122988 122449 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876692.1 protein_id gnl|my_center|LOCUS_12220 122989 124128 gene locus_tag LOCUS_12230 122989 124128 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876814.1 protein_id gnl|my_center|LOCUS_12230 124806 124120 gene locus_tag LOCUS_12240 124806 124120 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867184.1 protein_id gnl|my_center|LOCUS_12240 125942 124803 gene locus_tag LOCUS_12250 125942 124803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249139.1 protein_id gnl|my_center|LOCUS_12250 126155 125988 gene locus_tag LOCUS_12260 126155 125988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 128255 126228 gene locus_tag LOCUS_12270 128255 126228 CDS product DUF460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011011610.1 protein_id gnl|my_center|LOCUS_12270 128310 129635 gene locus_tag LOCUS_12280 128310 129635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 129649 131469 gene locus_tag LOCUS_12290 gene glmS 129649 131469 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249760.1 protein_id gnl|my_center|LOCUS_12290 131704 131474 gene locus_tag LOCUS_12300 131704 131474 CDS product U6 snRNA-associated Sm-like protein LSm6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762446.1 protein_id gnl|my_center|LOCUS_12300 132382 131756 gene locus_tag LOCUS_12310 132382 131756 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978220.1 protein_id gnl|my_center|LOCUS_12310 132827 132387 gene locus_tag LOCUS_12320 132827 132387 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978222.1 protein_id gnl|my_center|LOCUS_12320 133312 132836 gene locus_tag LOCUS_12330 133312 132836 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762453.1 protein_id gnl|my_center|LOCUS_12330 133642 133325 gene locus_tag LOCUS_12340 133642 133325 CDS product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876679.1 protein_id gnl|my_center|LOCUS_12340 137604 133639 gene locus_tag LOCUS_12350 137604 133639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 140987 137622 gene locus_tag LOCUS_12360 140987 137622 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867738.1 protein_id gnl|my_center|LOCUS_12360 141399 141007 gene locus_tag LOCUS_12370 141399 141007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 141490 142095 gene locus_tag LOCUS_12380 141490 142095 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868483.1 protein_id gnl|my_center|LOCUS_12380 142337 142092 gene locus_tag LOCUS_12390 142337 142092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 142511 146026 gene locus_tag LOCUS_12400 gene polC 142511 146026 CDS product DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879218.1 protein_id gnl|my_center|LOCUS_12400 146035 146352 gene locus_tag LOCUS_12410 146035 146352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 146346 147098 gene locus_tag LOCUS_12420 146346 147098 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762421.1 protein_id gnl|my_center|LOCUS_12420 147108 148037 gene locus_tag LOCUS_12430 gene priL 147108 148037 CDS product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020168.1 protein_id gnl|my_center|LOCUS_12430 148038 149207 gene locus_tag LOCUS_12440 148038 149207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 149240 149746 gene locus_tag LOCUS_12450 149240 149746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 149743 150021 gene locus_tag LOCUS_12460 149743 150021 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762190.1 protein_id gnl|my_center|LOCUS_12460 150027 150236 gene locus_tag LOCUS_12470 150027 150236 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978936.1 protein_id gnl|my_center|LOCUS_12470 150233 151042 gene locus_tag LOCUS_12480 150233 151042 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878034.1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence07 299 643 gene locus_tag LOCUS_12490 299 643 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868472.1 protein_id gnl|my_center|LOCUS_12490 1675 1821 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctgccagatcttcgtctgctc 2874 2296 gene locus_tag LOCUS_12500 2874 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 3663 3076 gene locus_tag LOCUS_12510 3663 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 3738 4652 gene locus_tag LOCUS_12520 3738 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 4665 6101 gene locus_tag LOCUS_12530 4665 6101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761896.1 protein_id gnl|my_center|LOCUS_12530 6388 6116 gene locus_tag LOCUS_12540 6388 6116 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546474.1 protein_id gnl|my_center|LOCUS_12540 6833 6423 gene locus_tag LOCUS_12550 6833 6423 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868473.1 protein_id gnl|my_center|LOCUS_12550 7904 8875 gene locus_tag LOCUS_12560 7904 8875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 10461 8941 gene locus_tag LOCUS_12570 10461 8941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 11457 10627 gene locus_tag LOCUS_12580 11457 10627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 11619 11485 gene locus_tag LOCUS_12590 11619 11485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 11854 11651 gene locus_tag LOCUS_12600 11854 11651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 13623 12205 gene locus_tag LOCUS_12610 13623 12205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 14668 13838 gene locus_tag LOCUS_12620 14668 13838 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140468.1 protein_id gnl|my_center|LOCUS_12620 15694 14744 gene locus_tag LOCUS_12630 15694 14744 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868717.1 protein_id gnl|my_center|LOCUS_12630 15852 16007 gene locus_tag LOCUS_12640 15852 16007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 16455 16108 gene locus_tag LOCUS_12650 16455 16108 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979180.1 protein_id gnl|my_center|LOCUS_12650 16750 16430 gene locus_tag LOCUS_12660 16750 16430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 17158 17628 gene locus_tag LOCUS_12670 17158 17628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 17631 18734 gene locus_tag LOCUS_12680 17631 18734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 18968 18708 gene locus_tag LOCUS_12690 18968 18708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 19279 18998 gene locus_tag LOCUS_12700 19279 18998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 19519 21186 gene locus_tag LOCUS_12710 19519 21186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 21190 22386 gene locus_tag LOCUS_12720 21190 22386 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461406.1 protein_id gnl|my_center|LOCUS_12720 23414 22383 gene locus_tag LOCUS_12730 23414 22383 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763164.1 protein_id gnl|my_center|LOCUS_12730 24204 23425 gene locus_tag LOCUS_12740 24204 23425 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847027.1 protein_id gnl|my_center|LOCUS_12740 25545 24244 gene locus_tag LOCUS_12750 25545 24244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 25717 26796 gene locus_tag LOCUS_12760 25717 26796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 26799 27677 gene locus_tag LOCUS_12770 gene cyoE 26799 27677 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879528.1 protein_id gnl|my_center|LOCUS_12770 27713 28144 gene locus_tag LOCUS_12780 27713 28144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 28242 28565 gene locus_tag LOCUS_12790 gene yciH 28242 28565 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867456.1 protein_id gnl|my_center|LOCUS_12790 30703 28688 gene locus_tag LOCUS_12800 30703 28688 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104337.1 protein_id gnl|my_center|LOCUS_12800 32318 30792 gene locus_tag LOCUS_12810 gene guaA 32318 30792 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762354.1 protein_id gnl|my_center|LOCUS_12810 33636 32320 gene locus_tag LOCUS_12820 33636 32320 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065661.1 protein_id gnl|my_center|LOCUS_12820 35070 33637 gene locus_tag LOCUS_12830 35070 33637 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251119.1 protein_id gnl|my_center|LOCUS_12830 35006 35392 gene locus_tag LOCUS_12840 35006 35392 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148208718.1 protein_id gnl|my_center|LOCUS_12840 36258 35389 gene locus_tag LOCUS_12850 36258 35389 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937880.1 protein_id gnl|my_center|LOCUS_12850 36611 37744 gene locus_tag LOCUS_12860 36611 37744 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763197.1 protein_id gnl|my_center|LOCUS_12860 38660 39775 gene locus_tag LOCUS_12870 gene qmoC 38660 39775 CDS product quinone-interacting membrane-bound oxidoreductase complex subunit QmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545389.1 protein_id gnl|my_center|LOCUS_12870 39772 41052 gene locus_tag LOCUS_12880 39772 41052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 41068 43056 gene locus_tag LOCUS_12890 gene hdrA 41068 43056 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_12890 43067 43507 gene locus_tag LOCUS_12900 43067 43507 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940766.1 protein_id gnl|my_center|LOCUS_12900 43500 44474 gene locus_tag LOCUS_12910 43500 44474 CDS product F420-non-reducing hydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545939.1 protein_id gnl|my_center|LOCUS_12910 44477 45937 gene locus_tag LOCUS_12920 44477 45937 CDS product F420-non-reducing hydrogenase subunit A, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545782.1 protein_id gnl|my_center|LOCUS_12920 45996 46469 gene locus_tag LOCUS_12930 45996 46469 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251016.1 protein_id gnl|my_center|LOCUS_12930 46524 46961 gene locus_tag LOCUS_12940 gene hypA 46524 46961 CDS product hydrogenase nickel incorporation protein HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250958.1 protein_id gnl|my_center|LOCUS_12940 46958 47749 gene locus_tag LOCUS_12950 46958 47749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 47751 47963 gene locus_tag LOCUS_12960 47751 47963 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868354.1 protein_id gnl|my_center|LOCUS_12960 47969 49021 gene locus_tag LOCUS_12970 gene hypE 47969 49021 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761962.1 protein_id gnl|my_center|LOCUS_12970 49181 51475 gene locus_tag LOCUS_12980 gene hypF 49181 51475 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761966.1 protein_id gnl|my_center|LOCUS_12980 51475 52623 gene locus_tag LOCUS_12990 gene hypD 51475 52623 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240243.1 protein_id gnl|my_center|LOCUS_12990 53386 52691 gene locus_tag LOCUS_13000 53386 52691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 56822 53397 gene locus_tag LOCUS_13010 56822 53397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 57066 57692 gene locus_tag LOCUS_13020 57066 57692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13020 57697 57978 gene locus_tag LOCUS_13030 57697 57978 CDS product PDGLE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761971.1 protein_id gnl|my_center|LOCUS_13030 57962 58723 gene locus_tag LOCUS_13040 57962 58723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 58720 59547 gene locus_tag LOCUS_13050 58720 59547 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060749.1 protein_id gnl|my_center|LOCUS_13050 59972 59556 gene locus_tag LOCUS_13060 gene nikR 59972 59556 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878246.1 protein_id gnl|my_center|LOCUS_13060 60368 60799 gene locus_tag LOCUS_13070 60368 60799 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762119.1 protein_id gnl|my_center|LOCUS_13070 61218 60919 gene locus_tag LOCUS_13080 61218 60919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 61655 61326 gene locus_tag LOCUS_13090 61655 61326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 62415 61900 gene locus_tag LOCUS_13100 62415 61900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 62950 62417 gene locus_tag LOCUS_13110 gene yjjX 62950 62417 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847016.1 protein_id gnl|my_center|LOCUS_13110 63017 63418 gene locus_tag LOCUS_13120 63017 63418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 64464 63478 gene locus_tag LOCUS_13130 64464 63478 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870761.1 protein_id gnl|my_center|LOCUS_13130 65989 64541 gene locus_tag LOCUS_13140 65989 64541 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877524.1 protein_id gnl|my_center|LOCUS_13140 67197 66130 gene locus_tag LOCUS_13150 67197 66130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 67226 67963 gene locus_tag LOCUS_13160 gene aroE 67226 67963 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870596.1 protein_id gnl|my_center|LOCUS_13160 67953 68777 gene locus_tag LOCUS_13170 67953 68777 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061249.1 protein_id gnl|my_center|LOCUS_13170 70584 68761 gene locus_tag LOCUS_13180 70584 68761 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249735.1 protein_id gnl|my_center|LOCUS_13180 70722 71453 gene locus_tag LOCUS_13190 70722 71453 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878652.1 protein_id gnl|my_center|LOCUS_13190 71577 72083 gene locus_tag LOCUS_13200 71577 72083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 72148 74775 gene locus_tag LOCUS_13210 72148 74775 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146858.1 protein_id gnl|my_center|LOCUS_13210 74848 75195 gene locus_tag LOCUS_13220 74848 75195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 75937 75221 gene locus_tag LOCUS_13230 75937 75221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 77294 75990 gene locus_tag LOCUS_13240 77294 75990 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867639.1 protein_id gnl|my_center|LOCUS_13240 77354 78538 gene locus_tag LOCUS_13250 gene thrC 77354 78538 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979259.1 protein_id gnl|my_center|LOCUS_13250 78535 79470 gene locus_tag LOCUS_13260 78535 79470 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761815.1 protein_id gnl|my_center|LOCUS_13260 79751 80710 gene locus_tag LOCUS_13270 79751 80710 CDS product tungsten cofactor oxidoreductase radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755814.1 protein_id gnl|my_center|LOCUS_13270 81346 80711 gene locus_tag LOCUS_13280 gene deoC 81346 80711 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583678.1 protein_id gnl|my_center|LOCUS_13280 82583 81357 gene locus_tag LOCUS_13290 gene norA 82583 81357 CDS product multidrug efflux MFS transporter NorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458987.1 protein_id gnl|my_center|LOCUS_13290 82881 82954 gene locus_tag LOCUS_t00360 82881 82954 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 83634 82954 gene locus_tag LOCUS_13300 83634 82954 CDS product winged helix-turn-helix domain-containing protein/riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319832.1 protein_id gnl|my_center|LOCUS_13300 84268 83618 gene locus_tag LOCUS_13310 84268 83618 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979556.1 protein_id gnl|my_center|LOCUS_13310 84488 85294 gene locus_tag LOCUS_13320 84488 85294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 >Feature sequence08 <1 1806 gene locus_tag LOCUS_13330 <1 1806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941635.1:choice-of-anchor J domain-containing protein 4670 1848 gene locus_tag LOCUS_13340 4670 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 4748 5533 gene locus_tag LOCUS_13350 4748 5533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 5534 6583 gene locus_tag LOCUS_13360 5534 6583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 7053 6589 gene locus_tag LOCUS_13370 7053 6589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062371128.1 protein_id gnl|my_center|LOCUS_13370 7243 7515 gene locus_tag LOCUS_13380 7243 7515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 7517 7978 gene locus_tag LOCUS_13390 7517 7978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 7989 9002 gene locus_tag LOCUS_13400 7989 9002 CDS product DUF711 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762695.1 protein_id gnl|my_center|LOCUS_13400 10013 9003 gene locus_tag LOCUS_13410 gene trxB 10013 9003 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080734.1 protein_id gnl|my_center|LOCUS_13410 10344 10021 gene locus_tag LOCUS_13420 10344 10021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 10493 11761 gene locus_tag LOCUS_13430 gene aroA 10493 11761 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876404.1 protein_id gnl|my_center|LOCUS_13430 11758 12522 gene locus_tag LOCUS_13440 gene udp 11758 12522 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_13440 13509 13958 gene locus_tag LOCUS_13450 13509 13958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 13939 14283 gene locus_tag LOCUS_13460 13939 14283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 14327 14956 gene locus_tag LOCUS_13470 14327 14956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 15542 15216 gene locus_tag LOCUS_13480 15542 15216 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980344.1 protein_id gnl|my_center|LOCUS_13480 15625 16095 gene locus_tag LOCUS_13490 15625 16095 CDS product TIGR00288 family NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867206.1 protein_id gnl|my_center|LOCUS_13490 17136 16036 gene locus_tag LOCUS_13500 17136 16036 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147160.1 protein_id gnl|my_center|LOCUS_13500 18074 17169 gene locus_tag LOCUS_13510 18074 17169 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879523.1 protein_id gnl|my_center|LOCUS_13510 18380 19489 gene locus_tag LOCUS_13520 18380 19489 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064399.1 protein_id gnl|my_center|LOCUS_13520 20189 19476 gene locus_tag LOCUS_13530 20189 19476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 20336 20791 gene locus_tag LOCUS_13540 20336 20791 CDS product HD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978503.1 protein_id gnl|my_center|LOCUS_13540 21741 20788 gene locus_tag LOCUS_13550 gene moaA 21741 20788 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251175.1 protein_id gnl|my_center|LOCUS_13550 22170 21742 gene locus_tag LOCUS_13560 gene moaC 22170 21742 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249309.1 protein_id gnl|my_center|LOCUS_13560 22637 22185 gene locus_tag LOCUS_13570 22637 22185 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867291.1 protein_id gnl|my_center|LOCUS_13570 22873 22637 gene locus_tag LOCUS_13580 22873 22637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 24078 22888 gene locus_tag LOCUS_13590 24078 22888 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763039.1 protein_id gnl|my_center|LOCUS_13590 25380 24091 gene locus_tag LOCUS_13600 25380 24091 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287774.1 protein_id gnl|my_center|LOCUS_13600 26300 25383 gene locus_tag LOCUS_13610 26300 25383 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762507.1 protein_id gnl|my_center|LOCUS_13610 27086 26313 gene locus_tag LOCUS_13620 27086 26313 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762508.1 protein_id gnl|my_center|LOCUS_13620 27165 27461 gene locus_tag LOCUS_13630 27165 27461 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391609.1 protein_id gnl|my_center|LOCUS_13630 27545 28747 gene locus_tag LOCUS_13640 27545 28747 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763576.1 protein_id gnl|my_center|LOCUS_13640 28904 29212 gene locus_tag LOCUS_13650 28904 29212 CDS product YunC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066065.1 protein_id gnl|my_center|LOCUS_13650 29298 30329 gene locus_tag LOCUS_13660 29298 30329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 30335 30976 gene locus_tag LOCUS_13670 30335 30976 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798635.1 protein_id gnl|my_center|LOCUS_13670 31098 31958 gene locus_tag LOCUS_13680 31098 31958 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583214.1 protein_id gnl|my_center|LOCUS_13680 31995 33893 gene locus_tag LOCUS_13690 31995 33893 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249526.1 protein_id gnl|my_center|LOCUS_13690 33905 34972 gene locus_tag LOCUS_13700 33905 34972 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_13700 36478 35006 gene locus_tag LOCUS_13710 36478 35006 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_13710 36902 36747 gene locus_tag LOCUS_13720 36902 36747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 38262 37135 gene locus_tag LOCUS_13730 38262 37135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 40295 38352 gene locus_tag LOCUS_13740 40295 38352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 41154 40489 gene locus_tag LOCUS_13750 41154 40489 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582946.1 protein_id gnl|my_center|LOCUS_13750 41474 42340 gene locus_tag LOCUS_13760 41474 42340 CDS product 7,8-dihydropterin-6-methyl-4-(beta-D-ribofuranosyl)-aminobenzene-5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869799.1 protein_id gnl|my_center|LOCUS_13760 42389 43933 gene locus_tag LOCUS_13770 42389 43933 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732280.1 protein_id gnl|my_center|LOCUS_13770 43930 45006 gene locus_tag LOCUS_13780 43930 45006 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_13780 45003 45938 gene locus_tag LOCUS_13790 45003 45938 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_13790 46128 47450 gene locus_tag LOCUS_13800 46128 47450 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228579.1 protein_id gnl|my_center|LOCUS_13800 48342 47455 gene locus_tag LOCUS_13810 48342 47455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 49033 48326 gene locus_tag LOCUS_13820 gene cobB 49033 48326 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762545.1 protein_id gnl|my_center|LOCUS_13820 50393 49083 gene locus_tag LOCUS_13830 50393 49083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 52078 50390 gene locus_tag LOCUS_13840 52078 50390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 52132 52860 gene locus_tag LOCUS_13850 52132 52860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 52841 53521 gene locus_tag LOCUS_13860 52841 53521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 54746 53487 gene locus_tag LOCUS_13870 54746 53487 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867591.1 protein_id gnl|my_center|LOCUS_13870 55190 54759 gene locus_tag LOCUS_13880 55190 54759 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870773.1 protein_id gnl|my_center|LOCUS_13880 57029 55236 gene locus_tag LOCUS_13890 57029 55236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 57248 57063 gene locus_tag LOCUS_13900 57248 57063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 57477 57259 gene locus_tag LOCUS_13910 57477 57259 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867791.1 protein_id gnl|my_center|LOCUS_13910 57919 57521 gene locus_tag LOCUS_13920 gene rpl7ae 57919 57521 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240293.1 protein_id gnl|my_center|LOCUS_13920 59032 57950 gene locus_tag LOCUS_13930 gene fni 59032 57950 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904022.1 protein_id gnl|my_center|LOCUS_13930 59877 59029 gene locus_tag LOCUS_13940 gene amrB 59877 59029 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875685.1 protein_id gnl|my_center|LOCUS_13940 60538 59885 gene locus_tag LOCUS_13950 gene rpsB 60538 59885 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250447.1 protein_id gnl|my_center|LOCUS_13950 60746 60543 gene locus_tag LOCUS_13960 60746 60543 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980138.1 protein_id gnl|my_center|LOCUS_13960 60839 61825 gene locus_tag LOCUS_13970 60839 61825 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879552.1 protein_id gnl|my_center|LOCUS_13970 61803 63041 gene locus_tag LOCUS_13980 61803 63041 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251169.1 protein_id gnl|my_center|LOCUS_13980 64069 63038 gene locus_tag LOCUS_13990 gene cdc6-1 64069 63038 CDS product ORC1-type DNA replication protein Cdc6-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877024.1 protein_id gnl|my_center|LOCUS_13990 65289 64282 gene locus_tag LOCUS_14000 65289 64282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 65394 66530 gene locus_tag LOCUS_14010 65394 66530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 66906 66520 gene locus_tag LOCUS_14020 66906 66520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 67282 67357 gene locus_tag LOCUS_t00370 67282 67357 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 67389 67670 gene locus_tag LOCUS_14030 67389 67670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 67971 67675 gene locus_tag LOCUS_14040 67971 67675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 68011 68349 gene locus_tag LOCUS_14050 68011 68349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 68540 69166 gene locus_tag LOCUS_14060 68540 69166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 69171 69320 gene locus_tag LOCUS_14070 69171 69320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 69310 71049 gene locus_tag LOCUS_14080 69310 71049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 71619 71032 gene locus_tag LOCUS_14090 71619 71032 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868259.1 protein_id gnl|my_center|LOCUS_14090 71651 71728 gene locus_tag LOCUS_t00380 71651 71728 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 72128 71742 gene locus_tag LOCUS_14100 72128 71742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 >Feature sequence09 570 983 gene locus_tag LOCUS_14110 570 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 961 2541 gene locus_tag LOCUS_14120 961 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 4228 2585 gene locus_tag LOCUS_14130 4228 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 4493 5101 gene locus_tag LOCUS_14140 4493 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 5738 5109 gene locus_tag LOCUS_14150 5738 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 8219 6081 gene locus_tag LOCUS_14160 8219 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 8640 8368 gene locus_tag LOCUS_14170 8640 8368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 8618 12625 gene locus_tag LOCUS_14180 8618 12625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 13056 12838 gene locus_tag LOCUS_14190 13056 12838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 13297 13689 gene locus_tag LOCUS_14200 13297 13689 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081206.1 protein_id gnl|my_center|LOCUS_14200 13658 13990 gene locus_tag LOCUS_14210 13658 13990 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081204.1 protein_id gnl|my_center|LOCUS_14210 14592 14741 gene locus_tag LOCUS_14220 14592 14741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 14720 14974 gene locus_tag LOCUS_14230 14720 14974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 15348 16556 gene locus_tag LOCUS_14240 15348 16556 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868019.1 protein_id gnl|my_center|LOCUS_14240 17757 17143 gene locus_tag LOCUS_14250 17757 17143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 17810 18601 gene locus_tag LOCUS_14260 17810 18601 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868648.1 protein_id gnl|my_center|LOCUS_14260 19080 18943 gene locus_tag LOCUS_14270 19080 18943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 19305 20297 gene locus_tag LOCUS_14280 19305 20297 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763671.1 protein_id gnl|my_center|LOCUS_14280 21209 20319 gene locus_tag LOCUS_14290 21209 20319 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867579.1 protein_id gnl|my_center|LOCUS_14290 22236 21199 gene locus_tag LOCUS_14300 22236 21199 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867578.1 protein_id gnl|my_center|LOCUS_14300 23719 22226 gene locus_tag LOCUS_14310 23719 22226 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867577.1 protein_id gnl|my_center|LOCUS_14310 25055 23751 gene locus_tag LOCUS_14320 25055 23751 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867576.1 protein_id gnl|my_center|LOCUS_14320 25121 25825 gene locus_tag LOCUS_14330 25121 25825 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867607.1 protein_id gnl|my_center|LOCUS_14330 25975 27759 gene locus_tag LOCUS_14340 25975 27759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 28787 27855 gene locus_tag LOCUS_14350 28787 27855 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902161.1 protein_id gnl|my_center|LOCUS_14350 28957 29265 gene locus_tag LOCUS_14360 28957 29265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 29243 29554 gene locus_tag LOCUS_14370 29243 29554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14370 29551 29703 gene locus_tag LOCUS_14380 29551 29703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14380 29843 31636 gene locus_tag LOCUS_14390 29843 31636 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146750.1 protein_id gnl|my_center|LOCUS_14390 32626 31655 gene locus_tag LOCUS_14400 gene ala 32626 31655 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879161.1 protein_id gnl|my_center|LOCUS_14400 32878 33588 gene locus_tag LOCUS_14410 32878 33588 CDS product ubiquinone/menaquinone biosynthesis methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012765.1 protein_id gnl|my_center|LOCUS_14410 33955 33569 gene locus_tag LOCUS_14420 33955 33569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 34005 34364 gene locus_tag LOCUS_14430 34005 34364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 34410 35021 gene locus_tag LOCUS_14440 34410 35021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 35011 35430 gene locus_tag LOCUS_14450 35011 35430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 35427 36380 gene locus_tag LOCUS_14460 gene cas7a 35427 36380 CDS product type I-A CRISPR-associated protein Cas7/Csa2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147281.1 protein_id gnl|my_center|LOCUS_14460 36370 37155 gene locus_tag LOCUS_14470 gene cas5a 36370 37155 CDS product type I-A CRISPR-associated protein Cas5a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980734.1 protein_id gnl|my_center|LOCUS_14470 37121 38125 gene locus_tag LOCUS_14480 37121 38125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 38727 39533 gene locus_tag LOCUS_14490 38727 39533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 41294 39540 gene locus_tag LOCUS_14500 41294 39540 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867909.1 protein_id gnl|my_center|LOCUS_14500 41682 41915 gene locus_tag LOCUS_14510 41682 41915 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080635.1 protein_id gnl|my_center|LOCUS_14510 42289 41924 gene locus_tag LOCUS_14520 42289 41924 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867780.1 protein_id gnl|my_center|LOCUS_14520 43463 42375 gene locus_tag LOCUS_14530 43463 42375 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147062.1 protein_id gnl|my_center|LOCUS_14530 44876 43602 gene locus_tag LOCUS_14540 44876 43602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 45390 44902 gene locus_tag LOCUS_14550 45390 44902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 47076 45706 gene locus_tag LOCUS_14560 47076 45706 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762511.1 protein_id gnl|my_center|LOCUS_14560 47361 47086 gene locus_tag LOCUS_14570 47361 47086 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846230.1 protein_id gnl|my_center|LOCUS_14570 47967 48911 gene locus_tag LOCUS_14580 47967 48911 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937413.1 protein_id gnl|my_center|LOCUS_14580 48916 49362 gene locus_tag LOCUS_14590 48916 49362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 49425 50036 gene locus_tag LOCUS_14600 49425 50036 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761990.1 protein_id gnl|my_center|LOCUS_14600 50033 50872 gene locus_tag LOCUS_14610 50033 50872 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007204.1 protein_id gnl|my_center|LOCUS_14610 53092 51188 gene locus_tag LOCUS_14620 53092 51188 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870139.1 protein_id gnl|my_center|LOCUS_14620 54164 53583 gene locus_tag LOCUS_14630 54164 53583 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877737.1 protein_id gnl|my_center|LOCUS_14630 54590 55438 gene locus_tag LOCUS_14640 54590 55438 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762112.1 protein_id gnl|my_center|LOCUS_14640 55453 56106 gene locus_tag LOCUS_14650 55453 56106 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763543.1 protein_id gnl|my_center|LOCUS_14650 56112 56855 gene locus_tag LOCUS_14660 56112 56855 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_14660 56848 57525 gene locus_tag LOCUS_14670 56848 57525 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937694.1 protein_id gnl|my_center|LOCUS_14670 >Feature sequence10 287 1309 gene locus_tag LOCUS_14680 287 1309 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880876.1 protein_id gnl|my_center|LOCUS_14680 2250 1327 gene locus_tag LOCUS_14690 2250 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 2791 2306 gene locus_tag LOCUS_14700 2791 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156007889.1 protein_id gnl|my_center|LOCUS_14700 3777 2857 gene locus_tag LOCUS_14710 3777 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 4494 3889 gene locus_tag LOCUS_14720 4494 3889 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868013.1 protein_id gnl|my_center|LOCUS_14720 4953 5141 gene locus_tag LOCUS_14730 4953 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 5481 5735 gene locus_tag LOCUS_14740 5481 5735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 5912 6424 gene locus_tag LOCUS_14750 5912 6424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 6956 6621 gene locus_tag LOCUS_14760 gene metG 6956 6621 CDS product methionine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249194.1 protein_id gnl|my_center|LOCUS_14760 7333 7091 gene locus_tag LOCUS_14770 7333 7091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 7745 7936 gene locus_tag LOCUS_14780 7745 7936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 8615 8974 gene locus_tag LOCUS_14790 8615 8974 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867143.1 protein_id gnl|my_center|LOCUS_14790 9721 9936 gene locus_tag LOCUS_14800 9721 9936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 9938 10087 gene locus_tag LOCUS_14810 9938 10087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 10087 10695 gene locus_tag LOCUS_14820 10087 10695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 10682 11572 gene locus_tag LOCUS_14830 10682 11572 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079210.1 protein_id gnl|my_center|LOCUS_14830 12328 12005 gene locus_tag LOCUS_14840 12328 12005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 12727 12416 gene locus_tag LOCUS_14850 12727 12416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 14169 12961 gene locus_tag LOCUS_14860 14169 12961 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582517.1 protein_id gnl|my_center|LOCUS_14860 15101 14166 gene locus_tag LOCUS_14870 15101 14166 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966215.1 protein_id gnl|my_center|LOCUS_14870 15299 15490 gene locus_tag LOCUS_14880 15299 15490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 15487 15915 gene locus_tag LOCUS_14890 15487 15915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 17978 16152 gene locus_tag LOCUS_14900 17978 16152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 18652 17975 gene locus_tag LOCUS_14910 18652 17975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 20547 18760 gene locus_tag LOCUS_14920 20547 18760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 21361 20810 gene locus_tag LOCUS_14930 21361 20810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 21942 21412 gene locus_tag LOCUS_14940 21942 21412 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060742.1 protein_id gnl|my_center|LOCUS_14940 22285 23589 gene locus_tag LOCUS_14950 22285 23589 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053195.1 protein_id gnl|my_center|LOCUS_14950 24534 23728 gene locus_tag LOCUS_14960 24534 23728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 24672 25565 gene locus_tag LOCUS_14970 24672 25565 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021397.1 protein_id gnl|my_center|LOCUS_14970 26592 25636 gene locus_tag LOCUS_14980 26592 25636 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546059.1 protein_id gnl|my_center|LOCUS_14980 26654 27112 gene locus_tag LOCUS_14990 26654 27112 CDS product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066877438.1 protein_id gnl|my_center|LOCUS_14990 28076 27078 gene locus_tag LOCUS_15000 gene thiF 28076 27078 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245868.1 protein_id gnl|my_center|LOCUS_15000 28250 29470 gene locus_tag LOCUS_15010 gene nifS 28250 29470 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_15010 29457 30005 gene locus_tag LOCUS_15020 29457 30005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 30002 30259 gene locus_tag LOCUS_15030 30002 30259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 30262 31392 gene locus_tag LOCUS_15040 gene thiI 30262 31392 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496669.1 protein_id gnl|my_center|LOCUS_15040 32564 40672 gene locus_tag LOCUS_15050 32564 40672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 41832 40693 gene locus_tag LOCUS_15060 41832 40693 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761873.1 protein_id gnl|my_center|LOCUS_15060 42920 41817 gene locus_tag LOCUS_15070 gene ahbD 42920 41817 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_15070 >Feature sequence11 4 6430 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gaatcccgaaaagggagttgaaag 7826 7179 gene locus_tag LOCUS_15080 7826 7179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 10048 8453 gene locus_tag LOCUS_15090 gene cas3 10048 8453 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868140.1 protein_id gnl|my_center|LOCUS_15090 11208 10045 gene locus_tag LOCUS_15100 gene cas8a2 11208 10045 CDS product type I-A CRISPR-associated protein Cas8a2/Csx9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868141.1 protein_id gnl|my_center|LOCUS_15100 11980 11258 gene locus_tag LOCUS_15110 gene cas5a 11980 11258 CDS product type I-A CRISPR-associated protein Cas5a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202795687.1 protein_id gnl|my_center|LOCUS_15110 12987 11995 gene locus_tag LOCUS_15120 gene cas7a 12987 11995 CDS product type I-A CRISPR-associated protein Cas7/Csa2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147281.1 protein_id gnl|my_center|LOCUS_15120 13327 12992 gene locus_tag LOCUS_15130 13327 12992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 13858 13643 gene locus_tag LOCUS_15140 13858 13643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 15569 14670 gene locus_tag LOCUS_15150 15569 14670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 16624 15566 gene locus_tag LOCUS_15160 16624 15566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 17016 16621 gene locus_tag LOCUS_15170 17016 16621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 17885 17013 gene locus_tag LOCUS_15180 gene cmr4 17885 17013 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880200.1 protein_id gnl|my_center|LOCUS_15180 18972 17878 gene locus_tag LOCUS_15190 18972 17878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 21789 18973 gene locus_tag LOCUS_15200 21789 18973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 22823 23032 gene locus_tag LOCUS_15210 22823 23032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 23033 23254 gene locus_tag LOCUS_15220 23033 23254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 24057 24290 gene locus_tag LOCUS_15230 24057 24290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 24287 24691 gene locus_tag LOCUS_15240 24287 24691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 24840 25604 gene locus_tag LOCUS_15250 24840 25604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 25881 26309 gene locus_tag LOCUS_15260 25881 26309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 26341 27555 gene locus_tag LOCUS_15270 26341 27555 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869050.1 protein_id gnl|my_center|LOCUS_15270 28738 27782 gene locus_tag LOCUS_15280 28738 27782 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240546.1 protein_id gnl|my_center|LOCUS_15280 30907 28754 gene locus_tag LOCUS_15290 30907 28754 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_15290 32297 31101 gene locus_tag LOCUS_15300 32297 31101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 32572 32715 gene locus_tag LOCUS_15310 32572 32715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 33403 33630 gene locus_tag LOCUS_15320 33403 33630 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240527.1 protein_id gnl|my_center|LOCUS_15320 33743 34027 gene locus_tag LOCUS_15330 33743 34027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 34513 34094 gene locus_tag LOCUS_15340 34513 34094 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248971.1 protein_id gnl|my_center|LOCUS_15340 34745 34500 gene locus_tag LOCUS_15350 34745 34500 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146815.1 protein_id gnl|my_center|LOCUS_15350 35394 35726 gene locus_tag LOCUS_15360 35394 35726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 35723 36121 gene locus_tag LOCUS_15370 35723 36121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 36840 36502 gene locus_tag LOCUS_15380 36840 36502 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879110.1 protein_id gnl|my_center|LOCUS_15380 37257 36931 gene locus_tag LOCUS_15390 37257 36931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15390 37276 37518 gene locus_tag LOCUS_15400 37276 37518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 37825 39972 gene locus_tag LOCUS_15410 37825 39972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 40673 40909 gene locus_tag LOCUS_15420 40673 40909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763095.1 protein_id gnl|my_center|LOCUS_15420 42064 41249 gene locus_tag LOCUS_15430 42064 41249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence12 314 967 gene locus_tag LOCUS_15440 314 967 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147211.1 protein_id gnl|my_center|LOCUS_15440 933 2000 gene locus_tag LOCUS_15450 gene spn 933 2000 CDS product bifunctional sugar-1-phosphate nucleotidylyltransferase/acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978425.1 protein_id gnl|my_center|LOCUS_15450 3186 1993 gene locus_tag LOCUS_15460 3186 1993 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061074.1 protein_id gnl|my_center|LOCUS_15460 3255 3854 gene locus_tag LOCUS_15470 3255 3854 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978423.1 protein_id gnl|my_center|LOCUS_15470 3859 4302 gene locus_tag LOCUS_15480 3859 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 4293 4931 gene locus_tag LOCUS_15490 4293 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 4928 5266 gene locus_tag LOCUS_15500 4928 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 5340 6050 gene locus_tag LOCUS_15510 gene psmA 5340 6050 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877997.1 protein_id gnl|my_center|LOCUS_15510 6058 6735 gene locus_tag LOCUS_15520 6058 6735 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496552.1 protein_id gnl|my_center|LOCUS_15520 6728 7420 gene locus_tag LOCUS_15530 gene rrp4 6728 7420 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250586.1 protein_id gnl|my_center|LOCUS_15530 7437 8198 gene locus_tag LOCUS_15540 gene rrp41 7437 8198 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867734.1 protein_id gnl|my_center|LOCUS_15540 8198 9004 gene locus_tag LOCUS_15550 gene rrp42 8198 9004 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867735.1 protein_id gnl|my_center|LOCUS_15550 9006 9254 gene locus_tag LOCUS_15560 9006 9254 CDS product 50S ribosomal protein L37ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867396.1 protein_id gnl|my_center|LOCUS_15560 9251 9853 gene locus_tag LOCUS_15570 9251 9853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 9798 10040 gene locus_tag LOCUS_15580 9798 10040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 10717 9995 gene locus_tag LOCUS_15590 10717 9995 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228266.1 protein_id gnl|my_center|LOCUS_15590 11511 10714 gene locus_tag LOCUS_15600 11511 10714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 11573 11649 gene locus_tag LOCUS_t00390 11573 11649 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 13219 11651 gene locus_tag LOCUS_15610 13219 11651 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871145.1 protein_id gnl|my_center|LOCUS_15610 13239 13781 gene locus_tag LOCUS_15620 13239 13781 CDS product GTP-dependent dephospho-CoA kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878611.1 protein_id gnl|my_center|LOCUS_15620 15522 13768 gene locus_tag LOCUS_15630 gene tgtA 15522 13768 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068322314.1 protein_id gnl|my_center|LOCUS_15630 16007 17146 gene locus_tag LOCUS_15640 16007 17146 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021498.1 protein_id gnl|my_center|LOCUS_15640 17158 17940 gene locus_tag LOCUS_15650 17158 17940 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978333.1 protein_id gnl|my_center|LOCUS_15650 18265 17924 gene locus_tag LOCUS_15660 18265 17924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 18531 18259 gene locus_tag LOCUS_15670 18531 18259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 19193 18528 gene locus_tag LOCUS_15680 19193 18528 CDS product Era-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878677.1 protein_id gnl|my_center|LOCUS_15680 20431 19277 gene locus_tag LOCUS_15690 20431 19277 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869657.1 protein_id gnl|my_center|LOCUS_15690 21968 20595 gene locus_tag LOCUS_15700 gene purB 21968 20595 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868368.1 protein_id gnl|my_center|LOCUS_15700 24066 21943 gene locus_tag LOCUS_15710 24066 21943 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868004.1 protein_id gnl|my_center|LOCUS_15710 27432 24073 gene locus_tag LOCUS_15720 27432 24073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 27929 27432 gene locus_tag LOCUS_15730 27929 27432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 27991 28845 gene locus_tag LOCUS_15740 27991 28845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 28879 28964 gene locus_tag LOCUS_t00400 28879 28964 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 30129 28975 gene locus_tag LOCUS_15750 30129 28975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 30218 30628 gene locus_tag LOCUS_15760 30218 30628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 30604 31098 gene locus_tag LOCUS_15770 30604 31098 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250286.1 protein_id gnl|my_center|LOCUS_15770 31851 31093 gene locus_tag LOCUS_15780 31851 31093 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224412629.1 protein_id gnl|my_center|LOCUS_15780 33034 31976 gene locus_tag LOCUS_15790 33034 31976 CDS product TIGR01177 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876363.1 protein_id gnl|my_center|LOCUS_15790 34062 33031 gene locus_tag LOCUS_15800 34062 33031 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867947.1 protein_id gnl|my_center|LOCUS_15800 35194 34073 gene locus_tag LOCUS_15810 35194 34073 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867359.1 protein_id gnl|my_center|LOCUS_15810 36319 35210 gene locus_tag LOCUS_15820 36319 35210 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251116.1 protein_id gnl|my_center|LOCUS_15820 36930 36334 gene locus_tag LOCUS_15830 gene psmB 36930 36334 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762506.1 protein_id gnl|my_center|LOCUS_15830 37032 36957 gene locus_tag LOCUS_t00410 37032 36957 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 38745 37069 gene locus_tag LOCUS_15840 38745 37069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 39077 38742 gene locus_tag LOCUS_15850 39077 38742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 39291 39207 gene locus_tag LOCUS_t00420 39291 39207 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence13 4584 967 gene locus_tag LOCUS_15860 4584 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 4940 6604 gene locus_tag LOCUS_15870 gene ade 4940 6604 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392001.1 protein_id gnl|my_center|LOCUS_15870 6604 7290 gene locus_tag LOCUS_15880 6604 7290 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082974.1 protein_id gnl|my_center|LOCUS_15880 7291 8193 gene locus_tag LOCUS_15890 gene mtgA 7291 8193 CDS product methylcobalamin--tetrahydrofolate methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816523.1 protein_id gnl|my_center|LOCUS_15890 9502 8309 gene locus_tag LOCUS_15900 9502 8309 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065687.1 protein_id gnl|my_center|LOCUS_15900 9553 10251 gene locus_tag LOCUS_15910 gene sfsA 9553 10251 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877131.1 protein_id gnl|my_center|LOCUS_15910 12646 10238 gene locus_tag LOCUS_15920 12646 10238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 13655 12651 gene locus_tag LOCUS_15930 13655 12651 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250860.1 protein_id gnl|my_center|LOCUS_15930 14788 13751 gene locus_tag LOCUS_15940 14788 13751 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877642.1 protein_id gnl|my_center|LOCUS_15940 14913 15707 gene locus_tag LOCUS_15950 14913 15707 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979496.1 protein_id gnl|my_center|LOCUS_15950 16123 15704 gene locus_tag LOCUS_15960 16123 15704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 16896 16138 gene locus_tag LOCUS_15970 gene nucF 16896 16138 CDS product 5' nucleotidase NucF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243196.1 protein_id gnl|my_center|LOCUS_15970 17437 16877 gene locus_tag LOCUS_15980 17437 16877 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869779.1 protein_id gnl|my_center|LOCUS_15980 17803 17501 gene locus_tag LOCUS_15990 17803 17501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 18492 17869 gene locus_tag LOCUS_16000 18492 17869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 19621 18497 gene locus_tag LOCUS_16010 19621 18497 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250787.1 protein_id gnl|my_center|LOCUS_16010 19850 19611 gene locus_tag LOCUS_16020 19850 19611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 20638 19856 gene locus_tag LOCUS_16030 20638 19856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 21501 20695 gene locus_tag LOCUS_16040 21501 20695 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878207.1 protein_id gnl|my_center|LOCUS_16040 22256 21498 gene locus_tag LOCUS_16050 22256 21498 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066032.1 protein_id gnl|my_center|LOCUS_16050 23137 22253 gene locus_tag LOCUS_16060 23137 22253 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227962.1 protein_id gnl|my_center|LOCUS_16060 23624 24802 gene locus_tag LOCUS_16070 23624 24802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 25658 24786 gene locus_tag LOCUS_16080 25658 24786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 25698 27617 gene locus_tag LOCUS_16090 25698 27617 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762340.1 protein_id gnl|my_center|LOCUS_16090 28275 27598 gene locus_tag LOCUS_16100 28275 27598 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762886.1 protein_id gnl|my_center|LOCUS_16100 28655 28275 gene locus_tag LOCUS_16110 28655 28275 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196772272.1 protein_id gnl|my_center|LOCUS_16110 30112 28652 gene locus_tag LOCUS_16120 30112 28652 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015590803.1 protein_id gnl|my_center|LOCUS_16120 30285 30100 gene locus_tag LOCUS_16130 30285 30100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 31217 30318 gene locus_tag LOCUS_16140 31217 30318 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870653.1 protein_id gnl|my_center|LOCUS_16140 31464 32837 gene locus_tag LOCUS_16150 31464 32837 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868347.1 protein_id gnl|my_center|LOCUS_16150 32870 34066 gene locus_tag LOCUS_16160 32870 34066 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021450.1 protein_id gnl|my_center|LOCUS_16160 34958 34071 gene locus_tag LOCUS_16170 34958 34071 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762507.1 protein_id gnl|my_center|LOCUS_16170 35716 34955 gene locus_tag LOCUS_16180 35716 34955 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762508.1 protein_id gnl|my_center|LOCUS_16180 36750 35755 gene locus_tag LOCUS_16190 36750 35755 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146584.1 protein_id gnl|my_center|LOCUS_16190 37238 36747 gene locus_tag LOCUS_16200 37238 36747 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251052.1 protein_id gnl|my_center|LOCUS_16200 37361 37876 gene locus_tag LOCUS_16210 37361 37876 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867429.1 protein_id gnl|my_center|LOCUS_16210 37929 38444 gene locus_tag LOCUS_16220 37929 38444 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878792.1 protein_id gnl|my_center|LOCUS_16220 >Feature sequence14 742 149 gene locus_tag LOCUS_16230 gene cas4 742 149 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003042183.1 protein_id gnl|my_center|LOCUS_16230 992 714 gene locus_tag LOCUS_16240 992 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 1999 992 gene locus_tag LOCUS_16250 gene cas1 1999 992 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256457.1 protein_id gnl|my_center|LOCUS_16250 2907 1996 gene locus_tag LOCUS_16260 gene cas4a 2907 1996 CDS product type I-A CRISPR-associated protein Cas4/Csa1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977960.1 protein_id gnl|my_center|LOCUS_16260 3189 3785 gene locus_tag LOCUS_16270 3189 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 5852 4077 gene locus_tag LOCUS_16280 5852 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 6178 7509 gene locus_tag LOCUS_16290 6178 7509 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021092.1 protein_id gnl|my_center|LOCUS_16290 8929 7697 gene locus_tag LOCUS_16300 8929 7697 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249727.1 protein_id gnl|my_center|LOCUS_16300 9252 9013 gene locus_tag LOCUS_16310 9252 9013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 10198 9782 gene locus_tag LOCUS_16320 10198 9782 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868416.1 protein_id gnl|my_center|LOCUS_16320 10454 10176 gene locus_tag LOCUS_16330 10454 10176 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014121434.1 protein_id gnl|my_center|LOCUS_16330 11001 11420 gene locus_tag LOCUS_16340 11001 11420 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763263.1 protein_id gnl|my_center|LOCUS_16340 11417 11818 gene locus_tag LOCUS_16350 11417 11818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 13930 12197 gene locus_tag LOCUS_16360 gene ade 13930 12197 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392001.1 protein_id gnl|my_center|LOCUS_16360 14871 14599 gene locus_tag LOCUS_16370 14871 14599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 15924 15055 gene locus_tag LOCUS_16380 15924 15055 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081450.1 protein_id gnl|my_center|LOCUS_16380 16537 16109 gene locus_tag LOCUS_16390 16537 16109 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846630.1 protein_id gnl|my_center|LOCUS_16390 17001 16549 gene locus_tag LOCUS_16400 17001 16549 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979773.1 protein_id gnl|my_center|LOCUS_16400 17520 19052 gene locus_tag LOCUS_16410 17520 19052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 19722 20288 gene locus_tag LOCUS_16420 19722 20288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 22966 20327 gene locus_tag LOCUS_16430 22966 20327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 23028 23300 gene locus_tag LOCUS_16440 23028 23300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 23615 23412 gene locus_tag LOCUS_16450 23615 23412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 23686 24156 gene locus_tag LOCUS_16460 23686 24156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 >Feature sequence15 1874 2086 gene locus_tag LOCUS_16470 1874 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 2076 2462 gene locus_tag LOCUS_16480 2076 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 2545 2766 gene locus_tag LOCUS_16490 2545 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 2763 3017 gene locus_tag LOCUS_16500 2763 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 3470 3727 gene locus_tag LOCUS_16510 3470 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 3711 4166 gene locus_tag LOCUS_16520 3711 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 5265 4858 gene locus_tag LOCUS_16530 5265 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 5483 5253 gene locus_tag LOCUS_16540 5483 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 6112 6699 gene locus_tag LOCUS_16550 6112 6699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 6725 7222 gene locus_tag LOCUS_16560 6725 7222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 8267 7434 gene locus_tag LOCUS_16570 8267 7434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 8478 9392 gene locus_tag LOCUS_16580 8478 9392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 9389 10369 gene locus_tag LOCUS_16590 9389 10369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 10401 11066 gene locus_tag LOCUS_16600 10401 11066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 11470 11757 gene locus_tag LOCUS_16610 11470 11757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 11754 12005 gene locus_tag LOCUS_16620 11754 12005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 12291 12121 gene locus_tag LOCUS_16630 12291 12121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 12496 12329 gene locus_tag LOCUS_16640 12496 12329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 13185 12622 gene locus_tag LOCUS_16650 13185 12622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 13549 13130 gene locus_tag LOCUS_16660 13549 13130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 13941 13774 gene locus_tag LOCUS_16670 13941 13774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 14249 14001 gene locus_tag LOCUS_16680 14249 14001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 14716 15036 gene locus_tag LOCUS_16690 14716 15036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 15047 15373 gene locus_tag LOCUS_16700 15047 15373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 15392 15697 gene locus_tag LOCUS_16710 15392 15697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 16047 15694 gene locus_tag LOCUS_16720 16047 15694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 16801 16529 gene locus_tag LOCUS_16730 16801 16529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 17047 17553 gene locus_tag LOCUS_16740 17047 17553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 18567 18821 gene locus_tag LOCUS_16750 18567 18821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 18787 19266 gene locus_tag LOCUS_16760 18787 19266 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248955.1 protein_id gnl|my_center|LOCUS_16760 19521 19201 gene locus_tag LOCUS_16770 19521 19201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 >Feature sequence16 134 1405 gene locus_tag LOCUS_16780 gene cytX 134 1405 CDS product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256688.1 protein_id gnl|my_center|LOCUS_16780 1393 2760 gene locus_tag LOCUS_16790 1393 2760 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868207.1 protein_id gnl|my_center|LOCUS_16790 2757 3278 gene locus_tag LOCUS_16800 gene thiW 2757 3278 CDS product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870435.1 protein_id gnl|my_center|LOCUS_16800 3247 3819 gene locus_tag LOCUS_16810 3247 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 3954 4355 gene locus_tag LOCUS_16820 3954 4355 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978742.1 protein_id gnl|my_center|LOCUS_16820 4333 4650 gene locus_tag LOCUS_16830 4333 4650 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879110.1 protein_id gnl|my_center|LOCUS_16830 4899 5834 gene locus_tag LOCUS_16840 4899 5834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 6370 5933 gene locus_tag LOCUS_16850 6370 5933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 6647 6360 gene locus_tag LOCUS_16860 6647 6360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 7039 6758 gene locus_tag LOCUS_16870 7039 6758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 7191 8216 gene locus_tag LOCUS_16880 7191 8216 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146519.1 protein_id gnl|my_center|LOCUS_16880 8372 8836 gene locus_tag LOCUS_16890 8372 8836 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250161.1 protein_id gnl|my_center|LOCUS_16890 8886 9917 gene locus_tag LOCUS_16900 gene ahbD 8886 9917 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_16900 9914 10462 gene locus_tag LOCUS_16910 9914 10462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 10810 11013 gene locus_tag LOCUS_16920 10810 11013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 11010 11444 gene locus_tag LOCUS_16930 11010 11444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 11684 13267 gene locus_tag LOCUS_16940 11684 13267 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656519.1 protein_id gnl|my_center|LOCUS_16940 13318 13875 gene locus_tag LOCUS_16950 13318 13875 CDS product ECF-type riboflavin transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921974.1 protein_id gnl|my_center|LOCUS_16950 13877 14665 gene locus_tag LOCUS_16960 13877 14665 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148083.1 protein_id gnl|my_center|LOCUS_16960 15478 14690 gene locus_tag LOCUS_16970 15478 14690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 >Feature sequence17 1393 647 gene locus_tag LOCUS_16980 1393 647 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082259.1 protein_id gnl|my_center|LOCUS_16980 2289 1420 gene locus_tag LOCUS_16990 2289 1420 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162828730.1 protein_id gnl|my_center|LOCUS_16990 3088 2312 gene locus_tag LOCUS_17000 3088 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 3620 3186 gene locus_tag LOCUS_17010 3620 3186 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021853.1 protein_id gnl|my_center|LOCUS_17010 4011 3613 gene locus_tag LOCUS_17020 4011 3613 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877770.1 protein_id gnl|my_center|LOCUS_17020 5052 4063 gene locus_tag LOCUS_17030 5052 4063 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878132.1 protein_id gnl|my_center|LOCUS_17030 5539 5024 gene locus_tag LOCUS_17040 gene leuD 5539 5024 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_17040 6786 5536 gene locus_tag LOCUS_17050 gene leuC 6786 5536 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081330.1 protein_id gnl|my_center|LOCUS_17050 8263 6755 gene locus_tag LOCUS_17060 8263 6755 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870707.1 protein_id gnl|my_center|LOCUS_17060 8466 9293 gene locus_tag LOCUS_17070 gene udp 8466 9293 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250430.1 protein_id gnl|my_center|LOCUS_17070 <10793 9325 gene locus_tag LOCUS_17080 <10793 9325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878793.1:CDC48 family AAA ATPase >Feature sequence18 3658 1817 gene locus_tag LOCUS_17090 3658 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 4092 3655 gene locus_tag LOCUS_17100 4092 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 4715 4296 gene locus_tag LOCUS_17110 4715 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 5020 4700 gene locus_tag LOCUS_17120 5020 4700 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393074.1 protein_id gnl|my_center|LOCUS_17120 6136 5210 gene locus_tag LOCUS_17130 6136 5210 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015848914.1 protein_id gnl|my_center|LOCUS_17130 <8432 6168 gene locus_tag LOCUS_17140 <8432 6168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249244.1:glycyl radical protein >Feature sequence19 602 231 gene locus_tag LOCUS_17150 602 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 2119 608 gene locus_tag LOCUS_17160 2119 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 3800 2121 gene locus_tag LOCUS_17170 3800 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170