>Feature sequence01 <1 1212 gene locus_tag LOCUS_00010 <1 1212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870830.1:aconitase X 1929 1222 gene locus_tag LOCUS_00020 1929 1222 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 protein_id gnl|my_center|LOCUS_00020 2656 1916 gene locus_tag LOCUS_00030 2656 1916 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812849.1 protein_id gnl|my_center|LOCUS_00030 3612 2653 gene locus_tag LOCUS_00040 3612 2653 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948215.1 protein_id gnl|my_center|LOCUS_00040 4529 3612 gene locus_tag LOCUS_00050 4529 3612 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_00050 5826 4591 gene locus_tag LOCUS_00060 5826 4591 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_00060 6118 7059 gene locus_tag LOCUS_00070 gene argF 6118 7059 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584136.1 protein_id gnl|my_center|LOCUS_00070 7095 8030 gene locus_tag LOCUS_00080 gene arcC 7095 8030 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251108.1 protein_id gnl|my_center|LOCUS_00080 9348 8062 gene locus_tag LOCUS_00090 9348 8062 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064354.1 protein_id gnl|my_center|LOCUS_00090 9579 10871 gene locus_tag LOCUS_00100 9579 10871 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014146.1 protein_id gnl|my_center|LOCUS_00100 11253 10852 gene locus_tag LOCUS_00110 11253 10852 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251148.1 protein_id gnl|my_center|LOCUS_00110 11456 12166 gene locus_tag LOCUS_00120 11456 12166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 13374 12094 gene locus_tag LOCUS_00130 gene hisS 13374 12094 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117814.1 protein_id gnl|my_center|LOCUS_00130 14484 13384 gene locus_tag LOCUS_00140 14484 13384 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052886479.1 protein_id gnl|my_center|LOCUS_00140 15813 14539 gene locus_tag LOCUS_00150 gene hisD 15813 14539 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060775.1 protein_id gnl|my_center|LOCUS_00150 15892 16272 gene locus_tag LOCUS_00160 15892 16272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 16782 16240 gene locus_tag LOCUS_00170 16782 16240 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250125.1 protein_id gnl|my_center|LOCUS_00170 18262 16787 gene locus_tag LOCUS_00180 18262 16787 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869054.1 protein_id gnl|my_center|LOCUS_00180 18403 19104 gene locus_tag LOCUS_00190 18403 19104 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_00190 19076 20686 gene locus_tag LOCUS_00200 19076 20686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 20673 21878 gene locus_tag LOCUS_00210 20673 21878 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_00210 22255 21887 gene locus_tag LOCUS_00220 22255 21887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 22676 22443 gene locus_tag LOCUS_00230 22676 22443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 22994 22695 gene locus_tag LOCUS_00240 22994 22695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 23578 23504 gene locus_tag LOCUS_t00010 23578 23504 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 25286 23619 gene locus_tag LOCUS_00250 25286 23619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 25406 25903 gene locus_tag LOCUS_00260 25406 25903 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197463606.1 protein_id gnl|my_center|LOCUS_00260 26831 25905 gene locus_tag LOCUS_00270 26831 25905 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250104.1 protein_id gnl|my_center|LOCUS_00270 26895 27056 gene locus_tag LOCUS_00280 26895 27056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 27072 27362 gene locus_tag LOCUS_00290 27072 27362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 27366 27953 gene locus_tag LOCUS_00300 27366 27953 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583777.1 protein_id gnl|my_center|LOCUS_00300 27925 29454 gene locus_tag LOCUS_00310 27925 29454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 30170 29445 gene locus_tag LOCUS_00320 gene moeB 30170 29445 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228615.1 protein_id gnl|my_center|LOCUS_00320 30930 30217 gene locus_tag LOCUS_00330 30930 30217 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978563.1 protein_id gnl|my_center|LOCUS_00330 30993 31241 gene locus_tag LOCUS_00340 30993 31241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 31709 31431 gene locus_tag LOCUS_00350 31709 31431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 31862 32101 gene locus_tag LOCUS_00360 31862 32101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 33140 32151 gene locus_tag LOCUS_00370 33140 32151 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582674.1 protein_id gnl|my_center|LOCUS_00370 34378 33140 gene locus_tag LOCUS_00380 34378 33140 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582673.1 protein_id gnl|my_center|LOCUS_00380 34666 34391 gene locus_tag LOCUS_00390 34666 34391 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582672.1 protein_id gnl|my_center|LOCUS_00390 34983 34663 gene locus_tag LOCUS_00400 34983 34663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 36007 35465 gene locus_tag LOCUS_00410 36007 35465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 36243 36845 gene locus_tag LOCUS_00420 36243 36845 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867285.1 protein_id gnl|my_center|LOCUS_00420 36848 37738 gene locus_tag LOCUS_00430 gene surE 36848 37738 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020163.1 protein_id gnl|my_center|LOCUS_00430 38131 37718 gene locus_tag LOCUS_00440 38131 37718 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546500.1 protein_id gnl|my_center|LOCUS_00440 39128 38133 gene locus_tag LOCUS_00450 39128 38133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 39946 39182 gene locus_tag LOCUS_00460 39946 39182 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020689.1 protein_id gnl|my_center|LOCUS_00460 40020 41339 gene locus_tag LOCUS_00470 40020 41339 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877907.1 protein_id gnl|my_center|LOCUS_00470 41600 41331 gene locus_tag LOCUS_00480 41600 41331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 42622 41597 gene locus_tag LOCUS_00490 42622 41597 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762127.1 protein_id gnl|my_center|LOCUS_00490 42997 42623 gene locus_tag LOCUS_00500 42997 42623 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250445.1 protein_id gnl|my_center|LOCUS_00500 43739 42972 gene locus_tag LOCUS_00510 43739 42972 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066594.1 protein_id gnl|my_center|LOCUS_00510 43801 45099 gene locus_tag LOCUS_00520 43801 45099 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867173.1 protein_id gnl|my_center|LOCUS_00520 46069 45089 gene locus_tag LOCUS_00530 46069 45089 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867617.1 protein_id gnl|my_center|LOCUS_00530 46280 46056 gene locus_tag LOCUS_00540 46280 46056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 46302 46997 gene locus_tag LOCUS_00550 46302 46997 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763299.1 protein_id gnl|my_center|LOCUS_00550 47926 46994 gene locus_tag LOCUS_00560 gene radA 47926 46994 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146514.1 protein_id gnl|my_center|LOCUS_00560 48338 48111 gene locus_tag LOCUS_00570 48338 48111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 49344 48526 gene locus_tag LOCUS_00580 49344 48526 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978942.1 protein_id gnl|my_center|LOCUS_00580 49462 50055 gene locus_tag LOCUS_00590 gene tmk 49462 50055 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496455.1 protein_id gnl|my_center|LOCUS_00590 50052 50984 gene locus_tag LOCUS_00600 50052 50984 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762863.1 protein_id gnl|my_center|LOCUS_00600 51016 52011 gene locus_tag LOCUS_00610 51016 52011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 52061 53230 gene locus_tag LOCUS_00620 52061 53230 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_00620 53731 53225 gene locus_tag LOCUS_00630 53731 53225 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762515.1 protein_id gnl|my_center|LOCUS_00630 54505 53738 gene locus_tag LOCUS_00640 54505 53738 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_00640 54839 54507 gene locus_tag LOCUS_00650 54839 54507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 55965 54913 gene locus_tag LOCUS_00660 55965 54913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 58435 55955 gene locus_tag LOCUS_00670 58435 55955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 59782 58505 gene locus_tag LOCUS_00680 gene aspS 59782 58505 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868079.1 protein_id gnl|my_center|LOCUS_00680 62718 59761 gene locus_tag LOCUS_00690 gene ileS 62718 59761 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978404.1 protein_id gnl|my_center|LOCUS_00690 62807 62921 gene locus_tag LOCUS_r00010 62807 62921 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 64043 62919 gene locus_tag LOCUS_00700 gene thiI 64043 62919 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249323.1 protein_id gnl|my_center|LOCUS_00700 64099 66312 gene locus_tag LOCUS_00710 64099 66312 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868838.1 protein_id gnl|my_center|LOCUS_00710 66658 66317 gene locus_tag LOCUS_00720 66658 66317 CDS product 30S ribosomal protein S26e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762572.1 protein_id gnl|my_center|LOCUS_00720 68224 66785 gene locus_tag LOCUS_00730 gene proS 68224 66785 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060857.1 protein_id gnl|my_center|LOCUS_00730 68719 68267 gene locus_tag LOCUS_00740 68719 68267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 68973 69680 gene locus_tag LOCUS_00750 68973 69680 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980156.1 protein_id gnl|my_center|LOCUS_00750 70758 69682 gene locus_tag LOCUS_00760 70758 69682 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249915.1 protein_id gnl|my_center|LOCUS_00760 71970 70768 gene locus_tag LOCUS_00770 gene dnaG 71970 70768 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867599.1 protein_id gnl|my_center|LOCUS_00770 72255 72476 gene locus_tag LOCUS_00780 72255 72476 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251242.1 protein_id gnl|my_center|LOCUS_00780 72572 73960 gene locus_tag LOCUS_00790 72572 73960 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717669.1 protein_id gnl|my_center|LOCUS_00790 75027 73948 gene locus_tag LOCUS_00800 75027 73948 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020733.1 protein_id gnl|my_center|LOCUS_00800 76370 75033 gene locus_tag LOCUS_00810 76370 75033 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545342.1 protein_id gnl|my_center|LOCUS_00810 76444 77553 gene locus_tag LOCUS_00820 gene gcvT 76444 77553 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583865.1 protein_id gnl|my_center|LOCUS_00820 77878 77546 gene locus_tag LOCUS_00830 77878 77546 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846880.1 protein_id gnl|my_center|LOCUS_00830 78084 77875 gene locus_tag LOCUS_00840 78084 77875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 78344 78144 gene locus_tag LOCUS_00850 78344 78144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 79155 78328 gene locus_tag LOCUS_00860 79155 78328 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875650.1 protein_id gnl|my_center|LOCUS_00860 79622 79152 gene locus_tag LOCUS_00870 gene rplV 79622 79152 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064485.1 protein_id gnl|my_center|LOCUS_00870 79670 80374 gene locus_tag LOCUS_00880 79670 80374 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023459.1 protein_id gnl|my_center|LOCUS_00880 81326 80361 gene locus_tag LOCUS_00890 81326 80361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 81395 83884 gene locus_tag LOCUS_00900 81395 83884 CDS product DNA-directed DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979471.1 protein_id gnl|my_center|LOCUS_00900 85753 83858 gene locus_tag LOCUS_00910 gene gatE 85753 83858 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146615.1 protein_id gnl|my_center|LOCUS_00910 87086 85758 gene locus_tag LOCUS_00920 gene gatD 87086 85758 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249859.1 protein_id gnl|my_center|LOCUS_00920 87563 87153 gene locus_tag LOCUS_00930 87563 87153 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249134.1 protein_id gnl|my_center|LOCUS_00930 88697 87567 gene locus_tag LOCUS_00940 88697 87567 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868485.1 protein_id gnl|my_center|LOCUS_00940 89794 88709 gene locus_tag LOCUS_00950 89794 88709 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249136.1 protein_id gnl|my_center|LOCUS_00950 90490 90023 gene locus_tag LOCUS_00960 90490 90023 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357508.1 protein_id gnl|my_center|LOCUS_00960 91184 90516 gene locus_tag LOCUS_00970 91184 90516 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496597.1 protein_id gnl|my_center|LOCUS_00970 92301 91432 gene locus_tag LOCUS_00980 gene sdhB 92301 91432 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878185.1 protein_id gnl|my_center|LOCUS_00980 92641 92312 gene locus_tag LOCUS_00990 92641 92312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 93068 92643 gene locus_tag LOCUS_01000 93068 92643 CDS product succinate dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878186.1 protein_id gnl|my_center|LOCUS_01000 94796 93078 gene locus_tag LOCUS_01010 94796 93078 CDS product succinate dehydrogenase/fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878184.1 protein_id gnl|my_center|LOCUS_01010 95025 95198 gene locus_tag LOCUS_01020 95025 95198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 95198 95701 gene locus_tag LOCUS_01030 95198 95701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 95701 97119 gene locus_tag LOCUS_01040 95701 97119 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979726.1 protein_id gnl|my_center|LOCUS_01040 97222 98013 gene locus_tag LOCUS_01050 97222 98013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 98123 99751 gene locus_tag LOCUS_01060 98123 99751 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978180.1 protein_id gnl|my_center|LOCUS_01060 100868 99738 gene locus_tag LOCUS_01070 100868 99738 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_01070 101608 100976 gene locus_tag LOCUS_01080 101608 100976 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762488.1 protein_id gnl|my_center|LOCUS_01080 102194 101610 gene locus_tag LOCUS_01090 102194 101610 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980395.1 protein_id gnl|my_center|LOCUS_01090 102510 102851 gene locus_tag LOCUS_01100 102510 102851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 103535 103020 gene locus_tag LOCUS_01110 103535 103020 CDS product ADP-ribose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880613.1 protein_id gnl|my_center|LOCUS_01110 103862 103569 gene locus_tag LOCUS_01120 103862 103569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 104550 103867 gene locus_tag LOCUS_01130 104550 103867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 104602 104862 gene locus_tag LOCUS_01140 104602 104862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 105496 104804 gene locus_tag LOCUS_01150 105496 104804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 106175 105546 gene locus_tag LOCUS_01160 106175 105546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 106468 106208 gene locus_tag LOCUS_01170 106468 106208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 106487 107479 gene locus_tag LOCUS_01180 106487 107479 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979315.1 protein_id gnl|my_center|LOCUS_01180 107522 108664 gene locus_tag LOCUS_01190 107522 108664 CDS product DUF1512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979465.1 protein_id gnl|my_center|LOCUS_01190 108657 109091 gene locus_tag LOCUS_01200 108657 109091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 109088 109552 gene locus_tag LOCUS_01210 109088 109552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 110759 109587 gene locus_tag LOCUS_01220 110759 109587 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250432.1 protein_id gnl|my_center|LOCUS_01220 112134 110812 gene locus_tag LOCUS_01230 112134 110812 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978513.1 protein_id gnl|my_center|LOCUS_01230 112861 112121 gene locus_tag LOCUS_01240 112861 112121 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_01240 112932 114134 gene locus_tag LOCUS_01250 112932 114134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 114067 114774 gene locus_tag LOCUS_01260 114067 114774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 115273 114776 gene locus_tag LOCUS_01270 115273 114776 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979561.1 protein_id gnl|my_center|LOCUS_01270 115658 115278 gene locus_tag LOCUS_01280 115658 115278 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250212.1 protein_id gnl|my_center|LOCUS_01280 115743 116837 gene locus_tag LOCUS_01290 115743 116837 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 protein_id gnl|my_center|LOCUS_01290 117411 117007 gene locus_tag LOCUS_01300 117411 117007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 117626 117375 gene locus_tag LOCUS_01310 117626 117375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 117943 117623 gene locus_tag LOCUS_01320 117943 117623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 118082 119026 gene locus_tag LOCUS_01330 118082 119026 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878506.1 protein_id gnl|my_center|LOCUS_01330 119023 120156 gene locus_tag LOCUS_01340 119023 120156 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202952.1 protein_id gnl|my_center|LOCUS_01340 120160 122658 gene locus_tag LOCUS_01350 120160 122658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 124072 122645 gene locus_tag LOCUS_01360 124072 122645 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249895.1 protein_id gnl|my_center|LOCUS_01360 124432 124208 gene locus_tag LOCUS_01370 gene hpkA 124432 124208 CDS product archaeal histone HpkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250364.1 protein_id gnl|my_center|LOCUS_01370 125749 124757 gene locus_tag LOCUS_01380 125749 124757 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249912.1 protein_id gnl|my_center|LOCUS_01380 125773 126630 gene locus_tag LOCUS_01390 gene pheA 125773 126630 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038038884.1 protein_id gnl|my_center|LOCUS_01390 126655 127176 gene locus_tag LOCUS_01400 gene pfpI 126655 127176 CDS product deglycase PfpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867593.1 protein_id gnl|my_center|LOCUS_01400 127656 127165 gene locus_tag LOCUS_01410 127656 127165 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060842.1 protein_id gnl|my_center|LOCUS_01410 127913 127671 gene locus_tag LOCUS_01420 127913 127671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 128104 128304 gene locus_tag LOCUS_01430 128104 128304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 129605 128415 gene locus_tag LOCUS_01440 129605 128415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 131021 129612 gene locus_tag LOCUS_01450 131021 129612 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240545.1 protein_id gnl|my_center|LOCUS_01450 131147 132223 gene locus_tag LOCUS_01460 gene idsA 131147 132223 CDS product short chain isoprenyl diphosphate synthase IdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875690.1 protein_id gnl|my_center|LOCUS_01460 133505 132228 gene locus_tag LOCUS_01470 133505 132228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 134166 133453 gene locus_tag LOCUS_01480 134166 133453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 135853 134411 gene locus_tag LOCUS_01490 gene guaB 135853 134411 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871141.1 protein_id gnl|my_center|LOCUS_01490 136431 135925 gene locus_tag LOCUS_01500 136431 135925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 137276 136332 gene locus_tag LOCUS_01510 137276 136332 CDS product tRNA (cytosine(49)-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249315.1 protein_id gnl|my_center|LOCUS_01510 137339 139048 gene locus_tag LOCUS_01520 137339 139048 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250359.1 protein_id gnl|my_center|LOCUS_01520 139174 142059 gene locus_tag LOCUS_01530 139174 142059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 145373 142092 gene locus_tag LOCUS_01540 gene rgy 145373 142092 CDS product reverse gyrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878524.1 protein_id gnl|my_center|LOCUS_01540 145443 145838 gene locus_tag LOCUS_01550 145443 145838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 145828 146055 gene locus_tag LOCUS_01560 145828 146055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 147204 146041 gene locus_tag LOCUS_01570 147204 146041 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868809.1 protein_id gnl|my_center|LOCUS_01570 148305 147229 gene locus_tag LOCUS_01580 gene pepQ 148305 147229 CDS product Xaa-Pro dipeptidase PepQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146836.1 protein_id gnl|my_center|LOCUS_01580 149868 148414 gene locus_tag LOCUS_01590 149868 148414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 149921 150163 gene locus_tag LOCUS_01600 149921 150163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 150924 150199 gene locus_tag LOCUS_01610 150924 150199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 150987 151062 gene locus_tag LOCUS_t00020 150987 151062 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 151164 152357 gene locus_tag LOCUS_01620 151164 152357 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250627.1 protein_id gnl|my_center|LOCUS_01620 152438 152815 gene locus_tag LOCUS_01630 152438 152815 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878097.1 protein_id gnl|my_center|LOCUS_01630 152803 153156 gene locus_tag LOCUS_01640 152803 153156 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879110.1 protein_id gnl|my_center|LOCUS_01640 154148 153165 gene locus_tag LOCUS_01650 154148 153165 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250425.1 protein_id gnl|my_center|LOCUS_01650 154601 155716 gene locus_tag LOCUS_01660 154601 155716 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545936.1 protein_id gnl|my_center|LOCUS_01660 155942 155706 gene locus_tag LOCUS_01670 155942 155706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 156594 156016 gene locus_tag LOCUS_01680 156594 156016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 157618 156608 gene locus_tag LOCUS_01690 157618 156608 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250751.1 protein_id gnl|my_center|LOCUS_01690 158597 157608 gene locus_tag LOCUS_01700 158597 157608 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868867.1 protein_id gnl|my_center|LOCUS_01700 159099 158608 gene locus_tag LOCUS_01710 159099 158608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 160472 159096 gene locus_tag LOCUS_01720 160472 159096 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250753.1 protein_id gnl|my_center|LOCUS_01720 161539 160469 gene locus_tag LOCUS_01730 161539 160469 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868869.1 protein_id gnl|my_center|LOCUS_01730 164601 161650 gene locus_tag LOCUS_01740 164601 161650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 165128 166462 gene locus_tag LOCUS_01750 165128 166462 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763469.1 protein_id gnl|my_center|LOCUS_01750 166947 166522 gene locus_tag LOCUS_01760 166947 166522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 168224 167100 gene locus_tag LOCUS_01770 168224 167100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 170259 168232 gene locus_tag LOCUS_01780 170259 168232 CDS product STT3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762186.1 protein_id gnl|my_center|LOCUS_01780 170355 171221 gene locus_tag LOCUS_01790 170355 171221 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944001.1 protein_id gnl|my_center|LOCUS_01790 171300 172097 gene locus_tag LOCUS_01800 171300 172097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 172081 173097 gene locus_tag LOCUS_01810 172081 173097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 173568 173101 gene locus_tag LOCUS_01820 173568 173101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062371128.1 protein_id gnl|my_center|LOCUS_01820 173756 174028 gene locus_tag LOCUS_01830 173756 174028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 174021 174497 gene locus_tag LOCUS_01840 174021 174497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 174507 175520 gene locus_tag LOCUS_01850 174507 175520 CDS product DUF711 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762695.1 protein_id gnl|my_center|LOCUS_01850 176010 175639 gene locus_tag LOCUS_01860 176010 175639 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250702.1 protein_id gnl|my_center|LOCUS_01860 176216 175983 gene locus_tag LOCUS_01870 176216 175983 CDS product antitoxin VapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879489.1 protein_id gnl|my_center|LOCUS_01870 177647 176610 gene locus_tag LOCUS_01880 gene trxB 177647 176610 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251050.1 protein_id gnl|my_center|LOCUS_01880 177970 177644 gene locus_tag LOCUS_01890 177970 177644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 178203 179495 gene locus_tag LOCUS_01900 gene aroA 178203 179495 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289296.1 protein_id gnl|my_center|LOCUS_01900 179492 180241 gene locus_tag LOCUS_01910 gene udp 179492 180241 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_01910 180595 180269 gene locus_tag LOCUS_01920 180595 180269 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980344.1 protein_id gnl|my_center|LOCUS_01920 180678 181148 gene locus_tag LOCUS_01930 180678 181148 CDS product TIGR00288 family NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867205.1 protein_id gnl|my_center|LOCUS_01930 182186 181089 gene locus_tag LOCUS_01940 182186 181089 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053635.1 protein_id gnl|my_center|LOCUS_01940 183125 182220 gene locus_tag LOCUS_01950 183125 182220 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251107.1 protein_id gnl|my_center|LOCUS_01950 183411 184520 gene locus_tag LOCUS_01960 183411 184520 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750457.1 protein_id gnl|my_center|LOCUS_01960 184584 185108 gene locus_tag LOCUS_01970 184584 185108 CDS product HD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978503.1 protein_id gnl|my_center|LOCUS_01970 186088 185144 gene locus_tag LOCUS_01980 gene moaA 186088 185144 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251175.1 protein_id gnl|my_center|LOCUS_01980 186533 186090 gene locus_tag LOCUS_01990 gene moaC 186533 186090 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249309.1 protein_id gnl|my_center|LOCUS_01990 187056 186628 gene locus_tag LOCUS_02000 187056 186628 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251065.1 protein_id gnl|my_center|LOCUS_02000 187294 187058 gene locus_tag LOCUS_02010 187294 187058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 188511 187321 gene locus_tag LOCUS_02020 188511 187321 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763039.1 protein_id gnl|my_center|LOCUS_02020 189810 188521 gene locus_tag LOCUS_02030 189810 188521 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287740.1 protein_id gnl|my_center|LOCUS_02030 190728 189814 gene locus_tag LOCUS_02040 190728 189814 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762507.1 protein_id gnl|my_center|LOCUS_02040 191515 190742 gene locus_tag LOCUS_02050 191515 190742 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762508.1 protein_id gnl|my_center|LOCUS_02050 191597 191893 gene locus_tag LOCUS_02060 191597 191893 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391609.1 protein_id gnl|my_center|LOCUS_02060 191976 193178 gene locus_tag LOCUS_02070 191976 193178 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763576.1 protein_id gnl|my_center|LOCUS_02070 193382 193678 gene locus_tag LOCUS_02080 193382 193678 CDS product YunC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066065.1 protein_id gnl|my_center|LOCUS_02080 193832 194800 gene locus_tag LOCUS_02090 193832 194800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 194805 195467 gene locus_tag LOCUS_02100 194805 195467 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798635.1 protein_id gnl|my_center|LOCUS_02100 195534 196373 gene locus_tag LOCUS_02110 195534 196373 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583214.1 protein_id gnl|my_center|LOCUS_02110 197611 196568 gene locus_tag LOCUS_02120 197611 196568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 198340 197678 gene locus_tag LOCUS_02130 198340 197678 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080855.1 protein_id gnl|my_center|LOCUS_02130 198527 199663 gene locus_tag LOCUS_02140 198527 199663 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979159.1 protein_id gnl|my_center|LOCUS_02140 199996 200763 gene locus_tag LOCUS_02150 199996 200763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02150 201079 202614 gene locus_tag LOCUS_02160 201079 202614 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381361.1 protein_id gnl|my_center|LOCUS_02160 202615 203691 gene locus_tag LOCUS_02170 202615 203691 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_02170 203685 204617 gene locus_tag LOCUS_02180 203685 204617 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_02180 204847 206172 gene locus_tag LOCUS_02190 204847 206172 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228579.1 protein_id gnl|my_center|LOCUS_02190 207190 206315 gene locus_tag LOCUS_02200 207190 206315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 207725 207165 gene locus_tag LOCUS_02210 207725 207165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 209238 207928 gene locus_tag LOCUS_02220 209238 207928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 210887 209238 gene locus_tag LOCUS_02230 210887 209238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 210976 211710 gene locus_tag LOCUS_02240 210976 211710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 211901 212344 gene locus_tag LOCUS_02250 211901 212344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 212391 212846 gene locus_tag LOCUS_02260 212391 212846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 212886 213065 gene locus_tag LOCUS_02270 212886 213065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 213053 213541 gene locus_tag LOCUS_02280 213053 213541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02280 >Feature sequence02 434 48 gene locus_tag LOCUS_02290 434 48 CDS product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763557.1 protein_id gnl|my_center|LOCUS_02290 1240 437 gene locus_tag LOCUS_02300 1240 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 1997 1230 gene locus_tag LOCUS_02310 1997 1230 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867640.1 protein_id gnl|my_center|LOCUS_02310 2057 3049 gene locus_tag LOCUS_02320 2057 3049 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868643.1 protein_id gnl|my_center|LOCUS_02320 3144 3392 gene locus_tag LOCUS_02330 3144 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 4005 3370 gene locus_tag LOCUS_02340 4005 3370 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868563.1 protein_id gnl|my_center|LOCUS_02340 5018 3999 gene locus_tag LOCUS_02350 5018 3999 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970230.1 protein_id gnl|my_center|LOCUS_02350 5038 5463 gene locus_tag LOCUS_02360 5038 5463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 5502 6344 gene locus_tag LOCUS_02370 5502 6344 CDS product 7,8-dihydropterin-6-methyl-4-(beta-D-ribofuranosyl)-aminobenzene-5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869799.1 protein_id gnl|my_center|LOCUS_02370 6945 6730 gene locus_tag LOCUS_02380 6945 6730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02380 8060 7173 gene locus_tag LOCUS_02390 8060 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02390 8198 9058 gene locus_tag LOCUS_02400 8198 9058 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081450.1 protein_id gnl|my_center|LOCUS_02400 10297 9152 gene locus_tag LOCUS_02410 10297 9152 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763090.1 protein_id gnl|my_center|LOCUS_02410 11822 10302 gene locus_tag LOCUS_02420 11822 10302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 12909 12037 gene locus_tag LOCUS_02430 12909 12037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 13722 12934 gene locus_tag LOCUS_02440 13722 12934 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249013.1 protein_id gnl|my_center|LOCUS_02440 14841 13858 gene locus_tag LOCUS_02450 14841 13858 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878132.1 protein_id gnl|my_center|LOCUS_02450 15328 14813 gene locus_tag LOCUS_02460 gene leuD 15328 14813 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_02460 16575 15325 gene locus_tag LOCUS_02470 gene leuC 16575 15325 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081330.1 protein_id gnl|my_center|LOCUS_02470 18031 16559 gene locus_tag LOCUS_02480 18031 16559 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870707.1 protein_id gnl|my_center|LOCUS_02480 20553 18325 gene locus_tag LOCUS_02490 20553 18325 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_02490 20626 20922 gene locus_tag LOCUS_02500 20626 20922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 20926 21609 gene locus_tag LOCUS_02510 20926 21609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 21614 22510 gene locus_tag LOCUS_02520 gene mtgA 21614 22510 CDS product methylcobalamin--tetrahydrofolate methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816523.1 protein_id gnl|my_center|LOCUS_02520 23819 22617 gene locus_tag LOCUS_02530 23819 22617 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584117.1 protein_id gnl|my_center|LOCUS_02530 23867 24580 gene locus_tag LOCUS_02540 gene sfsA 23867 24580 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877131.1 protein_id gnl|my_center|LOCUS_02540 26932 24569 gene locus_tag LOCUS_02550 26932 24569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 27974 26934 gene locus_tag LOCUS_02560 27974 26934 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146468.1 protein_id gnl|my_center|LOCUS_02560 29069 28029 gene locus_tag LOCUS_02570 29069 28029 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877642.1 protein_id gnl|my_center|LOCUS_02570 29145 29939 gene locus_tag LOCUS_02580 29145 29939 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979496.1 protein_id gnl|my_center|LOCUS_02580 30348 29932 gene locus_tag LOCUS_02590 30348 29932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 31115 30345 gene locus_tag LOCUS_02600 31115 30345 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877881.1 protein_id gnl|my_center|LOCUS_02600 31653 31102 gene locus_tag LOCUS_02610 31653 31102 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869779.1 protein_id gnl|my_center|LOCUS_02610 31979 31686 gene locus_tag LOCUS_02620 31979 31686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 32697 32050 gene locus_tag LOCUS_02630 32697 32050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 33824 32703 gene locus_tag LOCUS_02640 33824 32703 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876364.1 protein_id gnl|my_center|LOCUS_02640 34086 33814 gene locus_tag LOCUS_02650 34086 33814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 34832 34044 gene locus_tag LOCUS_02660 34832 34044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 35700 34888 gene locus_tag LOCUS_02670 35700 34888 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762468.1 protein_id gnl|my_center|LOCUS_02670 36451 35693 gene locus_tag LOCUS_02680 36451 35693 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066032.1 protein_id gnl|my_center|LOCUS_02680 37246 36452 gene locus_tag LOCUS_02690 37246 36452 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227962.1 protein_id gnl|my_center|LOCUS_02690 37549 38991 gene locus_tag LOCUS_02700 37549 38991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 39847 38975 gene locus_tag LOCUS_02710 39847 38975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 39887 41800 gene locus_tag LOCUS_02720 39887 41800 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762340.1 protein_id gnl|my_center|LOCUS_02720 42473 41805 gene locus_tag LOCUS_02730 42473 41805 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762886.1 protein_id gnl|my_center|LOCUS_02730 42844 42470 gene locus_tag LOCUS_02740 42844 42470 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196772272.1 protein_id gnl|my_center|LOCUS_02740 44277 42850 gene locus_tag LOCUS_02750 44277 42850 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015590803.1 protein_id gnl|my_center|LOCUS_02750 44449 44270 gene locus_tag LOCUS_02760 44449 44270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 45336 44446 gene locus_tag LOCUS_02770 45336 44446 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870653.1 protein_id gnl|my_center|LOCUS_02770 46191 45478 gene locus_tag LOCUS_02780 46191 45478 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763250.1 protein_id gnl|my_center|LOCUS_02780 46972 46178 gene locus_tag LOCUS_02790 46972 46178 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763251.1 protein_id gnl|my_center|LOCUS_02790 47988 46987 gene locus_tag LOCUS_02800 47988 46987 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763252.1 protein_id gnl|my_center|LOCUS_02800 48902 47985 gene locus_tag LOCUS_02810 48902 47985 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763253.1 protein_id gnl|my_center|LOCUS_02810 50267 48942 gene locus_tag LOCUS_02820 50267 48942 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240446.1 protein_id gnl|my_center|LOCUS_02820 50630 52018 gene locus_tag LOCUS_02830 50630 52018 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868347.1 protein_id gnl|my_center|LOCUS_02830 52038 53246 gene locus_tag LOCUS_02840 52038 53246 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021450.1 protein_id gnl|my_center|LOCUS_02840 54184 53303 gene locus_tag LOCUS_02850 54184 53303 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762507.1 protein_id gnl|my_center|LOCUS_02850 54945 54181 gene locus_tag LOCUS_02860 54945 54181 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762508.1 protein_id gnl|my_center|LOCUS_02860 56034 55036 gene locus_tag LOCUS_02870 56034 55036 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146584.1 protein_id gnl|my_center|LOCUS_02870 56521 56024 gene locus_tag LOCUS_02880 56521 56024 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251052.1 protein_id gnl|my_center|LOCUS_02880 56633 57145 gene locus_tag LOCUS_02890 56633 57145 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251241.1 protein_id gnl|my_center|LOCUS_02890 57200 57706 gene locus_tag LOCUS_02900 57200 57706 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978534.1 protein_id gnl|my_center|LOCUS_02900 57765 59966 gene locus_tag LOCUS_02910 57765 59966 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_02910 60024 61034 gene locus_tag LOCUS_02920 gene gap 60024 61034 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_02920 64034 61161 gene locus_tag LOCUS_02930 gene leuS 64034 61161 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846570.1 protein_id gnl|my_center|LOCUS_02930 64387 64160 gene locus_tag LOCUS_02940 64387 64160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 64455 64670 gene locus_tag LOCUS_02950 64455 64670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 64630 65058 gene locus_tag LOCUS_02960 64630 65058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 65284 65532 gene locus_tag LOCUS_02970 65284 65532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 66160 65549 gene locus_tag LOCUS_02980 66160 65549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 68268 66112 gene locus_tag LOCUS_02990 gene topA 68268 66112 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496891.1 protein_id gnl|my_center|LOCUS_02990 68502 72227 gene locus_tag LOCUS_03000 68502 72227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 73884 72247 gene locus_tag LOCUS_03010 73884 72247 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762019.1 protein_id gnl|my_center|LOCUS_03010 73988 74956 gene locus_tag LOCUS_03020 73988 74956 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563822.1 protein_id gnl|my_center|LOCUS_03020 74982 75779 gene locus_tag LOCUS_03030 74982 75779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 77939 75747 gene locus_tag LOCUS_03040 77939 75747 CDS product tRNA(Met) cytidine acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868389.1 protein_id gnl|my_center|LOCUS_03040 78796 77948 gene locus_tag LOCUS_03050 78796 77948 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980408.1 protein_id gnl|my_center|LOCUS_03050 79701 78793 gene locus_tag LOCUS_03060 79701 78793 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146595.1 protein_id gnl|my_center|LOCUS_03060 80173 79664 gene locus_tag LOCUS_03070 80173 79664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 80760 80236 gene locus_tag LOCUS_03080 80760 80236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 83036 80760 gene locus_tag LOCUS_03090 83036 80760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 84047 83106 gene locus_tag LOCUS_03100 84047 83106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 85380 84001 gene locus_tag LOCUS_03110 85380 84001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 >Feature sequence03 2565 1720 gene locus_tag LOCUS_03120 2565 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013597.1 protein_id gnl|my_center|LOCUS_03120 3012 3662 gene locus_tag LOCUS_03130 3012 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 4162 3827 gene locus_tag LOCUS_03140 4162 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 5164 4196 gene locus_tag LOCUS_03150 5164 4196 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979037.1 protein_id gnl|my_center|LOCUS_03150 5339 6940 gene locus_tag LOCUS_03160 5339 6940 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979926.1 protein_id gnl|my_center|LOCUS_03160 8241 7189 gene locus_tag LOCUS_03170 8241 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 8381 9382 gene locus_tag LOCUS_03180 gene wtpA 8381 9382 CDS product tungstate ABC transporter substrate-binding protein WtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867274.1 protein_id gnl|my_center|LOCUS_03180 9383 10153 gene locus_tag LOCUS_03190 gene wtpB 9383 10153 CDS product tungstate ABC transporter permease WtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870885.1 protein_id gnl|my_center|LOCUS_03190 10155 11216 gene locus_tag LOCUS_03200 gene wtpC 10155 11216 CDS product tungstate ABC transporter ATP-binding protein WtpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867278.1 protein_id gnl|my_center|LOCUS_03200 11331 11777 gene locus_tag LOCUS_03210 11331 11777 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979773.1 protein_id gnl|my_center|LOCUS_03210 11774 12220 gene locus_tag LOCUS_03220 11774 12220 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846630.1 protein_id gnl|my_center|LOCUS_03220 12708 12349 gene locus_tag LOCUS_03230 12708 12349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 13342 12668 gene locus_tag LOCUS_03240 13342 12668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 15271 13358 gene locus_tag LOCUS_03250 15271 13358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 17007 15538 gene locus_tag LOCUS_03260 17007 15538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 17066 17413 gene locus_tag LOCUS_03270 17066 17413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 17503 18276 gene locus_tag LOCUS_03280 17503 18276 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496701.1 protein_id gnl|my_center|LOCUS_03280 18667 18329 gene locus_tag LOCUS_03290 18667 18329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 18990 18661 gene locus_tag LOCUS_03300 18990 18661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 19311 20096 gene locus_tag LOCUS_03310 19311 20096 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240394.1 protein_id gnl|my_center|LOCUS_03310 20093 20701 gene locus_tag LOCUS_03320 gene udg 20093 20701 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879766.1 protein_id gnl|my_center|LOCUS_03320 20930 21151 gene locus_tag LOCUS_03330 20930 21151 CDS product antitoxin VapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218265868.1 protein_id gnl|my_center|LOCUS_03330 21148 21594 gene locus_tag LOCUS_03340 21148 21594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 21896 22279 gene locus_tag LOCUS_03350 21896 22279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 23704 22676 gene locus_tag LOCUS_03360 23704 22676 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546236.1 protein_id gnl|my_center|LOCUS_03360 23961 25256 gene locus_tag LOCUS_03370 gene glnA 23961 25256 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979431.1 protein_id gnl|my_center|LOCUS_03370 25341 26930 gene locus_tag LOCUS_03380 25341 26930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 27163 28449 gene locus_tag LOCUS_03390 27163 28449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 28440 29693 gene locus_tag LOCUS_03400 gene hacA 28440 29693 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876998.1 protein_id gnl|my_center|LOCUS_03400 29690 30184 gene locus_tag LOCUS_03410 29690 30184 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083008.1 protein_id gnl|my_center|LOCUS_03410 30191 31201 gene locus_tag LOCUS_03420 30191 31201 CDS product isocitrate dehydrogenase (NAD(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964290.1 protein_id gnl|my_center|LOCUS_03420 31932 31225 gene locus_tag LOCUS_03430 31932 31225 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763250.1 protein_id gnl|my_center|LOCUS_03430 32711 31968 gene locus_tag LOCUS_03440 32711 31968 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545387.1 protein_id gnl|my_center|LOCUS_03440 33666 32695 gene locus_tag LOCUS_03450 33666 32695 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942650.1 protein_id gnl|my_center|LOCUS_03450 34558 33668 gene locus_tag LOCUS_03460 34558 33668 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897070.1 protein_id gnl|my_center|LOCUS_03460 35968 34598 gene locus_tag LOCUS_03470 35968 34598 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942648.1 protein_id gnl|my_center|LOCUS_03470 37539 36232 gene locus_tag LOCUS_03480 37539 36232 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867786.1 protein_id gnl|my_center|LOCUS_03480 38269 37802 gene locus_tag LOCUS_03490 38269 37802 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 protein_id gnl|my_center|LOCUS_03490 39061 38447 gene locus_tag LOCUS_03500 39061 38447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 39839 39018 gene locus_tag LOCUS_03510 39839 39018 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240385.1 protein_id gnl|my_center|LOCUS_03510 40615 39965 gene locus_tag LOCUS_03520 40615 39965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 40714 41151 gene locus_tag LOCUS_03530 40714 41151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 41161 41496 gene locus_tag LOCUS_03540 41161 41496 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022869.1 protein_id gnl|my_center|LOCUS_03540 41546 41872 gene locus_tag LOCUS_03550 41546 41872 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393974.1 protein_id gnl|my_center|LOCUS_03550 42983 41835 gene locus_tag LOCUS_03560 42983 41835 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249826.1 protein_id gnl|my_center|LOCUS_03560 43663 43241 gene locus_tag LOCUS_03570 43663 43241 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763571.1 protein_id gnl|my_center|LOCUS_03570 44469 43732 gene locus_tag LOCUS_03580 44469 43732 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249085.1 protein_id gnl|my_center|LOCUS_03580 45309 44605 gene locus_tag LOCUS_03590 45309 44605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 46055 45306 gene locus_tag LOCUS_03600 46055 45306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 46975 46052 gene locus_tag LOCUS_03610 46975 46052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 47738 47028 gene locus_tag LOCUS_03620 gene alaXM 47738 47028 CDS product alanyl-tRNA editing protein AlaXM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846184.1 protein_id gnl|my_center|LOCUS_03620 47851 49272 gene locus_tag LOCUS_03630 47851 49272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 50552 50755 gene locus_tag LOCUS_03640 50552 50755 CDS product 2-oxoisovalerate dehydrogenase E1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393634.1 protein_id gnl|my_center|LOCUS_03640 50752 50988 gene locus_tag LOCUS_03650 50752 50988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 51195 51524 gene locus_tag LOCUS_03660 51195 51524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 51867 52259 gene locus_tag LOCUS_03670 51867 52259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 52244 52450 gene locus_tag LOCUS_03680 52244 52450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 52524 52808 gene locus_tag LOCUS_03690 52524 52808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 52805 53623 gene locus_tag LOCUS_03700 52805 53623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 53684 53980 gene locus_tag LOCUS_03710 53684 53980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 53977 54816 gene locus_tag LOCUS_03720 53977 54816 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868514.1 protein_id gnl|my_center|LOCUS_03720 54800 56404 gene locus_tag LOCUS_03730 54800 56404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 56382 57182 gene locus_tag LOCUS_03740 56382 57182 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249796.1 protein_id gnl|my_center|LOCUS_03740 57187 58272 gene locus_tag LOCUS_03750 57187 58272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 58327 59280 gene locus_tag LOCUS_03760 gene speE 58327 59280 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978308.1 protein_id gnl|my_center|LOCUS_03760 60056 59268 gene locus_tag LOCUS_03770 60056 59268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 61387 60053 gene locus_tag LOCUS_03780 61387 60053 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249215.1 protein_id gnl|my_center|LOCUS_03780 62483 61392 gene locus_tag LOCUS_03790 gene aroC 62483 61392 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867581.1 protein_id gnl|my_center|LOCUS_03790 64098 62497 gene locus_tag LOCUS_03800 64098 62497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 65573 64191 gene locus_tag LOCUS_03810 65573 64191 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978229.1 protein_id gnl|my_center|LOCUS_03810 65938 66120 gene locus_tag LOCUS_03820 65938 66120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 66203 67075 gene locus_tag LOCUS_03830 66203 67075 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868373.1 protein_id gnl|my_center|LOCUS_03830 68209 67064 gene locus_tag LOCUS_03840 68209 67064 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879038.1 protein_id gnl|my_center|LOCUS_03840 68671 68219 gene locus_tag LOCUS_03850 68671 68219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 70742 68826 gene locus_tag LOCUS_03860 gene thrS 70742 68826 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360261.1 protein_id gnl|my_center|LOCUS_03860 71902 73446 gene locus_tag LOCUS_03870 71902 73446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 73531 74925 gene locus_tag LOCUS_03880 73531 74925 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393791.1 protein_id gnl|my_center|LOCUS_03880 76351 74978 gene locus_tag LOCUS_03890 gene serS 76351 74978 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979517.1 protein_id gnl|my_center|LOCUS_03890 76793 76413 gene locus_tag LOCUS_03900 76793 76413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 76926 78632 gene locus_tag LOCUS_03910 76926 78632 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878912.1 protein_id gnl|my_center|LOCUS_03910 80110 78686 gene locus_tag LOCUS_03920 gene cysS 80110 78686 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249399.1 protein_id gnl|my_center|LOCUS_03920 80751 80311 gene locus_tag LOCUS_03930 80751 80311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 80766 81434 gene locus_tag LOCUS_03940 80766 81434 CDS product DUF4443 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251227.1 protein_id gnl|my_center|LOCUS_03940 81503 83188 gene locus_tag LOCUS_03950 81503 83188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 >Feature sequence04 492 842 gene locus_tag LOCUS_03960 492 842 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249913.1 protein_id gnl|my_center|LOCUS_03960 835 1215 gene locus_tag LOCUS_03970 835 1215 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249914.1 protein_id gnl|my_center|LOCUS_03970 1993 1673 gene locus_tag LOCUS_03980 1993 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 3477 2212 gene locus_tag LOCUS_03990 3477 2212 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867591.1 protein_id gnl|my_center|LOCUS_03990 3916 3488 gene locus_tag LOCUS_04000 3916 3488 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870773.1 protein_id gnl|my_center|LOCUS_04000 5788 3983 gene locus_tag LOCUS_04010 gene infB 5788 3983 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978230.1 protein_id gnl|my_center|LOCUS_04010 6006 5809 gene locus_tag LOCUS_04020 6006 5809 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875896.1 protein_id gnl|my_center|LOCUS_04020 6229 6011 gene locus_tag LOCUS_04030 6229 6011 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867791.1 protein_id gnl|my_center|LOCUS_04030 6670 6272 gene locus_tag LOCUS_04040 gene rpl7ae 6670 6272 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240293.1 protein_id gnl|my_center|LOCUS_04040 7788 6700 gene locus_tag LOCUS_04050 gene fni 7788 6700 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259707.1 protein_id gnl|my_center|LOCUS_04050 8636 7785 gene locus_tag LOCUS_04060 8636 7785 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250428.1 protein_id gnl|my_center|LOCUS_04060 9296 8643 gene locus_tag LOCUS_04070 gene rpsB 9296 8643 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867661.1 protein_id gnl|my_center|LOCUS_04070 9505 9302 gene locus_tag LOCUS_04080 9505 9302 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980138.1 protein_id gnl|my_center|LOCUS_04080 9599 10585 gene locus_tag LOCUS_04090 9599 10585 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879552.1 protein_id gnl|my_center|LOCUS_04090 10563 11807 gene locus_tag LOCUS_04100 10563 11807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 12821 11790 gene locus_tag LOCUS_04110 12821 11790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 14026 13019 gene locus_tag LOCUS_04120 14026 13019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 14131 15258 gene locus_tag LOCUS_04130 14131 15258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 15648 15265 gene locus_tag LOCUS_04140 15648 15265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 16007 16079 gene locus_tag LOCUS_t00030 16007 16079 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 16105 16386 gene locus_tag LOCUS_04150 16105 16386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 16669 16400 gene locus_tag LOCUS_04160 16669 16400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 16732 17067 gene locus_tag LOCUS_04170 16732 17067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 17222 17926 gene locus_tag LOCUS_04180 17222 17926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 17907 18059 gene locus_tag LOCUS_04190 17907 18059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 18046 19788 gene locus_tag LOCUS_04200 18046 19788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 20426 19773 gene locus_tag LOCUS_04210 20426 19773 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868259.1 protein_id gnl|my_center|LOCUS_04210 20399 20476 gene locus_tag LOCUS_t00040 20399 20476 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 20876 20490 gene locus_tag LOCUS_04220 20876 20490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 21576 20881 gene locus_tag LOCUS_04230 gene pyrH 21576 20881 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979322.1 protein_id gnl|my_center|LOCUS_04230 22610 21603 gene locus_tag LOCUS_04240 gene twy1 22610 21603 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979301.1 protein_id gnl|my_center|LOCUS_04240 22708 23247 gene locus_tag LOCUS_04250 22708 23247 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868496.1 protein_id gnl|my_center|LOCUS_04250 23240 23917 gene locus_tag LOCUS_04260 23240 23917 CDS product winged helix-turn-helix domain-containing protein/riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319832.1 protein_id gnl|my_center|LOCUS_04260 23990 23918 gene locus_tag LOCUS_t00050 23990 23918 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 24366 25436 gene locus_tag LOCUS_04270 24366 25436 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918931.1 protein_id gnl|my_center|LOCUS_04270 26192 25473 gene locus_tag LOCUS_04280 26192 25473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 27114 26212 gene locus_tag LOCUS_04290 27114 26212 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978483.1 protein_id gnl|my_center|LOCUS_04290 28297 27104 gene locus_tag LOCUS_04300 gene thrC 28297 27104 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979259.1 protein_id gnl|my_center|LOCUS_04300 28481 29662 gene locus_tag LOCUS_04310 28481 29662 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979394.1 protein_id gnl|my_center|LOCUS_04310 29784 30446 gene locus_tag LOCUS_04320 29784 30446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 30761 30417 gene locus_tag LOCUS_04330 30761 30417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 33689 31041 gene locus_tag LOCUS_04340 33689 31041 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146858.1 protein_id gnl|my_center|LOCUS_04340 35010 34510 gene locus_tag LOCUS_04350 35010 34510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 35763 35011 gene locus_tag LOCUS_04360 35763 35011 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878652.1 protein_id gnl|my_center|LOCUS_04360 36053 36289 gene locus_tag LOCUS_04370 36053 36289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 36420 38255 gene locus_tag LOCUS_04380 36420 38255 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249735.1 protein_id gnl|my_center|LOCUS_04380 39146 38325 gene locus_tag LOCUS_04390 39146 38325 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061249.1 protein_id gnl|my_center|LOCUS_04390 40041 39124 gene locus_tag LOCUS_04400 40041 39124 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249220.1 protein_id gnl|my_center|LOCUS_04400 40139 41101 gene locus_tag LOCUS_04410 40139 41101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 41098 42708 gene locus_tag LOCUS_04420 41098 42708 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877524.1 protein_id gnl|my_center|LOCUS_04420 42767 43777 gene locus_tag LOCUS_04430 42767 43777 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868111.1 protein_id gnl|my_center|LOCUS_04430 43849 44862 gene locus_tag LOCUS_04440 43849 44862 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881255.1 protein_id gnl|my_center|LOCUS_04440 45303 44947 gene locus_tag LOCUS_04450 45303 44947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 45363 45941 gene locus_tag LOCUS_04460 gene yjjX 45363 45941 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318533.1 protein_id gnl|my_center|LOCUS_04460 45946 46461 gene locus_tag LOCUS_04470 45946 46461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 46644 46970 gene locus_tag LOCUS_04480 46644 46970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 46980 47315 gene locus_tag LOCUS_04490 46980 47315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 48403 47366 gene locus_tag LOCUS_04500 48403 47366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 48675 48541 gene locus_tag LOCUS_04510 48675 48541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 48934 52554 gene locus_tag LOCUS_04520 48934 52554 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763716.1 protein_id gnl|my_center|LOCUS_04520 52559 53371 gene locus_tag LOCUS_04530 gene fdxH 52559 53371 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693893.1 protein_id gnl|my_center|LOCUS_04530 53373 54110 gene locus_tag LOCUS_04540 53373 54110 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880649.1 protein_id gnl|my_center|LOCUS_04540 54204 55109 gene locus_tag LOCUS_04550 gene fdhE 54204 55109 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880651.1 protein_id gnl|my_center|LOCUS_04550 55829 55095 gene locus_tag LOCUS_04560 55829 55095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 56061 57419 gene locus_tag LOCUS_04570 56061 57419 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251119.1 protein_id gnl|my_center|LOCUS_04570 57420 58748 gene locus_tag LOCUS_04580 57420 58748 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869729.1 protein_id gnl|my_center|LOCUS_04580 58745 60268 gene locus_tag LOCUS_04590 gene guaA 58745 60268 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762354.1 protein_id gnl|my_center|LOCUS_04590 60340 62382 gene locus_tag LOCUS_04600 60340 62382 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104337.1 protein_id gnl|my_center|LOCUS_04600 62887 62564 gene locus_tag LOCUS_04610 gene yciH 62887 62564 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496503.1 protein_id gnl|my_center|LOCUS_04610 63001 63381 gene locus_tag LOCUS_04620 63001 63381 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846402.1 protein_id gnl|my_center|LOCUS_04620 63335 63724 gene locus_tag LOCUS_04630 63335 63724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 64209 63793 gene locus_tag LOCUS_04640 64209 63793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 65126 64248 gene locus_tag LOCUS_04650 gene cyoE 65126 64248 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879528.1 protein_id gnl|my_center|LOCUS_04650 66344 65250 gene locus_tag LOCUS_04660 66344 65250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 66439 67218 gene locus_tag LOCUS_04670 66439 67218 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847027.1 protein_id gnl|my_center|LOCUS_04670 67237 67878 gene locus_tag LOCUS_04680 67237 67878 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979589.1 protein_id gnl|my_center|LOCUS_04680 69101 67881 gene locus_tag LOCUS_04690 69101 67881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 69433 69999 gene locus_tag LOCUS_04700 69433 69999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 70157 70636 gene locus_tag LOCUS_04710 70157 70636 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146602.1 protein_id gnl|my_center|LOCUS_04710 70608 71642 gene locus_tag LOCUS_04720 70608 71642 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867784.1 protein_id gnl|my_center|LOCUS_04720 71648 72421 gene locus_tag LOCUS_04730 71648 72421 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250096.1 protein_id gnl|my_center|LOCUS_04730 72568 73659 gene locus_tag LOCUS_04740 72568 73659 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146519.1 protein_id gnl|my_center|LOCUS_04740 73842 74570 gene locus_tag LOCUS_04750 73842 74570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 76204 74582 gene locus_tag LOCUS_04760 76204 74582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 76846 76247 gene locus_tag LOCUS_04770 76846 76247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 77366 76821 gene locus_tag LOCUS_04780 77366 76821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 77438 77728 gene locus_tag LOCUS_04790 77438 77728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 77700 78056 gene locus_tag LOCUS_04800 77700 78056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 79013 77973 gene locus_tag LOCUS_04810 79013 77973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 79563 79015 gene locus_tag LOCUS_04820 79563 79015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 79832 80236 gene locus_tag LOCUS_04830 79832 80236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 81237 80245 gene locus_tag LOCUS_04840 gene ilvC 81237 80245 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762306.1 protein_id gnl|my_center|LOCUS_04840 81540 81262 gene locus_tag LOCUS_04850 81540 81262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 82852 81545 gene locus_tag LOCUS_04860 82852 81545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 >Feature sequence05 1862 675 gene locus_tag LOCUS_04870 1862 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 2270 2455 gene locus_tag LOCUS_04880 2270 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 3807 2608 gene locus_tag LOCUS_04890 3807 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 4611 4435 gene locus_tag LOCUS_04900 4611 4435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 8830 4706 gene locus_tag LOCUS_04910 8830 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 9812 9285 gene locus_tag LOCUS_04920 9812 9285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 10828 10634 gene locus_tag LOCUS_04930 10828 10634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 11362 11105 gene locus_tag LOCUS_04940 11362 11105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 11397 11741 gene locus_tag LOCUS_04950 11397 11741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 11932 12234 gene locus_tag LOCUS_04960 11932 12234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 12405 12686 gene locus_tag LOCUS_04970 12405 12686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 12664 13092 gene locus_tag LOCUS_04980 12664 13092 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868296.1 protein_id gnl|my_center|LOCUS_04980 13734 13976 gene locus_tag LOCUS_04990 13734 13976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 13973 14383 gene locus_tag LOCUS_05000 13973 14383 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911313.1 protein_id gnl|my_center|LOCUS_05000 16200 18302 gene locus_tag LOCUS_05010 16200 18302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 19626 19844 gene locus_tag LOCUS_05020 19626 19844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 19838 20236 gene locus_tag LOCUS_05030 19838 20236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 20583 20840 gene locus_tag LOCUS_05040 20583 20840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 20852 21184 gene locus_tag LOCUS_05050 20852 21184 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846392.1 protein_id gnl|my_center|LOCUS_05050 21347 21156 gene locus_tag LOCUS_05060 21347 21156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 21803 22048 gene locus_tag LOCUS_05070 21803 22048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 22174 23934 gene locus_tag LOCUS_05080 22174 23934 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979811.1 protein_id gnl|my_center|LOCUS_05080 24881 25441 gene locus_tag LOCUS_05090 24881 25441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 26704 25520 gene locus_tag LOCUS_05100 26704 25520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 27903 26710 gene locus_tag LOCUS_05110 27903 26710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 29156 28692 gene locus_tag LOCUS_05120 29156 28692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 29453 29992 gene locus_tag LOCUS_05130 29453 29992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 30569 31297 gene locus_tag LOCUS_05140 30569 31297 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867364.1 protein_id gnl|my_center|LOCUS_05140 31299 31526 gene locus_tag LOCUS_05150 31299 31526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 32178 31870 gene locus_tag LOCUS_05160 32178 31870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 32918 32178 gene locus_tag LOCUS_05170 32918 32178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 33420 32878 gene locus_tag LOCUS_05180 33420 32878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 34607 34023 gene locus_tag LOCUS_05190 34607 34023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 35097 34579 gene locus_tag LOCUS_05200 gene thiW 35097 34579 CDS product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870435.1 protein_id gnl|my_center|LOCUS_05200 36461 35094 gene locus_tag LOCUS_05210 36461 35094 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868207.1 protein_id gnl|my_center|LOCUS_05210 37717 36449 gene locus_tag LOCUS_05220 gene cytX 37717 36449 CDS product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256688.1 protein_id gnl|my_center|LOCUS_05220 38222 38554 gene locus_tag LOCUS_05230 38222 38554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 39186 38680 gene locus_tag LOCUS_05240 39186 38680 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225807463.1 protein_id gnl|my_center|LOCUS_05240 41020 39701 gene locus_tag LOCUS_05250 41020 39701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 41330 41542 gene locus_tag LOCUS_05260 41330 41542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 41539 42321 gene locus_tag LOCUS_05270 41539 42321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 42338 44056 gene locus_tag LOCUS_05280 42338 44056 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460552.1 protein_id gnl|my_center|LOCUS_05280 44053 44919 gene locus_tag LOCUS_05290 44053 44919 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020913.1 protein_id gnl|my_center|LOCUS_05290 46274 45006 gene locus_tag LOCUS_05300 46274 45006 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980086.1 protein_id gnl|my_center|LOCUS_05300 46439 46849 gene locus_tag LOCUS_05310 46439 46849 CDS product putative zinc-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582844.1 protein_id gnl|my_center|LOCUS_05310 47813 47085 gene locus_tag LOCUS_05320 47813 47085 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289375.1 protein_id gnl|my_center|LOCUS_05320 48063 48587 gene locus_tag LOCUS_05330 48063 48587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 49758 48712 gene locus_tag LOCUS_05340 49758 48712 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762399.1 protein_id gnl|my_center|LOCUS_05340 50578 49775 gene locus_tag LOCUS_05350 50578 49775 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762400.1 protein_id gnl|my_center|LOCUS_05350 50915 50598 gene locus_tag LOCUS_05360 50915 50598 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762401.1 protein_id gnl|my_center|LOCUS_05360 52198 50912 gene locus_tag LOCUS_05370 52198 50912 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762402.1 protein_id gnl|my_center|LOCUS_05370 52400 53182 gene locus_tag LOCUS_05380 gene larB 52400 53182 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061016.1 protein_id gnl|my_center|LOCUS_05380 53179 54435 gene locus_tag LOCUS_05390 gene larC 53179 54435 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060969.1 protein_id gnl|my_center|LOCUS_05390 55340 54528 gene locus_tag LOCUS_05400 55340 54528 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250748.1 protein_id gnl|my_center|LOCUS_05400 55581 57287 gene locus_tag LOCUS_05410 55581 57287 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860413.1 protein_id gnl|my_center|LOCUS_05410 57349 58266 gene locus_tag LOCUS_05420 57349 58266 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986307.1 protein_id gnl|my_center|LOCUS_05420 58263 59090 gene locus_tag LOCUS_05430 58263 59090 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066027.1 protein_id gnl|my_center|LOCUS_05430 59096 59881 gene locus_tag LOCUS_05440 59096 59881 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496515.1 protein_id gnl|my_center|LOCUS_05440 59904 60806 gene locus_tag LOCUS_05450 59904 60806 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 protein_id gnl|my_center|LOCUS_05450 60769 61761 gene locus_tag LOCUS_05460 60769 61761 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755881.1 protein_id gnl|my_center|LOCUS_05460 61798 62241 gene locus_tag LOCUS_05470 gene nikR 61798 62241 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250390.1 protein_id gnl|my_center|LOCUS_05470 62477 62238 gene locus_tag LOCUS_05480 62477 62238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 63433 62534 gene locus_tag LOCUS_05490 63433 62534 CDS product methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532031.1 protein_id gnl|my_center|LOCUS_05490 65325 63493 gene locus_tag LOCUS_05500 65325 63493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879350.1 protein_id gnl|my_center|LOCUS_05500 66020 65532 gene locus_tag LOCUS_05510 gene fae 66020 65532 CDS product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022945.1 protein_id gnl|my_center|LOCUS_05510 66172 66846 gene locus_tag LOCUS_05520 66172 66846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 67125 67988 gene locus_tag LOCUS_05530 67125 67988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 68072 68836 gene locus_tag LOCUS_05540 68072 68836 CDS product dihydromethanopterin reductase (acceptor) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020741.1 protein_id gnl|my_center|LOCUS_05540 68866 70431 gene locus_tag LOCUS_05550 68866 70431 CDS product dihydropteroate synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867378.1 protein_id gnl|my_center|LOCUS_05550 70653 71408 gene locus_tag LOCUS_05560 70653 71408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 >Feature sequence06 1966 842 gene locus_tag LOCUS_05570 gene hypD 1966 842 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240243.1 protein_id gnl|my_center|LOCUS_05570 4281 1963 gene locus_tag LOCUS_05580 gene hypF 4281 1963 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761966.1 protein_id gnl|my_center|LOCUS_05580 4575 4351 gene locus_tag LOCUS_05590 4575 4351 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868354.1 protein_id gnl|my_center|LOCUS_05590 5352 4579 gene locus_tag LOCUS_05600 5352 4579 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869781.1 protein_id gnl|my_center|LOCUS_05600 5783 5352 gene locus_tag LOCUS_05610 gene hypA 5783 5352 CDS product hydrogenase nickel incorporation protein HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867705.1 protein_id gnl|my_center|LOCUS_05610 6383 5793 gene locus_tag LOCUS_05620 6383 5793 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221964.1 protein_id gnl|my_center|LOCUS_05620 7051 6326 gene locus_tag LOCUS_05630 7051 6326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 8437 7097 gene locus_tag LOCUS_05640 8437 7097 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761957.1 protein_id gnl|my_center|LOCUS_05640 9222 8434 gene locus_tag LOCUS_05650 9222 8434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761958.1 protein_id gnl|my_center|LOCUS_05650 11002 9233 gene locus_tag LOCUS_05660 11002 9233 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761956.1 protein_id gnl|my_center|LOCUS_05660 12251 11004 gene locus_tag LOCUS_05670 12251 11004 CDS product hyaluronate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761959.1 protein_id gnl|my_center|LOCUS_05670 13252 14295 gene locus_tag LOCUS_05680 gene hypE 13252 14295 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761962.1 protein_id gnl|my_center|LOCUS_05680 14875 14447 gene locus_tag LOCUS_05690 14875 14447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 16043 14895 gene locus_tag LOCUS_05700 16043 14895 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878064.1 protein_id gnl|my_center|LOCUS_05700 16282 16040 gene locus_tag LOCUS_05710 16282 16040 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979944.1 protein_id gnl|my_center|LOCUS_05710 16700 16293 gene locus_tag LOCUS_05720 16700 16293 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978597.1 protein_id gnl|my_center|LOCUS_05720 17254 16817 gene locus_tag LOCUS_05730 17254 16817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 18417 17278 gene locus_tag LOCUS_05740 18417 17278 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256474.1 protein_id gnl|my_center|LOCUS_05740 18652 19611 gene locus_tag LOCUS_05750 18652 19611 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812204.1 protein_id gnl|my_center|LOCUS_05750 19608 20789 gene locus_tag LOCUS_05760 19608 20789 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812206.1 protein_id gnl|my_center|LOCUS_05760 21932 20868 gene locus_tag LOCUS_05770 21932 20868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 22342 22446 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23147 25051 gene locus_tag LOCUS_05780 23147 25051 CDS product DUF3160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023262.1 protein_id gnl|my_center|LOCUS_05780 26219 25566 gene locus_tag LOCUS_05790 26219 25566 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932180.1 protein_id gnl|my_center|LOCUS_05790 26381 26929 gene locus_tag LOCUS_05800 26381 26929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05800 26913 27122 gene locus_tag LOCUS_05810 26913 27122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 27125 28111 gene locus_tag LOCUS_05820 27125 28111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 28121 28987 gene locus_tag LOCUS_05830 gene fdxH 28121 28987 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880648.1 protein_id gnl|my_center|LOCUS_05830 28984 29700 gene locus_tag LOCUS_05840 28984 29700 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880649.1 protein_id gnl|my_center|LOCUS_05840 30962 29793 gene locus_tag LOCUS_05850 30962 29793 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041161656.1 protein_id gnl|my_center|LOCUS_05850 31261 33120 gene locus_tag LOCUS_05860 31261 33120 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081506.1 protein_id gnl|my_center|LOCUS_05860 33180 34214 gene locus_tag LOCUS_05870 33180 34214 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081437.1 protein_id gnl|my_center|LOCUS_05870 34231 35172 gene locus_tag LOCUS_05880 34231 35172 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081440.1 protein_id gnl|my_center|LOCUS_05880 35179 36336 gene locus_tag LOCUS_05890 35179 36336 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146644.1 protein_id gnl|my_center|LOCUS_05890 36333 37427 gene locus_tag LOCUS_05900 36333 37427 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584051.1 protein_id gnl|my_center|LOCUS_05900 37432 37974 gene locus_tag LOCUS_05910 37432 37974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 38755 38000 gene locus_tag LOCUS_05920 38755 38000 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065164.1 protein_id gnl|my_center|LOCUS_05920 39669 38752 gene locus_tag LOCUS_05930 39669 38752 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021606.1 protein_id gnl|my_center|LOCUS_05930 40250 39666 gene locus_tag LOCUS_05940 40250 39666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 40671 40210 gene locus_tag LOCUS_05950 40671 40210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 40969 42081 gene locus_tag LOCUS_05960 40969 42081 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846928.1 protein_id gnl|my_center|LOCUS_05960 42205 45330 gene locus_tag LOCUS_05970 42205 45330 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867823.1 protein_id gnl|my_center|LOCUS_05970 45393 45683 gene locus_tag LOCUS_05980 45393 45683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 45888 45670 gene locus_tag LOCUS_05990 45888 45670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 45800 46696 gene locus_tag LOCUS_06000 gene menA 45800 46696 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081897.1 protein_id gnl|my_center|LOCUS_06000 46970 48295 gene locus_tag LOCUS_06010 46970 48295 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762365.1 protein_id gnl|my_center|LOCUS_06010 48708 48319 gene locus_tag LOCUS_06020 48708 48319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 49767 48826 gene locus_tag LOCUS_06030 49767 48826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 50214 49933 gene locus_tag LOCUS_06040 50214 49933 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763032.1 protein_id gnl|my_center|LOCUS_06040 50612 50259 gene locus_tag LOCUS_06050 50612 50259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 50695 50832 gene locus_tag LOCUS_06060 50695 50832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 51131 51610 gene locus_tag LOCUS_06070 51131 51610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 52398 51652 gene locus_tag LOCUS_06080 52398 51652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 53335 52562 gene locus_tag LOCUS_06090 53335 52562 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541595.1 protein_id gnl|my_center|LOCUS_06090 53371 54555 gene locus_tag LOCUS_06100 53371 54555 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048176563.1 protein_id gnl|my_center|LOCUS_06100 54626 55399 gene locus_tag LOCUS_06110 gene xth 54626 55399 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878084.1 protein_id gnl|my_center|LOCUS_06110 56467 55520 gene locus_tag LOCUS_06120 56467 55520 CDS product isoaspartyl peptidase/L-asparaginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939517.1 protein_id gnl|my_center|LOCUS_06120 57984 56695 gene locus_tag LOCUS_06130 57984 56695 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391475.1 protein_id gnl|my_center|LOCUS_06130 58923 59699 gene locus_tag LOCUS_06140 58923 59699 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583300.1 protein_id gnl|my_center|LOCUS_06140 59692 60393 gene locus_tag LOCUS_06150 59692 60393 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_06150 60396 61295 gene locus_tag LOCUS_06160 60396 61295 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852952.1 protein_id gnl|my_center|LOCUS_06160 61292 62338 gene locus_tag LOCUS_06170 61292 62338 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080270.1 protein_id gnl|my_center|LOCUS_06170 62452 63216 gene locus_tag LOCUS_06180 62452 63216 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391476.1 protein_id gnl|my_center|LOCUS_06180 63267 63794 gene locus_tag LOCUS_06190 gene tsaA 63267 63794 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978062.1 protein_id gnl|my_center|LOCUS_06190 65189 63855 gene locus_tag LOCUS_06200 65189 63855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 65338 66219 gene locus_tag LOCUS_06210 gene rbsK 65338 66219 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980414.1 protein_id gnl|my_center|LOCUS_06210 66295 66684 gene locus_tag LOCUS_06220 66295 66684 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979516.1 protein_id gnl|my_center|LOCUS_06220 66771 67652 gene locus_tag LOCUS_06230 66771 67652 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867985.1 protein_id gnl|my_center|LOCUS_06230 67649 68623 gene locus_tag LOCUS_06240 67649 68623 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867986.1 protein_id gnl|my_center|LOCUS_06240 68660 69415 gene locus_tag LOCUS_06250 gene fabG 68660 69415 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_06250 >Feature sequence07 877 137 gene locus_tag LOCUS_06260 877 137 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060841.1 protein_id gnl|my_center|LOCUS_06260 1062 1544 gene locus_tag LOCUS_06270 1062 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 1596 3923 gene locus_tag LOCUS_06280 1596 3923 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762768.1 protein_id gnl|my_center|LOCUS_06280 4285 4869 gene locus_tag LOCUS_06290 4285 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429693.1 protein_id gnl|my_center|LOCUS_06290 4891 6330 gene locus_tag LOCUS_06300 4891 6330 CDS product DNA-directed DNA polymerase II small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877017.1 protein_id gnl|my_center|LOCUS_06300 7516 6332 gene locus_tag LOCUS_06310 7516 6332 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877755.1 protein_id gnl|my_center|LOCUS_06310 8528 7764 gene locus_tag LOCUS_06320 8528 7764 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_06320 9296 8529 gene locus_tag LOCUS_06330 9296 8529 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249697.1 protein_id gnl|my_center|LOCUS_06330 10120 9293 gene locus_tag LOCUS_06340 10120 9293 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867495.1 protein_id gnl|my_center|LOCUS_06340 10183 10836 gene locus_tag LOCUS_06350 10183 10836 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147211.1 protein_id gnl|my_center|LOCUS_06350 10808 11869 gene locus_tag LOCUS_06360 gene spn 10808 11869 CDS product bifunctional sugar-1-phosphate nucleotidylyltransferase/acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978425.1 protein_id gnl|my_center|LOCUS_06360 13055 11862 gene locus_tag LOCUS_06370 13055 11862 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978424.1 protein_id gnl|my_center|LOCUS_06370 13190 13717 gene locus_tag LOCUS_06380 13190 13717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 13724 14176 gene locus_tag LOCUS_06390 13724 14176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 14161 14781 gene locus_tag LOCUS_06400 14161 14781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 14782 15102 gene locus_tag LOCUS_06410 14782 15102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 15191 15901 gene locus_tag LOCUS_06420 gene psmA 15191 15901 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877997.1 protein_id gnl|my_center|LOCUS_06420 15879 16583 gene locus_tag LOCUS_06430 15879 16583 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867732.1 protein_id gnl|my_center|LOCUS_06430 16576 17268 gene locus_tag LOCUS_06440 gene rrp4 16576 17268 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250586.1 protein_id gnl|my_center|LOCUS_06440 17286 18038 gene locus_tag LOCUS_06450 gene rrp41 17286 18038 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250585.1 protein_id gnl|my_center|LOCUS_06450 18038 18847 gene locus_tag LOCUS_06460 gene rrp42 18038 18847 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250584.1 protein_id gnl|my_center|LOCUS_06460 18848 19096 gene locus_tag LOCUS_06470 18848 19096 CDS product 50S ribosomal protein L37ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867396.1 protein_id gnl|my_center|LOCUS_06470 19093 19665 gene locus_tag LOCUS_06480 19093 19665 CDS product rRNA maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870098.1 protein_id gnl|my_center|LOCUS_06480 19646 19873 gene locus_tag LOCUS_06490 19646 19873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 20563 19862 gene locus_tag LOCUS_06500 20563 19862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 21369 20563 gene locus_tag LOCUS_06510 21369 20563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 21431 21505 gene locus_tag LOCUS_t00060 21431 21505 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 23059 21515 gene locus_tag LOCUS_06520 23059 21515 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871145.1 protein_id gnl|my_center|LOCUS_06520 23118 23621 gene locus_tag LOCUS_06530 23118 23621 CDS product GTP-dependent dephospho-CoA kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875905.1 protein_id gnl|my_center|LOCUS_06530 25362 23587 gene locus_tag LOCUS_06540 gene tgtA 25362 23587 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068322314.1 protein_id gnl|my_center|LOCUS_06540 25651 25418 gene locus_tag LOCUS_06550 25651 25418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 25864 27003 gene locus_tag LOCUS_06560 25864 27003 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867288.1 protein_id gnl|my_center|LOCUS_06560 27017 27799 gene locus_tag LOCUS_06570 27017 27799 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978333.1 protein_id gnl|my_center|LOCUS_06570 28121 27783 gene locus_tag LOCUS_06580 28121 27783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 28387 28115 gene locus_tag LOCUS_06590 28387 28115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 29040 28384 gene locus_tag LOCUS_06600 29040 28384 CDS product Era-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878677.1 protein_id gnl|my_center|LOCUS_06600 30452 29118 gene locus_tag LOCUS_06610 30452 29118 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869657.1 protein_id gnl|my_center|LOCUS_06610 31818 30445 gene locus_tag LOCUS_06620 gene purB 31818 30445 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496668.1 protein_id gnl|my_center|LOCUS_06620 32458 31799 gene locus_tag LOCUS_06630 32458 31799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06630 33912 32569 gene locus_tag LOCUS_06640 33912 32569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06640 36064 33917 gene locus_tag LOCUS_06650 36064 33917 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846340.1 protein_id gnl|my_center|LOCUS_06650 36551 36048 gene locus_tag LOCUS_06660 36551 36048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 36611 37465 gene locus_tag LOCUS_06670 36611 37465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 37493 37577 gene locus_tag LOCUS_t00070 37493 37577 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 38731 37559 gene locus_tag LOCUS_06680 38731 37559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 38818 39228 gene locus_tag LOCUS_06690 38818 39228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 39204 39704 gene locus_tag LOCUS_06700 39204 39704 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978945.1 protein_id gnl|my_center|LOCUS_06700 40602 39694 gene locus_tag LOCUS_06710 gene rnz 40602 39694 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878439.1 protein_id gnl|my_center|LOCUS_06710 41638 40604 gene locus_tag LOCUS_06720 41638 40604 CDS product TIGR01177 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876363.1 protein_id gnl|my_center|LOCUS_06720 42661 41639 gene locus_tag LOCUS_06730 42661 41639 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867947.1 protein_id gnl|my_center|LOCUS_06730 43793 42672 gene locus_tag LOCUS_06740 43793 42672 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061033.1 protein_id gnl|my_center|LOCUS_06740 44911 43796 gene locus_tag LOCUS_06750 44911 43796 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251116.1 protein_id gnl|my_center|LOCUS_06750 45517 44921 gene locus_tag LOCUS_06760 gene psmB 45517 44921 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762506.1 protein_id gnl|my_center|LOCUS_06760 45615 45538 gene locus_tag LOCUS_t00080 45615 45538 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 47128 45650 gene locus_tag LOCUS_06770 47128 45650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 47654 47322 gene locus_tag LOCUS_06780 47654 47322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 47752 47676 gene locus_tag LOCUS_t00090 47752 47676 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 47903 49006 gene locus_tag LOCUS_06790 47903 49006 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878796.1 protein_id gnl|my_center|LOCUS_06790 49200 49742 gene locus_tag LOCUS_06800 49200 49742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 49884 50519 gene locus_tag LOCUS_06810 49884 50519 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762559.1 protein_id gnl|my_center|LOCUS_06810 50591 51688 gene locus_tag LOCUS_06820 gene fbp 50591 51688 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846263.1 protein_id gnl|my_center|LOCUS_06820 52364 51675 gene locus_tag LOCUS_06830 gene tpiA 52364 51675 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868855.1 protein_id gnl|my_center|LOCUS_06830 52418 53284 gene locus_tag LOCUS_06840 52418 53284 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496419.1 protein_id gnl|my_center|LOCUS_06840 53289 53900 gene locus_tag LOCUS_06850 53289 53900 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867133.1 protein_id gnl|my_center|LOCUS_06850 53903 55081 gene locus_tag LOCUS_06860 53903 55081 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066094.1 protein_id gnl|my_center|LOCUS_06860 55574 55083 gene locus_tag LOCUS_06870 55574 55083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 57180 55558 gene locus_tag LOCUS_06880 gene lysS 57180 55558 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583287.1 protein_id gnl|my_center|LOCUS_06880 57543 57256 gene locus_tag LOCUS_06890 gene albA 57543 57256 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879448.1 protein_id gnl|my_center|LOCUS_06890 57927 57634 gene locus_tag LOCUS_06900 57927 57634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 59539 57896 gene locus_tag LOCUS_06910 gene thsB 59539 57896 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879727.1 protein_id gnl|my_center|LOCUS_06910 59690 62590 gene locus_tag LOCUS_06920 59690 62590 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762372.1 protein_id gnl|my_center|LOCUS_06920 >Feature sequence08 451 77 gene locus_tag LOCUS_06930 451 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 582 1331 gene locus_tag LOCUS_06940 582 1331 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541103.1 protein_id gnl|my_center|LOCUS_06940 1351 1623 gene locus_tag LOCUS_06950 1351 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 1629 2816 gene locus_tag LOCUS_06960 1629 2816 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582945.1 protein_id gnl|my_center|LOCUS_06960 3441 2791 gene locus_tag LOCUS_06970 3441 2791 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_06970 3532 4728 gene locus_tag LOCUS_06980 3532 4728 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 protein_id gnl|my_center|LOCUS_06980 5069 4773 gene locus_tag LOCUS_06990 5069 4773 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980224.1 protein_id gnl|my_center|LOCUS_06990 5120 5827 gene locus_tag LOCUS_07000 5120 5827 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763153.1 protein_id gnl|my_center|LOCUS_07000 6320 5814 gene locus_tag LOCUS_07010 6320 5814 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867764.1 protein_id gnl|my_center|LOCUS_07010 8455 6359 gene locus_tag LOCUS_07020 gene feoB 8455 6359 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249908.1 protein_id gnl|my_center|LOCUS_07020 8688 8455 gene locus_tag LOCUS_07030 8688 8455 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583917.1 protein_id gnl|my_center|LOCUS_07030 10573 8732 gene locus_tag LOCUS_07040 10573 8732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 12160 10580 gene locus_tag LOCUS_07050 12160 10580 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978536.1 protein_id gnl|my_center|LOCUS_07050 12295 12433 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14266 13235 gene locus_tag LOCUS_07060 gene mtnA 14266 13235 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869953.1 protein_id gnl|my_center|LOCUS_07060 14870 14241 gene locus_tag LOCUS_07070 14870 14241 CDS product DUF434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870449.1 protein_id gnl|my_center|LOCUS_07070 17620 14906 gene locus_tag LOCUS_07080 gene alaS 17620 14906 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250518.1 protein_id gnl|my_center|LOCUS_07080 17988 17668 gene locus_tag LOCUS_07090 17988 17668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 20220 18034 gene locus_tag LOCUS_07100 20220 18034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 20286 20362 gene locus_tag LOCUS_t00100 20286 20362 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 21382 20777 gene locus_tag LOCUS_07110 21382 20777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 23780 21372 gene locus_tag LOCUS_07120 23780 21372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 26736 23935 gene locus_tag LOCUS_07130 26736 23935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 28115 27306 gene locus_tag LOCUS_07140 28115 27306 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061020.1 protein_id gnl|my_center|LOCUS_07140 28336 28112 gene locus_tag LOCUS_07150 28336 28112 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978936.1 protein_id gnl|my_center|LOCUS_07150 28611 28333 gene locus_tag LOCUS_07160 28611 28333 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762190.1 protein_id gnl|my_center|LOCUS_07160 29108 28608 gene locus_tag LOCUS_07170 29108 28608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 30295 29144 gene locus_tag LOCUS_07180 gene priS 30295 29144 CDS product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064280.1 protein_id gnl|my_center|LOCUS_07180 31229 30297 gene locus_tag LOCUS_07190 gene priL 31229 30297 CDS product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020168.1 protein_id gnl|my_center|LOCUS_07190 31986 31234 gene locus_tag LOCUS_07200 gene pcn 31986 31234 CDS product proliferating cell nuclear antigen (pcna) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762193.1 protein_id gnl|my_center|LOCUS_07200 32296 31976 gene locus_tag LOCUS_07210 32296 31976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 35851 32306 gene locus_tag LOCUS_07220 gene polC 35851 32306 CDS product DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879218.1 protein_id gnl|my_center|LOCUS_07220 35955 36200 gene locus_tag LOCUS_07230 35955 36200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 36838 36233 gene locus_tag LOCUS_07240 36838 36233 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868483.1 protein_id gnl|my_center|LOCUS_07240 36931 37350 gene locus_tag LOCUS_07250 36931 37350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 37380 40748 gene locus_tag LOCUS_07260 37380 40748 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867738.1 protein_id gnl|my_center|LOCUS_07260 40770 44747 gene locus_tag LOCUS_07270 40770 44747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 44716 45048 gene locus_tag LOCUS_07280 44716 45048 CDS product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762454.1 protein_id gnl|my_center|LOCUS_07280 45127 45534 gene locus_tag LOCUS_07290 45127 45534 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762453.1 protein_id gnl|my_center|LOCUS_07290 45543 45983 gene locus_tag LOCUS_07300 45543 45983 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978222.1 protein_id gnl|my_center|LOCUS_07300 45988 46635 gene locus_tag LOCUS_07310 45988 46635 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978220.1 protein_id gnl|my_center|LOCUS_07310 46683 46913 gene locus_tag LOCUS_07320 46683 46913 CDS product U6 snRNA-associated Sm-like protein LSm6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762446.1 protein_id gnl|my_center|LOCUS_07320 48716 46920 gene locus_tag LOCUS_07330 gene glmS 48716 46920 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249760.1 protein_id gnl|my_center|LOCUS_07330 49901 48729 gene locus_tag LOCUS_07340 49901 48729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 50106 52112 gene locus_tag LOCUS_07350 50106 52112 CDS product DUF460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598715.1 protein_id gnl|my_center|LOCUS_07350 52167 52334 gene locus_tag LOCUS_07360 52167 52334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 52378 53523 gene locus_tag LOCUS_07370 52378 53523 CDS product C/D box methylation guide ribonucleoprotein complex aNOP56 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156014546.1 protein_id gnl|my_center|LOCUS_07370 53513 54196 gene locus_tag LOCUS_07380 53513 54196 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867184.1 protein_id gnl|my_center|LOCUS_07380 55316 54183 gene locus_tag LOCUS_07390 55316 54183 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146544.1 protein_id gnl|my_center|LOCUS_07390 55303 55857 gene locus_tag LOCUS_07400 55303 55857 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876692.1 protein_id gnl|my_center|LOCUS_07400 56113 55835 gene locus_tag LOCUS_07410 56113 55835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 56397 56110 gene locus_tag LOCUS_07420 gene srp19 56397 56110 CDS product signal recognition particle SRP19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878753.1 protein_id gnl|my_center|LOCUS_07420 56788 56384 gene locus_tag LOCUS_07430 56788 56384 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875846.1 protein_id gnl|my_center|LOCUS_07430 57950 56790 gene locus_tag LOCUS_07440 57950 56790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 59253 57934 gene locus_tag LOCUS_07450 59253 57934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 60153 59269 gene locus_tag LOCUS_07460 60153 59269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 <60834 60163 gene locus_tag LOCUS_07470 <60834 60163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879727.1:thermosome subunit beta >Feature sequence09 1 1305 gene locus_tag LOCUS_07480 gene gdhA 1 1305 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867693.1 protein_id gnl|my_center|LOCUS_07480 2840 1392 gene locus_tag LOCUS_07490 2840 1392 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064511.1 protein_id gnl|my_center|LOCUS_07490 3116 3541 gene locus_tag LOCUS_07500 3116 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 3781 5106 gene locus_tag LOCUS_07510 3781 5106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 5272 6555 gene locus_tag LOCUS_07520 5272 6555 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867316.1 protein_id gnl|my_center|LOCUS_07520 6640 7518 gene locus_tag LOCUS_07530 6640 7518 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250915.1 protein_id gnl|my_center|LOCUS_07530 7531 8130 gene locus_tag LOCUS_07540 7531 8130 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240327.1 protein_id gnl|my_center|LOCUS_07540 8236 8529 gene locus_tag LOCUS_07550 8236 8529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 8904 9437 gene locus_tag LOCUS_07560 8904 9437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 9443 9709 gene locus_tag LOCUS_07570 9443 9709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 9706 10818 gene locus_tag LOCUS_07580 9706 10818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 11037 10810 gene locus_tag LOCUS_07590 11037 10810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 11803 11018 gene locus_tag LOCUS_07600 11803 11018 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240277.1 protein_id gnl|my_center|LOCUS_07600 13191 11803 gene locus_tag LOCUS_07610 13191 11803 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924859.1 protein_id gnl|my_center|LOCUS_07610 13926 13213 gene locus_tag LOCUS_07620 13926 13213 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020802.1 protein_id gnl|my_center|LOCUS_07620 13929 14303 gene locus_tag LOCUS_07630 13929 14303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 14363 15139 gene locus_tag LOCUS_07640 14363 15139 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867812.1 protein_id gnl|my_center|LOCUS_07640 15299 16138 gene locus_tag LOCUS_07650 15299 16138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 16214 17569 gene locus_tag LOCUS_07660 16214 17569 CDS product RuvB-like helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012965679.1 protein_id gnl|my_center|LOCUS_07660 17798 19321 gene locus_tag LOCUS_07670 17798 19321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 19308 19940 gene locus_tag LOCUS_07680 19308 19940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 21023 19977 gene locus_tag LOCUS_07690 21023 19977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 22705 21041 gene locus_tag LOCUS_07700 22705 21041 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763533.1 protein_id gnl|my_center|LOCUS_07700 22746 23789 gene locus_tag LOCUS_07710 22746 23789 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876249.1 protein_id gnl|my_center|LOCUS_07710 24595 23786 gene locus_tag LOCUS_07720 gene proC 24595 23786 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869320.1 protein_id gnl|my_center|LOCUS_07720 24958 24671 gene locus_tag LOCUS_07730 24958 24671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 25163 25420 gene locus_tag LOCUS_07740 25163 25420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 25468 27408 gene locus_tag LOCUS_07750 25468 27408 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763166.1 protein_id gnl|my_center|LOCUS_07750 27648 27442 gene locus_tag LOCUS_07760 27648 27442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 28345 27653 gene locus_tag LOCUS_07770 28345 27653 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249420.1 protein_id gnl|my_center|LOCUS_07770 29692 28418 gene locus_tag LOCUS_07780 29692 28418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 30195 32414 gene locus_tag LOCUS_07790 30195 32414 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846316.1 protein_id gnl|my_center|LOCUS_07790 33003 32422 gene locus_tag LOCUS_07800 gene pgsA 33003 32422 CDS product archaetidylinositol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061121.1 protein_id gnl|my_center|LOCUS_07800 33069 33782 gene locus_tag LOCUS_07810 33069 33782 CDS product TrmJ/YjtD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877451.1 protein_id gnl|my_center|LOCUS_07810 33784 34329 gene locus_tag LOCUS_07820 33784 34329 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846759.1 protein_id gnl|my_center|LOCUS_07820 34286 34918 gene locus_tag LOCUS_07830 34286 34918 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250883.1 protein_id gnl|my_center|LOCUS_07830 34915 35502 gene locus_tag LOCUS_07840 34915 35502 CDS product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250120.1 protein_id gnl|my_center|LOCUS_07840 35477 36112 gene locus_tag LOCUS_07850 35477 36112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 36114 36407 gene locus_tag LOCUS_07860 36114 36407 CDS product DNA-directed RNA polymerase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763526.1 protein_id gnl|my_center|LOCUS_07860 37491 36496 gene locus_tag LOCUS_07870 37491 36496 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250751.1 protein_id gnl|my_center|LOCUS_07870 38473 37484 gene locus_tag LOCUS_07880 38473 37484 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868867.1 protein_id gnl|my_center|LOCUS_07880 38705 40312 gene locus_tag LOCUS_07890 38705 40312 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020884.1 protein_id gnl|my_center|LOCUS_07890 40370 41347 gene locus_tag LOCUS_07900 40370 41347 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022455.1 protein_id gnl|my_center|LOCUS_07900 41352 42275 gene locus_tag LOCUS_07910 41352 42275 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860221.1 protein_id gnl|my_center|LOCUS_07910 42918 42475 gene locus_tag LOCUS_07920 42918 42475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 43333 42899 gene locus_tag LOCUS_07930 43333 42899 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867144.1 protein_id gnl|my_center|LOCUS_07930 44956 43655 gene locus_tag LOCUS_07940 44956 43655 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085916.1 protein_id gnl|my_center|LOCUS_07940 45935 45042 gene locus_tag LOCUS_07950 45935 45042 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812973.1 protein_id gnl|my_center|LOCUS_07950 46825 45935 gene locus_tag LOCUS_07960 46825 45935 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391940.1 protein_id gnl|my_center|LOCUS_07960 47088 46825 gene locus_tag LOCUS_07970 47088 46825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391939.1 protein_id gnl|my_center|LOCUS_07970 48344 47079 gene locus_tag LOCUS_07980 48344 47079 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391938.1 protein_id gnl|my_center|LOCUS_07980 49332 48427 gene locus_tag LOCUS_07990 49332 48427 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228258.1 protein_id gnl|my_center|LOCUS_07990 50096 49467 gene locus_tag LOCUS_08000 50096 49467 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867429.1 protein_id gnl|my_center|LOCUS_08000 50769 50098 gene locus_tag LOCUS_08010 50769 50098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 51437 50766 gene locus_tag LOCUS_08020 51437 50766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 51847 52176 gene locus_tag LOCUS_08030 51847 52176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 52158 53324 gene locus_tag LOCUS_08040 52158 53324 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876437.1 protein_id gnl|my_center|LOCUS_08040 53329 54366 gene locus_tag LOCUS_08050 gene asd 53329 54366 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876434.1 protein_id gnl|my_center|LOCUS_08050 54586 55128 gene locus_tag LOCUS_08060 gene dcd 54586 55128 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763548.1 protein_id gnl|my_center|LOCUS_08060 >Feature sequence10 1754 879 gene locus_tag LOCUS_08070 1754 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 2142 1747 gene locus_tag LOCUS_08080 2142 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 4209 2893 gene locus_tag LOCUS_08090 4209 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 5219 4251 gene locus_tag LOCUS_08100 5219 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 6012 5317 gene locus_tag LOCUS_08110 6012 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 7400 6267 gene locus_tag LOCUS_08120 7400 6267 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074272.1 protein_id gnl|my_center|LOCUS_08120 8811 7627 gene locus_tag LOCUS_08130 8811 7627 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928857.1 protein_id gnl|my_center|LOCUS_08130 8998 9186 gene locus_tag LOCUS_08140 8998 9186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 10307 9936 gene locus_tag LOCUS_08150 10307 9936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 11060 10374 gene locus_tag LOCUS_08160 11060 10374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 11197 11326 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13295 12228 gene locus_tag LOCUS_08170 13295 12228 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167827656.1 protein_id gnl|my_center|LOCUS_08170 14423 13311 gene locus_tag LOCUS_08180 14423 13311 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763188.1 protein_id gnl|my_center|LOCUS_08180 15125 15307 gene locus_tag LOCUS_08190 15125 15307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 15568 15792 gene locus_tag LOCUS_08200 15568 15792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 15879 16055 gene locus_tag LOCUS_08210 15879 16055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 17619 16285 gene locus_tag LOCUS_08220 17619 16285 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875835.1 protein_id gnl|my_center|LOCUS_08220 17946 17689 gene locus_tag LOCUS_08230 17946 17689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 18711 18541 gene locus_tag LOCUS_08240 18711 18541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 18754 18873 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19398 19934 gene locus_tag LOCUS_08250 19398 19934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 20766 20365 gene locus_tag LOCUS_08260 20766 20365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 21003 20773 gene locus_tag LOCUS_08270 21003 20773 CDS product type II toxin-antitoxin system CcdA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979989.1 protein_id gnl|my_center|LOCUS_08270 21737 21228 gene locus_tag LOCUS_08280 21737 21228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 23776 22286 gene locus_tag LOCUS_08290 23776 22286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 24981 24649 gene locus_tag LOCUS_08300 24981 24649 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979180.1 protein_id gnl|my_center|LOCUS_08300 25603 24968 gene locus_tag LOCUS_08310 25603 24968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 26889 26305 gene locus_tag LOCUS_08320 26889 26305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 27517 26876 gene locus_tag LOCUS_08330 27517 26876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 28492 28875 gene locus_tag LOCUS_08340 28492 28875 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879111.1 protein_id gnl|my_center|LOCUS_08340 28868 29191 gene locus_tag LOCUS_08350 28868 29191 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879110.1 protein_id gnl|my_center|LOCUS_08350 29382 29585 gene locus_tag LOCUS_08360 29382 29585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 29841 29980 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30865 31134 gene locus_tag LOCUS_08370 30865 31134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 32172 31213 gene locus_tag LOCUS_08380 32172 31213 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250659.1 protein_id gnl|my_center|LOCUS_08380 32393 32758 gene locus_tag LOCUS_08390 32393 32758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 32997 33485 gene locus_tag LOCUS_08400 32997 33485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 33593 34204 gene locus_tag LOCUS_08410 33593 34204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 34541 35182 gene locus_tag LOCUS_08420 34541 35182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 35152 35577 gene locus_tag LOCUS_08430 35152 35577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 35895 35638 gene locus_tag LOCUS_08440 35895 35638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 35905 36116 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36294 36923 gene locus_tag LOCUS_08450 36294 36923 CDS product IS607-like element ISTko1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249606.1 protein_id gnl|my_center|LOCUS_08450 36920 38209 gene locus_tag LOCUS_08460 36920 38209 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249605.1 protein_id gnl|my_center|LOCUS_08460 39067 38315 gene locus_tag LOCUS_08470 39067 38315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 40273 40016 gene locus_tag LOCUS_08480 40273 40016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 40851 41567 gene locus_tag LOCUS_08490 40851 41567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 42353 42198 gene locus_tag LOCUS_08500 42353 42198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 42448 43251 gene locus_tag LOCUS_08510 42448 43251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 43472 43711 gene locus_tag LOCUS_08520 43472 43711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 43686 44189 gene locus_tag LOCUS_08530 43686 44189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 45016 44774 gene locus_tag LOCUS_08540 45016 44774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 44985 46811 gene locus_tag LOCUS_08550 44985 46811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 46808 47539 gene locus_tag LOCUS_08560 46808 47539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 48778 48002 gene locus_tag LOCUS_08570 48778 48002 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927632.1 protein_id gnl|my_center|LOCUS_08570 49800 49246 gene locus_tag LOCUS_08580 49800 49246 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250217.1 protein_id gnl|my_center|LOCUS_08580 49859 50968 gene locus_tag LOCUS_08590 49859 50968 CDS product cystathionine gamma-synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068577384.1 protein_id gnl|my_center|LOCUS_08590 51121 51594 gene locus_tag LOCUS_08600 51121 51594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 52738 51704 gene locus_tag LOCUS_08610 52738 51704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 54019 52832 gene locus_tag LOCUS_08620 54019 52832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 >Feature sequence11 2483 123 gene locus_tag LOCUS_08630 2483 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 3148 2657 gene locus_tag LOCUS_08640 gene lysM 3148 2657 CDS product HTH-type transcriptional regulator LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978132.1 protein_id gnl|my_center|LOCUS_08640 3614 3102 gene locus_tag LOCUS_08650 3614 3102 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978555.1 protein_id gnl|my_center|LOCUS_08650 3667 4458 gene locus_tag LOCUS_08660 gene uppS 3667 4458 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867696.1 protein_id gnl|my_center|LOCUS_08660 4448 5365 gene locus_tag LOCUS_08670 4448 5365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 5331 6062 gene locus_tag LOCUS_08680 5331 6062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 6049 6657 gene locus_tag LOCUS_08690 6049 6657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 7276 6638 gene locus_tag LOCUS_08700 7276 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 8052 7273 gene locus_tag LOCUS_08710 8052 7273 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881009.1 protein_id gnl|my_center|LOCUS_08710 8113 8703 gene locus_tag LOCUS_08720 8113 8703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 8715 9203 gene locus_tag LOCUS_08730 8715 9203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 10506 9256 gene locus_tag LOCUS_08740 10506 9256 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846662.1 protein_id gnl|my_center|LOCUS_08740 10988 10551 gene locus_tag LOCUS_08750 10988 10551 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762119.1 protein_id gnl|my_center|LOCUS_08750 11166 13106 gene locus_tag LOCUS_08760 11166 13106 CDS product CGP-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146626.1 protein_id gnl|my_center|LOCUS_08760 13107 13379 gene locus_tag LOCUS_08770 13107 13379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 13457 13939 gene locus_tag LOCUS_08780 13457 13939 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879790.1 protein_id gnl|my_center|LOCUS_08780 14800 14024 gene locus_tag LOCUS_08790 14800 14024 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879103.1 protein_id gnl|my_center|LOCUS_08790 15624 14797 gene locus_tag LOCUS_08800 15624 14797 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879104.1 protein_id gnl|my_center|LOCUS_08800 16721 15630 gene locus_tag LOCUS_08810 16721 15630 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879105.1 protein_id gnl|my_center|LOCUS_08810 16890 18353 gene locus_tag LOCUS_08820 16890 18353 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762889.1 protein_id gnl|my_center|LOCUS_08820 19685 18840 gene locus_tag LOCUS_08830 19685 18840 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762992.1 protein_id gnl|my_center|LOCUS_08830 21198 19990 gene locus_tag LOCUS_08840 21198 19990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 22137 21199 gene locus_tag LOCUS_08850 22137 21199 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582519.1 protein_id gnl|my_center|LOCUS_08850 22387 23271 gene locus_tag LOCUS_08860 22387 23271 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259348.1 protein_id gnl|my_center|LOCUS_08860 23337 24266 gene locus_tag LOCUS_08870 23337 24266 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876013.1 protein_id gnl|my_center|LOCUS_08870 25406 24330 gene locus_tag LOCUS_08880 25406 24330 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949089.1 protein_id gnl|my_center|LOCUS_08880 25664 25452 gene locus_tag LOCUS_08890 25664 25452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 25620 26669 gene locus_tag LOCUS_08900 25620 26669 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868404.1 protein_id gnl|my_center|LOCUS_08900 27360 26701 gene locus_tag LOCUS_08910 27360 26701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 27713 27453 gene locus_tag LOCUS_08920 gene moaD 27713 27453 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251068.1 protein_id gnl|my_center|LOCUS_08920 27959 28438 gene locus_tag LOCUS_08930 27959 28438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 28640 29935 gene locus_tag LOCUS_08940 28640 29935 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460037.1 protein_id gnl|my_center|LOCUS_08940 30150 30620 gene locus_tag LOCUS_08950 30150 30620 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229486.1 protein_id gnl|my_center|LOCUS_08950 30906 31508 gene locus_tag LOCUS_08960 30906 31508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 31999 31547 gene locus_tag LOCUS_08970 31999 31547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 32430 32197 gene locus_tag LOCUS_08980 32430 32197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763095.1 protein_id gnl|my_center|LOCUS_08980 32968 32408 gene locus_tag LOCUS_08990 32968 32408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763094.1 protein_id gnl|my_center|LOCUS_08990 33194 32958 gene locus_tag LOCUS_09000 33194 32958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763093.1 protein_id gnl|my_center|LOCUS_09000 33560 35710 gene locus_tag LOCUS_09010 33560 35710 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_09010 35715 36680 gene locus_tag LOCUS_09020 35715 36680 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240546.1 protein_id gnl|my_center|LOCUS_09020 36879 37919 gene locus_tag LOCUS_09030 36879 37919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 39226 38009 gene locus_tag LOCUS_09040 39226 38009 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869050.1 protein_id gnl|my_center|LOCUS_09040 39770 39357 gene locus_tag LOCUS_09050 39770 39357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 40098 39739 gene locus_tag LOCUS_09060 40098 39739 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172718.1 protein_id gnl|my_center|LOCUS_09060 40822 40304 gene locus_tag LOCUS_09070 40822 40304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 40890 41246 gene locus_tag LOCUS_09080 40890 41246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 41529 41732 gene locus_tag LOCUS_09090 41529 41732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 43310 43786 gene locus_tag LOCUS_09100 43310 43786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 43911 44828 gene locus_tag LOCUS_09110 43911 44828 CDS product 7,8-dihydropterin-6-methyl-4-(beta-D-ribofuranosyl)-aminobenzene-5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869799.1 protein_id gnl|my_center|LOCUS_09110 45505 44858 gene locus_tag LOCUS_09120 45505 44858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 46290 45829 gene locus_tag LOCUS_09130 46290 45829 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228850.1 protein_id gnl|my_center|LOCUS_09130 <47581 46592 gene locus_tag LOCUS_09140 <47581 46592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001072162.1:Fic family protein >Feature sequence12 1400 468 gene locus_tag LOCUS_09150 gene argF 1400 468 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868438.1 protein_id gnl|my_center|LOCUS_09150 2295 1423 gene locus_tag LOCUS_09160 gene ftsY 2295 1423 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867626.1 protein_id gnl|my_center|LOCUS_09160 2683 2285 gene locus_tag LOCUS_09170 2683 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 3376 2705 gene locus_tag LOCUS_09180 3376 2705 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250272.1 protein_id gnl|my_center|LOCUS_09180 3657 3385 gene locus_tag LOCUS_09190 3657 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 3819 3667 gene locus_tag LOCUS_09200 3819 3667 CDS product 50S ribosomal protein L39e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877221.1 protein_id gnl|my_center|LOCUS_09200 4161 3832 gene locus_tag LOCUS_09210 4161 3832 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024007.1 protein_id gnl|my_center|LOCUS_09210 4616 4158 gene locus_tag LOCUS_09220 4616 4158 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867943.1 protein_id gnl|my_center|LOCUS_09220 5734 5060 gene locus_tag LOCUS_09230 5734 5060 CDS product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980208.1 protein_id gnl|my_center|LOCUS_09230 5784 5860 gene locus_tag LOCUS_t00110 5784 5860 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5866 5941 gene locus_tag LOCUS_t00120 5866 5941 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 6077 6004 gene locus_tag LOCUS_t00130 6077 6004 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 6352 7554 gene locus_tag LOCUS_09240 gene ftsZ 6352 7554 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877283.1 protein_id gnl|my_center|LOCUS_09240 7565 7759 gene locus_tag LOCUS_09250 7565 7759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 7764 8267 gene locus_tag LOCUS_09260 7764 8267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 8260 8745 gene locus_tag LOCUS_09270 8260 8745 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867125.1 protein_id gnl|my_center|LOCUS_09270 8747 9430 gene locus_tag LOCUS_09280 8747 9430 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762220.1 protein_id gnl|my_center|LOCUS_09280 9427 10311 gene locus_tag LOCUS_09290 9427 10311 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877288.1 protein_id gnl|my_center|LOCUS_09290 11653 10532 gene locus_tag LOCUS_09300 11653 10532 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878279.1 protein_id gnl|my_center|LOCUS_09300 12283 11777 gene locus_tag LOCUS_09310 12283 11777 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978170.1 protein_id gnl|my_center|LOCUS_09310 12379 12305 gene locus_tag LOCUS_t00140 12379 12305 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 12509 12423 gene locus_tag LOCUS_t00150 12509 12423 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12587 12512 gene locus_tag LOCUS_t00160 12587 12512 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 13800 12700 gene locus_tag LOCUS_09320 13800 12700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 15355 13766 gene locus_tag LOCUS_09330 15355 13766 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979316.1 protein_id gnl|my_center|LOCUS_09330 15938 15345 gene locus_tag LOCUS_09340 15938 15345 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060946.1 protein_id gnl|my_center|LOCUS_09340 16736 15948 gene locus_tag LOCUS_09350 gene rio1 16736 15948 CDS product serine/threonine-protein kinase Rio1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289466.1 protein_id gnl|my_center|LOCUS_09350 17131 16751 gene locus_tag LOCUS_09360 17131 16751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 17565 17143 gene locus_tag LOCUS_09370 17565 17143 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869589.1 protein_id gnl|my_center|LOCUS_09370 18211 17573 gene locus_tag LOCUS_09380 18211 17573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 18600 18358 gene locus_tag LOCUS_09390 18600 18358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 19003 18605 gene locus_tag LOCUS_09400 19003 18605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 19002 19187 gene locus_tag LOCUS_09410 19002 19187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 19230 19733 gene locus_tag LOCUS_09420 19230 19733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 19897 20571 gene locus_tag LOCUS_09430 19897 20571 CDS product UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884438.1 protein_id gnl|my_center|LOCUS_09430 22059 20527 gene locus_tag LOCUS_09440 gene gcvPB 22059 20527 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868896.1 protein_id gnl|my_center|LOCUS_09440 23468 22056 gene locus_tag LOCUS_09450 gene gcvPA 23468 22056 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868897.1 protein_id gnl|my_center|LOCUS_09450 23778 23939 gene locus_tag LOCUS_09460 23778 23939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 23939 25168 gene locus_tag LOCUS_09470 23939 25168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 26174 27016 gene locus_tag LOCUS_09480 26174 27016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 27004 27453 gene locus_tag LOCUS_09490 27004 27453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 27462 27944 gene locus_tag LOCUS_09500 27462 27944 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147117.1 protein_id gnl|my_center|LOCUS_09500 27946 28857 gene locus_tag LOCUS_09510 gene radA 27946 28857 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762467.1 protein_id gnl|my_center|LOCUS_09510 28915 29346 gene locus_tag LOCUS_09520 gene gcvH 28915 29346 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583866.1 protein_id gnl|my_center|LOCUS_09520 29348 30532 gene locus_tag LOCUS_09530 29348 30532 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878920.1 protein_id gnl|my_center|LOCUS_09530 30685 31149 gene locus_tag LOCUS_09540 30685 31149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 31486 31106 gene locus_tag LOCUS_09550 31486 31106 CDS product Sjogren's syndrome/scleroderma autoantigen 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240467.1 protein_id gnl|my_center|LOCUS_09550 31580 31864 gene locus_tag LOCUS_09560 31580 31864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 32619 31861 gene locus_tag LOCUS_09570 32619 31861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 32709 32637 gene locus_tag LOCUS_t00170 32709 32637 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 32793 32716 gene locus_tag LOCUS_t00180 32793 32716 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 33080 32889 gene locus_tag LOCUS_09580 33080 32889 CDS product 50S ribosomal protein L37e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978307.1 protein_id gnl|my_center|LOCUS_09580 33347 33093 gene locus_tag LOCUS_09590 33347 33093 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846912.1 protein_id gnl|my_center|LOCUS_09590 33591 33992 gene locus_tag LOCUS_09600 33591 33992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 35907 34012 gene locus_tag LOCUS_09610 35907 34012 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180546184.1 protein_id gnl|my_center|LOCUS_09610 36604 35924 gene locus_tag LOCUS_09620 36604 35924 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762844.1 protein_id gnl|my_center|LOCUS_09620 36700 37146 gene locus_tag LOCUS_09630 36700 37146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 37891 37172 gene locus_tag LOCUS_09640 37891 37172 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762843.1 protein_id gnl|my_center|LOCUS_09640 40779 37948 gene locus_tag LOCUS_09650 40779 37948 CDS product intein-containing RctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870187.1 protein_id gnl|my_center|LOCUS_09650 40839 41606 gene locus_tag LOCUS_09660 gene rsmA 40839 41606 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867501.1 protein_id gnl|my_center|LOCUS_09660 41576 42202 gene locus_tag LOCUS_09670 41576 42202 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870442.1 protein_id gnl|my_center|LOCUS_09670 42371 42174 gene locus_tag LOCUS_09680 42371 42174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 42577 42500 gene locus_tag LOCUS_t00190 42577 42500 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 42832 42668 gene locus_tag LOCUS_09690 42832 42668 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878609.1 protein_id gnl|my_center|LOCUS_09690 43128 42829 gene locus_tag LOCUS_09700 43128 42829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 43385 43197 gene locus_tag LOCUS_09710 43385 43197 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868804.1 protein_id gnl|my_center|LOCUS_09710 43950 43390 gene locus_tag LOCUS_09720 gene rpoE 43950 43390 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869896.1 protein_id gnl|my_center|LOCUS_09720 44402 43998 gene locus_tag LOCUS_09730 44402 43998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 44491 44415 gene locus_tag LOCUS_t00200 44491 44415 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 44565 44492 gene locus_tag LOCUS_t00210 44565 44492 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 <45608 44611 gene locus_tag LOCUS_09740 <45608 44611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870340.1:peptide chain release factor aRF-1 >Feature sequence13 864 706 gene locus_tag LOCUS_09750 864 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 1491 877 gene locus_tag LOCUS_09760 1491 877 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877737.1 protein_id gnl|my_center|LOCUS_09760 1761 2729 gene locus_tag LOCUS_09770 gene ilvA 1761 2729 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_09770 3027 3911 gene locus_tag LOCUS_09780 3027 3911 CDS product DUF2099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066046.1 protein_id gnl|my_center|LOCUS_09780 4022 4507 gene locus_tag LOCUS_09790 4022 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 4530 5594 gene locus_tag LOCUS_09800 4530 5594 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867610.1 protein_id gnl|my_center|LOCUS_09800 6412 5690 gene locus_tag LOCUS_09810 6412 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 7270 6473 gene locus_tag LOCUS_09820 7270 6473 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871096.1 protein_id gnl|my_center|LOCUS_09820 8091 7249 gene locus_tag LOCUS_09830 gene cbiQ 8091 7249 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023916.1 protein_id gnl|my_center|LOCUS_09830 8393 8091 gene locus_tag LOCUS_09840 8393 8091 CDS product PDGLE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584113.1 protein_id gnl|my_center|LOCUS_09840 9079 8399 gene locus_tag LOCUS_09850 gene cbiM 9079 8399 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871093.1 protein_id gnl|my_center|LOCUS_09850 9978 9166 gene locus_tag LOCUS_09860 9978 9166 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255779.1 protein_id gnl|my_center|LOCUS_09860 11678 9969 gene locus_tag LOCUS_09870 11678 9969 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392228.1 protein_id gnl|my_center|LOCUS_09870 11799 13085 gene locus_tag LOCUS_09880 11799 13085 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948975.1 protein_id gnl|my_center|LOCUS_09880 13073 14053 gene locus_tag LOCUS_09890 13073 14053 CDS product DNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876855.1 protein_id gnl|my_center|LOCUS_09890 14639 14223 gene locus_tag LOCUS_09900 14639 14223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 14869 14639 gene locus_tag LOCUS_09910 14869 14639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 15553 15200 gene locus_tag LOCUS_09920 15553 15200 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980076.1 protein_id gnl|my_center|LOCUS_09920 15824 15579 gene locus_tag LOCUS_09930 15824 15579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 17218 16511 gene locus_tag LOCUS_09940 17218 16511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 17775 17203 gene locus_tag LOCUS_09950 17775 17203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 17953 17768 gene locus_tag LOCUS_09960 17953 17768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 18253 18002 gene locus_tag LOCUS_09970 18253 18002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 18406 18807 gene locus_tag LOCUS_09980 18406 18807 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978646.1 protein_id gnl|my_center|LOCUS_09980 18782 19102 gene locus_tag LOCUS_09990 18782 19102 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879110.1 protein_id gnl|my_center|LOCUS_09990 19256 19675 gene locus_tag LOCUS_10000 19256 19675 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978678.1 protein_id gnl|my_center|LOCUS_10000 19635 20021 gene locus_tag LOCUS_10010 19635 20021 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978679.1 protein_id gnl|my_center|LOCUS_10010 20858 20322 gene locus_tag LOCUS_10020 20858 20322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 21134 21595 gene locus_tag LOCUS_10030 21134 21595 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880208.1 protein_id gnl|my_center|LOCUS_10030 22099 21857 gene locus_tag LOCUS_10040 22099 21857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 23204 22305 gene locus_tag LOCUS_10050 23204 22305 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429779.1 protein_id gnl|my_center|LOCUS_10050 24138 23185 gene locus_tag LOCUS_10060 gene mch 24138 23185 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021714.1 protein_id gnl|my_center|LOCUS_10060 24986 24141 gene locus_tag LOCUS_10070 24986 24141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 26678 24987 gene locus_tag LOCUS_10080 26678 24987 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879423.1 protein_id gnl|my_center|LOCUS_10080 28420 26675 gene locus_tag LOCUS_10090 28420 26675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 29340 28417 gene locus_tag LOCUS_10100 gene fhcD 29340 28417 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879696.1 protein_id gnl|my_center|LOCUS_10100 30235 29828 gene locus_tag LOCUS_10110 30235 29828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 30636 30220 gene locus_tag LOCUS_10120 30636 30220 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980577.1 protein_id gnl|my_center|LOCUS_10120 30994 31143 gene locus_tag LOCUS_10130 30994 31143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 32904 31297 gene locus_tag LOCUS_10140 32904 31297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 33633 32905 gene locus_tag LOCUS_10150 33633 32905 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_10150 34086 33781 gene locus_tag LOCUS_10160 34086 33781 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868474.1 protein_id gnl|my_center|LOCUS_10160 34442 34056 gene locus_tag LOCUS_10170 34442 34056 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868473.1 protein_id gnl|my_center|LOCUS_10170 35590 34661 gene locus_tag LOCUS_10180 35590 34661 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942741.1 protein_id gnl|my_center|LOCUS_10180 36895 35624 gene locus_tag LOCUS_10190 36895 35624 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083225.1 protein_id gnl|my_center|LOCUS_10190 38658 36943 gene locus_tag LOCUS_10200 gene cooS 38658 36943 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066467.1 protein_id gnl|my_center|LOCUS_10200 39446 38829 gene locus_tag LOCUS_10210 39446 38829 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942740.1 protein_id gnl|my_center|LOCUS_10210 41020 39926 gene locus_tag LOCUS_10220 41020 39926 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870598.1 protein_id gnl|my_center|LOCUS_10220 41480 42595 gene locus_tag LOCUS_10230 41480 42595 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_10230 <43579 42693 gene locus_tag LOCUS_10240 <43579 42693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249108.1:triphosphoribosyl-dephospho-CoA synthase >Feature sequence14 673 377 gene locus_tag LOCUS_10250 673 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 903 664 gene locus_tag LOCUS_10260 903 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 2273 909 gene locus_tag LOCUS_10270 gene wecB 2273 909 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060909.1 protein_id gnl|my_center|LOCUS_10270 2354 4753 gene locus_tag LOCUS_10280 2354 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 4836 5156 gene locus_tag LOCUS_10290 4836 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 6283 5243 gene locus_tag LOCUS_10300 6283 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 6912 6286 gene locus_tag LOCUS_10310 6912 6286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 8326 6905 gene locus_tag LOCUS_10320 8326 6905 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_10320 10112 8328 gene locus_tag LOCUS_10330 10112 8328 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250553.1 protein_id gnl|my_center|LOCUS_10330 10756 10115 gene locus_tag LOCUS_10340 10756 10115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 10877 10734 gene locus_tag LOCUS_10350 10877 10734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 10913 10961 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11386 11042 gene locus_tag LOCUS_10360 11386 11042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 11449 11533 gene locus_tag LOCUS_t00220 11449 11533 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11572 12162 gene locus_tag LOCUS_10370 gene cyaB 11572 12162 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978253.1 protein_id gnl|my_center|LOCUS_10370 13437 12118 gene locus_tag LOCUS_10380 13437 12118 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_10380 13505 15067 gene locus_tag LOCUS_10390 13505 15067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 15951 15064 gene locus_tag LOCUS_10400 gene porB 15951 15064 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762255.1 protein_id gnl|my_center|LOCUS_10400 17177 15948 gene locus_tag LOCUS_10410 gene porA 17177 15948 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496445.1 protein_id gnl|my_center|LOCUS_10410 17449 17174 gene locus_tag LOCUS_10420 17449 17174 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846589.1 protein_id gnl|my_center|LOCUS_10420 17806 17552 gene locus_tag LOCUS_10430 17806 17552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 17974 18879 gene locus_tag LOCUS_10440 gene speB 17974 18879 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_10440 19356 18793 gene locus_tag LOCUS_10450 19356 18793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 20515 19409 gene locus_tag LOCUS_10460 gene hflX 20515 19409 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762823.1 protein_id gnl|my_center|LOCUS_10460 21912 20587 gene locus_tag LOCUS_10470 21912 20587 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086313.1 protein_id gnl|my_center|LOCUS_10470 21981 23279 gene locus_tag LOCUS_10480 gene asnS 21981 23279 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249710.1 protein_id gnl|my_center|LOCUS_10480 23920 23276 gene locus_tag LOCUS_10490 23920 23276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 25607 23901 gene locus_tag LOCUS_10500 25607 23901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 26650 25610 gene locus_tag LOCUS_10510 gene rtcA 26650 25610 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762505.1 protein_id gnl|my_center|LOCUS_10510 26715 27338 gene locus_tag LOCUS_10520 26715 27338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 27322 28605 gene locus_tag LOCUS_10530 27322 28605 CDS product actin/actin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762638.1 protein_id gnl|my_center|LOCUS_10530 29333 28593 gene locus_tag LOCUS_10540 29333 28593 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318933.1 protein_id gnl|my_center|LOCUS_10540 29481 30710 gene locus_tag LOCUS_10550 29481 30710 CDS product Clp1/GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496787.1 protein_id gnl|my_center|LOCUS_10550 30707 32092 gene locus_tag LOCUS_10560 30707 32092 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256515.1 protein_id gnl|my_center|LOCUS_10560 32162 32470 gene locus_tag LOCUS_10570 32162 32470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 32470 33195 gene locus_tag LOCUS_10580 32470 33195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 33242 33622 gene locus_tag LOCUS_10590 33242 33622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 33606 33974 gene locus_tag LOCUS_10600 33606 33974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 34003 34079 gene locus_tag LOCUS_t00230 34003 34079 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 34327 34701 gene locus_tag LOCUS_10610 34327 34701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 35051 35773 gene locus_tag LOCUS_10620 35051 35773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 36573 35776 gene locus_tag LOCUS_10630 36573 35776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 37375 36632 gene locus_tag LOCUS_10640 37375 36632 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250541.1 protein_id gnl|my_center|LOCUS_10640 37449 38828 gene locus_tag LOCUS_10650 37449 38828 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762251.1 protein_id gnl|my_center|LOCUS_10650 39408 38797 gene locus_tag LOCUS_10660 39408 38797 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762690.1 protein_id gnl|my_center|LOCUS_10660 40099 39392 gene locus_tag LOCUS_10670 40099 39392 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762989.1 protein_id gnl|my_center|LOCUS_10670 40764 40204 gene locus_tag LOCUS_10680 40764 40204 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146568.1 protein_id gnl|my_center|LOCUS_10680 41092 40754 gene locus_tag LOCUS_10690 41092 40754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 41940 41098 gene locus_tag LOCUS_10700 41940 41098 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250080.1 protein_id gnl|my_center|LOCUS_10700 42967 41945 gene locus_tag LOCUS_10710 42967 41945 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867631.1 protein_id gnl|my_center|LOCUS_10710 >Feature sequence15 2336 1074 gene locus_tag LOCUS_10720 2336 1074 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966033.1 protein_id gnl|my_center|LOCUS_10720 2682 3506 gene locus_tag LOCUS_10730 2682 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 3592 4095 gene locus_tag LOCUS_10740 3592 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 4382 5392 gene locus_tag LOCUS_10750 gene mthK 4382 5392 CDS product calcium-gated potassium channel MthK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877130.1 protein_id gnl|my_center|LOCUS_10750 5551 5769 gene locus_tag LOCUS_10760 5551 5769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 5776 6648 gene locus_tag LOCUS_10770 5776 6648 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248984.1 protein_id gnl|my_center|LOCUS_10770 7714 6713 gene locus_tag LOCUS_10780 7714 6713 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485760.1 protein_id gnl|my_center|LOCUS_10780 10262 7815 gene locus_tag LOCUS_10790 10262 7815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 11548 10301 gene locus_tag LOCUS_10800 gene larA 11548 10301 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860456.1 protein_id gnl|my_center|LOCUS_10800 12744 11539 gene locus_tag LOCUS_10810 12744 11539 CDS product DUF401 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320021.1 protein_id gnl|my_center|LOCUS_10810 12956 14440 gene locus_tag LOCUS_10820 12956 14440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 14575 16836 gene locus_tag LOCUS_10830 14575 16836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 17023 17523 gene locus_tag LOCUS_10840 17023 17523 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021181.1 protein_id gnl|my_center|LOCUS_10840 18105 17641 gene locus_tag LOCUS_10850 18105 17641 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867605.1 protein_id gnl|my_center|LOCUS_10850 18166 19110 gene locus_tag LOCUS_10860 18166 19110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 19177 21888 gene locus_tag LOCUS_10870 19177 21888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 21873 22535 gene locus_tag LOCUS_10880 21873 22535 CDS product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979569.1 protein_id gnl|my_center|LOCUS_10880 22782 22486 gene locus_tag LOCUS_10890 22782 22486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 23510 22779 gene locus_tag LOCUS_10900 23510 22779 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867800.1 protein_id gnl|my_center|LOCUS_10900 24247 23507 gene locus_tag LOCUS_10910 24247 23507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 24397 24831 gene locus_tag LOCUS_10920 24397 24831 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582438.1 protein_id gnl|my_center|LOCUS_10920 24828 25232 gene locus_tag LOCUS_10930 24828 25232 CDS product class II SORL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081116.1 protein_id gnl|my_center|LOCUS_10930 25297 25752 gene locus_tag LOCUS_10940 gene lrpA 25297 25752 CDS product HTH-type transcriptional regulator LrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251084.1 protein_id gnl|my_center|LOCUS_10940 26016 25756 gene locus_tag LOCUS_10950 26016 25756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 27852 26023 gene locus_tag LOCUS_10960 27852 26023 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392858.1 protein_id gnl|my_center|LOCUS_10960 29102 27942 gene locus_tag LOCUS_10970 29102 27942 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877728.1 protein_id gnl|my_center|LOCUS_10970 29979 29131 gene locus_tag LOCUS_10980 29979 29131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 30167 31234 gene locus_tag LOCUS_10990 30167 31234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 31231 33795 gene locus_tag LOCUS_11000 31231 33795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 33841 35358 gene locus_tag LOCUS_11010 33841 35358 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870707.1 protein_id gnl|my_center|LOCUS_11010 36852 35575 gene locus_tag LOCUS_11020 36852 35575 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879595.1 protein_id gnl|my_center|LOCUS_11020 38801 36951 gene locus_tag LOCUS_11030 38801 36951 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319085.1 protein_id gnl|my_center|LOCUS_11030 40026 38986 gene locus_tag LOCUS_11040 40026 38986 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147062.1 protein_id gnl|my_center|LOCUS_11040 >Feature sequence16 1 1329 gene locus_tag LOCUS_11050 gene gcvPA 1 1329 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979226.1 protein_id gnl|my_center|LOCUS_11050 1334 2893 gene locus_tag LOCUS_11060 gene gcvPB 1334 2893 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868896.1 protein_id gnl|my_center|LOCUS_11060 2890 4035 gene locus_tag LOCUS_11070 2890 4035 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072974.1 protein_id gnl|my_center|LOCUS_11070 4128 4733 gene locus_tag LOCUS_11080 4128 4733 CDS product DUF3782 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763642.1 protein_id gnl|my_center|LOCUS_11080 5635 5168 gene locus_tag LOCUS_11090 gene sixA 5635 5168 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878502.1 protein_id gnl|my_center|LOCUS_11090 5753 6541 gene locus_tag LOCUS_11100 5753 6541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 6583 8007 gene locus_tag LOCUS_11110 6583 8007 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875835.1 protein_id gnl|my_center|LOCUS_11110 8043 8492 gene locus_tag LOCUS_11120 8043 8492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 9610 8633 gene locus_tag LOCUS_11130 9610 8633 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080230.1 protein_id gnl|my_center|LOCUS_11130 10565 9615 gene locus_tag LOCUS_11140 10565 9615 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879266.1 protein_id gnl|my_center|LOCUS_11140 11423 10566 gene locus_tag LOCUS_11150 11423 10566 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879265.1 protein_id gnl|my_center|LOCUS_11150 12448 11438 gene locus_tag LOCUS_11160 12448 11438 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064459.1 protein_id gnl|my_center|LOCUS_11160 14175 12511 gene locus_tag LOCUS_11170 14175 12511 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762356.1 protein_id gnl|my_center|LOCUS_11170 15006 14581 gene locus_tag LOCUS_11180 15006 14581 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021853.1 protein_id gnl|my_center|LOCUS_11180 15468 16226 gene locus_tag LOCUS_11190 15468 16226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 19195 16502 gene locus_tag LOCUS_11200 gene acnA 19195 16502 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228149.1 protein_id gnl|my_center|LOCUS_11200 19596 20933 gene locus_tag LOCUS_11210 19596 20933 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875835.1 protein_id gnl|my_center|LOCUS_11210 21515 23665 gene locus_tag LOCUS_11220 21515 23665 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 protein_id gnl|my_center|LOCUS_11220 24970 24065 gene locus_tag LOCUS_11230 24970 24065 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020194.1 protein_id gnl|my_center|LOCUS_11230 25493 25197 gene locus_tag LOCUS_11240 25493 25197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 25738 26658 gene locus_tag LOCUS_11250 25738 26658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 26843 28048 gene locus_tag LOCUS_11260 26843 28048 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250732.1 protein_id gnl|my_center|LOCUS_11260 28111 29406 gene locus_tag LOCUS_11270 28111 29406 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436675.1 protein_id gnl|my_center|LOCUS_11270 30183 29785 gene locus_tag LOCUS_11280 30183 29785 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868296.1 protein_id gnl|my_center|LOCUS_11280 30410 30180 gene locus_tag LOCUS_11290 30410 30180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 31257 30916 gene locus_tag LOCUS_11300 31257 30916 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979180.1 protein_id gnl|my_center|LOCUS_11300 31867 31235 gene locus_tag LOCUS_11310 31867 31235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 34099 32768 gene locus_tag LOCUS_11320 34099 32768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 37166 34671 gene locus_tag LOCUS_11330 37166 34671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 39223 37409 gene locus_tag LOCUS_11340 39223 37409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 >Feature sequence17 713 1597 gene locus_tag LOCUS_11350 713 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 1748 3034 gene locus_tag LOCUS_11360 gene gabT 1748 3034 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964736.1 protein_id gnl|my_center|LOCUS_11360 3099 4034 gene locus_tag LOCUS_11370 3099 4034 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249955.1 protein_id gnl|my_center|LOCUS_11370 4201 5427 gene locus_tag LOCUS_11380 gene hisD 4201 5427 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979512.1 protein_id gnl|my_center|LOCUS_11380 5499 6542 gene locus_tag LOCUS_11390 5499 6542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 6958 7356 gene locus_tag LOCUS_11400 gene speD 6958 7356 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583813.1 protein_id gnl|my_center|LOCUS_11400 8172 7357 gene locus_tag LOCUS_11410 8172 7357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 8272 8838 gene locus_tag LOCUS_11420 8272 8838 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146776.1 protein_id gnl|my_center|LOCUS_11420 9915 8851 gene locus_tag LOCUS_11430 9915 8851 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762578.1 protein_id gnl|my_center|LOCUS_11430 10195 11040 gene locus_tag LOCUS_11440 10195 11040 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060947.1 protein_id gnl|my_center|LOCUS_11440 11077 11153 gene locus_tag LOCUS_t00240 11077 11153 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 11710 13011 gene locus_tag LOCUS_11450 11710 13011 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249616.1 protein_id gnl|my_center|LOCUS_11450 13149 15044 gene locus_tag LOCUS_11460 gene iorA 13149 15044 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249091.1 protein_id gnl|my_center|LOCUS_11460 15047 15661 gene locus_tag LOCUS_11470 15047 15661 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879522.1 protein_id gnl|my_center|LOCUS_11470 15666 17444 gene locus_tag LOCUS_11480 15666 17444 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496592.1 protein_id gnl|my_center|LOCUS_11480 17441 18112 gene locus_tag LOCUS_11490 17441 18112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 19193 18093 gene locus_tag LOCUS_11500 19193 18093 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023593.1 protein_id gnl|my_center|LOCUS_11500 19282 19992 gene locus_tag LOCUS_11510 19282 19992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 21673 19994 gene locus_tag LOCUS_11520 gene metG 21673 19994 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762101.1 protein_id gnl|my_center|LOCUS_11520 21738 22202 gene locus_tag LOCUS_11530 21738 22202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 22625 22161 gene locus_tag LOCUS_11540 gene ribL 22625 22161 CDS product FAD synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870692.1 protein_id gnl|my_center|LOCUS_11540 22692 23579 gene locus_tag LOCUS_11550 22692 23579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 23686 24042 gene locus_tag LOCUS_11560 23686 24042 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146466.1 protein_id gnl|my_center|LOCUS_11560 24043 24606 gene locus_tag LOCUS_11570 gene thpR 24043 24606 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762325.1 protein_id gnl|my_center|LOCUS_11570 24807 24583 gene locus_tag LOCUS_11580 24807 24583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 24861 25631 gene locus_tag LOCUS_11590 24861 25631 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877968.1 protein_id gnl|my_center|LOCUS_11590 25642 27330 gene locus_tag LOCUS_11600 25642 27330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 27327 28412 gene locus_tag LOCUS_11610 27327 28412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 29517 28348 gene locus_tag LOCUS_11620 29517 28348 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023790.1 protein_id gnl|my_center|LOCUS_11620 29692 30357 gene locus_tag LOCUS_11630 29692 30357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 30418 31089 gene locus_tag LOCUS_11640 30418 31089 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249096.1 protein_id gnl|my_center|LOCUS_11640 31079 31447 gene locus_tag LOCUS_11650 gene speD 31079 31447 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081137.1 protein_id gnl|my_center|LOCUS_11650 32762 31494 gene locus_tag LOCUS_11660 32762 31494 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868848.1 protein_id gnl|my_center|LOCUS_11660 33057 32803 gene locus_tag LOCUS_11670 33057 32803 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250833.1 protein_id gnl|my_center|LOCUS_11670 33403 33155 gene locus_tag LOCUS_11680 33403 33155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 34316 33474 gene locus_tag LOCUS_11690 34316 33474 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250373.1 protein_id gnl|my_center|LOCUS_11690 34366 34932 gene locus_tag LOCUS_11700 34366 34932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 35709 34909 gene locus_tag LOCUS_11710 35709 34909 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496786.1 protein_id gnl|my_center|LOCUS_11710 35764 36954 gene locus_tag LOCUS_11720 35764 36954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 37009 37085 gene locus_tag LOCUS_t00250 37009 37085 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 37677 37447 gene locus_tag LOCUS_11730 gene hpkA 37677 37447 CDS product archaeal histone HpkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250364.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence18 1177 200 gene locus_tag LOCUS_11740 1177 200 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948743.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11740 2019 1507 gene locus_tag LOCUS_11750 2019 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11750 3087 2815 gene locus_tag LOCUS_11760 3087 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 3574 3074 gene locus_tag LOCUS_11770 3574 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 4822 3611 gene locus_tag LOCUS_11780 gene nifS 4822 3611 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_11780 4993 5298 gene locus_tag LOCUS_11790 4993 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 5460 5693 gene locus_tag LOCUS_11800 5460 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 5674 6033 gene locus_tag LOCUS_11810 5674 6033 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870428.1 protein_id gnl|my_center|LOCUS_11810 6186 6509 gene locus_tag LOCUS_11820 6186 6509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 6860 8410 gene locus_tag LOCUS_11830 6860 8410 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016558.1 protein_id gnl|my_center|LOCUS_11830 9229 8612 gene locus_tag LOCUS_11840 9229 8612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11840 9629 9330 gene locus_tag LOCUS_11850 9629 9330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11850 10040 10930 gene locus_tag LOCUS_11860 10040 10930 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902161.1 protein_id gnl|my_center|LOCUS_11860 12241 11102 gene locus_tag LOCUS_11870 12241 11102 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761873.1 protein_id gnl|my_center|LOCUS_11870 13335 12226 gene locus_tag LOCUS_11880 gene ahbD 13335 12226 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_11880 13884 13351 gene locus_tag LOCUS_11890 13884 13351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 14510 14052 gene locus_tag LOCUS_11900 14510 14052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 14922 14479 gene locus_tag LOCUS_11910 14922 14479 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259347.1 protein_id gnl|my_center|LOCUS_11910 15573 15241 gene locus_tag LOCUS_11920 15573 15241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 16142 15792 gene locus_tag LOCUS_11930 16142 15792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11930 16763 16143 gene locus_tag LOCUS_11940 16763 16143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11940 17244 17591 gene locus_tag LOCUS_11950 17244 17591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 17608 18570 gene locus_tag LOCUS_11960 17608 18570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 18533 19261 gene locus_tag LOCUS_11970 18533 19261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 19266 20408 gene locus_tag LOCUS_11980 19266 20408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 20374 22482 gene locus_tag LOCUS_11990 20374 22482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 22574 24226 gene locus_tag LOCUS_12000 22574 24226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 25254 24454 gene locus_tag LOCUS_12010 25254 24454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 25424 26959 gene locus_tag LOCUS_12020 25424 26959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 27455 27733 gene locus_tag LOCUS_12030 27455 27733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 27735 28148 gene locus_tag LOCUS_12040 27735 28148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 29354 28752 gene locus_tag LOCUS_12050 gene cas4 29354 28752 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003042183.1 protein_id gnl|my_center|LOCUS_12050 29604 29326 gene locus_tag LOCUS_12060 29604 29326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 30605 29604 gene locus_tag LOCUS_12070 gene cas1 30605 29604 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256457.1 protein_id gnl|my_center|LOCUS_12070 31516 30602 gene locus_tag LOCUS_12080 gene cas4a 31516 30602 CDS product type I-A CRISPR-associated protein Cas4/Csa1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977960.1 protein_id gnl|my_center|LOCUS_12080 31743 35416 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gaatcccgaaaagggagttgaaag >Feature sequence19 687 956 gene locus_tag LOCUS_12090 687 956 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879082.1 protein_id gnl|my_center|LOCUS_12090 953 1282 gene locus_tag LOCUS_12100 953 1282 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879083.1 protein_id gnl|my_center|LOCUS_12100 2198 1794 gene locus_tag LOCUS_12110 2198 1794 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173254061.1 protein_id gnl|my_center|LOCUS_12110 2415 2185 gene locus_tag LOCUS_12120 2415 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 3038 2757 gene locus_tag LOCUS_12130 3038 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 3325 3086 gene locus_tag LOCUS_12140 3325 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 3629 3438 gene locus_tag LOCUS_12150 3629 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 3704 4147 gene locus_tag LOCUS_12160 3704 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 4137 5972 gene locus_tag LOCUS_12170 4137 5972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 6097 6645 gene locus_tag LOCUS_12180 6097 6645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 6751 7440 gene locus_tag LOCUS_12190 6751 7440 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878743.1 protein_id gnl|my_center|LOCUS_12190 8053 7649 gene locus_tag LOCUS_12200 8053 7649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 8360 8914 gene locus_tag LOCUS_12210 8360 8914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 9520 9059 gene locus_tag LOCUS_12220 9520 9059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 10055 9645 gene locus_tag LOCUS_12230 10055 9645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 10264 10052 gene locus_tag LOCUS_12240 10264 10052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 11191 12531 gene locus_tag LOCUS_12250 11191 12531 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249453.1 protein_id gnl|my_center|LOCUS_12250 13194 16343 gene locus_tag LOCUS_12260 13194 16343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 16960 16394 gene locus_tag LOCUS_12270 16960 16394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 17792 17118 gene locus_tag LOCUS_12280 17792 17118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 18314 18475 gene locus_tag LOCUS_12290 18314 18475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 18472 18936 gene locus_tag LOCUS_12300 18472 18936 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878587.1 protein_id gnl|my_center|LOCUS_12300 18937 19101 gene locus_tag LOCUS_12310 18937 19101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 19091 19561 gene locus_tag LOCUS_12320 19091 19561 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978007.1 protein_id gnl|my_center|LOCUS_12320 19878 20240 gene locus_tag LOCUS_12330 19878 20240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 20578 21267 gene locus_tag LOCUS_12340 20578 21267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 21394 22032 gene locus_tag LOCUS_12350 21394 22032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 22754 22095 gene locus_tag LOCUS_12360 22754 22095 CDS product DUF2848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085745.1 protein_id gnl|my_center|LOCUS_12360 23023 24240 gene locus_tag LOCUS_12370 23023 24240 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867337.1 protein_id gnl|my_center|LOCUS_12370 24967 24302 gene locus_tag LOCUS_12380 24967 24302 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249239.1 protein_id gnl|my_center|LOCUS_12380 26683 25025 gene locus_tag LOCUS_12390 26683 25025 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385666.1 protein_id gnl|my_center|LOCUS_12390 26613 26792 gene locus_tag LOCUS_12400 26613 26792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 27842 26883 gene locus_tag LOCUS_12410 27842 26883 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_12410 28833 27835 gene locus_tag LOCUS_12420 28833 27835 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861634.1 protein_id gnl|my_center|LOCUS_12420 29702 28830 gene locus_tag LOCUS_12430 29702 28830 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383587.1 protein_id gnl|my_center|LOCUS_12430 30729 29704 gene locus_tag LOCUS_12440 30729 29704 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311992.1 protein_id gnl|my_center|LOCUS_12440 31011 31757 gene locus_tag LOCUS_12450 31011 31757 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385665.1 protein_id gnl|my_center|LOCUS_12450 31754 32866 gene locus_tag LOCUS_12460 31754 32866 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980409.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence20 51 509 gene locus_tag LOCUS_12470 51 509 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545915.1 protein_id gnl|my_center|LOCUS_12470 634 861 gene locus_tag LOCUS_12480 634 861 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250645.1 protein_id gnl|my_center|LOCUS_12480 1915 1250 gene locus_tag LOCUS_12490 gene rpiA 1915 1250 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867895.1 protein_id gnl|my_center|LOCUS_12490 3099 1933 gene locus_tag LOCUS_12500 3099 1933 CDS product TGS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978498.1 protein_id gnl|my_center|LOCUS_12500 3656 3099 gene locus_tag LOCUS_12510 3656 3099 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762824.1 protein_id gnl|my_center|LOCUS_12510 3721 4080 gene locus_tag LOCUS_12520 3721 4080 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250923.1 protein_id gnl|my_center|LOCUS_12520 4077 4607 gene locus_tag LOCUS_12530 4077 4607 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_12530 4639 4712 gene locus_tag LOCUS_t00260 4639 4712 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4853 4779 gene locus_tag LOCUS_t00270 4853 4779 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4906 5448 gene locus_tag LOCUS_12540 gene tfe 4906 5448 CDS product transcription factor E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878260.1 protein_id gnl|my_center|LOCUS_12540 5445 6200 gene locus_tag LOCUS_12550 5445 6200 CDS product DUF2110 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250973.1 protein_id gnl|my_center|LOCUS_12550 6257 6345 gene locus_tag LOCUS_t00280 6257 6345 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 6352 6424 gene locus_tag LOCUS_t00290 6352 6424 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6440 7957 gene locus_tag LOCUS_12560 6440 7957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 8011 8289 gene locus_tag LOCUS_12570 8011 8289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 9002 8346 gene locus_tag LOCUS_12580 9002 8346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 9134 9700 gene locus_tag LOCUS_12590 gene hxlB 9134 9700 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763308.1 protein_id gnl|my_center|LOCUS_12590 9684 11087 gene locus_tag LOCUS_12600 gene cca 9684 11087 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902052.1 protein_id gnl|my_center|LOCUS_12600 12341 11046 gene locus_tag LOCUS_12610 gene eno 12341 11046 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496902.1 protein_id gnl|my_center|LOCUS_12610 12400 13446 gene locus_tag LOCUS_12620 12400 13446 CDS product lysyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250128.1 protein_id gnl|my_center|LOCUS_12620 15140 13476 gene locus_tag LOCUS_12630 gene pheT 15140 13476 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868500.1 protein_id gnl|my_center|LOCUS_12630 16638 15145 gene locus_tag LOCUS_12640 16638 15145 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869988.1 protein_id gnl|my_center|LOCUS_12640 17718 16705 gene locus_tag LOCUS_12650 17718 16705 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867675.1 protein_id gnl|my_center|LOCUS_12650 17811 18410 gene locus_tag LOCUS_12660 17811 18410 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877484.1 protein_id gnl|my_center|LOCUS_12660 18423 18986 gene locus_tag LOCUS_12670 18423 18986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 18993 19859 gene locus_tag LOCUS_12680 gene coaW 18993 19859 CDS product type II pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446246.1 protein_id gnl|my_center|LOCUS_12680 19840 20595 gene locus_tag LOCUS_12690 19840 20595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 20693 21241 gene locus_tag LOCUS_12700 20693 21241 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249022.1 protein_id gnl|my_center|LOCUS_12700 22826 21255 gene locus_tag LOCUS_12710 22826 21255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 22930 23613 gene locus_tag LOCUS_12720 22930 23613 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902825.1 protein_id gnl|my_center|LOCUS_12720 24205 23639 gene locus_tag LOCUS_12730 24205 23639 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867500.1 protein_id gnl|my_center|LOCUS_12730 24574 24230 gene locus_tag LOCUS_12740 24574 24230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 24882 24586 gene locus_tag LOCUS_12750 24882 24586 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762332.1 protein_id gnl|my_center|LOCUS_12750 26119 24899 gene locus_tag LOCUS_12760 26119 24899 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876935.1 protein_id gnl|my_center|LOCUS_12760 27431 26112 gene locus_tag LOCUS_12770 27431 26112 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250437.1 protein_id gnl|my_center|LOCUS_12770 27841 27437 gene locus_tag LOCUS_12780 gene eif5A 27841 27437 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876502.1 protein_id gnl|my_center|LOCUS_12780 28312 27884 gene locus_tag LOCUS_12790 28312 27884 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061175.1 protein_id gnl|my_center|LOCUS_12790 28787 28296 gene locus_tag LOCUS_12800 gene rplM 28787 28296 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878624.1 protein_id gnl|my_center|LOCUS_12800 29136 28813 gene locus_tag LOCUS_12810 29136 28813 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867655.1 protein_id gnl|my_center|LOCUS_12810 29260 29126 gene locus_tag LOCUS_12820 29260 29126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 31903 29363 gene locus_tag LOCUS_12830 31903 29363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 32190 32101 gene locus_tag LOCUS_t00300 32190 32101 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 32994 32230 gene locus_tag LOCUS_12840 32994 32230 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868100.1 protein_id gnl|my_center|LOCUS_12840 >Feature sequence21 86 352 gene locus_tag LOCUS_12850 86 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 464 2197 gene locus_tag LOCUS_12860 464 2197 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249942.1 protein_id gnl|my_center|LOCUS_12860 2235 2552 gene locus_tag LOCUS_12870 2235 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 2561 3562 gene locus_tag LOCUS_12880 2561 3562 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 protein_id gnl|my_center|LOCUS_12880 3553 4611 gene locus_tag LOCUS_12890 3553 4611 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870653.1 protein_id gnl|my_center|LOCUS_12890 4728 5276 gene locus_tag LOCUS_12900 4728 5276 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868100.1 protein_id gnl|my_center|LOCUS_12900 5329 5631 gene locus_tag LOCUS_12910 5329 5631 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868508.1 protein_id gnl|my_center|LOCUS_12910 8818 5717 gene locus_tag LOCUS_12920 gene carB 8818 5717 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979554.1 protein_id gnl|my_center|LOCUS_12920 9858 8806 gene locus_tag LOCUS_12930 gene carA 9858 8806 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240374.1 protein_id gnl|my_center|LOCUS_12930 10873 10052 gene locus_tag LOCUS_12940 10873 10052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 10979 11200 gene locus_tag LOCUS_12950 10979 11200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 12365 11232 gene locus_tag LOCUS_12960 12365 11232 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761948.1 protein_id gnl|my_center|LOCUS_12960 13619 12603 gene locus_tag LOCUS_12970 13619 12603 CDS product N-acetyl-lysine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978128.1 protein_id gnl|my_center|LOCUS_12970 14745 13591 gene locus_tag LOCUS_12980 14745 13591 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978129.1 protein_id gnl|my_center|LOCUS_12980 15578 14742 gene locus_tag LOCUS_12990 gene lysX 15578 14742 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479919.1 protein_id gnl|my_center|LOCUS_12990 15745 15575 gene locus_tag LOCUS_13000 gene lysW/argW 15745 15575 CDS product alpha-aminoadipate/glutamate carrier protein LysW/ArgW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978131.1 protein_id gnl|my_center|LOCUS_13000 16618 15839 gene locus_tag LOCUS_13010 16618 15839 CDS product [LysW]-aminoadipate/[LysW]-glutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978133.1 protein_id gnl|my_center|LOCUS_13010 17666 16644 gene locus_tag LOCUS_13020 gene argC 17666 16644 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978134.1 protein_id gnl|my_center|LOCUS_13020 18463 17663 gene locus_tag LOCUS_13030 gene lysX 18463 17663 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979555.1 protein_id gnl|my_center|LOCUS_13030 20246 18732 gene locus_tag LOCUS_13040 20246 18732 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979670.1 protein_id gnl|my_center|LOCUS_13040 21472 20246 gene locus_tag LOCUS_13050 21472 20246 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064221.1 protein_id gnl|my_center|LOCUS_13050 21685 22104 gene locus_tag LOCUS_13060 21685 22104 CDS product DUF4332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946351.1 protein_id gnl|my_center|LOCUS_13060 22281 23660 gene locus_tag LOCUS_13070 22281 23660 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868821.1 protein_id gnl|my_center|LOCUS_13070 23653 24225 gene locus_tag LOCUS_13080 23653 24225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 24552 24220 gene locus_tag LOCUS_13090 24552 24220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 25538 24747 gene locus_tag LOCUS_13100 25538 24747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 26352 25540 gene locus_tag LOCUS_13110 26352 25540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 27365 26349 gene locus_tag LOCUS_13120 27365 26349 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867543.1 protein_id gnl|my_center|LOCUS_13120 27469 28239 gene locus_tag LOCUS_13130 27469 28239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 29725 28367 gene locus_tag LOCUS_13140 29725 28367 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867976.1 protein_id gnl|my_center|LOCUS_13140 29864 31261 gene locus_tag LOCUS_13150 29864 31261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 31316 31720 gene locus_tag LOCUS_13160 31316 31720 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230349.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence22 780 1382 gene locus_tag LOCUS_13170 780 1382 CDS product DUF3782 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763642.1 protein_id gnl|my_center|LOCUS_13170 1673 1425 gene locus_tag LOCUS_13180 1673 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 2411 1782 gene locus_tag LOCUS_13190 2411 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 2483 3199 gene locus_tag LOCUS_13200 2483 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 3431 3180 gene locus_tag LOCUS_13210 3431 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 3571 3975 gene locus_tag LOCUS_13220 3571 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 5244 3976 gene locus_tag LOCUS_13230 5244 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 6077 5259 gene locus_tag LOCUS_13240 6077 5259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13240 7149 6067 gene locus_tag LOCUS_13250 7149 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13250 7652 7341 gene locus_tag LOCUS_13260 7652 7341 CDS product FUN14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250444.1 protein_id gnl|my_center|LOCUS_13260 8319 9038 gene locus_tag LOCUS_13270 8319 9038 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256821.1 protein_id gnl|my_center|LOCUS_13270 9031 9735 gene locus_tag LOCUS_13280 9031 9735 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 protein_id gnl|my_center|LOCUS_13280 10659 9754 gene locus_tag LOCUS_13290 10659 9754 CDS product DUF6282 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007717423.1 protein_id gnl|my_center|LOCUS_13290 11588 10635 gene locus_tag LOCUS_13300 11588 10635 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727510.1 protein_id gnl|my_center|LOCUS_13300 12453 11590 gene locus_tag LOCUS_13310 12453 11590 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_13310 13811 12498 gene locus_tag LOCUS_13320 13811 12498 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240446.1 protein_id gnl|my_center|LOCUS_13320 14080 14310 gene locus_tag LOCUS_13330 14080 14310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 15539 14649 gene locus_tag LOCUS_13340 15539 14649 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867579.1 protein_id gnl|my_center|LOCUS_13340 16569 15520 gene locus_tag LOCUS_13350 16569 15520 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867578.1 protein_id gnl|my_center|LOCUS_13350 18061 16556 gene locus_tag LOCUS_13360 18061 16556 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867577.1 protein_id gnl|my_center|LOCUS_13360 19422 18106 gene locus_tag LOCUS_13370 19422 18106 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867576.1 protein_id gnl|my_center|LOCUS_13370 20584 19595 gene locus_tag LOCUS_13380 20584 19595 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763671.1 protein_id gnl|my_center|LOCUS_13380 21008 21152 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22006 22395 gene locus_tag LOCUS_13390 22006 22395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 22392 22760 gene locus_tag LOCUS_13400 22392 22760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 23768 24025 gene locus_tag LOCUS_13410 23768 24025 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943881.1 protein_id gnl|my_center|LOCUS_13410 24022 24249 gene locus_tag LOCUS_13420 24022 24249 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249666.1 protein_id gnl|my_center|LOCUS_13420 24246 26273 gene locus_tag LOCUS_13430 gene feoB 24246 26273 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249665.1 protein_id gnl|my_center|LOCUS_13430 26278 26814 gene locus_tag LOCUS_13440 26278 26814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 28266 27643 gene locus_tag LOCUS_13450 28266 27643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 28417 28259 gene locus_tag LOCUS_13460 28417 28259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 28834 30117 gene locus_tag LOCUS_13470 28834 30117 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876486.1 protein_id gnl|my_center|LOCUS_13470 30697 30125 gene locus_tag LOCUS_13480 30697 30125 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949009.1 protein_id gnl|my_center|LOCUS_13480 >Feature sequence23 632 78 gene locus_tag LOCUS_13490 632 78 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879824.1 protein_id gnl|my_center|LOCUS_13490 1225 629 gene locus_tag LOCUS_13500 1225 629 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878293.1 protein_id gnl|my_center|LOCUS_13500 1493 1206 gene locus_tag LOCUS_13510 1493 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 2585 1494 gene locus_tag LOCUS_13520 2585 1494 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978607.1 protein_id gnl|my_center|LOCUS_13520 2947 4155 gene locus_tag LOCUS_13530 2947 4155 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021000.1 protein_id gnl|my_center|LOCUS_13530 7055 4149 gene locus_tag LOCUS_13540 7055 4149 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977932.1 protein_id gnl|my_center|LOCUS_13540 7678 7220 gene locus_tag LOCUS_13550 7678 7220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 10430 7713 gene locus_tag LOCUS_13560 gene rad50 10430 7713 CDS product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868338.1 protein_id gnl|my_center|LOCUS_13560 11611 10433 gene locus_tag LOCUS_13570 11611 10433 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870840.1 protein_id gnl|my_center|LOCUS_13570 13220 11613 gene locus_tag LOCUS_13580 13220 11613 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871089.1 protein_id gnl|my_center|LOCUS_13580 14331 13210 gene locus_tag LOCUS_13590 14331 13210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 14391 15776 gene locus_tag LOCUS_13600 14391 15776 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867476.1 protein_id gnl|my_center|LOCUS_13600 15819 16526 gene locus_tag LOCUS_13610 15819 16526 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392237.1 protein_id gnl|my_center|LOCUS_13610 16534 16926 gene locus_tag LOCUS_13620 16534 16926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 17249 16923 gene locus_tag LOCUS_13630 17249 16923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 17352 18629 gene locus_tag LOCUS_13640 17352 18629 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022483.1 protein_id gnl|my_center|LOCUS_13640 18883 18626 gene locus_tag LOCUS_13650 18883 18626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 19953 18880 gene locus_tag LOCUS_13660 19953 18880 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146822.1 protein_id gnl|my_center|LOCUS_13660 21194 19956 gene locus_tag LOCUS_13670 gene ahcY 21194 19956 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978302.1 protein_id gnl|my_center|LOCUS_13670 21451 21230 gene locus_tag LOCUS_13680 21451 21230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 22012 21461 gene locus_tag LOCUS_13690 gene rimI 22012 21461 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978207.1 protein_id gnl|my_center|LOCUS_13690 22039 23118 gene locus_tag LOCUS_13700 22039 23118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 23151 23966 gene locus_tag LOCUS_13710 23151 23966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 24011 24268 gene locus_tag LOCUS_13720 24011 24268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 24313 24699 gene locus_tag LOCUS_13730 24313 24699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 24696 25370 gene locus_tag LOCUS_13740 24696 25370 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251182.1 protein_id gnl|my_center|LOCUS_13740 26298 25351 gene locus_tag LOCUS_13750 26298 25351 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146545.1 protein_id gnl|my_center|LOCUS_13750 26407 27708 gene locus_tag LOCUS_13760 26407 27708 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147002.1 protein_id gnl|my_center|LOCUS_13760 27705 28463 gene locus_tag LOCUS_13770 27705 28463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 29184 28468 gene locus_tag LOCUS_13780 29184 28468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 >Feature sequence24 1191 2006 gene locus_tag LOCUS_13790 gene mtnP 1191 2006 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868192.1 protein_id gnl|my_center|LOCUS_13790 2111 3319 gene locus_tag LOCUS_13800 2111 3319 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979397.1 protein_id gnl|my_center|LOCUS_13800 3316 4080 gene locus_tag LOCUS_13810 3316 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 4589 4281 gene locus_tag LOCUS_13820 4589 4281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 4852 6108 gene locus_tag LOCUS_13830 4852 6108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 6077 7414 gene locus_tag LOCUS_13840 gene glmM 6077 7414 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250059.1 protein_id gnl|my_center|LOCUS_13840 7901 7428 gene locus_tag LOCUS_13850 7901 7428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 7995 9263 gene locus_tag LOCUS_13860 gene tuf 7995 9263 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878437.1 protein_id gnl|my_center|LOCUS_13860 9316 9633 gene locus_tag LOCUS_13870 gene rpsJ 9316 9633 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249262.1 protein_id gnl|my_center|LOCUS_13870 9798 9712 gene locus_tag LOCUS_t00310 9798 9712 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10271 9873 gene locus_tag LOCUS_13880 gene rpsS 10271 9873 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867460.1 protein_id gnl|my_center|LOCUS_13880 11050 10319 gene locus_tag LOCUS_13890 11050 10319 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762841.1 protein_id gnl|my_center|LOCUS_13890 11331 11056 gene locus_tag LOCUS_13900 11331 11056 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867462.1 protein_id gnl|my_center|LOCUS_13900 12115 11324 gene locus_tag LOCUS_13910 gene rpl4p 12115 11324 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250492.1 protein_id gnl|my_center|LOCUS_13910 13126 12119 gene locus_tag LOCUS_13920 13126 12119 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869671.1 protein_id gnl|my_center|LOCUS_13920 13651 13244 gene locus_tag LOCUS_13930 13651 13244 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869516.1 protein_id gnl|my_center|LOCUS_13930 14531 13656 gene locus_tag LOCUS_13940 14531 13656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 14585 16492 gene locus_tag LOCUS_13950 gene rqcH 14585 16492 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879530.1 protein_id gnl|my_center|LOCUS_13950 16489 16986 gene locus_tag LOCUS_13960 16489 16986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 17000 17821 gene locus_tag LOCUS_13970 17000 17821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13970 17811 18605 gene locus_tag LOCUS_13980 17811 18605 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589511.1 protein_id gnl|my_center|LOCUS_13980 19446 18598 gene locus_tag LOCUS_13990 19446 18598 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250907.1 protein_id gnl|my_center|LOCUS_13990 19502 20437 gene locus_tag LOCUS_14000 19502 20437 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259623.1 protein_id gnl|my_center|LOCUS_14000 20448 21539 gene locus_tag LOCUS_14010 gene endA 20448 21539 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023532.1 protein_id gnl|my_center|LOCUS_14010 21939 21529 gene locus_tag LOCUS_14020 21939 21529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 22868 21936 gene locus_tag LOCUS_14030 gene map 22868 21936 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061017.1 protein_id gnl|my_center|LOCUS_14030 22981 23529 gene locus_tag LOCUS_14040 22981 23529 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869554.1 protein_id gnl|my_center|LOCUS_14040 23637 24503 gene locus_tag LOCUS_14050 23637 24503 CDS product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251076.1 protein_id gnl|my_center|LOCUS_14050 24513 25088 gene locus_tag LOCUS_14060 24513 25088 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868267.1 protein_id gnl|my_center|LOCUS_14060 25188 26066 gene locus_tag LOCUS_14070 25188 26066 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887563.1 protein_id gnl|my_center|LOCUS_14070 26090 27073 gene locus_tag LOCUS_14080 26090 27073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 27123 27210 gene locus_tag LOCUS_t00320 27123 27210 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 27338 27263 gene locus_tag LOCUS_t00330 27338 27263 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 27418 27341 gene locus_tag LOCUS_t00340 27418 27341 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 27500 27572 gene locus_tag LOCUS_t00350 27500 27572 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 28804 27572 gene locus_tag LOCUS_14090 28804 27572 CDS product putative sugar nucleotidyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256908.1 protein_id gnl|my_center|LOCUS_14090 >Feature sequence25 892 206 gene locus_tag LOCUS_14100 892 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 2176 917 gene locus_tag LOCUS_14110 2176 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 2755 2195 gene locus_tag LOCUS_14120 2755 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 5382 3028 gene locus_tag LOCUS_14130 5382 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 5420 5710 gene locus_tag LOCUS_14140 5420 5710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 7863 6124 gene locus_tag LOCUS_14150 7863 6124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 9100 8294 gene locus_tag LOCUS_14160 9100 8294 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249603.1 protein_id gnl|my_center|LOCUS_14160 9827 9369 gene locus_tag LOCUS_14170 9827 9369 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249766.1 protein_id gnl|my_center|LOCUS_14170 10864 10088 gene locus_tag LOCUS_14180 10864 10088 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980192.1 protein_id gnl|my_center|LOCUS_14180 11516 11133 gene locus_tag LOCUS_14190 11516 11133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 11547 11664 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12290 12517 gene locus_tag LOCUS_14200 12290 12517 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966884.1 protein_id gnl|my_center|LOCUS_14200 13748 13422 gene locus_tag LOCUS_14210 13748 13422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14210 14068 13739 gene locus_tag LOCUS_14220 14068 13739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14220 14804 14052 gene locus_tag LOCUS_14230 14804 14052 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_14230 15480 14806 gene locus_tag LOCUS_14240 15480 14806 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937694.1 protein_id gnl|my_center|LOCUS_14240 16324 15482 gene locus_tag LOCUS_14250 16324 15482 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937693.1 protein_id gnl|my_center|LOCUS_14250 16405 16818 gene locus_tag LOCUS_14260 16405 16818 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868151.1 protein_id gnl|my_center|LOCUS_14260 17567 17154 gene locus_tag LOCUS_14270 17567 17154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 17788 17546 gene locus_tag LOCUS_14280 17788 17546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 18048 17890 gene locus_tag LOCUS_14290 18048 17890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 18708 18986 gene locus_tag LOCUS_14300 18708 18986 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014121434.1 protein_id gnl|my_center|LOCUS_14300 18964 19380 gene locus_tag LOCUS_14310 18964 19380 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868416.1 protein_id gnl|my_center|LOCUS_14310 20480 21829 gene locus_tag LOCUS_14320 20480 21829 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868120.1 protein_id gnl|my_center|LOCUS_14320 22382 22963 gene locus_tag LOCUS_14330 22382 22963 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990695.1 protein_id gnl|my_center|LOCUS_14330 23664 23065 gene locus_tag LOCUS_14340 23664 23065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 >Feature sequence26 1726 2676 gene locus_tag LOCUS_14350 1726 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 3074 2652 gene locus_tag LOCUS_14360 3074 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 3294 3064 gene locus_tag LOCUS_14370 3294 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 3531 4136 gene locus_tag LOCUS_14380 3531 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013683780.1 protein_id gnl|my_center|LOCUS_14380 4096 4899 gene locus_tag LOCUS_14390 4096 4899 CDS product nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240366.1 protein_id gnl|my_center|LOCUS_14390 4889 5389 gene locus_tag LOCUS_14400 4889 5389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 5386 6495 gene locus_tag LOCUS_14410 5386 6495 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762209.1 protein_id gnl|my_center|LOCUS_14410 6555 7277 gene locus_tag LOCUS_14420 6555 7277 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979223.1 protein_id gnl|my_center|LOCUS_14420 7295 7630 gene locus_tag LOCUS_14430 7295 7630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 7631 9457 gene locus_tag LOCUS_14440 7631 9457 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762861.1 protein_id gnl|my_center|LOCUS_14440 9601 10023 gene locus_tag LOCUS_14450 9601 10023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 10016 11596 gene locus_tag LOCUS_14460 10016 11596 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249122.1 protein_id gnl|my_center|LOCUS_14460 11675 12007 gene locus_tag LOCUS_14470 11675 12007 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880624.1 protein_id gnl|my_center|LOCUS_14470 13078 12044 gene locus_tag LOCUS_14480 13078 12044 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249654.1 protein_id gnl|my_center|LOCUS_14480 13167 13955 gene locus_tag LOCUS_14490 13167 13955 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249187.1 protein_id gnl|my_center|LOCUS_14490 15011 14064 gene locus_tag LOCUS_14500 15011 14064 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763133.1 protein_id gnl|my_center|LOCUS_14500 15601 15197 gene locus_tag LOCUS_14510 15601 15197 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088858713.1 protein_id gnl|my_center|LOCUS_14510 15739 16020 gene locus_tag LOCUS_14520 15739 16020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 16007 16399 gene locus_tag LOCUS_14530 16007 16399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 16396 16830 gene locus_tag LOCUS_14540 16396 16830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 17216 16905 gene locus_tag LOCUS_14550 17216 16905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 17929 17222 gene locus_tag LOCUS_14560 17929 17222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 18826 18203 gene locus_tag LOCUS_14570 18826 18203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 19528 18974 gene locus_tag LOCUS_14580 gene dps 19528 18974 CDS product DNA protection during starvation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250010.1 protein_id gnl|my_center|LOCUS_14580 19632 20045 gene locus_tag LOCUS_14590 19632 20045 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879721.1 protein_id gnl|my_center|LOCUS_14590 20152 20328 gene locus_tag LOCUS_14600 20152 20328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 21020 20520 gene locus_tag LOCUS_14610 21020 20520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 21322 22005 gene locus_tag LOCUS_14620 21322 22005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 22542 22120 gene locus_tag LOCUS_14630 22542 22120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 >Feature sequence27 314 874 gene locus_tag LOCUS_14640 314 874 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258961.1 protein_id gnl|my_center|LOCUS_14640 1024 1205 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2470 1667 gene locus_tag LOCUS_14650 2470 1667 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434782.1 protein_id gnl|my_center|LOCUS_14650 2590 3408 gene locus_tag LOCUS_14660 2590 3408 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978674.1 protein_id gnl|my_center|LOCUS_14660 4260 3499 gene locus_tag LOCUS_14670 4260 3499 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250819.1 protein_id gnl|my_center|LOCUS_14670 5099 4257 gene locus_tag LOCUS_14680 gene pstA 5099 4257 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870526.1 protein_id gnl|my_center|LOCUS_14680 6024 5092 gene locus_tag LOCUS_14690 gene pstC 6024 5092 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250817.1 protein_id gnl|my_center|LOCUS_14690 7053 6355 gene locus_tag LOCUS_14700 7053 6355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 8840 7233 gene locus_tag LOCUS_14710 8840 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14710 9880 8840 gene locus_tag LOCUS_14720 9880 8840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14720 10201 10611 gene locus_tag LOCUS_14730 10201 10611 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064579.1 protein_id gnl|my_center|LOCUS_14730 10589 11017 gene locus_tag LOCUS_14740 10589 11017 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879919.1 protein_id gnl|my_center|LOCUS_14740 11508 11242 gene locus_tag LOCUS_14750 11508 11242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 11860 12519 gene locus_tag LOCUS_14760 11860 12519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 13330 12548 gene locus_tag LOCUS_14770 13330 12548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 13392 15080 gene locus_tag LOCUS_14780 13392 15080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 16672 15101 gene locus_tag LOCUS_14790 16672 15101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 17075 16662 gene locus_tag LOCUS_14800 17075 16662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 17701 17252 gene locus_tag LOCUS_14810 17701 17252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 18266 17889 gene locus_tag LOCUS_14820 18266 17889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 19806 18271 gene locus_tag LOCUS_14830 19806 18271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 21526 19811 gene locus_tag LOCUS_14840 21526 19811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 21973 21533 gene locus_tag LOCUS_14850 21973 21533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 >Feature sequence28 <1 953 gene locus_tag LOCUS_14860 <1 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762509.1:asparagine synthetase A 950 2380 gene locus_tag LOCUS_14870 950 2380 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761902.1 protein_id gnl|my_center|LOCUS_14870 2913 3452 gene locus_tag LOCUS_14880 2913 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14880 3507 3914 gene locus_tag LOCUS_14890 3507 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14890 4093 5301 gene locus_tag LOCUS_14900 4093 5301 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167827706.1 protein_id gnl|my_center|LOCUS_14900 5324 6667 gene locus_tag LOCUS_14910 gene argH 5324 6667 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979552.1 protein_id gnl|my_center|LOCUS_14910 6664 8166 gene locus_tag LOCUS_14920 6664 8166 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978681.1 protein_id gnl|my_center|LOCUS_14920 8732 8163 gene locus_tag LOCUS_14930 8732 8163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 9520 8834 gene locus_tag LOCUS_14940 9520 8834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 10961 9681 gene locus_tag LOCUS_14950 gene icd 10961 9681 CDS product isocitrate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878150.1 protein_id gnl|my_center|LOCUS_14950 12340 11069 gene locus_tag LOCUS_14960 12340 11069 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240344.1 protein_id gnl|my_center|LOCUS_14960 12410 14290 gene locus_tag LOCUS_14970 12410 14290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 15396 14350 gene locus_tag LOCUS_14980 15396 14350 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258816.1 protein_id gnl|my_center|LOCUS_14980 16542 15496 gene locus_tag LOCUS_14990 16542 15496 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095662.1 protein_id gnl|my_center|LOCUS_14990 17461 16544 gene locus_tag LOCUS_15000 17461 16544 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496774.1 protein_id gnl|my_center|LOCUS_15000 18176 17463 gene locus_tag LOCUS_15010 18176 17463 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762258.1 protein_id gnl|my_center|LOCUS_15010 18958 18173 gene locus_tag LOCUS_15020 18958 18173 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095657.1 protein_id gnl|my_center|LOCUS_15020 20398 19055 gene locus_tag LOCUS_15030 20398 19055 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878888.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence29 868 629 gene locus_tag LOCUS_15040 868 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 1880 1428 gene locus_tag LOCUS_15050 1880 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 2366 2241 gene locus_tag LOCUS_15060 2366 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 2761 3087 gene locus_tag LOCUS_15070 2761 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 4783 3437 gene locus_tag LOCUS_15080 4783 3437 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053756.1 protein_id gnl|my_center|LOCUS_15080 6168 6034 gene locus_tag LOCUS_15090 6168 6034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 6572 6958 gene locus_tag LOCUS_15100 6572 6958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 7391 7167 gene locus_tag LOCUS_15110 7391 7167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 7797 8015 gene locus_tag LOCUS_15120 7797 8015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 8514 8119 gene locus_tag LOCUS_15130 8514 8119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 9198 9052 gene locus_tag LOCUS_15140 9198 9052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 9732 10460 gene locus_tag LOCUS_15150 9732 10460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 10460 11761 gene locus_tag LOCUS_15160 10460 11761 CDS product Piwi domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878815.1 protein_id gnl|my_center|LOCUS_15160 11758 12771 gene locus_tag LOCUS_15170 11758 12771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064368.1 protein_id gnl|my_center|LOCUS_15170 13145 16207 gene locus_tag LOCUS_15180 13145 16207 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080574.1 protein_id gnl|my_center|LOCUS_15180 16212 19523 gene locus_tag LOCUS_15190 16212 19523 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868001.1 protein_id gnl|my_center|LOCUS_15190 19525 19977 gene locus_tag LOCUS_15200 19525 19977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 >Feature sequence30 1497 1153 gene locus_tag LOCUS_15210 1497 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 2891 1725 gene locus_tag LOCUS_15220 2891 1725 CDS product citrate synthase/methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978565.1 protein_id gnl|my_center|LOCUS_15220 3817 2981 gene locus_tag LOCUS_15230 3817 2981 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582908.1 protein_id gnl|my_center|LOCUS_15230 4957 3857 gene locus_tag LOCUS_15240 4957 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 6054 4954 gene locus_tag LOCUS_15250 6054 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 6117 7787 gene locus_tag LOCUS_15260 6117 7787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 8505 7789 gene locus_tag LOCUS_15270 8505 7789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 9526 8588 gene locus_tag LOCUS_15280 9526 8588 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867338.1 protein_id gnl|my_center|LOCUS_15280 9571 11433 gene locus_tag LOCUS_15290 9571 11433 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240328.1 protein_id gnl|my_center|LOCUS_15290 11440 11694 gene locus_tag LOCUS_15300 11440 11694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 12355 11663 gene locus_tag LOCUS_15310 12355 11663 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_15310 12768 12352 gene locus_tag LOCUS_15320 12768 12352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 12860 13120 gene locus_tag LOCUS_15330 12860 13120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 13138 13902 gene locus_tag LOCUS_15340 13138 13902 CDS product bifunctional fructose-bisphosphatase/inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876504.1 protein_id gnl|my_center|LOCUS_15340 13977 13904 gene locus_tag LOCUS_t00360 13977 13904 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 15423 14035 gene locus_tag LOCUS_15350 15423 14035 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870075.1 protein_id gnl|my_center|LOCUS_15350 16430 15417 gene locus_tag LOCUS_15360 16430 15417 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871127.1 protein_id gnl|my_center|LOCUS_15360 16556 16900 gene locus_tag LOCUS_15370 16556 16900 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990651.1 protein_id gnl|my_center|LOCUS_15370 17728 16913 gene locus_tag LOCUS_15380 17728 16913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 17751 19031 gene locus_tag LOCUS_15390 17751 19031 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868536.1 protein_id gnl|my_center|LOCUS_15390 19028 20992 gene locus_tag LOCUS_15400 19028 20992 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878431.1 protein_id gnl|my_center|LOCUS_15400 <21487 20979 gene locus_tag LOCUS_15410 <21487 20979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980400.1:molybdenum cofactor biosynthesis protein MoaB >Feature sequence31 796 1434 gene locus_tag LOCUS_15420 796 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 2084 1722 gene locus_tag LOCUS_15430 2084 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 2382 2035 gene locus_tag LOCUS_15440 2382 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 2691 2891 gene locus_tag LOCUS_15450 2691 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 2888 3097 gene locus_tag LOCUS_15460 2888 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 3060 3398 gene locus_tag LOCUS_15470 3060 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 4175 3579 gene locus_tag LOCUS_15480 4175 3579 CDS product DUF3782 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763642.1 protein_id gnl|my_center|LOCUS_15480 5016 4759 gene locus_tag LOCUS_15490 5016 4759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 6435 5236 gene locus_tag LOCUS_15500 6435 5236 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250274.1 protein_id gnl|my_center|LOCUS_15500 6541 7491 gene locus_tag LOCUS_15510 6541 7491 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249955.1 protein_id gnl|my_center|LOCUS_15510 7649 8977 gene locus_tag LOCUS_15520 7649 8977 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021092.1 protein_id gnl|my_center|LOCUS_15520 9301 9468 gene locus_tag LOCUS_15530 9301 9468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 9465 9731 gene locus_tag LOCUS_15540 9465 9731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 9902 9714 gene locus_tag LOCUS_15550 9902 9714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 11180 10071 gene locus_tag LOCUS_15560 11180 10071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 11440 12657 gene locus_tag LOCUS_15570 11440 12657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 13954 14679 gene locus_tag LOCUS_15580 13954 14679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 14833 15084 gene locus_tag LOCUS_15590 14833 15084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 16327 15107 gene locus_tag LOCUS_15600 gene sufS 16327 15107 CDS product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228604.1 protein_id gnl|my_center|LOCUS_15600 16706 16410 gene locus_tag LOCUS_15610 16706 16410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 16925 17098 gene locus_tag LOCUS_15620 16925 17098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 18641 17433 gene locus_tag LOCUS_15630 18641 17433 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868019.1 protein_id gnl|my_center|LOCUS_15630 19754 19371 gene locus_tag LOCUS_15640 19754 19371 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868472.1 protein_id gnl|my_center|LOCUS_15640 >Feature sequence32 1345 368 gene locus_tag LOCUS_15650 1345 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 1504 2226 gene locus_tag LOCUS_15660 1504 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 2466 2251 gene locus_tag LOCUS_15670 2466 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 3014 3226 gene locus_tag LOCUS_15680 3014 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 3213 3638 gene locus_tag LOCUS_15690 3213 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 4171 4386 gene locus_tag LOCUS_15700 4171 4386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 5179 4856 gene locus_tag LOCUS_15710 5179 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 5265 6041 gene locus_tag LOCUS_15720 5265 6041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 6034 6255 gene locus_tag LOCUS_15730 6034 6255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 6248 6553 gene locus_tag LOCUS_15740 6248 6553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 6758 6558 gene locus_tag LOCUS_15750 6758 6558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 7313 6954 gene locus_tag LOCUS_15760 7313 6954 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868472.1 protein_id gnl|my_center|LOCUS_15760 7677 7276 gene locus_tag LOCUS_15770 7677 7276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 7870 7679 gene locus_tag LOCUS_15780 7870 7679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 8081 8836 gene locus_tag LOCUS_15790 8081 8836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 8833 9231 gene locus_tag LOCUS_15800 8833 9231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 9228 9623 gene locus_tag LOCUS_15810 9228 9623 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846477.1 protein_id gnl|my_center|LOCUS_15810 10603 10115 gene locus_tag LOCUS_15820 10603 10115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 10698 10922 gene locus_tag LOCUS_15830 10698 10922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 12812 11508 gene locus_tag LOCUS_15840 12812 11508 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978991.1 protein_id gnl|my_center|LOCUS_15840 13549 13391 gene locus_tag LOCUS_15850 13549 13391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 13700 13509 gene locus_tag LOCUS_15860 13700 13509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 14632 14072 gene locus_tag LOCUS_15870 14632 14072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15870 15103 14756 gene locus_tag LOCUS_15880 15103 14756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 15707 15309 gene locus_tag LOCUS_15890 15707 15309 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980076.1 protein_id gnl|my_center|LOCUS_15890 16011 15712 gene locus_tag LOCUS_15900 16011 15712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 16177 16365 gene locus_tag LOCUS_15910 16177 16365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 16386 16769 gene locus_tag LOCUS_15920 16386 16769 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878097.1 protein_id gnl|my_center|LOCUS_15920 16753 17157 gene locus_tag LOCUS_15930 16753 17157 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846477.1 protein_id gnl|my_center|LOCUS_15930 17834 17433 gene locus_tag LOCUS_15940 17834 17433 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249949.1 protein_id gnl|my_center|LOCUS_15940 18085 17831 gene locus_tag LOCUS_15950 18085 17831 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013906585.1 protein_id gnl|my_center|LOCUS_15950 18879 18673 gene locus_tag LOCUS_15960 18879 18673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15960 19316 18999 gene locus_tag LOCUS_15970 19316 18999 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879182.1 protein_id gnl|my_center|LOCUS_15970 >Feature sequence33 149 286 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 306 593 gene locus_tag LOCUS_15980 306 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 767 1708 gene locus_tag LOCUS_15990 767 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 3549 1762 gene locus_tag LOCUS_16000 3549 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 4656 3784 gene locus_tag LOCUS_16010 4656 3784 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403928.1 protein_id gnl|my_center|LOCUS_16010 5636 4833 gene locus_tag LOCUS_16020 5636 4833 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250628.1 protein_id gnl|my_center|LOCUS_16020 5804 6391 gene locus_tag LOCUS_16030 5804 6391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 6979 6671 gene locus_tag LOCUS_16040 6979 6671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 7530 8090 gene locus_tag LOCUS_16050 7530 8090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16050 8114 8515 gene locus_tag LOCUS_16060 8114 8515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16060 8482 8742 gene locus_tag LOCUS_16070 8482 8742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16070 9084 9911 gene locus_tag LOCUS_16080 9084 9911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 10714 10406 gene locus_tag LOCUS_16090 10714 10406 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879110.1 protein_id gnl|my_center|LOCUS_16090 11054 10701 gene locus_tag LOCUS_16100 11054 10701 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978742.1 protein_id gnl|my_center|LOCUS_16100 11374 14151 gene locus_tag LOCUS_16110 11374 14151 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762372.1 protein_id gnl|my_center|LOCUS_16110 14800 14261 gene locus_tag LOCUS_16120 14800 14261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 15470 14790 gene locus_tag LOCUS_16130 15470 14790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 17222 15498 gene locus_tag LOCUS_16140 17222 15498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 17893 17492 gene locus_tag LOCUS_16150 17893 17492 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763262.1 protein_id gnl|my_center|LOCUS_16150 18309 17890 gene locus_tag LOCUS_16160 18309 17890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 18751 18530 gene locus_tag LOCUS_16170 18751 18530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 18736 18927 gene locus_tag LOCUS_16180 18736 18927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 18993 19178 gene locus_tag LOCUS_16190 18993 19178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence34 <1 1293 gene locus_tag LOCUS_16200 <1 1293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980304.1:proton-conducting transporter membrane subunit 1300 3405 gene locus_tag LOCUS_16210 1300 3405 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763355.1 protein_id gnl|my_center|LOCUS_16210 3409 4809 gene locus_tag LOCUS_16220 gene fpoN 3409 4809 CDS product F(420)H(2) dehydrogenase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021520.1 protein_id gnl|my_center|LOCUS_16220 5339 4854 gene locus_tag LOCUS_16230 5339 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 5544 5302 gene locus_tag LOCUS_16240 5544 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 6183 6722 gene locus_tag LOCUS_16250 6183 6722 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877952.1 protein_id gnl|my_center|LOCUS_16250 7540 6920 gene locus_tag LOCUS_16260 7540 6920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069168210.1 protein_id gnl|my_center|LOCUS_16260 7691 8038 gene locus_tag LOCUS_16270 7691 8038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 9085 8072 gene locus_tag LOCUS_16280 gene pyrC 9085 8072 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060972.1 protein_id gnl|my_center|LOCUS_16280 10178 9378 gene locus_tag LOCUS_16290 10178 9378 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870966.1 protein_id gnl|my_center|LOCUS_16290 10629 10156 gene locus_tag LOCUS_16300 gene pyrI 10629 10156 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240282.1 protein_id gnl|my_center|LOCUS_16300 11516 10626 gene locus_tag LOCUS_16310 gene pyrB 11516 10626 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762814.1 protein_id gnl|my_center|LOCUS_16310 12106 11513 gene locus_tag LOCUS_16320 gene pyrE 12106 11513 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870621.1 protein_id gnl|my_center|LOCUS_16320 12683 12087 gene locus_tag LOCUS_16330 gene pyrF 12683 12087 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251226.1 protein_id gnl|my_center|LOCUS_16330 14183 12885 gene locus_tag LOCUS_16340 14183 12885 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869244.1 protein_id gnl|my_center|LOCUS_16340 14410 14958 gene locus_tag LOCUS_16350 14410 14958 CDS product DUF4125 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065189580.1 protein_id gnl|my_center|LOCUS_16350 15859 14960 gene locus_tag LOCUS_16360 15859 14960 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015848914.1 protein_id gnl|my_center|LOCUS_16360 <17207 15897 gene locus_tag LOCUS_16370 <17207 15897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249244.1:glycyl radical protein >Feature sequence35 232 158 gene locus_tag LOCUS_t00370 232 158 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1437 274 gene locus_tag LOCUS_16380 gene sucC 1437 274 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879675.1 protein_id gnl|my_center|LOCUS_16380 1467 2348 gene locus_tag LOCUS_16390 gene sucD 1467 2348 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762776.1 protein_id gnl|my_center|LOCUS_16390 2592 2332 gene locus_tag LOCUS_16400 2592 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 2699 2863 gene locus_tag LOCUS_16410 2699 2863 CDS product 50S ribosomal protein L40e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762234.1 protein_id gnl|my_center|LOCUS_16410 2922 4004 gene locus_tag LOCUS_16420 2922 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 2928 3004 gene locus_tag LOCUS_t00380 2928 3004 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4271 4540 gene locus_tag LOCUS_16430 4271 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 4541 4789 gene locus_tag LOCUS_16440 4541 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 5824 4796 gene locus_tag LOCUS_16450 gene fen 5824 4796 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250232.1 protein_id gnl|my_center|LOCUS_16450 5927 6976 gene locus_tag LOCUS_16460 5927 6976 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249842.1 protein_id gnl|my_center|LOCUS_16460 6973 7329 gene locus_tag LOCUS_16470 gene pth2 6973 7329 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320039.1 protein_id gnl|my_center|LOCUS_16470 7326 8420 gene locus_tag LOCUS_16480 gene truD 7326 8420 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762266.1 protein_id gnl|my_center|LOCUS_16480 8859 8449 gene locus_tag LOCUS_16490 8859 8449 CDS product DUF371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251243.1 protein_id gnl|my_center|LOCUS_16490 8893 9540 gene locus_tag LOCUS_16500 8893 9540 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876460.1 protein_id gnl|my_center|LOCUS_16500 9531 10124 gene locus_tag LOCUS_16510 9531 10124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 10121 10717 gene locus_tag LOCUS_16520 10121 10717 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879726.1 protein_id gnl|my_center|LOCUS_16520 10722 11177 gene locus_tag LOCUS_16530 10722 11177 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250202.1 protein_id gnl|my_center|LOCUS_16530 11191 12552 gene locus_tag LOCUS_16540 11191 12552 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064974.1 protein_id gnl|my_center|LOCUS_16540 12856 12533 gene locus_tag LOCUS_16550 12856 12533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 13389 12898 gene locus_tag LOCUS_16560 13389 12898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 13518 14669 gene locus_tag LOCUS_16570 13518 14669 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202993.1 protein_id gnl|my_center|LOCUS_16570 15276 15488 gene locus_tag LOCUS_16580 15276 15488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 15485 15826 gene locus_tag LOCUS_16590 15485 15826 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064210.1 protein_id gnl|my_center|LOCUS_16590 16229 16465 gene locus_tag LOCUS_16600 16229 16465 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024015.1 protein_id gnl|my_center|LOCUS_16600 16549 16695 gene locus_tag LOCUS_16610 16549 16695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 >Feature sequence36 1236 2825 gene locus_tag LOCUS_16620 1236 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 3870 2809 gene locus_tag LOCUS_16630 3870 2809 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878914.1 protein_id gnl|my_center|LOCUS_16630 5065 3845 gene locus_tag LOCUS_16640 5065 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 5371 6270 gene locus_tag LOCUS_16650 5371 6270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 6524 7297 gene locus_tag LOCUS_16660 6524 7297 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868103.1 protein_id gnl|my_center|LOCUS_16660 7281 8432 gene locus_tag LOCUS_16670 7281 8432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 9235 8522 gene locus_tag LOCUS_16680 9235 8522 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868218.1 protein_id gnl|my_center|LOCUS_16680 9950 9237 gene locus_tag LOCUS_16690 9950 9237 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942652.1 protein_id gnl|my_center|LOCUS_16690 10654 9947 gene locus_tag LOCUS_16700 10654 9947 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763251.1 protein_id gnl|my_center|LOCUS_16700 11754 10669 gene locus_tag LOCUS_16710 11754 10669 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942650.1 protein_id gnl|my_center|LOCUS_16710 12634 11759 gene locus_tag LOCUS_16720 12634 11759 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_16720 13966 12668 gene locus_tag LOCUS_16730 13966 12668 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965775.1 protein_id gnl|my_center|LOCUS_16730 14125 16170 gene locus_tag LOCUS_16740 14125 16170 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870478.1 protein_id gnl|my_center|LOCUS_16740 >Feature sequence37 762 211 gene locus_tag LOCUS_16750 gene cas4 762 211 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003042183.1 protein_id gnl|my_center|LOCUS_16750 1042 749 gene locus_tag LOCUS_16760 1042 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 2058 1039 gene locus_tag LOCUS_16770 gene cas1 2058 1039 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258803.1 protein_id gnl|my_center|LOCUS_16770 3419 2058 gene locus_tag LOCUS_16780 3419 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 3955 3416 gene locus_tag LOCUS_16790 3955 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 5408 4107 gene locus_tag LOCUS_16800 5408 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 5542 6390 gene locus_tag LOCUS_16810 5542 6390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 6356 7837 gene locus_tag LOCUS_16820 6356 7837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 9326 7815 gene locus_tag LOCUS_16830 9326 7815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 9630 11597 gene locus_tag LOCUS_16840 9630 11597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 11590 12108 gene locus_tag LOCUS_16850 11590 12108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 12110 13423 gene locus_tag LOCUS_16860 12110 13423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 13498 14301 gene locus_tag LOCUS_16870 13498 14301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 >Feature sequence38 3234 397 gene locus_tag LOCUS_16880 3234 397 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020506622.1 protein_id gnl|my_center|LOCUS_16880 3366 6662 gene locus_tag LOCUS_16890 3366 6662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16890 6667 8082 gene locus_tag LOCUS_16900 6667 8082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 8082 8984 gene locus_tag LOCUS_16910 8082 8984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 8988 9362 gene locus_tag LOCUS_16920 8988 9362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 10536 9391 gene locus_tag LOCUS_16930 10536 9391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 11696 10773 gene locus_tag LOCUS_16940 11696 10773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 11794 12171 gene locus_tag LOCUS_16950 11794 12171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 12420 13634 gene locus_tag LOCUS_16960 12420 13634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 13631 14092 gene locus_tag LOCUS_16970 13631 14092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 14679 14203 gene locus_tag LOCUS_16980 14679 14203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 >Feature sequence39 1164 1370 gene locus_tag LOCUS_16990 1164 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 1607 1849 gene locus_tag LOCUS_17000 1607 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 1851 2252 gene locus_tag LOCUS_17010 1851 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 3310 2624 gene locus_tag LOCUS_17020 3310 2624 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249663.1 protein_id gnl|my_center|LOCUS_17020 4206 3487 gene locus_tag LOCUS_17030 4206 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 4512 4276 gene locus_tag LOCUS_17040 4512 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 5250 5540 gene locus_tag LOCUS_17050 5250 5540 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869621.1 protein_id gnl|my_center|LOCUS_17050 5537 5896 gene locus_tag LOCUS_17060 5537 5896 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_17060 6535 6272 gene locus_tag LOCUS_17070 6535 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 8085 6673 gene locus_tag LOCUS_17080 8085 6673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 8356 8613 gene locus_tag LOCUS_17090 8356 8613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 9353 8775 gene locus_tag LOCUS_17100 9353 8775 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722009.1 protein_id gnl|my_center|LOCUS_17100 9527 10558 gene locus_tag LOCUS_17110 9527 10558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 10966 10628 gene locus_tag LOCUS_17120 10966 10628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 11216 10947 gene locus_tag LOCUS_17130 11216 10947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 11493 12173 gene locus_tag LOCUS_17140 11493 12173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 12205 12480 gene locus_tag LOCUS_17150 12205 12480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17150 12589 13020 gene locus_tag LOCUS_17160 12589 13020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 13917 13141 gene locus_tag LOCUS_17170 13917 13141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 >Feature sequence40 757 290 gene locus_tag LOCUS_17180 757 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 1476 772 gene locus_tag LOCUS_17190 1476 772 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942652.1 protein_id gnl|my_center|LOCUS_17190 2268 1477 gene locus_tag LOCUS_17200 2268 1477 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763251.1 protein_id gnl|my_center|LOCUS_17200 2422 3657 gene locus_tag LOCUS_17210 2422 3657 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399216.1 protein_id gnl|my_center|LOCUS_17210 3720 4586 gene locus_tag LOCUS_17220 3720 4586 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 protein_id gnl|my_center|LOCUS_17220 4595 5584 gene locus_tag LOCUS_17230 4595 5584 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809683.1 protein_id gnl|my_center|LOCUS_17230 7580 5817 gene locus_tag LOCUS_17240 7580 5817 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878912.1 protein_id gnl|my_center|LOCUS_17240 8348 7746 gene locus_tag LOCUS_17250 8348 7746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 11533 8486 gene locus_tag LOCUS_17260 11533 8486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 11439 11906 gene locus_tag LOCUS_17270 11439 11906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 12165 13055 gene locus_tag LOCUS_17280 12165 13055 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_17280 >Feature sequence41 865 470 gene locus_tag LOCUS_17290 865 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 1463 891 gene locus_tag LOCUS_17300 1463 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17300 1661 1993 gene locus_tag LOCUS_17310 1661 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 1971 3239 gene locus_tag LOCUS_17320 1971 3239 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080628.1 protein_id gnl|my_center|LOCUS_17320 3761 3213 gene locus_tag LOCUS_17330 3761 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 3918 4823 gene locus_tag LOCUS_17340 3918 4823 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941519.1 protein_id gnl|my_center|LOCUS_17340 4971 6839 gene locus_tag LOCUS_17350 4971 6839 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249703.1 protein_id gnl|my_center|LOCUS_17350 6849 8111 gene locus_tag LOCUS_17360 6849 8111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 8966 8208 gene locus_tag LOCUS_17370 8966 8208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 10545 10201 gene locus_tag LOCUS_17380 10545 10201 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868472.1 protein_id gnl|my_center|LOCUS_17380 10915 10529 gene locus_tag LOCUS_17390 10915 10529 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878097.1 protein_id gnl|my_center|LOCUS_17390 11588 11157 gene locus_tag LOCUS_17400 11588 11157 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021853.1 protein_id gnl|my_center|LOCUS_17400 11977 11594 gene locus_tag LOCUS_17410 11977 11594 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065983.1 protein_id gnl|my_center|LOCUS_17410 12949 12074 gene locus_tag LOCUS_17420 12949 12074 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079210.1 protein_id gnl|my_center|LOCUS_17420 >Feature sequence42 1330 929 gene locus_tag LOCUS_17430 1330 929 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250455.1 protein_id gnl|my_center|LOCUS_17430 1862 1335 gene locus_tag LOCUS_17440 gene rpsD 1862 1335 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879773.1 protein_id gnl|my_center|LOCUS_17440 2336 1884 gene locus_tag LOCUS_17450 2336 1884 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762661.1 protein_id gnl|my_center|LOCUS_17450 2546 2462 gene locus_tag LOCUS_t00390 2546 2462 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3604 2609 gene locus_tag LOCUS_17460 3604 2609 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877749.1 protein_id gnl|my_center|LOCUS_17460 3923 3618 gene locus_tag LOCUS_17470 3923 3618 CDS product 50S ribosomal protein L14e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978366.1 protein_id gnl|my_center|LOCUS_17470 4263 3958 gene locus_tag LOCUS_17480 4263 3958 CDS product 50S ribosomal protein L34e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870160.1 protein_id gnl|my_center|LOCUS_17480 4911 4405 gene locus_tag LOCUS_17490 4911 4405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 6319 4916 gene locus_tag LOCUS_17500 gene secY 6319 4916 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250469.1 protein_id gnl|my_center|LOCUS_17500 6790 6332 gene locus_tag LOCUS_17510 6790 6332 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869978.1 protein_id gnl|my_center|LOCUS_17510 7311 6787 gene locus_tag LOCUS_17520 7311 6787 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867442.1 protein_id gnl|my_center|LOCUS_17520 8014 7367 gene locus_tag LOCUS_17530 gene rpsE 8014 7367 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879398.1 protein_id gnl|my_center|LOCUS_17530 8652 8047 gene locus_tag LOCUS_17540 8652 8047 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869975.1 protein_id gnl|my_center|LOCUS_17540 9070 8645 gene locus_tag LOCUS_17550 9070 8645 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021119.1 protein_id gnl|my_center|LOCUS_17550 9471 9067 gene locus_tag LOCUS_17560 9471 9067 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867446.1 protein_id gnl|my_center|LOCUS_17560 10024 9473 gene locus_tag LOCUS_17570 10024 9473 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875661.1 protein_id gnl|my_center|LOCUS_17570 10437 10045 gene locus_tag LOCUS_17580 10437 10045 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867448.1 protein_id gnl|my_center|LOCUS_17580 10611 10447 gene locus_tag LOCUS_17590 10611 10447 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879404.1 protein_id gnl|my_center|LOCUS_17590 11182 10622 gene locus_tag LOCUS_17600 11182 10622 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250479.1 protein_id gnl|my_center|LOCUS_17600 11909 11187 gene locus_tag LOCUS_17610 11909 11187 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869968.1 protein_id gnl|my_center|LOCUS_17610 12394 11912 gene locus_tag LOCUS_17620 12394 11912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 12851 12426 gene locus_tag LOCUS_17630 12851 12426 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875655.1 protein_id gnl|my_center|LOCUS_17630 >Feature sequence43 711 382 gene locus_tag LOCUS_17640 gene metG 711 382 CDS product methionine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867535.1 protein_id gnl|my_center|LOCUS_17640 778 1860 gene locus_tag LOCUS_17650 778 1860 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393148.1 protein_id gnl|my_center|LOCUS_17650 3027 1957 gene locus_tag LOCUS_17660 3027 1957 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485734.1 protein_id gnl|my_center|LOCUS_17660 3593 4876 gene locus_tag LOCUS_17670 3593 4876 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053886.1 protein_id gnl|my_center|LOCUS_17670 5031 5903 gene locus_tag LOCUS_17680 5031 5903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 6080 6595 gene locus_tag LOCUS_17690 6080 6595 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_17690 6793 8151 gene locus_tag LOCUS_17700 6793 8151 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082444.1 protein_id gnl|my_center|LOCUS_17700 8885 8220 gene locus_tag LOCUS_17710 gene rnhB 8885 8220 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867642.1 protein_id gnl|my_center|LOCUS_17710 9720 9100 gene locus_tag LOCUS_17720 9720 9100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 10591 10379 gene locus_tag LOCUS_17730 10591 10379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 10524 12068 gene locus_tag LOCUS_17740 10524 12068 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053795.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence44 <1 694 gene locus_tag LOCUS_17750 <1 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013527926.1:ABC transporter substrate-binding protein 741 1754 gene locus_tag LOCUS_17760 741 1754 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370098.1 protein_id gnl|my_center|LOCUS_17760 1768 2637 gene locus_tag LOCUS_17770 1768 2637 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338504.1 protein_id gnl|my_center|LOCUS_17770 2643 3608 gene locus_tag LOCUS_17780 2643 3608 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867269.1 protein_id gnl|my_center|LOCUS_17780 3605 4588 gene locus_tag LOCUS_17790 3605 4588 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_17790 4590 4745 gene locus_tag LOCUS_17800 4590 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 6009 4726 gene locus_tag LOCUS_17810 6009 4726 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868396.1 protein_id gnl|my_center|LOCUS_17810 6712 6074 gene locus_tag LOCUS_17820 6712 6074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 6811 7209 gene locus_tag LOCUS_17830 6811 7209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 8368 7217 gene locus_tag LOCUS_17840 gene lysA 8368 7217 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880764.1 protein_id gnl|my_center|LOCUS_17840 8436 8999 gene locus_tag LOCUS_17850 8436 8999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 10108 8987 gene locus_tag LOCUS_17860 10108 8987 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963516.1 protein_id gnl|my_center|LOCUS_17860 10150 11304 gene locus_tag LOCUS_17870 gene amrS 10150 11304 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249844.1 protein_id gnl|my_center|LOCUS_17870 12301 11438 gene locus_tag LOCUS_17880 12301 11438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 >Feature sequence45 1708 4908 gene locus_tag LOCUS_17890 1708 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 4910 5977 gene locus_tag LOCUS_17900 4910 5977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 5970 6854 gene locus_tag LOCUS_17910 gene cmr4 5970 6854 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880200.1 protein_id gnl|my_center|LOCUS_17910 6847 7284 gene locus_tag LOCUS_17920 6847 7284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 7281 8315 gene locus_tag LOCUS_17930 7281 8315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 8312 9229 gene locus_tag LOCUS_17940 8312 9229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 9216 9641 gene locus_tag LOCUS_17950 9216 9641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 9920 10573 gene locus_tag LOCUS_17960 9920 10573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 11241 10879 gene locus_tag LOCUS_17970 11241 10879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 11467 11255 gene locus_tag LOCUS_17980 11467 11255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 11636 11433 gene locus_tag LOCUS_17990 11636 11433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence46 88 849 gene locus_tag LOCUS_18000 88 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 1714 2571 gene locus_tag LOCUS_18010 1714 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 2925 3320 gene locus_tag LOCUS_18020 2925 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 3322 4092 gene locus_tag LOCUS_18030 gene csx7 3322 4092 CDS product CRISPR-associated RAMP protein Csx7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977938.1 protein_id gnl|my_center|LOCUS_18030 4089 5012 gene locus_tag LOCUS_18040 gene csx7 4089 5012 CDS product CRISPR-associated RAMP protein Csx7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977939.1 protein_id gnl|my_center|LOCUS_18040 5005 5958 gene locus_tag LOCUS_18050 5005 5958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 5969 6214 gene locus_tag LOCUS_18060 5969 6214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 6198 9062 gene locus_tag LOCUS_18070 6198 9062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 9059 9682 gene locus_tag LOCUS_18080 9059 9682 CDS product RAMP superfamily CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977943.1 protein_id gnl|my_center|LOCUS_18080 9673 10833 gene locus_tag LOCUS_18090 9673 10833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 10916 11551 gene locus_tag LOCUS_18100 10916 11551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 >Feature sequence47 187 702 gene locus_tag LOCUS_18110 187 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 1059 1301 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1797 2384 gene locus_tag LOCUS_18120 1797 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 2410 2907 gene locus_tag LOCUS_18130 2410 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 3031 3321 gene locus_tag LOCUS_18140 3031 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 3781 4002 gene locus_tag LOCUS_18150 3781 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 4242 3955 gene locus_tag LOCUS_18160 4242 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 4519 4214 gene locus_tag LOCUS_18170 4519 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 4577 4936 gene locus_tag LOCUS_18180 4577 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 5303 5058 gene locus_tag LOCUS_18190 5303 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 6346 5300 gene locus_tag LOCUS_18200 6346 5300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 6544 6350 gene locus_tag LOCUS_18210 6544 6350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 7355 6513 gene locus_tag LOCUS_18220 7355 6513 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890071.1 protein_id gnl|my_center|LOCUS_18220 7635 7345 gene locus_tag LOCUS_18230 7635 7345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 8872 8384 gene locus_tag LOCUS_18240 8872 8384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 9620 8838 gene locus_tag LOCUS_18250 9620 8838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 10061 9711 gene locus_tag LOCUS_18260 10061 9711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 10285 10112 gene locus_tag LOCUS_18270 10285 10112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 10591 10451 gene locus_tag LOCUS_18280 10591 10451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 10841 10569 gene locus_tag LOCUS_18290 10841 10569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 11090 10941 gene locus_tag LOCUS_18300 11090 10941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 11397 11107 gene locus_tag LOCUS_18310 11397 11107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 >Feature sequence48 203 30 gene locus_tag LOCUS_18320 203 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 405 238 gene locus_tag LOCUS_18330 405 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 1094 531 gene locus_tag LOCUS_18340 1094 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 1458 1039 gene locus_tag LOCUS_18350 1458 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 1850 1683 gene locus_tag LOCUS_18360 1850 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 2158 1910 gene locus_tag LOCUS_18370 2158 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 2625 2945 gene locus_tag LOCUS_18380 2625 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 2956 3282 gene locus_tag LOCUS_18390 2956 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 3301 3606 gene locus_tag LOCUS_18400 3301 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 3956 3603 gene locus_tag LOCUS_18410 3956 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 4710 4438 gene locus_tag LOCUS_18420 4710 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 4956 5462 gene locus_tag LOCUS_18430 4956 5462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 6476 6730 gene locus_tag LOCUS_18440 6476 6730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 6696 7175 gene locus_tag LOCUS_18450 6696 7175 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248955.1 protein_id gnl|my_center|LOCUS_18450 7608 7306 gene locus_tag LOCUS_18460 7608 7306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 7989 8231 gene locus_tag LOCUS_18470 7989 8231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 9409 9101 gene locus_tag LOCUS_18480 9409 9101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 9614 9369 gene locus_tag LOCUS_18490 9614 9369 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879678.1 protein_id gnl|my_center|LOCUS_18490 9967 10206 gene locus_tag LOCUS_18500 9967 10206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146880.1 protein_id gnl|my_center|LOCUS_18500 10215 10520 gene locus_tag LOCUS_18510 10215 10520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 11318 10914 gene locus_tag LOCUS_18520 11318 10914 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879186.1 protein_id gnl|my_center|LOCUS_18520 >Feature sequence49 212 637 gene locus_tag LOCUS_18530 212 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 796 1605 gene locus_tag LOCUS_18540 796 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 1618 2346 gene locus_tag LOCUS_18550 1618 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 3660 2386 gene locus_tag LOCUS_18560 3660 2386 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209169.1 protein_id gnl|my_center|LOCUS_18560 3833 3657 gene locus_tag LOCUS_18570 3833 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496689.1 protein_id gnl|my_center|LOCUS_18570 4274 3924 gene locus_tag LOCUS_18580 4274 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 4332 4544 gene locus_tag LOCUS_18590 4332 4544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 4740 6872 gene locus_tag LOCUS_18600 4740 6872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 7302 6940 gene locus_tag LOCUS_18610 7302 6940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 7610 7305 gene locus_tag LOCUS_18620 7610 7305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 7974 8132 gene locus_tag LOCUS_18630 7974 8132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 9632 9213 gene locus_tag LOCUS_18640 9632 9213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 10020 9607 gene locus_tag LOCUS_18650 10020 9607 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172718.1 protein_id gnl|my_center|LOCUS_18650 10955 11155 gene locus_tag LOCUS_18660 10955 11155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 >Feature sequence50 576 815 gene locus_tag LOCUS_18670 576 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 790 1230 gene locus_tag LOCUS_18680 790 1230 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846620.1 protein_id gnl|my_center|LOCUS_18680 2616 2173 gene locus_tag LOCUS_18690 2616 2173 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180546210.1 protein_id gnl|my_center|LOCUS_18690 2860 2591 gene locus_tag LOCUS_18700 2860 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 3396 3019 gene locus_tag LOCUS_18710 3396 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 3625 4023 gene locus_tag LOCUS_18720 3625 4023 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868473.1 protein_id gnl|my_center|LOCUS_18720 3998 4336 gene locus_tag LOCUS_18730 3998 4336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 5179 4904 gene locus_tag LOCUS_18740 5179 4904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18740 5761 5321 gene locus_tag LOCUS_18750 5761 5321 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979773.1 protein_id gnl|my_center|LOCUS_18750 5922 6134 gene locus_tag LOCUS_18760 5922 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 6448 7410 gene locus_tag LOCUS_18770 6448 7410 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937413.1 protein_id gnl|my_center|LOCUS_18770 7391 8089 gene locus_tag LOCUS_18780 7391 8089 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943614.1 protein_id gnl|my_center|LOCUS_18780 8086 8925 gene locus_tag LOCUS_18790 8086 8925 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007204.1 protein_id gnl|my_center|LOCUS_18790 8922 9833 gene locus_tag LOCUS_18800 8922 9833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 10702 10352 gene locus_tag LOCUS_18810 10702 10352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 >Feature sequence51 <1 600 gene locus_tag LOCUS_18820 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979991.1:AAA family ATPase 597 1289 gene locus_tag LOCUS_18830 597 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 1974 1576 gene locus_tag LOCUS_18840 1974 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 2514 1981 gene locus_tag LOCUS_18850 2514 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 2969 2511 gene locus_tag LOCUS_18860 2969 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 3569 3985 gene locus_tag LOCUS_18870 3569 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 3978 5561 gene locus_tag LOCUS_18880 3978 5561 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249122.1 protein_id gnl|my_center|LOCUS_18880 6160 5981 gene locus_tag LOCUS_18890 6160 5981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 6426 6755 gene locus_tag LOCUS_18900 6426 6755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 6718 7080 gene locus_tag LOCUS_18910 6718 7080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 7729 7370 gene locus_tag LOCUS_18920 7729 7370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 7964 8209 gene locus_tag LOCUS_18930 7964 8209 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977947.1 protein_id gnl|my_center|LOCUS_18930 8190 8651 gene locus_tag LOCUS_18940 8190 8651 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846603.1 protein_id gnl|my_center|LOCUS_18940 9185 8937 gene locus_tag LOCUS_18950 9185 8937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 9501 9274 gene locus_tag LOCUS_18960 9501 9274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 10198 9713 gene locus_tag LOCUS_18970 10198 9713 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761996.1 protein_id gnl|my_center|LOCUS_18970 10403 10236 gene locus_tag LOCUS_18980 10403 10236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 >Feature sequence52 569 159 gene locus_tag LOCUS_18990 569 159 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020586.1 protein_id gnl|my_center|LOCUS_18990 765 1613 gene locus_tag LOCUS_19000 765 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 2778 1753 gene locus_tag LOCUS_19010 2778 1753 CDS product arsenic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080192.1 protein_id gnl|my_center|LOCUS_19010 3579 2947 gene locus_tag LOCUS_19020 3579 2947 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979459.1 protein_id gnl|my_center|LOCUS_19020 4120 3788 gene locus_tag LOCUS_19030 4120 3788 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876799.1 protein_id gnl|my_center|LOCUS_19030 4647 4267 gene locus_tag LOCUS_19040 4647 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 4985 6385 gene locus_tag LOCUS_19050 4985 6385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 6573 6947 gene locus_tag LOCUS_19060 6573 6947 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877770.1 protein_id gnl|my_center|LOCUS_19060 6934 7329 gene locus_tag LOCUS_19070 6934 7329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 8674 7469 gene locus_tag LOCUS_19080 8674 7469 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146758.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence53 185 307 gene locus_tag LOCUS_19090 185 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 792 523 gene locus_tag LOCUS_19100 792 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 1639 890 gene locus_tag LOCUS_19110 1639 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 2228 2470 gene locus_tag LOCUS_19120 2228 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 2921 3166 gene locus_tag LOCUS_19130 2921 3166 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977947.1 protein_id gnl|my_center|LOCUS_19130 3147 3608 gene locus_tag LOCUS_19140 3147 3608 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846603.1 protein_id gnl|my_center|LOCUS_19140 4440 4742 gene locus_tag LOCUS_19150 4440 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 4705 5067 gene locus_tag LOCUS_19160 4705 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 5495 4971 gene locus_tag LOCUS_19170 5495 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 6259 5492 gene locus_tag LOCUS_19180 6259 5492 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867167.1 protein_id gnl|my_center|LOCUS_19180 6567 7373 gene locus_tag LOCUS_19190 6567 7373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 7366 8394 gene locus_tag LOCUS_19200 7366 8394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 8512 8682 gene locus_tag LOCUS_19210 8512 8682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 8848 9045 gene locus_tag LOCUS_19220 8848 9045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 >Feature sequence54 1112 330 gene locus_tag LOCUS_19230 gene larE 1112 330 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964093.1 protein_id gnl|my_center|LOCUS_19230 1229 2074 gene locus_tag LOCUS_19240 1229 2074 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877277.1 protein_id gnl|my_center|LOCUS_19240 2246 2842 gene locus_tag LOCUS_19250 2246 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 3291 2854 gene locus_tag LOCUS_19260 3291 2854 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846620.1 protein_id gnl|my_center|LOCUS_19260 3518 3294 gene locus_tag LOCUS_19270 3518 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878112.1 protein_id gnl|my_center|LOCUS_19270 3694 5028 gene locus_tag LOCUS_19280 3694 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 5226 6242 gene locus_tag LOCUS_19290 5226 6242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868097.1 protein_id gnl|my_center|LOCUS_19290 6883 6269 gene locus_tag LOCUS_19300 6883 6269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 7508 6873 gene locus_tag LOCUS_19310 7508 6873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 7857 8543 gene locus_tag LOCUS_19320 7857 8543 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978652.1 protein_id gnl|my_center|LOCUS_19320 8713 9501 gene locus_tag LOCUS_19330 8713 9501 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584118.1 protein_id gnl|my_center|LOCUS_19330 >Feature sequence55 575 102 gene locus_tag LOCUS_19340 575 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 1059 568 gene locus_tag LOCUS_19350 gene nuoI 1059 568 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847026.1 protein_id gnl|my_center|LOCUS_19350 2083 1061 gene locus_tag LOCUS_19360 gene nuoH 2083 1061 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015591312.1 protein_id gnl|my_center|LOCUS_19360 3249 2080 gene locus_tag LOCUS_19370 3249 2080 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980299.1 protein_id gnl|my_center|LOCUS_19370 3722 3246 gene locus_tag LOCUS_19380 3722 3246 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846746.1 protein_id gnl|my_center|LOCUS_19380 4236 3712 gene locus_tag LOCUS_19390 gene nuoB 4236 3712 CDS product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979576.1 protein_id gnl|my_center|LOCUS_19390 4592 4221 gene locus_tag LOCUS_19400 4592 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 5216 4911 gene locus_tag LOCUS_19410 5216 4911 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250011.1 protein_id gnl|my_center|LOCUS_19410 5801 5286 gene locus_tag LOCUS_19420 gene cobO 5801 5286 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442279.1 protein_id gnl|my_center|LOCUS_19420 <7423 5801 gene locus_tag LOCUS_19430 <7423 5801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868726.1:adenosylcobalamin-dependent ribonucleoside-diphosphate reductase >Feature sequence56 804 2267 gene locus_tag LOCUS_19440 804 2267 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021657.1 protein_id gnl|my_center|LOCUS_19440 2780 2310 gene locus_tag LOCUS_19450 2780 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 2879 3559 gene locus_tag LOCUS_19460 2879 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 3635 3802 gene locus_tag LOCUS_19470 3635 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 3979 4158 gene locus_tag LOCUS_19480 3979 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 5318 5034 gene locus_tag LOCUS_19490 5318 5034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 6713 5805 gene locus_tag LOCUS_19500 6713 5805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 >Feature sequence57 98 604 gene locus_tag LOCUS_19510 98 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 1162 671 gene locus_tag LOCUS_19520 1162 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 1397 1645 gene locus_tag LOCUS_19530 1397 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 2468 2277 gene locus_tag LOCUS_19540 2468 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 2952 3287 gene locus_tag LOCUS_19550 2952 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 3945 3457 gene locus_tag LOCUS_19560 3945 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 >Feature sequence58 1229 270 gene locus_tag LOCUS_19570 gene ilvA 1229 270 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_19570 1741 2103 gene locus_tag LOCUS_19580 1741 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 2450 2109 gene locus_tag LOCUS_19590 2450 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 2735 3283 gene locus_tag LOCUS_19600 2735 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 3623 3294 gene locus_tag LOCUS_19610 3623 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 3918 5189 gene locus_tag LOCUS_19620 3918 5189 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023489.1 protein_id gnl|my_center|LOCUS_19620 >Feature sequence59 558 250 gene locus_tag LOCUS_19630 558 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 1059 1451 gene locus_tag LOCUS_19640 1059 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 1418 1729 gene locus_tag LOCUS_19650 1418 1729 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878118.1 protein_id gnl|my_center|LOCUS_19650 3479 2598 gene locus_tag LOCUS_19660 3479 2598 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147080.1 protein_id gnl|my_center|LOCUS_19660 4702 3476 gene locus_tag LOCUS_19670 4702 3476 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867774.1 protein_id gnl|my_center|LOCUS_19670 >Feature sequence60 834 52 gene locus_tag LOCUS_19680 834 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 1058 834 gene locus_tag LOCUS_19690 1058 834 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057829.1 protein_id gnl|my_center|LOCUS_19690 1434 1024 gene locus_tag LOCUS_19700 1434 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 1801 1421 gene locus_tag LOCUS_19710 1801 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 2272 3804 gene locus_tag LOCUS_19720 2272 3804 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_19720 >Feature sequence61 884 675 gene locus_tag LOCUS_19730 884 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 985 1104 gene locus_tag LOCUS_19740 985 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 3051 1264 gene locus_tag LOCUS_19750 3051 1264 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_19750 3405 3779 gene locus_tag LOCUS_19760 3405 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 4300 3800 gene locus_tag LOCUS_19770 4300 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 >Feature sequence62 547 1908 gene locus_tag LOCUS_19780 547 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 2041 2829 gene locus_tag LOCUS_19790 2041 2829 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013805.1 protein_id gnl|my_center|LOCUS_19790 3034 3930 gene locus_tag LOCUS_19800 3034 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 <4694 4046 gene locus_tag LOCUS_19810 <4694 4046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012289085.1:glycosyltransferase family 4 protein >Feature sequence63 611 994 gene locus_tag LOCUS_19820 611 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 1057 2301 gene locus_tag LOCUS_19830 1057 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 2406 3146 gene locus_tag LOCUS_19840 2406 3146 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251231.1 protein_id gnl|my_center|LOCUS_19840 >Feature sequence64 <1 762 gene locus_tag LOCUS_19850 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870477.1:hydantoinase B/oxoprolinase family protein 900 1328 gene locus_tag LOCUS_19860 900 1328 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240498.1 protein_id gnl|my_center|LOCUS_19860 1779 1285 gene locus_tag LOCUS_19870 1779 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 3586 1790 gene locus_tag LOCUS_19880 3586 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 <4165 3604 gene locus_tag LOCUS_19890 <4165 3604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461328.1:molecular chaperone TorD family protein >Feature sequence65 359 108 gene locus_tag LOCUS_19900 359 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 643 356 gene locus_tag LOCUS_19910 643 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 1712 1047 gene locus_tag LOCUS_19920 1712 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 2724 1744 gene locus_tag LOCUS_19930 2724 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 3635 2721 gene locus_tag LOCUS_19940 3635 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 >Feature sequence66 240 109 gene locus_tag LOCUS_19950 240 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 654 295 gene locus_tag LOCUS_19960 654 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 1222 632 gene locus_tag LOCUS_19970 1222 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 1481 3265 gene locus_tag LOCUS_19980 gene ade 1481 3265 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392001.1 protein_id gnl|my_center|LOCUS_19980 3954 3817 gene locus_tag LOCUS_19990 3954 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 >Feature sequence67 292 1041 gene locus_tag LOCUS_20000 292 1041 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546695.1 protein_id gnl|my_center|LOCUS_20000 1043 2248 gene locus_tag LOCUS_20010 1043 2248 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761797.1 protein_id gnl|my_center|LOCUS_20010 2512 3408 gene locus_tag LOCUS_20020 2512 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 3690 3421 gene locus_tag LOCUS_20030 3690 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 >Feature sequence68 900 565 gene locus_tag LOCUS_20040 900 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 2639 891 gene locus_tag LOCUS_20050 2639 891 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393464.1 protein_id gnl|my_center|LOCUS_20050 <3640 2644 gene locus_tag LOCUS_20060 <3640 2644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393465.1:hydantoinase/oxoprolinase family protein >Feature sequence69 946 545 gene locus_tag LOCUS_20070 946 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 1205 903 gene locus_tag LOCUS_20080 1205 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 1521 1360 gene locus_tag LOCUS_20090 1521 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 1845 1991 gene locus_tag LOCUS_20100 1845 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 2107 2373 gene locus_tag LOCUS_20110 2107 2373 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423251.1 protein_id gnl|my_center|LOCUS_20110 >Feature sequence70 951 148 gene locus_tag LOCUS_20120 951 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 1359 3395 gene locus_tag LOCUS_20130 1359 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 >Feature sequence71 556 1101 gene locus_tag LOCUS_20140 556 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 2079 1150 gene locus_tag LOCUS_20150 2079 1150 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979533.1 protein_id gnl|my_center|LOCUS_20150 >Feature sequence72 255 548 gene locus_tag LOCUS_20160 255 548 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979535.1 protein_id gnl|my_center|LOCUS_20160 545 826 gene locus_tag LOCUS_20170 545 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 <2978 1649 gene locus_tag LOCUS_20180 <2978 1649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010871190.1:CRISPR-associated CARF protein Csx1