>Feature sequence001 399 1064 gene locus_tag LOCUS_00010 399 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1031 1846 gene locus_tag LOCUS_00020 1031 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1878 2726 gene locus_tag LOCUS_00030 1878 2726 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877239.1 protein_id gnl|my_center|LOCUS_00030 2782 4140 gene locus_tag LOCUS_00040 2782 4140 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113389.1 protein_id gnl|my_center|LOCUS_00040 5687 4158 gene locus_tag LOCUS_00050 5687 4158 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892316.1 protein_id gnl|my_center|LOCUS_00050 6484 5744 gene locus_tag LOCUS_00060 6484 5744 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416907.1 protein_id gnl|my_center|LOCUS_00060 6515 7849 gene locus_tag LOCUS_00070 gene aroA 6515 7849 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416914.1 protein_id gnl|my_center|LOCUS_00070 7473 7549 gene locus_tag LOCUS_t00010 7473 7549 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7846 8865 gene locus_tag LOCUS_00080 gene rsgA 7846 8865 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727982.1 protein_id gnl|my_center|LOCUS_00080 8862 9722 gene locus_tag LOCUS_00090 8862 9722 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228550.1 protein_id gnl|my_center|LOCUS_00090 10951 9707 gene locus_tag LOCUS_00100 gene desA3 10951 9707 CDS product NADPH-dependent stearoyl-CoA 9-desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416919.1 protein_id gnl|my_center|LOCUS_00100 12036 10951 gene locus_tag LOCUS_00110 12036 10951 CDS product NADPH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416922.1 protein_id gnl|my_center|LOCUS_00110 12576 12073 gene locus_tag LOCUS_00120 12576 12073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416925.1 protein_id gnl|my_center|LOCUS_00120 13428 12586 gene locus_tag LOCUS_00130 gene ppk2 13428 12586 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416928.1 protein_id gnl|my_center|LOCUS_00130 14882 13476 gene locus_tag LOCUS_00140 14882 13476 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727977.1 protein_id gnl|my_center|LOCUS_00140 14946 15488 gene locus_tag LOCUS_00150 14946 15488 CDS product Rv3235 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416932.1 protein_id gnl|my_center|LOCUS_00150 18198 15499 gene locus_tag LOCUS_00160 gene secA 18198 15499 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727975.1 protein_id gnl|my_center|LOCUS_00160 19024 18341 gene locus_tag LOCUS_00170 gene raiA 19024 18341 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727974.1 protein_id gnl|my_center|LOCUS_00170 19888 19244 gene locus_tag LOCUS_00180 19888 19244 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054881065.1 protein_id gnl|my_center|LOCUS_00180 21481 19934 gene locus_tag LOCUS_00190 21481 19934 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408499.1 protein_id gnl|my_center|LOCUS_00190 23245 21491 gene locus_tag LOCUS_00200 gene lpqB 23245 21491 CDS product MtrAB system accessory lipoprotein LpqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727973.1 protein_id gnl|my_center|LOCUS_00200 24882 23242 gene locus_tag LOCUS_00210 gene mtrB 24882 23242 CDS product two-component system sensor histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416988.1 protein_id gnl|my_center|LOCUS_00210 25622 24915 gene locus_tag LOCUS_00220 gene mtrA 25622 24915 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727971.1 protein_id gnl|my_center|LOCUS_00220 26338 25709 gene locus_tag LOCUS_00230 26338 25709 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417036.1 protein_id gnl|my_center|LOCUS_00230 27942 26485 gene locus_tag LOCUS_00240 gene ahcY 27942 26485 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080862.1 protein_id gnl|my_center|LOCUS_00240 29484 27976 gene locus_tag LOCUS_00250 29484 27976 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727944.1 protein_id gnl|my_center|LOCUS_00250 30721 29504 gene locus_tag LOCUS_00260 gene manA 30721 29504 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417054.1 protein_id gnl|my_center|LOCUS_00260 31802 30729 gene locus_tag LOCUS_00270 31802 30729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907917.1 protein_id gnl|my_center|LOCUS_00270 33196 31799 gene locus_tag LOCUS_00280 33196 31799 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727940.1 protein_id gnl|my_center|LOCUS_00280 33670 33251 gene locus_tag LOCUS_00290 33670 33251 CDS product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727939.1 protein_id gnl|my_center|LOCUS_00290 33735 34253 gene locus_tag LOCUS_00300 33735 34253 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080840.1 protein_id gnl|my_center|LOCUS_00300 34647 34255 gene locus_tag LOCUS_00310 34647 34255 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020102910.1 protein_id gnl|my_center|LOCUS_00310 34921 35928 gene locus_tag LOCUS_00320 gene cofD 34921 35928 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727938.1 protein_id gnl|my_center|LOCUS_00320 35925 37283 gene locus_tag LOCUS_00330 35925 37283 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727937.1 protein_id gnl|my_center|LOCUS_00330 37280 37831 gene locus_tag LOCUS_00340 37280 37831 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727936.1 protein_id gnl|my_center|LOCUS_00340 38916 37813 gene locus_tag LOCUS_00350 38916 37813 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080830.1 protein_id gnl|my_center|LOCUS_00350 39806 38913 gene locus_tag LOCUS_00360 39806 38913 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893217.1 protein_id gnl|my_center|LOCUS_00360 40681 39803 gene locus_tag LOCUS_00370 gene rfbD 40681 39803 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417101.1 protein_id gnl|my_center|LOCUS_00370 40788 42269 gene locus_tag LOCUS_00380 40788 42269 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727933.1 protein_id gnl|my_center|LOCUS_00380 42257 42991 gene locus_tag LOCUS_00390 42257 42991 CDS product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727932.1 protein_id gnl|my_center|LOCUS_00390 43431 42988 gene locus_tag LOCUS_00400 43431 42988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 43455 44321 gene locus_tag LOCUS_00410 43455 44321 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727931.1 protein_id gnl|my_center|LOCUS_00410 45512 44346 gene locus_tag LOCUS_00420 45512 44346 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893212.1 protein_id gnl|my_center|LOCUS_00420 46071 45556 gene locus_tag LOCUS_00430 gene purE 46071 45556 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877211.1 protein_id gnl|my_center|LOCUS_00430 47276 46068 gene locus_tag LOCUS_00440 47276 46068 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083453060.1 protein_id gnl|my_center|LOCUS_00440 47390 48016 gene locus_tag LOCUS_00450 47390 48016 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893209.1 protein_id gnl|my_center|LOCUS_00450 48510 48013 gene locus_tag LOCUS_00460 48510 48013 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727928.1 protein_id gnl|my_center|LOCUS_00460 48589 50013 gene locus_tag LOCUS_00470 48589 50013 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048125.1 protein_id gnl|my_center|LOCUS_00470 50050 51657 gene locus_tag LOCUS_00480 50050 51657 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893203.1 protein_id gnl|my_center|LOCUS_00480 51667 51942 gene locus_tag LOCUS_00490 51667 51942 CDS product acyl-CoA carboxylase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727925.1 protein_id gnl|my_center|LOCUS_00490 51991 52647 gene locus_tag LOCUS_00500 51991 52647 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907893.1 protein_id gnl|my_center|LOCUS_00500 52649 53533 gene locus_tag LOCUS_00510 52649 53533 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950863.1 protein_id gnl|my_center|LOCUS_00510 53530 53943 gene locus_tag LOCUS_00520 53530 53943 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727923.1 protein_id gnl|my_center|LOCUS_00520 55334 53940 gene locus_tag LOCUS_00530 55334 53940 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906341.1 protein_id gnl|my_center|LOCUS_00530 57575 55401 gene locus_tag LOCUS_00540 57575 55401 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104325.1 protein_id gnl|my_center|LOCUS_00540 57651 58943 gene locus_tag LOCUS_00550 57651 58943 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728880.1 protein_id gnl|my_center|LOCUS_00550 59010 60203 gene locus_tag LOCUS_00560 59010 60203 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728881.1 protein_id gnl|my_center|LOCUS_00560 60200 60871 gene locus_tag LOCUS_00570 gene bioD 60200 60871 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908203.1 protein_id gnl|my_center|LOCUS_00570 60874 61401 gene locus_tag LOCUS_00580 60874 61401 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728883.1 protein_id gnl|my_center|LOCUS_00580 61436 62443 gene locus_tag LOCUS_00590 gene bioB 61436 62443 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728886.1 protein_id gnl|my_center|LOCUS_00590 62443 62670 gene locus_tag LOCUS_00600 62443 62670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877604.1 protein_id gnl|my_center|LOCUS_00600 62667 63290 gene locus_tag LOCUS_00610 62667 63290 CDS product DUF2567 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728888.1 protein_id gnl|my_center|LOCUS_00610 64584 63253 gene locus_tag LOCUS_00620 64584 63253 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728889.1 protein_id gnl|my_center|LOCUS_00620 65319 64600 gene locus_tag LOCUS_00630 65319 64600 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898937.1 protein_id gnl|my_center|LOCUS_00630 65365 66420 gene locus_tag LOCUS_00640 gene nadA 65365 66420 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894588.1 protein_id gnl|my_center|LOCUS_00640 66480 67997 gene locus_tag LOCUS_00650 66480 67997 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728891.1 protein_id gnl|my_center|LOCUS_00650 67994 68851 gene locus_tag LOCUS_00660 gene nadC 67994 68851 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407935.1 protein_id gnl|my_center|LOCUS_00660 69352 68933 gene locus_tag LOCUS_00670 69352 68933 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250147.1 protein_id gnl|my_center|LOCUS_00670 69607 70920 gene locus_tag LOCUS_00680 gene hisD 69607 70920 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877610.1 protein_id gnl|my_center|LOCUS_00680 70920 72068 gene locus_tag LOCUS_00690 70920 72068 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728896.1 protein_id gnl|my_center|LOCUS_00690 72065 72721 gene locus_tag LOCUS_00700 gene hisB 72065 72721 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728897.1 protein_id gnl|my_center|LOCUS_00700 72718 73350 gene locus_tag LOCUS_00710 gene hisH 72718 73350 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894597.1 protein_id gnl|my_center|LOCUS_00710 73347 74123 gene locus_tag LOCUS_00720 gene priA 73347 74123 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407955.1 protein_id gnl|my_center|LOCUS_00720 74125 74931 gene locus_tag LOCUS_00730 74125 74931 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894599.1 protein_id gnl|my_center|LOCUS_00730 74931 75716 gene locus_tag LOCUS_00740 gene hisF 74931 75716 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898942.1 protein_id gnl|my_center|LOCUS_00740 75713 76060 gene locus_tag LOCUS_00750 gene hisI 75713 76060 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728899.1 protein_id gnl|my_center|LOCUS_00750 76544 76065 gene locus_tag LOCUS_00760 76544 76065 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894605.1 protein_id gnl|my_center|LOCUS_00760 76603 78138 gene locus_tag LOCUS_00770 76603 78138 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407977.1 protein_id gnl|my_center|LOCUS_00770 78135 78707 gene locus_tag LOCUS_00780 78135 78707 CDS product TIGR02234 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197492547.1 protein_id gnl|my_center|LOCUS_00780 78788 79606 gene locus_tag LOCUS_00790 gene trpC 78788 79606 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894608.1 protein_id gnl|my_center|LOCUS_00790 79637 80908 gene locus_tag LOCUS_00800 gene trpB 79637 80908 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728904.1 protein_id gnl|my_center|LOCUS_00800 80905 81717 gene locus_tag LOCUS_00810 gene trpA 80905 81717 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407999.1 protein_id gnl|my_center|LOCUS_00810 81714 83210 gene locus_tag LOCUS_00820 81714 83210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 83236 83826 gene locus_tag LOCUS_00830 83236 83826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 83813 84223 gene locus_tag LOCUS_00840 83813 84223 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728907.1 protein_id gnl|my_center|LOCUS_00840 84251 85669 gene locus_tag LOCUS_00850 gene pyk 84251 85669 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728910.1 protein_id gnl|my_center|LOCUS_00850 85696 86577 gene locus_tag LOCUS_00860 85696 86577 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894617.1 protein_id gnl|my_center|LOCUS_00860 87138 86593 gene locus_tag LOCUS_00870 87138 86593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 >Feature sequence002 4192 4019 gene locus_tag LOCUS_00880 4192 4019 CDS product DUF2613 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891682.1 protein_id gnl|my_center|LOCUS_00880 4354 5556 gene locus_tag LOCUS_00890 4354 5556 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908964.1 protein_id gnl|my_center|LOCUS_00890 5568 6203 gene locus_tag LOCUS_00900 5568 6203 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876752.1 protein_id gnl|my_center|LOCUS_00900 7046 6207 gene locus_tag LOCUS_00910 gene htdX 7046 6207 CDS product 3-hydroxyacyl-thioester dehydratase HtdX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401305.1 protein_id gnl|my_center|LOCUS_00910 8410 7046 gene locus_tag LOCUS_00920 8410 7046 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899869.1 protein_id gnl|my_center|LOCUS_00920 8579 9910 gene locus_tag LOCUS_00930 8579 9910 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401309.1 protein_id gnl|my_center|LOCUS_00930 11475 10108 gene locus_tag LOCUS_00940 11475 10108 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899402.1 protein_id gnl|my_center|LOCUS_00940 13384 11549 gene locus_tag LOCUS_00950 13384 11549 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401312.1 protein_id gnl|my_center|LOCUS_00950 24661 13559 gene locus_tag LOCUS_00960 24661 13559 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113356.1 protein_id gnl|my_center|LOCUS_00960 24822 26243 gene locus_tag LOCUS_00970 24822 26243 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115124.1 protein_id gnl|my_center|LOCUS_00970 26280 29276 gene locus_tag LOCUS_00980 26280 29276 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726924.1 protein_id gnl|my_center|LOCUS_00980 29273 30397 gene locus_tag LOCUS_00990 29273 30397 CDS product PE-PPE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726926.1 protein_id gnl|my_center|LOCUS_00990 31054 30410 gene locus_tag LOCUS_01000 31054 30410 CDS product GAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726927.1 protein_id gnl|my_center|LOCUS_01000 31125 31607 gene locus_tag LOCUS_01010 31125 31607 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726929.1 protein_id gnl|my_center|LOCUS_01010 32372 31620 gene locus_tag LOCUS_01020 32372 31620 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726931.1 protein_id gnl|my_center|LOCUS_01020 34316 32373 gene locus_tag LOCUS_01030 34316 32373 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726932.1 protein_id gnl|my_center|LOCUS_01030 35178 34351 gene locus_tag LOCUS_01040 35178 34351 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891739.1 protein_id gnl|my_center|LOCUS_01040 35545 35249 gene locus_tag LOCUS_01050 35545 35249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908955.1 protein_id gnl|my_center|LOCUS_01050 35830 36129 gene locus_tag LOCUS_01060 35830 36129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 36139 37401 gene locus_tag LOCUS_01070 36139 37401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 37539 37844 gene locus_tag LOCUS_01080 37539 37844 CDS product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400035.1 protein_id gnl|my_center|LOCUS_01080 37874 38161 gene locus_tag LOCUS_01090 37874 38161 CDS product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899750.1 protein_id gnl|my_center|LOCUS_01090 38243 39076 gene locus_tag LOCUS_01100 gene espG2 38243 39076 CDS product type VII secretion system ESX-2 associated protein EspG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400028.1 protein_id gnl|my_center|LOCUS_01100 39080 40066 gene locus_tag LOCUS_01110 39080 40066 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899748.1 protein_id gnl|my_center|LOCUS_01110 40066 41547 gene locus_tag LOCUS_01120 gene eccD2 40066 41547 CDS product type VII secretion system ESX-2 subunit EccD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900775.1 protein_id gnl|my_center|LOCUS_01120 41544 43103 gene locus_tag LOCUS_01130 gene mycP2 41544 43103 CDS product type VII secretion system ESX-2 serine protease mycosin MycP2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400012.1 protein_id gnl|my_center|LOCUS_01130 43100 44629 gene locus_tag LOCUS_01140 gene eccE2 43100 44629 CDS product type VII secretion system ESX-2 subunit EccE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902572.1 protein_id gnl|my_center|LOCUS_01140 44633 46483 gene locus_tag LOCUS_01150 gene eccA2 44633 46483 CDS product type VII secretion system ESX-2 AAA family ATPase EccA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003907154.1 protein_id gnl|my_center|LOCUS_01150 48172 46559 gene locus_tag LOCUS_01160 48172 46559 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731266.1 protein_id gnl|my_center|LOCUS_01160 49327 48350 gene locus_tag LOCUS_01170 49327 48350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897814.1 protein_id gnl|my_center|LOCUS_01170 49545 50783 gene locus_tag LOCUS_01180 gene glf 49545 50783 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897813.1 protein_id gnl|my_center|LOCUS_01180 50780 52729 gene locus_tag LOCUS_01190 50780 52729 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731265.1 protein_id gnl|my_center|LOCUS_01190 52722 53282 gene locus_tag LOCUS_01200 52722 53282 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897811.1 protein_id gnl|my_center|LOCUS_01200 53269 54183 gene locus_tag LOCUS_01210 53269 54183 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420788.1 protein_id gnl|my_center|LOCUS_01210 54161 56173 gene locus_tag LOCUS_01220 gene zomB 54161 56173 CDS product flagellar motor control protein ZomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496045.1 protein_id gnl|my_center|LOCUS_01220 56354 57253 gene locus_tag LOCUS_01230 56354 57253 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731260.1 protein_id gnl|my_center|LOCUS_01230 57415 57864 gene locus_tag LOCUS_01240 57415 57864 CDS product DUF732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731259.1 protein_id gnl|my_center|LOCUS_01240 57868 58893 gene locus_tag LOCUS_01250 57868 58893 CDS product cutinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731258.1 protein_id gnl|my_center|LOCUS_01250 59144 61036 gene locus_tag LOCUS_01260 gene fadD32 59144 61036 CDS product long-chain-fatty-acid--AMP ligase FadD32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731257.1 protein_id gnl|my_center|LOCUS_01260 61052 66562 gene locus_tag LOCUS_01270 gene pks13 61052 66562 CDS product polyketide synthase Pks13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878634.1 protein_id gnl|my_center|LOCUS_01270 66559 68109 gene locus_tag LOCUS_01280 66559 68109 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420767.1 protein_id gnl|my_center|LOCUS_01280 68109 68828 gene locus_tag LOCUS_01290 68109 68828 CDS product thioesterase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908858.1 protein_id gnl|my_center|LOCUS_01290 69340 71082 gene locus_tag LOCUS_01300 gene fadD26 69340 71082 CDS product long-chain-fatty-acid--AMP ligase FAAL26/FadD26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908857.1 protein_id gnl|my_center|LOCUS_01300 71079 75794 gene locus_tag LOCUS_01310 gene ppsB 71079 75794 CDS product phthiocerol type I polyketide synthase PpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414835.1 protein_id gnl|my_center|LOCUS_01310 75791 80248 gene locus_tag LOCUS_01320 gene ppsE 75791 80248 CDS product phthiocerol type I polyketide synthase PpsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904964.1 protein_id gnl|my_center|LOCUS_01320 80260 81267 gene locus_tag LOCUS_01330 80260 81267 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908851.1 protein_id gnl|my_center|LOCUS_01330 81264 82073 gene locus_tag LOCUS_01340 81264 82073 CDS product antibiotic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908850.1 protein_id gnl|my_center|LOCUS_01340 82073 82885 gene locus_tag LOCUS_01350 82073 82885 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908849.1 protein_id gnl|my_center|LOCUS_01350 82928 84175 gene locus_tag LOCUS_01360 82928 84175 CDS product phthiocerol/phthiodiolone dimycocerosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414853.1 protein_id gnl|my_center|LOCUS_01360 85604 84186 gene locus_tag LOCUS_01370 85604 84186 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729712.1 protein_id gnl|my_center|LOCUS_01370 85642 86460 gene locus_tag LOCUS_01380 85642 86460 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057728.1 protein_id gnl|my_center|LOCUS_01380 >Feature sequence003 544 795 gene locus_tag LOCUS_01390 544 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 1895 894 gene locus_tag LOCUS_01400 1895 894 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418263.1 protein_id gnl|my_center|LOCUS_01400 2341 1892 gene locus_tag LOCUS_01410 2341 1892 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144317.1 protein_id gnl|my_center|LOCUS_01410 2983 2399 gene locus_tag LOCUS_01420 2983 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 3284 3961 gene locus_tag LOCUS_01430 3284 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 3958 4716 gene locus_tag LOCUS_01440 3958 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 5103 5681 gene locus_tag LOCUS_01450 5103 5681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 6279 5707 gene locus_tag LOCUS_01460 6279 5707 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383033.1 protein_id gnl|my_center|LOCUS_01460 6824 6288 gene locus_tag LOCUS_01470 6824 6288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 8309 7125 gene locus_tag LOCUS_01480 8309 7125 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209912946.1 protein_id gnl|my_center|LOCUS_01480 8885 8583 gene locus_tag LOCUS_01490 8885 8583 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110276.1 protein_id gnl|my_center|LOCUS_01490 9238 8882 gene locus_tag LOCUS_01500 9238 8882 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296467.1 protein_id gnl|my_center|LOCUS_01500 9859 10242 gene locus_tag LOCUS_01510 9859 10242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 10634 11917 gene locus_tag LOCUS_01520 gene lysA 10634 11917 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280659.1 protein_id gnl|my_center|LOCUS_01520 12047 12397 gene locus_tag LOCUS_01530 12047 12397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 12477 12890 gene locus_tag LOCUS_01540 12477 12890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 12930 13352 gene locus_tag LOCUS_01550 12930 13352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 13799 13416 gene locus_tag LOCUS_01560 13799 13416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083117.1 protein_id gnl|my_center|LOCUS_01560 14539 13937 gene locus_tag LOCUS_01570 14539 13937 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729205.1 protein_id gnl|my_center|LOCUS_01570 14662 15162 gene locus_tag LOCUS_01580 14662 15162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727170.1 protein_id gnl|my_center|LOCUS_01580 15405 16469 gene locus_tag LOCUS_01590 15405 16469 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036621.1 protein_id gnl|my_center|LOCUS_01590 16479 18539 gene locus_tag LOCUS_01600 16479 18539 CDS product serine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259150.1 protein_id gnl|my_center|LOCUS_01600 19129 18563 gene locus_tag LOCUS_01610 19129 18563 CDS product CIA30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123297.1 protein_id gnl|my_center|LOCUS_01610 19264 20718 gene locus_tag LOCUS_01620 19264 20718 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900866.1 protein_id gnl|my_center|LOCUS_01620 20757 21833 gene locus_tag LOCUS_01630 20757 21833 CDS product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641745.1 protein_id gnl|my_center|LOCUS_01630 22826 21900 gene locus_tag LOCUS_01640 22826 21900 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627713.1 protein_id gnl|my_center|LOCUS_01640 23102 22941 gene locus_tag LOCUS_01650 23102 22941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 24445 23147 gene locus_tag LOCUS_01660 24445 23147 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803904.1 protein_id gnl|my_center|LOCUS_01660 25256 24516 gene locus_tag LOCUS_01670 25256 24516 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728469.1 protein_id gnl|my_center|LOCUS_01670 26032 25253 gene locus_tag LOCUS_01680 gene cbiQ 26032 25253 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893990.1 protein_id gnl|my_center|LOCUS_01680 26399 26034 gene locus_tag LOCUS_01690 26399 26034 CDS product PDGLE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728468.1 protein_id gnl|my_center|LOCUS_01690 27076 26396 gene locus_tag LOCUS_01700 27076 26396 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104219.1 protein_id gnl|my_center|LOCUS_01700 27500 27177 gene locus_tag LOCUS_01710 27500 27177 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877443.1 protein_id gnl|my_center|LOCUS_01710 28540 27584 gene locus_tag LOCUS_01720 28540 27584 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079944.1 protein_id gnl|my_center|LOCUS_01720 30068 28728 gene locus_tag LOCUS_01730 30068 28728 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992247.1 protein_id gnl|my_center|LOCUS_01730 31074 30010 gene locus_tag LOCUS_01740 31074 30010 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049749196.1 protein_id gnl|my_center|LOCUS_01740 31179 32405 gene locus_tag LOCUS_01750 31179 32405 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730738.1 protein_id gnl|my_center|LOCUS_01750 32489 34249 gene locus_tag LOCUS_01760 32489 34249 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083824.1 protein_id gnl|my_center|LOCUS_01760 34585 34262 gene locus_tag LOCUS_01770 34585 34262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 34629 37664 gene locus_tag LOCUS_01780 34629 37664 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_01780 38911 37661 gene locus_tag LOCUS_01790 38911 37661 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544355.1 protein_id gnl|my_center|LOCUS_01790 39043 39879 gene locus_tag LOCUS_01800 39043 39879 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728763.1 protein_id gnl|my_center|LOCUS_01800 40612 39887 gene locus_tag LOCUS_01810 40612 39887 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809659.1 protein_id gnl|my_center|LOCUS_01810 41874 40609 gene locus_tag LOCUS_01820 41874 40609 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072408.1 protein_id gnl|my_center|LOCUS_01820 41963 43303 gene locus_tag LOCUS_01830 41963 43303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 44476 43316 gene locus_tag LOCUS_01840 44476 43316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 44708 47239 gene locus_tag LOCUS_01850 44708 47239 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112283.1 protein_id gnl|my_center|LOCUS_01850 48151 47249 gene locus_tag LOCUS_01860 48151 47249 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729157.1 protein_id gnl|my_center|LOCUS_01860 49666 48173 gene locus_tag LOCUS_01870 49666 48173 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899182.1 protein_id gnl|my_center|LOCUS_01870 49893 49663 gene locus_tag LOCUS_01880 49893 49663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 50042 53434 gene locus_tag LOCUS_01890 50042 53434 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728760.1 protein_id gnl|my_center|LOCUS_01890 53510 56191 gene locus_tag LOCUS_01900 53510 56191 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728761.1 protein_id gnl|my_center|LOCUS_01900 56188 57120 gene locus_tag LOCUS_01910 56188 57120 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728762.1 protein_id gnl|my_center|LOCUS_01910 57113 58171 gene locus_tag LOCUS_01920 57113 58171 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894400.1 protein_id gnl|my_center|LOCUS_01920 58708 58157 gene locus_tag LOCUS_01930 58708 58157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 60402 58846 gene locus_tag LOCUS_01940 60402 58846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 60476 60799 gene locus_tag LOCUS_01950 60476 60799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 60869 61771 gene locus_tag LOCUS_01960 60869 61771 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908749.1 protein_id gnl|my_center|LOCUS_01960 61797 62579 gene locus_tag LOCUS_01970 gene deoC 61797 62579 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436656.1 protein_id gnl|my_center|LOCUS_01970 62579 64240 gene locus_tag LOCUS_01980 62579 64240 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495362.1 protein_id gnl|my_center|LOCUS_01980 65220 64474 gene locus_tag LOCUS_01990 65220 64474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01990 65827 65117 gene locus_tag LOCUS_02000 65827 65117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02000 66243 65824 gene locus_tag LOCUS_02010 66243 65824 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908747.1 protein_id gnl|my_center|LOCUS_02010 66423 68198 gene locus_tag LOCUS_02020 66423 68198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 68739 68200 gene locus_tag LOCUS_02030 68739 68200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411608.1 protein_id gnl|my_center|LOCUS_02030 68978 68727 gene locus_tag LOCUS_02040 68978 68727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 69329 69132 gene locus_tag LOCUS_02050 69329 69132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 70790 69384 gene locus_tag LOCUS_02060 70790 69384 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891985.1 protein_id gnl|my_center|LOCUS_02060 71661 70834 gene locus_tag LOCUS_02070 71661 70834 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109004014.1 protein_id gnl|my_center|LOCUS_02070 72281 74446 gene locus_tag LOCUS_02080 72281 74446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 74473 75255 gene locus_tag LOCUS_02090 74473 75255 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854724.1 protein_id gnl|my_center|LOCUS_02090 76214 75252 gene locus_tag LOCUS_02100 76214 75252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 76291 77103 gene locus_tag LOCUS_02110 76291 77103 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728691.1 protein_id gnl|my_center|LOCUS_02110 79385 77100 gene locus_tag LOCUS_02120 gene aceA 79385 77100 CDS product isocitrate lyase ICL2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729276.1 protein_id gnl|my_center|LOCUS_02120 >Feature sequence004 610 53 gene locus_tag LOCUS_02130 610 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 1683 934 gene locus_tag LOCUS_02140 1683 934 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227392.1 protein_id gnl|my_center|LOCUS_02140 2469 1717 gene locus_tag LOCUS_02150 2469 1717 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227393.1 protein_id gnl|my_center|LOCUS_02150 2809 2588 gene locus_tag LOCUS_02160 2809 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 3657 3112 gene locus_tag LOCUS_02170 3657 3112 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224856.1 protein_id gnl|my_center|LOCUS_02170 3791 6049 gene locus_tag LOCUS_02180 3791 6049 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899808.1 protein_id gnl|my_center|LOCUS_02180 6056 6271 gene locus_tag LOCUS_02190 6056 6271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 8204 6282 gene locus_tag LOCUS_02200 8204 6282 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908669.1 protein_id gnl|my_center|LOCUS_02200 8320 8970 gene locus_tag LOCUS_02210 8320 8970 CDS product DUF5134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898666.1 protein_id gnl|my_center|LOCUS_02210 9703 8981 gene locus_tag LOCUS_02220 9703 8981 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899809.1 protein_id gnl|my_center|LOCUS_02220 9980 9771 gene locus_tag LOCUS_02230 9980 9771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 9871 10305 gene locus_tag LOCUS_02240 9871 10305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 10391 12235 gene locus_tag LOCUS_02250 10391 12235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 12316 13455 gene locus_tag LOCUS_02260 12316 13455 CDS product acyl-protein synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112567.1 protein_id gnl|my_center|LOCUS_02260 13459 13860 gene locus_tag LOCUS_02270 13459 13860 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079675.1 protein_id gnl|my_center|LOCUS_02270 13853 15022 gene locus_tag LOCUS_02280 13853 15022 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112565.1 protein_id gnl|my_center|LOCUS_02280 15019 16122 gene locus_tag LOCUS_02290 15019 16122 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112563.1 protein_id gnl|my_center|LOCUS_02290 16132 16893 gene locus_tag LOCUS_02300 16132 16893 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095617.1 protein_id gnl|my_center|LOCUS_02300 17627 16899 gene locus_tag LOCUS_02310 17627 16899 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813919.1 protein_id gnl|my_center|LOCUS_02310 17657 18763 gene locus_tag LOCUS_02320 17657 18763 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112563.1 protein_id gnl|my_center|LOCUS_02320 18775 19071 gene locus_tag LOCUS_02330 18775 19071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 19068 20744 gene locus_tag LOCUS_02340 19068 20744 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005133958.1 protein_id gnl|my_center|LOCUS_02340 21619 20720 gene locus_tag LOCUS_02350 21619 20720 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223699.1 protein_id gnl|my_center|LOCUS_02350 22728 21616 gene locus_tag LOCUS_02360 22728 21616 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191279629.1 protein_id gnl|my_center|LOCUS_02360 23881 22775 gene locus_tag LOCUS_02370 23881 22775 CDS product NADPH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950854.1 protein_id gnl|my_center|LOCUS_02370 23967 25172 gene locus_tag LOCUS_02380 23967 25172 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223659.1 protein_id gnl|my_center|LOCUS_02380 25169 26083 gene locus_tag LOCUS_02390 25169 26083 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892442.1 protein_id gnl|my_center|LOCUS_02390 26106 26333 gene locus_tag LOCUS_02400 26106 26333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 26330 26707 gene locus_tag LOCUS_02410 26330 26707 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727560.1 protein_id gnl|my_center|LOCUS_02410 26782 27471 gene locus_tag LOCUS_02420 26782 27471 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256276.1 protein_id gnl|my_center|LOCUS_02420 27645 28892 gene locus_tag LOCUS_02430 27645 28892 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404404.1 protein_id gnl|my_center|LOCUS_02430 28933 30453 gene locus_tag LOCUS_02440 28933 30453 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727782.1 protein_id gnl|my_center|LOCUS_02440 30539 31840 gene locus_tag LOCUS_02450 30539 31840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 33106 31847 gene locus_tag LOCUS_02460 33106 31847 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227558.1 protein_id gnl|my_center|LOCUS_02460 33216 33458 gene locus_tag LOCUS_02470 33216 33458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 33468 34172 gene locus_tag LOCUS_02480 33468 34172 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411707.1 protein_id gnl|my_center|LOCUS_02480 34306 35457 gene locus_tag LOCUS_02490 gene cax 34306 35457 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967349.1 protein_id gnl|my_center|LOCUS_02490 35529 36164 gene locus_tag LOCUS_02500 35529 36164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 37594 36161 gene locus_tag LOCUS_02510 37594 36161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 39595 37595 gene locus_tag LOCUS_02520 39595 37595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 40234 39836 gene locus_tag LOCUS_02530 40234 39836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 40671 40222 gene locus_tag LOCUS_02540 40671 40222 CDS product DUF5078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877718.1 protein_id gnl|my_center|LOCUS_02540 40730 41065 gene locus_tag LOCUS_02550 40730 41065 CDS product DUF732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894938.1 protein_id gnl|my_center|LOCUS_02550 41818 41078 gene locus_tag LOCUS_02560 41818 41078 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729763.1 protein_id gnl|my_center|LOCUS_02560 41951 43090 gene locus_tag LOCUS_02570 41951 43090 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225925.1 protein_id gnl|my_center|LOCUS_02570 43118 44647 gene locus_tag LOCUS_02580 gene crtI 43118 44647 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728283.1 protein_id gnl|my_center|LOCUS_02580 44644 45567 gene locus_tag LOCUS_02590 44644 45567 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728282.1 protein_id gnl|my_center|LOCUS_02590 45632 46360 gene locus_tag LOCUS_02600 45632 46360 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225920.1 protein_id gnl|my_center|LOCUS_02600 46371 47912 gene locus_tag LOCUS_02610 46371 47912 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877361.1 protein_id gnl|my_center|LOCUS_02610 47912 48922 gene locus_tag LOCUS_02620 47912 48922 CDS product DUF5914 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728280.1 protein_id gnl|my_center|LOCUS_02620 48924 49997 gene locus_tag LOCUS_02630 48924 49997 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250320.1 protein_id gnl|my_center|LOCUS_02630 49994 50839 gene locus_tag LOCUS_02640 49994 50839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 51954 50872 gene locus_tag LOCUS_02650 51954 50872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729753.1 protein_id gnl|my_center|LOCUS_02650 52195 51959 gene locus_tag LOCUS_02660 52195 51959 CDS product lipopolysaccharide assembly protein LapA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729752.1 protein_id gnl|my_center|LOCUS_02660 52666 52349 gene locus_tag LOCUS_02670 52666 52349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 52679 53800 gene locus_tag LOCUS_02680 52679 53800 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900742.1 protein_id gnl|my_center|LOCUS_02680 54437 53811 gene locus_tag LOCUS_02690 54437 53811 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089210.1 protein_id gnl|my_center|LOCUS_02690 55519 54434 gene locus_tag LOCUS_02700 55519 54434 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729747.1 protein_id gnl|my_center|LOCUS_02700 56409 55531 gene locus_tag LOCUS_02710 gene qqlR 56409 55531 CDS product N-acyl homoserine lactonase QqlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886818.1 protein_id gnl|my_center|LOCUS_02710 56476 57111 gene locus_tag LOCUS_02720 56476 57111 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974075.1 protein_id gnl|my_center|LOCUS_02720 57121 57948 gene locus_tag LOCUS_02730 57121 57948 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411619.1 protein_id gnl|my_center|LOCUS_02730 58018 58569 gene locus_tag LOCUS_02740 58018 58569 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899235.1 protein_id gnl|my_center|LOCUS_02740 58618 59964 gene locus_tag LOCUS_02750 58618 59964 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112318.1 protein_id gnl|my_center|LOCUS_02750 61424 59961 gene locus_tag LOCUS_02760 61424 59961 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900464.1 protein_id gnl|my_center|LOCUS_02760 62356 61433 gene locus_tag LOCUS_02770 62356 61433 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729742.1 protein_id gnl|my_center|LOCUS_02770 63966 62353 gene locus_tag LOCUS_02780 63966 62353 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729741.1 protein_id gnl|my_center|LOCUS_02780 63984 64568 gene locus_tag LOCUS_02790 63984 64568 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895728.1 protein_id gnl|my_center|LOCUS_02790 64561 66099 gene locus_tag LOCUS_02800 64561 66099 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729740.1 protein_id gnl|my_center|LOCUS_02800 67626 66184 gene locus_tag LOCUS_02810 67626 66184 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900487.1 protein_id gnl|my_center|LOCUS_02810 68902 67649 gene locus_tag LOCUS_02820 gene kasB 68902 67649 CDS product 3-oxoacyl-ACP synthase KasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729737.1 protein_id gnl|my_center|LOCUS_02820 70138 68930 gene locus_tag LOCUS_02830 gene kasA 70138 68930 CDS product 3-oxoacyl-ACP synthase KasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729736.1 protein_id gnl|my_center|LOCUS_02830 70470 70177 gene locus_tag LOCUS_02840 gene acpM 70470 70177 CDS product meromycolate extension acyl carrier protein AcpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895721.1 protein_id gnl|my_center|LOCUS_02840 71452 70544 gene locus_tag LOCUS_02850 71452 70544 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878004.1 protein_id gnl|my_center|LOCUS_02850 72505 71579 gene locus_tag LOCUS_02860 72505 71579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 >Feature sequence005 932 2368 gene locus_tag LOCUS_02870 932 2368 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891776.1 protein_id gnl|my_center|LOCUS_02870 2373 2810 gene locus_tag LOCUS_02880 gene dtd 2373 2810 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409533.1 protein_id gnl|my_center|LOCUS_02880 2946 3509 gene locus_tag LOCUS_02890 2946 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408792.1 protein_id gnl|my_center|LOCUS_02890 4580 3513 gene locus_tag LOCUS_02900 4580 3513 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729254.1 protein_id gnl|my_center|LOCUS_02900 5482 4583 gene locus_tag LOCUS_02910 5482 4583 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729253.1 protein_id gnl|my_center|LOCUS_02910 5958 5551 gene locus_tag LOCUS_02920 5958 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 7569 6052 gene locus_tag LOCUS_02930 7569 6052 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484182.1 protein_id gnl|my_center|LOCUS_02930 7683 9761 gene locus_tag LOCUS_02940 7683 9761 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877752.1 protein_id gnl|my_center|LOCUS_02940 9758 11167 gene locus_tag LOCUS_02950 9758 11167 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729175.1 protein_id gnl|my_center|LOCUS_02950 11639 11169 gene locus_tag LOCUS_02960 11639 11169 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420437.1 protein_id gnl|my_center|LOCUS_02960 13781 11643 gene locus_tag LOCUS_02970 gene malQ 13781 11643 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408795.1 protein_id gnl|my_center|LOCUS_02970 14082 13813 gene locus_tag LOCUS_02980 14082 13813 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895125.1 protein_id gnl|my_center|LOCUS_02980 13967 14197 gene locus_tag LOCUS_02990 13967 14197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 14474 14136 gene locus_tag LOCUS_03000 14474 14136 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729249.1 protein_id gnl|my_center|LOCUS_03000 14523 15458 gene locus_tag LOCUS_03010 14523 15458 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895122.1 protein_id gnl|my_center|LOCUS_03010 15464 15949 gene locus_tag LOCUS_03020 15464 15949 CDS product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729245.1 protein_id gnl|my_center|LOCUS_03020 15954 16718 gene locus_tag LOCUS_03030 15954 16718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 16728 18155 gene locus_tag LOCUS_03040 16728 18155 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729243.1 protein_id gnl|my_center|LOCUS_03040 18259 18816 gene locus_tag LOCUS_03050 18259 18816 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079331.1 protein_id gnl|my_center|LOCUS_03050 18966 19676 gene locus_tag LOCUS_03060 18966 19676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729241.1 protein_id gnl|my_center|LOCUS_03060 19722 21185 gene locus_tag LOCUS_03070 19722 21185 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409207.1 protein_id gnl|my_center|LOCUS_03070 23092 21182 gene locus_tag LOCUS_03080 23092 21182 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729236.1 protein_id gnl|my_center|LOCUS_03080 25058 23142 gene locus_tag LOCUS_03090 gene bacA 25058 23142 CDS product vitamin B12 ABC transporter ATP-binding protein BacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900416.1 protein_id gnl|my_center|LOCUS_03090 25148 26791 gene locus_tag LOCUS_03100 25148 26791 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409218.1 protein_id gnl|my_center|LOCUS_03100 26881 29202 gene locus_tag LOCUS_03110 gene secA2 26881 29202 CDS product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409221.1 protein_id gnl|my_center|LOCUS_03110 29235 29807 gene locus_tag LOCUS_03120 29235 29807 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877775.1 protein_id gnl|my_center|LOCUS_03120 29929 30321 gene locus_tag LOCUS_03130 gene gcvH 29929 30321 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895104.1 protein_id gnl|my_center|LOCUS_03130 30493 30978 gene locus_tag LOCUS_03140 30493 30978 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877774.1 protein_id gnl|my_center|LOCUS_03140 30978 31706 gene locus_tag LOCUS_03150 30978 31706 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908704.1 protein_id gnl|my_center|LOCUS_03150 31745 32257 gene locus_tag LOCUS_03160 31745 32257 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058539.1 protein_id gnl|my_center|LOCUS_03160 32491 33123 gene locus_tag LOCUS_03170 32491 33123 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409244.1 protein_id gnl|my_center|LOCUS_03170 33426 36269 gene locus_tag LOCUS_03180 gene gcvP 33426 36269 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900418.1 protein_id gnl|my_center|LOCUS_03180 36266 37168 gene locus_tag LOCUS_03190 36266 37168 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409255.1 protein_id gnl|my_center|LOCUS_03190 38934 37165 gene locus_tag LOCUS_03200 38934 37165 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901265.1 protein_id gnl|my_center|LOCUS_03200 41118 38938 gene locus_tag LOCUS_03210 41118 38938 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877772.1 protein_id gnl|my_center|LOCUS_03210 42075 41149 gene locus_tag LOCUS_03220 42075 41149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729223.1 protein_id gnl|my_center|LOCUS_03220 43123 42068 gene locus_tag LOCUS_03230 43123 42068 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079371.1 protein_id gnl|my_center|LOCUS_03230 44487 43123 gene locus_tag LOCUS_03240 44487 43123 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877770.1 protein_id gnl|my_center|LOCUS_03240 46139 44691 gene locus_tag LOCUS_03250 46139 44691 CDS product GuaB1 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729218.1 protein_id gnl|my_center|LOCUS_03250 47698 46247 gene locus_tag LOCUS_03260 gene gndA 47698 46247 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729217.1 protein_id gnl|my_center|LOCUS_03260 48686 47760 gene locus_tag LOCUS_03270 48686 47760 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729216.1 protein_id gnl|my_center|LOCUS_03270 49919 48792 gene locus_tag LOCUS_03280 49919 48792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 50742 50353 gene locus_tag LOCUS_03290 gene blaI 50742 50353 CDS product transcriptional repressor BlaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409301.1 protein_id gnl|my_center|LOCUS_03290 50889 51302 gene locus_tag LOCUS_03300 50889 51302 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877767.1 protein_id gnl|my_center|LOCUS_03300 52675 51308 gene locus_tag LOCUS_03310 52675 51308 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894180.1 protein_id gnl|my_center|LOCUS_03310 52922 52737 gene locus_tag LOCUS_03320 52922 52737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 54350 52977 gene locus_tag LOCUS_03330 54350 52977 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895076.1 protein_id gnl|my_center|LOCUS_03330 55340 54435 gene locus_tag LOCUS_03340 55340 54435 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895075.1 protein_id gnl|my_center|LOCUS_03340 55412 56227 gene locus_tag LOCUS_03350 55412 56227 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409329.1 protein_id gnl|my_center|LOCUS_03350 56220 57311 gene locus_tag LOCUS_03360 56220 57311 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899051.1 protein_id gnl|my_center|LOCUS_03360 >Feature sequence006 <1 789 gene locus_tag LOCUS_03370 <1 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003895868.1:PhoH family protein 797 1330 gene locus_tag LOCUS_03380 gene ybeY 797 1330 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895867.1 protein_id gnl|my_center|LOCUS_03380 1327 2622 gene locus_tag LOCUS_03390 1327 2622 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895866.1 protein_id gnl|my_center|LOCUS_03390 2619 3539 gene locus_tag LOCUS_03400 gene era 2619 3539 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895864.1 protein_id gnl|my_center|LOCUS_03400 3587 4408 gene locus_tag LOCUS_03410 gene recO 3587 4408 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412222.1 protein_id gnl|my_center|LOCUS_03410 4368 5282 gene locus_tag LOCUS_03420 4368 5282 CDS product decaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729873.1 protein_id gnl|my_center|LOCUS_03420 5282 5677 gene locus_tag LOCUS_03430 5282 5677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906807.1 protein_id gnl|my_center|LOCUS_03430 6096 5674 gene locus_tag LOCUS_03440 gene zur 6096 5674 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903860.1 protein_id gnl|my_center|LOCUS_03440 6214 7611 gene locus_tag LOCUS_03450 6214 7611 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729870.1 protein_id gnl|my_center|LOCUS_03450 9614 7608 gene locus_tag LOCUS_03460 9614 7608 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729869.1 protein_id gnl|my_center|LOCUS_03460 9710 10987 gene locus_tag LOCUS_03470 9710 10987 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895838.1 protein_id gnl|my_center|LOCUS_03470 10997 12919 gene locus_tag LOCUS_03480 gene dnaG 10997 12919 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729868.1 protein_id gnl|my_center|LOCUS_03480 12967 13287 gene locus_tag LOCUS_03490 12967 13287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510586.1 protein_id gnl|my_center|LOCUS_03490 13526 13284 gene locus_tag LOCUS_03500 13526 13284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895835.1 protein_id gnl|my_center|LOCUS_03500 13650 13725 gene locus_tag LOCUS_t00020 13650 13725 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 13699 14091 gene locus_tag LOCUS_03510 13699 14091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 14165 15031 gene locus_tag LOCUS_03520 14165 15031 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768336.1 protein_id gnl|my_center|LOCUS_03520 15163 17145 gene locus_tag LOCUS_03530 15163 17145 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411969.1 protein_id gnl|my_center|LOCUS_03530 17142 17960 gene locus_tag LOCUS_03540 17142 17960 CDS product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411966.1 protein_id gnl|my_center|LOCUS_03540 19301 17985 gene locus_tag LOCUS_03550 19301 17985 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411947.1 protein_id gnl|my_center|LOCUS_03550 20124 19312 gene locus_tag LOCUS_03560 20124 19312 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878045.1 protein_id gnl|my_center|LOCUS_03560 21954 21082 gene locus_tag LOCUS_03570 21954 21082 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411940.1 protein_id gnl|my_center|LOCUS_03570 21989 23512 gene locus_tag LOCUS_03580 21989 23512 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729853.1 protein_id gnl|my_center|LOCUS_03580 23509 24882 gene locus_tag LOCUS_03590 23509 24882 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899270.1 protein_id gnl|my_center|LOCUS_03590 24915 25181 gene locus_tag LOCUS_03600 24915 25181 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410814.1 protein_id gnl|my_center|LOCUS_03600 25178 25615 gene locus_tag LOCUS_03610 25178 25615 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410811.1 protein_id gnl|my_center|LOCUS_03610 25619 25843 gene locus_tag LOCUS_03620 25619 25843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 25873 25947 gene locus_tag LOCUS_t00030 25873 25947 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 26471 27292 gene locus_tag LOCUS_03630 26471 27292 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082640.1 protein_id gnl|my_center|LOCUS_03630 27606 27352 gene locus_tag LOCUS_03640 gene rpsR 27606 27352 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897466.1 protein_id gnl|my_center|LOCUS_03640 27918 27613 gene locus_tag LOCUS_03650 gene rpsN 27918 27613 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897467.1 protein_id gnl|my_center|LOCUS_03650 28084 27920 gene locus_tag LOCUS_03660 gene rpmG 28084 27920 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410628.1 protein_id gnl|my_center|LOCUS_03660 28269 28084 gene locus_tag LOCUS_03670 gene rpmB 28269 28084 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410631.1 protein_id gnl|my_center|LOCUS_03670 28431 29633 gene locus_tag LOCUS_03680 28431 29633 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878548.1 protein_id gnl|my_center|LOCUS_03680 29630 29962 gene locus_tag LOCUS_03690 gene mhuD 29630 29962 CDS product mycobilin-forming heme oxygenase MhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731028.1 protein_id gnl|my_center|LOCUS_03690 30422 30081 gene locus_tag LOCUS_03700 30422 30081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 30739 30446 gene locus_tag LOCUS_03710 30739 30446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226834.1 protein_id gnl|my_center|LOCUS_03710 31319 31573 gene locus_tag LOCUS_03720 31319 31573 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975406.1 protein_id gnl|my_center|LOCUS_03720 31637 32482 gene locus_tag LOCUS_03730 31637 32482 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402432.1 protein_id gnl|my_center|LOCUS_03730 32609 33571 gene locus_tag LOCUS_03740 32609 33571 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976297.1 protein_id gnl|my_center|LOCUS_03740 33556 33858 gene locus_tag LOCUS_03750 33556 33858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 33842 34840 gene locus_tag LOCUS_03760 33842 34840 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193905664.1 protein_id gnl|my_center|LOCUS_03760 34879 35847 gene locus_tag LOCUS_03770 34879 35847 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140538.1 protein_id gnl|my_center|LOCUS_03770 35844 36581 gene locus_tag LOCUS_03780 35844 36581 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929259.1 protein_id gnl|my_center|LOCUS_03780 36599 37444 gene locus_tag LOCUS_03790 36599 37444 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888911.1 protein_id gnl|my_center|LOCUS_03790 37458 37694 gene locus_tag LOCUS_03800 37458 37694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 38811 38173 gene locus_tag LOCUS_03810 38811 38173 CDS product Fic/DOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899616.1 protein_id gnl|my_center|LOCUS_03810 39011 38823 gene locus_tag LOCUS_03820 39011 38823 CDS product antitoxin VbhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419627.1 protein_id gnl|my_center|LOCUS_03820 39504 39118 gene locus_tag LOCUS_03830 39504 39118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 39775 39933 gene locus_tag LOCUS_03840 39775 39933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 41039 40032 gene locus_tag LOCUS_03850 41039 40032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 41607 41071 gene locus_tag LOCUS_03860 41607 41071 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223758.1 protein_id gnl|my_center|LOCUS_03860 42728 41610 gene locus_tag LOCUS_03870 42728 41610 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223762.1 protein_id gnl|my_center|LOCUS_03870 44571 42760 gene locus_tag LOCUS_03880 44571 42760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 46154 44568 gene locus_tag LOCUS_03890 46154 44568 CDS product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727775.1 protein_id gnl|my_center|LOCUS_03890 46357 46554 gene locus_tag LOCUS_03900 46357 46554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 46576 47403 gene locus_tag LOCUS_03910 46576 47403 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088901.1 protein_id gnl|my_center|LOCUS_03910 47403 50123 gene locus_tag LOCUS_03920 47403 50123 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088902.1 protein_id gnl|my_center|LOCUS_03920 51113 50175 gene locus_tag LOCUS_03930 51113 50175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 52535 51120 gene locus_tag LOCUS_03940 52535 51120 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061359.1 protein_id gnl|my_center|LOCUS_03940 52699 54126 gene locus_tag LOCUS_03950 52699 54126 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296612.1 protein_id gnl|my_center|LOCUS_03950 54563 55642 gene locus_tag LOCUS_03960 54563 55642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 >Feature sequence007 2275 1322 gene locus_tag LOCUS_03970 2275 1322 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878394.1 protein_id gnl|my_center|LOCUS_03970 2524 2303 gene locus_tag LOCUS_03980 2524 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 2600 4864 gene locus_tag LOCUS_03990 2600 4864 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730625.1 protein_id gnl|my_center|LOCUS_03990 5114 4875 gene locus_tag LOCUS_04000 5114 4875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 6557 5199 gene locus_tag LOCUS_04010 6557 5199 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113389.1 protein_id gnl|my_center|LOCUS_04010 8042 6639 gene locus_tag LOCUS_04020 8042 6639 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115126.1 protein_id gnl|my_center|LOCUS_04020 9944 8052 gene locus_tag LOCUS_04030 9944 8052 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896800.1 protein_id gnl|my_center|LOCUS_04030 10841 9972 gene locus_tag LOCUS_04040 10841 9972 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079434.1 protein_id gnl|my_center|LOCUS_04040 11350 10874 gene locus_tag LOCUS_04050 11350 10874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225541.1 protein_id gnl|my_center|LOCUS_04050 11395 13692 gene locus_tag LOCUS_04060 11395 13692 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026895.1 protein_id gnl|my_center|LOCUS_04060 13699 14862 gene locus_tag LOCUS_04070 13699 14862 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986828.1 protein_id gnl|my_center|LOCUS_04070 14873 15607 gene locus_tag LOCUS_04080 gene cobF 14873 15607 CDS product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896950.1 protein_id gnl|my_center|LOCUS_04080 15621 16022 gene locus_tag LOCUS_04090 15621 16022 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409542.1 protein_id gnl|my_center|LOCUS_04090 16036 16890 gene locus_tag LOCUS_04100 16036 16890 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730610.1 protein_id gnl|my_center|LOCUS_04100 16905 17651 gene locus_tag LOCUS_04110 16905 17651 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404829.1 protein_id gnl|my_center|LOCUS_04110 17678 17953 gene locus_tag LOCUS_04120 17678 17953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878369.1 protein_id gnl|my_center|LOCUS_04120 19686 18037 gene locus_tag LOCUS_04130 gene pgi 19686 18037 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730607.1 protein_id gnl|my_center|LOCUS_04130 19763 21193 gene locus_tag LOCUS_04140 19763 21193 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730606.1 protein_id gnl|my_center|LOCUS_04140 21544 21287 gene locus_tag LOCUS_04150 21544 21287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 21802 24132 gene locus_tag LOCUS_04160 gene pcrA 21802 24132 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404859.1 protein_id gnl|my_center|LOCUS_04160 25109 24171 gene locus_tag LOCUS_04170 25109 24171 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878362.1 protein_id gnl|my_center|LOCUS_04170 25349 26524 gene locus_tag LOCUS_04180 gene sucC 25349 26524 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730595.1 protein_id gnl|my_center|LOCUS_04180 26528 27430 gene locus_tag LOCUS_04190 gene sucD 26528 27430 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896926.1 protein_id gnl|my_center|LOCUS_04190 27427 28956 gene locus_tag LOCUS_04200 27427 28956 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730593.1 protein_id gnl|my_center|LOCUS_04200 29887 29039 gene locus_tag LOCUS_04210 29887 29039 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896922.1 protein_id gnl|my_center|LOCUS_04210 30027 30794 gene locus_tag LOCUS_04220 30027 30794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 30826 32265 gene locus_tag LOCUS_04230 30826 32265 CDS product DUF6350 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730590.1 protein_id gnl|my_center|LOCUS_04230 32276 32917 gene locus_tag LOCUS_04240 gene purN 32276 32917 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878360.1 protein_id gnl|my_center|LOCUS_04240 32914 34518 gene locus_tag LOCUS_04250 gene purH 32914 34518 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730588.1 protein_id gnl|my_center|LOCUS_04250 34651 36039 gene locus_tag LOCUS_04260 34651 36039 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404892.1 protein_id gnl|my_center|LOCUS_04260 36032 38017 gene locus_tag LOCUS_04270 36032 38017 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730584.1 protein_id gnl|my_center|LOCUS_04270 38307 39575 gene locus_tag LOCUS_04280 38307 39575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 40214 39630 gene locus_tag LOCUS_04290 40214 39630 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907573.1 protein_id gnl|my_center|LOCUS_04290 40341 40685 gene locus_tag LOCUS_04300 40341 40685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413177.1 protein_id gnl|my_center|LOCUS_04300 41452 40682 gene locus_tag LOCUS_04310 41452 40682 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404949.1 protein_id gnl|my_center|LOCUS_04310 42618 41452 gene locus_tag LOCUS_04320 42618 41452 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730571.1 protein_id gnl|my_center|LOCUS_04320 44609 42615 gene locus_tag LOCUS_04330 44609 42615 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900244.1 protein_id gnl|my_center|LOCUS_04330 46228 44633 gene locus_tag LOCUS_04340 46228 44633 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896889.1 protein_id gnl|my_center|LOCUS_04340 47403 46225 gene locus_tag LOCUS_04350 47403 46225 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898670.1 protein_id gnl|my_center|LOCUS_04350 49112 47400 gene locus_tag LOCUS_04360 49112 47400 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404960.1 protein_id gnl|my_center|LOCUS_04360 49359 49532 gene locus_tag LOCUS_04370 gene rpmF 49359 49532 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896886.1 protein_id gnl|my_center|LOCUS_04370 49602 50303 gene locus_tag LOCUS_04380 49602 50303 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063392.1 protein_id gnl|my_center|LOCUS_04380 50347 51891 gene locus_tag LOCUS_04390 gene mprB 50347 51891 CDS product two-component system sensor histidine kinase MprB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405123.1 protein_id gnl|my_center|LOCUS_04390 51560 51646 gene locus_tag LOCUS_t00040 51560 51646 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 51961 53316 gene locus_tag LOCUS_04400 51961 53316 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730565.1 protein_id gnl|my_center|LOCUS_04400 53313 53894 gene locus_tag LOCUS_04410 53313 53894 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162234095.1 protein_id gnl|my_center|LOCUS_04410 >Feature sequence008 1687 584 gene locus_tag LOCUS_04420 1687 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413610.1 protein_id gnl|my_center|LOCUS_04420 1793 3295 gene locus_tag LOCUS_04430 1793 3295 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730278.1 protein_id gnl|my_center|LOCUS_04430 4617 3265 gene locus_tag LOCUS_04440 4617 3265 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730277.1 protein_id gnl|my_center|LOCUS_04440 4966 4625 gene locus_tag LOCUS_04450 gene mnhG 4966 4625 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727233.1 protein_id gnl|my_center|LOCUS_04450 5235 4966 gene locus_tag LOCUS_04460 5235 4966 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892270.1 protein_id gnl|my_center|LOCUS_04460 5780 5232 gene locus_tag LOCUS_04470 5780 5232 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727234.1 protein_id gnl|my_center|LOCUS_04470 7375 5777 gene locus_tag LOCUS_04480 7375 5777 CDS product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092260.1 protein_id gnl|my_center|LOCUS_04480 7857 7372 gene locus_tag LOCUS_04490 7857 7372 CDS product Na(+)/H(+) antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892273.1 protein_id gnl|my_center|LOCUS_04490 10772 7854 gene locus_tag LOCUS_04500 10772 7854 CDS product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727236.1 protein_id gnl|my_center|LOCUS_04500 11375 10860 gene locus_tag LOCUS_04510 11375 10860 CDS product LppP/LprE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406334.1 protein_id gnl|my_center|LOCUS_04510 11484 13142 gene locus_tag LOCUS_04520 11484 13142 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896448.1 protein_id gnl|my_center|LOCUS_04520 13156 14316 gene locus_tag LOCUS_04530 13156 14316 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406347.1 protein_id gnl|my_center|LOCUS_04530 14866 14297 gene locus_tag LOCUS_04540 14866 14297 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406350.1 protein_id gnl|my_center|LOCUS_04540 16089 14872 gene locus_tag LOCUS_04550 16089 14872 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730272.1 protein_id gnl|my_center|LOCUS_04550 17569 16205 gene locus_tag LOCUS_04560 17569 16205 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730270.1 protein_id gnl|my_center|LOCUS_04560 18911 17697 gene locus_tag LOCUS_04570 18911 17697 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406359.1 protein_id gnl|my_center|LOCUS_04570 18950 19771 gene locus_tag LOCUS_04580 18950 19771 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406360.1 protein_id gnl|my_center|LOCUS_04580 20210 19761 gene locus_tag LOCUS_04590 20210 19761 CDS product F420H(2)-dependent quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406364.1 protein_id gnl|my_center|LOCUS_04590 20629 20207 gene locus_tag LOCUS_04600 20629 20207 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730267.1 protein_id gnl|my_center|LOCUS_04600 20681 22072 gene locus_tag LOCUS_04610 20681 22072 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406369.1 protein_id gnl|my_center|LOCUS_04610 22069 23193 gene locus_tag LOCUS_04620 22069 23193 CDS product adenylate cyclase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730263.1 protein_id gnl|my_center|LOCUS_04620 23407 23204 gene locus_tag LOCUS_04630 23407 23204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730258.1 protein_id gnl|my_center|LOCUS_04630 23876 23415 gene locus_tag LOCUS_04640 23876 23415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 24130 23909 gene locus_tag LOCUS_04650 24130 23909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 26192 24321 gene locus_tag LOCUS_04660 26192 24321 CDS product fatty acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406569.1 protein_id gnl|my_center|LOCUS_04660 27979 26225 gene locus_tag LOCUS_04670 27979 26225 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406574.1 protein_id gnl|my_center|LOCUS_04670 28088 28651 gene locus_tag LOCUS_04680 28088 28651 CDS product DUF3558 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406577.1 protein_id gnl|my_center|LOCUS_04680 28648 29205 gene locus_tag LOCUS_04690 28648 29205 CDS product DUF3558 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900308.1 protein_id gnl|my_center|LOCUS_04690 29560 29297 gene locus_tag LOCUS_04700 29560 29297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 30184 29705 gene locus_tag LOCUS_04710 30184 29705 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730252.1 protein_id gnl|my_center|LOCUS_04710 30293 31441 gene locus_tag LOCUS_04720 30293 31441 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908139.1 protein_id gnl|my_center|LOCUS_04720 31438 34053 gene locus_tag LOCUS_04730 31438 34053 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898806.1 protein_id gnl|my_center|LOCUS_04730 35431 34055 gene locus_tag LOCUS_04740 35431 34055 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729414.1 protein_id gnl|my_center|LOCUS_04740 35583 36848 gene locus_tag LOCUS_04750 35583 36848 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730246.1 protein_id gnl|my_center|LOCUS_04750 38487 36838 gene locus_tag LOCUS_04760 38487 36838 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519688.1 protein_id gnl|my_center|LOCUS_04760 40394 38556 gene locus_tag LOCUS_04770 40394 38556 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406602.1 protein_id gnl|my_center|LOCUS_04770 41296 40391 gene locus_tag LOCUS_04780 41296 40391 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730243.1 protein_id gnl|my_center|LOCUS_04780 42312 41293 gene locus_tag LOCUS_04790 42312 41293 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730242.1 protein_id gnl|my_center|LOCUS_04790 42401 42892 gene locus_tag LOCUS_04800 42401 42892 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730233.1 protein_id gnl|my_center|LOCUS_04800 43010 43939 gene locus_tag LOCUS_04810 gene cysD 43010 43939 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730229.1 protein_id gnl|my_center|LOCUS_04810 44006 45850 gene locus_tag LOCUS_04820 gene cysC 44006 45850 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406621.1 protein_id gnl|my_center|LOCUS_04820 45847 46575 gene locus_tag LOCUS_04830 45847 46575 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_04830 46859 48121 gene locus_tag LOCUS_04840 46859 48121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 48453 49790 gene locus_tag LOCUS_04850 48453 49790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 49965 51164 gene locus_tag LOCUS_04860 49965 51164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 51204 51680 gene locus_tag LOCUS_04870 51204 51680 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730224.1 protein_id gnl|my_center|LOCUS_04870 51661 52824 gene locus_tag LOCUS_04880 51661 52824 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728588.1 protein_id gnl|my_center|LOCUS_04880 >Feature sequence009 420 163 gene locus_tag LOCUS_04890 420 163 CDS product TadE family type IV pilus minor pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179948709.1 protein_id gnl|my_center|LOCUS_04890 686 486 gene locus_tag LOCUS_04900 686 486 CDS product DUF4244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419673.1 protein_id gnl|my_center|LOCUS_04900 1322 732 gene locus_tag LOCUS_04910 1322 732 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419675.1 protein_id gnl|my_center|LOCUS_04910 2113 1319 gene locus_tag LOCUS_04920 2113 1319 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104598.1 protein_id gnl|my_center|LOCUS_04920 3273 2110 gene locus_tag LOCUS_04930 3273 2110 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731088.1 protein_id gnl|my_center|LOCUS_04930 4313 3270 gene locus_tag LOCUS_04940 gene ssd 4313 3270 CDS product septum site-determining protein Ssd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419685.1 protein_id gnl|my_center|LOCUS_04940 4428 4616 gene locus_tag LOCUS_04950 4428 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 5925 5170 gene locus_tag LOCUS_04960 5925 5170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908809.1 protein_id gnl|my_center|LOCUS_04960 6114 8075 gene locus_tag LOCUS_04970 gene acs 6114 8075 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878580.1 protein_id gnl|my_center|LOCUS_04970 8830 8072 gene locus_tag LOCUS_04980 8830 8072 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139568.1 protein_id gnl|my_center|LOCUS_04980 8962 9510 gene locus_tag LOCUS_04990 8962 9510 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419710.1 protein_id gnl|my_center|LOCUS_04990 9510 10454 gene locus_tag LOCUS_05000 9510 10454 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731100.1 protein_id gnl|my_center|LOCUS_05000 11653 10460 gene locus_tag LOCUS_05010 gene marP 11653 10460 CDS product acid resistance serine protease MarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731101.1 protein_id gnl|my_center|LOCUS_05010 12474 11650 gene locus_tag LOCUS_05020 12474 11650 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731102.1 protein_id gnl|my_center|LOCUS_05020 13109 12471 gene locus_tag LOCUS_05030 13109 12471 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731103.1 protein_id gnl|my_center|LOCUS_05030 13871 13113 gene locus_tag LOCUS_05040 gene nth 13871 13113 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162618339.1 protein_id gnl|my_center|LOCUS_05040 13952 14245 gene locus_tag LOCUS_05050 13952 14245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 14339 15013 gene locus_tag LOCUS_05060 gene crp 14339 15013 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897584.1 protein_id gnl|my_center|LOCUS_05060 15812 15027 gene locus_tag LOCUS_05070 15812 15027 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731106.1 protein_id gnl|my_center|LOCUS_05070 16264 15809 gene locus_tag LOCUS_05080 16264 15809 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419733.1 protein_id gnl|my_center|LOCUS_05080 16422 16261 gene locus_tag LOCUS_05090 16422 16261 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419736.1 protein_id gnl|my_center|LOCUS_05090 16484 17506 gene locus_tag LOCUS_05100 16484 17506 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419738.1 protein_id gnl|my_center|LOCUS_05100 17556 18686 gene locus_tag LOCUS_05110 17556 18686 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419740.1 protein_id gnl|my_center|LOCUS_05110 19013 18726 gene locus_tag LOCUS_05120 19013 18726 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731112.1 protein_id gnl|my_center|LOCUS_05120 19367 21868 gene locus_tag LOCUS_05130 gene ponA2 19367 21868 CDS product transglycosylase/D,D-transpeptidase PonA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878583.1 protein_id gnl|my_center|LOCUS_05130 21908 22861 gene locus_tag LOCUS_05140 21908 22861 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899637.1 protein_id gnl|my_center|LOCUS_05140 22869 23987 gene locus_tag LOCUS_05150 22869 23987 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731115.1 protein_id gnl|my_center|LOCUS_05150 24039 24113 gene locus_tag LOCUS_t00050 24039 24113 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 24581 24123 gene locus_tag LOCUS_05160 24581 24123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 25555 24755 gene locus_tag LOCUS_05170 25555 24755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 protein_id gnl|my_center|LOCUS_05170 27246 25576 gene locus_tag LOCUS_05180 27246 25576 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031577.1 protein_id gnl|my_center|LOCUS_05180 27190 27387 gene locus_tag LOCUS_05190 27190 27387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 27362 28381 gene locus_tag LOCUS_05200 27362 28381 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727891.1 protein_id gnl|my_center|LOCUS_05200 28852 28388 gene locus_tag LOCUS_05210 28852 28388 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419765.1 protein_id gnl|my_center|LOCUS_05210 28960 30102 gene locus_tag LOCUS_05220 28960 30102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05220 30114 30740 gene locus_tag LOCUS_05230 30114 30740 CDS product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419770.1 protein_id gnl|my_center|LOCUS_05230 30737 31849 gene locus_tag LOCUS_05240 30737 31849 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139569.1 protein_id gnl|my_center|LOCUS_05240 31846 32823 gene locus_tag LOCUS_05250 31846 32823 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731130.1 protein_id gnl|my_center|LOCUS_05250 32823 34145 gene locus_tag LOCUS_05260 32823 34145 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731131.1 protein_id gnl|my_center|LOCUS_05260 35173 34181 gene locus_tag LOCUS_05270 35173 34181 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731132.1 protein_id gnl|my_center|LOCUS_05270 35973 35197 gene locus_tag LOCUS_05280 35973 35197 CDS product RsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104495.1 protein_id gnl|my_center|LOCUS_05280 36662 35991 gene locus_tag LOCUS_05290 36662 35991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 37938 36688 gene locus_tag LOCUS_05300 37938 36688 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727449.1 protein_id gnl|my_center|LOCUS_05300 39191 37935 gene locus_tag LOCUS_05310 39191 37935 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175048384.1 protein_id gnl|my_center|LOCUS_05310 40303 39188 gene locus_tag LOCUS_05320 40303 39188 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113394.1 protein_id gnl|my_center|LOCUS_05320 41373 40300 gene locus_tag LOCUS_05330 41373 40300 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892513.1 protein_id gnl|my_center|LOCUS_05330 42418 41366 gene locus_tag LOCUS_05340 42418 41366 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073472.1 protein_id gnl|my_center|LOCUS_05340 44034 42421 gene locus_tag LOCUS_05350 44034 42421 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727446.1 protein_id gnl|my_center|LOCUS_05350 44921 44034 gene locus_tag LOCUS_05360 44921 44034 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892510.1 protein_id gnl|my_center|LOCUS_05360 45788 44925 gene locus_tag LOCUS_05370 45788 44925 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727445.1 protein_id gnl|my_center|LOCUS_05370 46008 46865 gene locus_tag LOCUS_05380 46008 46865 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731133.1 protein_id gnl|my_center|LOCUS_05380 47242 46862 gene locus_tag LOCUS_05390 47242 46862 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640167.1 protein_id gnl|my_center|LOCUS_05390 49722 47329 gene locus_tag LOCUS_05400 gene atsB 49722 47329 CDS product arylsulfatase AtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950867.1 protein_id gnl|my_center|LOCUS_05400 49801 50877 gene locus_tag LOCUS_05410 49801 50877 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899659.1 protein_id gnl|my_center|LOCUS_05410 50902 51720 gene locus_tag LOCUS_05420 50902 51720 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229549.1 protein_id gnl|my_center|LOCUS_05420 <52816 51721 gene locus_tag LOCUS_05430 <52816 51721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731135.1:carotenoid oxygenase family protein >Feature sequence010 388 1494 gene locus_tag LOCUS_05440 388 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 1494 2594 gene locus_tag LOCUS_05450 1494 2594 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530638.1 protein_id gnl|my_center|LOCUS_05450 2688 4154 gene locus_tag LOCUS_05460 2688 4154 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728948.1 protein_id gnl|my_center|LOCUS_05460 4242 5831 gene locus_tag LOCUS_05470 4242 5831 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728639.1 protein_id gnl|my_center|LOCUS_05470 5839 6342 gene locus_tag LOCUS_05480 5839 6342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728633.1 protein_id gnl|my_center|LOCUS_05480 7909 6344 gene locus_tag LOCUS_05490 7909 6344 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728632.1 protein_id gnl|my_center|LOCUS_05490 9177 7909 gene locus_tag LOCUS_05500 9177 7909 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728631.1 protein_id gnl|my_center|LOCUS_05500 10691 9177 gene locus_tag LOCUS_05510 10691 9177 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728630.1 protein_id gnl|my_center|LOCUS_05510 11809 10688 gene locus_tag LOCUS_05520 11809 10688 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728629.1 protein_id gnl|my_center|LOCUS_05520 12851 11826 gene locus_tag LOCUS_05530 12851 11826 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728628.1 protein_id gnl|my_center|LOCUS_05530 14050 12848 gene locus_tag LOCUS_05540 14050 12848 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728627.1 protein_id gnl|my_center|LOCUS_05540 14913 14056 gene locus_tag LOCUS_05550 14913 14056 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878148.1 protein_id gnl|my_center|LOCUS_05550 15727 14918 gene locus_tag LOCUS_05560 15727 14918 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878149.1 protein_id gnl|my_center|LOCUS_05560 15851 16654 gene locus_tag LOCUS_05570 15851 16654 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036463150.1 protein_id gnl|my_center|LOCUS_05570 16878 18119 gene locus_tag LOCUS_05580 16878 18119 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728946.1 protein_id gnl|my_center|LOCUS_05580 18152 19339 gene locus_tag LOCUS_05590 18152 19339 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894684.1 protein_id gnl|my_center|LOCUS_05590 19413 20234 gene locus_tag LOCUS_05600 19413 20234 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894683.1 protein_id gnl|my_center|LOCUS_05600 20231 21070 gene locus_tag LOCUS_05610 20231 21070 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894682.1 protein_id gnl|my_center|LOCUS_05610 21631 21074 gene locus_tag LOCUS_05620 21631 21074 CDS product bifunctional pyrazinamidase/nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410243.1 protein_id gnl|my_center|LOCUS_05620 21693 24620 gene locus_tag LOCUS_05630 21693 24620 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730385.1 protein_id gnl|my_center|LOCUS_05630 25513 24650 gene locus_tag LOCUS_05640 25513 24650 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409574.1 protein_id gnl|my_center|LOCUS_05640 25412 26680 gene locus_tag LOCUS_05650 25412 26680 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731311.1 protein_id gnl|my_center|LOCUS_05650 26674 27423 gene locus_tag LOCUS_05660 26674 27423 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731310.1 protein_id gnl|my_center|LOCUS_05660 27407 28483 gene locus_tag LOCUS_05670 27407 28483 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_05670 29133 28456 gene locus_tag LOCUS_05680 29133 28456 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731308.1 protein_id gnl|my_center|LOCUS_05680 29228 29857 gene locus_tag LOCUS_05690 29228 29857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 31861 29864 gene locus_tag LOCUS_05700 31861 29864 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729365.1 protein_id gnl|my_center|LOCUS_05700 33761 32007 gene locus_tag LOCUS_05710 33761 32007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 35993 34467 gene locus_tag LOCUS_05720 35993 34467 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899145.1 protein_id gnl|my_center|LOCUS_05720 36345 36058 gene locus_tag LOCUS_05730 36345 36058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 36326 36769 gene locus_tag LOCUS_05740 36326 36769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 37059 36793 gene locus_tag LOCUS_05750 37059 36793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080063.1 protein_id gnl|my_center|LOCUS_05750 37233 37571 gene locus_tag LOCUS_05760 gene rbpA 37233 37571 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895305.1 protein_id gnl|my_center|LOCUS_05760 38391 37588 gene locus_tag LOCUS_05770 38391 37588 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895306.1 protein_id gnl|my_center|LOCUS_05770 40055 38388 gene locus_tag LOCUS_05780 gene lnt 40055 38388 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109789858.1 protein_id gnl|my_center|LOCUS_05780 41634 40048 gene locus_tag LOCUS_05790 41634 40048 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410605.1 protein_id gnl|my_center|LOCUS_05790 42169 41666 gene locus_tag LOCUS_05800 gene fxsA 42169 41666 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086493.1 protein_id gnl|my_center|LOCUS_05800 42526 42254 gene locus_tag LOCUS_05810 42526 42254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 42987 42607 gene locus_tag LOCUS_05820 42987 42607 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895310.1 protein_id gnl|my_center|LOCUS_05820 46661 43005 gene locus_tag LOCUS_05830 gene cobN 46661 43005 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729378.1 protein_id gnl|my_center|LOCUS_05830 47164 46676 gene locus_tag LOCUS_05840 47164 46676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 48432 47170 gene locus_tag LOCUS_05850 48432 47170 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416584.1 protein_id gnl|my_center|LOCUS_05850 49425 48436 gene locus_tag LOCUS_05860 49425 48436 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416588.1 protein_id gnl|my_center|LOCUS_05860 49898 49422 gene locus_tag LOCUS_05870 49898 49422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416593.1 protein_id gnl|my_center|LOCUS_05870 >Feature sequence011 175 810 gene locus_tag LOCUS_05880 175 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226912.1 protein_id gnl|my_center|LOCUS_05880 869 1234 gene locus_tag LOCUS_05890 gene trxA 869 1234 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093515.1 protein_id gnl|my_center|LOCUS_05890 1264 2082 gene locus_tag LOCUS_05900 1264 2082 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877590.1 protein_id gnl|my_center|LOCUS_05900 2110 3738 gene locus_tag LOCUS_05910 2110 3738 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894527.1 protein_id gnl|my_center|LOCUS_05910 6675 3850 gene locus_tag LOCUS_05920 6675 3850 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728843.1 protein_id gnl|my_center|LOCUS_05920 6849 7394 gene locus_tag LOCUS_05930 6849 7394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728844.1 protein_id gnl|my_center|LOCUS_05930 7615 9078 gene locus_tag LOCUS_05940 gene ripA 7615 9078 CDS product NlpC/P60 family peptidoglycan endopeptidase RipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407523.1 protein_id gnl|my_center|LOCUS_05940 9080 9778 gene locus_tag LOCUS_05950 gene ripB 9080 9778 CDS product NlpC/P60 family peptidoglycan endopeptidase RipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728846.1 protein_id gnl|my_center|LOCUS_05950 9914 11041 gene locus_tag LOCUS_05960 9914 11041 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877592.1 protein_id gnl|my_center|LOCUS_05960 11038 12012 gene locus_tag LOCUS_05970 11038 12012 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049769945.1 protein_id gnl|my_center|LOCUS_05970 12032 13039 gene locus_tag LOCUS_05980 12032 13039 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877593.1 protein_id gnl|my_center|LOCUS_05980 13138 13893 gene locus_tag LOCUS_05990 gene fabG1 13138 13893 CDS product 3-oxoacyl-ACP reductase FabG1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898892.1 protein_id gnl|my_center|LOCUS_05990 13920 14729 gene locus_tag LOCUS_06000 gene inhA 13920 14729 CDS product NADH-dependent enoyl-ACP reductase InhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894540.1 protein_id gnl|my_center|LOCUS_06000 14726 15796 gene locus_tag LOCUS_06010 14726 15796 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728851.1 protein_id gnl|my_center|LOCUS_06010 16667 15765 gene locus_tag LOCUS_06020 16667 15765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902086.1 protein_id gnl|my_center|LOCUS_06020 16692 17126 gene locus_tag LOCUS_06030 16692 17126 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728853.1 protein_id gnl|my_center|LOCUS_06030 17161 18375 gene locus_tag LOCUS_06040 17161 18375 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728854.1 protein_id gnl|my_center|LOCUS_06040 18692 18411 gene locus_tag LOCUS_06050 18692 18411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 18772 19146 gene locus_tag LOCUS_06060 18772 19146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 19873 19136 gene locus_tag LOCUS_06070 19873 19136 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728856.1 protein_id gnl|my_center|LOCUS_06070 20038 21891 gene locus_tag LOCUS_06080 gene mutA 20038 21891 CDS product methylmalonyl-CoA mutase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407585.1 protein_id gnl|my_center|LOCUS_06080 21893 24193 gene locus_tag LOCUS_06090 gene scpA 21893 24193 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728858.1 protein_id gnl|my_center|LOCUS_06090 24193 25191 gene locus_tag LOCUS_06100 gene meaB 24193 25191 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728859.1 protein_id gnl|my_center|LOCUS_06100 25245 26519 gene locus_tag LOCUS_06110 25245 26519 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894552.1 protein_id gnl|my_center|LOCUS_06110 27586 33849 gene locus_tag LOCUS_06120 27586 33849 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003913253.1 protein_id gnl|my_center|LOCUS_06120 33885 35321 gene locus_tag LOCUS_06130 33885 35321 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730043.1 protein_id gnl|my_center|LOCUS_06130 35327 36688 gene locus_tag LOCUS_06140 35327 36688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462713.1 protein_id gnl|my_center|LOCUS_06140 36701 38095 gene locus_tag LOCUS_06150 36701 38095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730045.1 protein_id gnl|my_center|LOCUS_06150 41637 38092 gene locus_tag LOCUS_06160 41637 38092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 41822 42871 gene locus_tag LOCUS_06170 41822 42871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 43605 42895 gene locus_tag LOCUS_06180 43605 42895 CDS product GAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088284.1 protein_id gnl|my_center|LOCUS_06180 44900 43617 gene locus_tag LOCUS_06190 44900 43617 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730052.1 protein_id gnl|my_center|LOCUS_06190 48049 44897 gene locus_tag LOCUS_06200 48049 44897 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726924.1 protein_id gnl|my_center|LOCUS_06200 >Feature sequence012 1348 500 gene locus_tag LOCUS_06210 1348 500 CDS product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413928.1 protein_id gnl|my_center|LOCUS_06210 1812 1348 gene locus_tag LOCUS_06220 gene dut 1812 1348 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728566.1 protein_id gnl|my_center|LOCUS_06220 1934 2314 gene locus_tag LOCUS_06230 1934 2314 CDS product DUF3093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413931.1 protein_id gnl|my_center|LOCUS_06230 2622 2320 gene locus_tag LOCUS_06240 2622 2320 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728564.1 protein_id gnl|my_center|LOCUS_06240 2802 3452 gene locus_tag LOCUS_06250 gene cei 2802 3452 CDS product envelope integrity protein Cei inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413937.1 protein_id gnl|my_center|LOCUS_06250 4315 3473 gene locus_tag LOCUS_06260 4315 3473 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908081.1 protein_id gnl|my_center|LOCUS_06260 4426 5202 gene locus_tag LOCUS_06270 4426 5202 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894143.1 protein_id gnl|my_center|LOCUS_06270 5329 7089 gene locus_tag LOCUS_06280 5329 7089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 7332 7123 gene locus_tag LOCUS_06290 7332 7123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 8289 7435 gene locus_tag LOCUS_06300 8289 7435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 8944 8567 gene locus_tag LOCUS_06310 8944 8567 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413947.1 protein_id gnl|my_center|LOCUS_06310 9103 9294 gene locus_tag LOCUS_06320 9103 9294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894140.1 protein_id gnl|my_center|LOCUS_06320 9354 10343 gene locus_tag LOCUS_06330 9354 10343 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894139.1 protein_id gnl|my_center|LOCUS_06330 10569 10330 gene locus_tag LOCUS_06340 10569 10330 CDS product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894138.1 protein_id gnl|my_center|LOCUS_06340 10676 11074 gene locus_tag LOCUS_06350 10676 11074 CDS product DUF3099 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081892.1 protein_id gnl|my_center|LOCUS_06350 11222 12181 gene locus_tag LOCUS_06360 11222 12181 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894135.1 protein_id gnl|my_center|LOCUS_06360 12312 13007 gene locus_tag LOCUS_06370 gene ideR 12312 13007 CDS product iron-dependent transcriptional regulator IdeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413962.1 protein_id gnl|my_center|LOCUS_06370 14074 13004 gene locus_tag LOCUS_06380 14074 13004 CDS product DUF4192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413965.1 protein_id gnl|my_center|LOCUS_06380 14255 15217 gene locus_tag LOCUS_06390 14255 15217 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413968.1 protein_id gnl|my_center|LOCUS_06390 15241 15927 gene locus_tag LOCUS_06400 15241 15927 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413971.1 protein_id gnl|my_center|LOCUS_06400 16531 15932 gene locus_tag LOCUS_06410 gene nrdR 16531 15932 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413973.1 protein_id gnl|my_center|LOCUS_06410 16826 16548 gene locus_tag LOCUS_06420 16826 16548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 17269 17949 gene locus_tag LOCUS_06430 gene lexA 17269 17949 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894124.1 protein_id gnl|my_center|LOCUS_06430 20036 17988 gene locus_tag LOCUS_06440 20036 17988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 21371 20211 gene locus_tag LOCUS_06450 21371 20211 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413981.1 protein_id gnl|my_center|LOCUS_06450 22889 21474 gene locus_tag LOCUS_06460 gene hflX 22889 21474 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894120.1 protein_id gnl|my_center|LOCUS_06460 23844 22975 gene locus_tag LOCUS_06470 gene dapF 23844 22975 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728551.1 protein_id gnl|my_center|LOCUS_06470 24779 23841 gene locus_tag LOCUS_06480 gene miaA 24779 23841 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894118.1 protein_id gnl|my_center|LOCUS_06480 25492 24776 gene locus_tag LOCUS_06490 25492 24776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728550.1 protein_id gnl|my_center|LOCUS_06490 26399 25503 gene locus_tag LOCUS_06500 26399 25503 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728549.1 protein_id gnl|my_center|LOCUS_06500 26625 27965 gene locus_tag LOCUS_06510 26625 27965 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413997.1 protein_id gnl|my_center|LOCUS_06510 28575 27976 gene locus_tag LOCUS_06520 28575 27976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081855.1 protein_id gnl|my_center|LOCUS_06520 30107 28572 gene locus_tag LOCUS_06530 gene miaB 30107 28572 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728547.1 protein_id gnl|my_center|LOCUS_06530 30174 30989 gene locus_tag LOCUS_06540 30174 30989 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894111.1 protein_id gnl|my_center|LOCUS_06540 31079 31831 gene locus_tag LOCUS_06550 31079 31831 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894112.1 protein_id gnl|my_center|LOCUS_06550 31842 33347 gene locus_tag LOCUS_06560 31842 33347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 33478 34365 gene locus_tag LOCUS_06570 33478 34365 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728545.1 protein_id gnl|my_center|LOCUS_06570 34812 34372 gene locus_tag LOCUS_06580 gene trxC 34812 34372 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889424.1 protein_id gnl|my_center|LOCUS_06580 35304 34849 gene locus_tag LOCUS_06590 gene recX 35304 34849 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894108.1 protein_id gnl|my_center|LOCUS_06590 36385 35336 gene locus_tag LOCUS_06600 gene recA 36385 35336 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894107.1 protein_id gnl|my_center|LOCUS_06600 36779 36585 gene locus_tag LOCUS_06610 36779 36585 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728536.1 protein_id gnl|my_center|LOCUS_06610 37965 36799 gene locus_tag LOCUS_06620 37965 36799 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728535.1 protein_id gnl|my_center|LOCUS_06620 38025 38465 gene locus_tag LOCUS_06630 38025 38465 CDS product limonene-1,2-epoxide hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877467.1 protein_id gnl|my_center|LOCUS_06630 39322 38504 gene locus_tag LOCUS_06640 39322 38504 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728532.1 protein_id gnl|my_center|LOCUS_06640 40151 39351 gene locus_tag LOCUS_06650 gene pspA 40151 39351 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728531.1 protein_id gnl|my_center|LOCUS_06650 40621 40274 gene locus_tag LOCUS_06660 40621 40274 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894079.1 protein_id gnl|my_center|LOCUS_06660 41251 40700 gene locus_tag LOCUS_06670 gene pgsA 41251 40700 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894077.1 protein_id gnl|my_center|LOCUS_06670 41427 42008 gene locus_tag LOCUS_06680 41427 42008 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414037.1 protein_id gnl|my_center|LOCUS_06680 44499 42010 gene locus_tag LOCUS_06690 44499 42010 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877465.1 protein_id gnl|my_center|LOCUS_06690 >Feature sequence013 1567 281 gene locus_tag LOCUS_06700 gene tyrS 1567 281 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408375.1 protein_id gnl|my_center|LOCUS_06700 2206 1595 gene locus_tag LOCUS_06710 2206 1595 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408373.1 protein_id gnl|my_center|LOCUS_06710 2424 2221 gene locus_tag LOCUS_06720 2424 2221 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408362.1 protein_id gnl|my_center|LOCUS_06720 3002 2430 gene locus_tag LOCUS_06730 3002 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 6028 3050 gene locus_tag LOCUS_06740 6028 3050 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408360.1 protein_id gnl|my_center|LOCUS_06740 6174 7994 gene locus_tag LOCUS_06750 6174 7994 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408257.1 protein_id gnl|my_center|LOCUS_06750 9418 8006 gene locus_tag LOCUS_06760 gene argH 9418 8006 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729312.1 protein_id gnl|my_center|LOCUS_06760 10620 9415 gene locus_tag LOCUS_06770 10620 9415 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729313.1 protein_id gnl|my_center|LOCUS_06770 11192 10692 gene locus_tag LOCUS_06780 11192 10692 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408178.1 protein_id gnl|my_center|LOCUS_06780 12127 11189 gene locus_tag LOCUS_06790 gene argF 12127 11189 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729314.1 protein_id gnl|my_center|LOCUS_06790 13296 12124 gene locus_tag LOCUS_06800 13296 12124 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729315.1 protein_id gnl|my_center|LOCUS_06800 14129 13293 gene locus_tag LOCUS_06810 gene argB 14129 13293 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895218.1 protein_id gnl|my_center|LOCUS_06810 15355 14126 gene locus_tag LOCUS_06820 gene argJ 15355 14126 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408160.1 protein_id gnl|my_center|LOCUS_06820 16386 15352 gene locus_tag LOCUS_06830 gene argC 16386 15352 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729317.1 protein_id gnl|my_center|LOCUS_06830 19026 16522 gene locus_tag LOCUS_06840 gene pheT 19026 16522 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901220.1 protein_id gnl|my_center|LOCUS_06840 20072 19026 gene locus_tag LOCUS_06850 gene pheS 20072 19026 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895223.1 protein_id gnl|my_center|LOCUS_06850 20237 21817 gene locus_tag LOCUS_06860 20237 21817 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285120.1 protein_id gnl|my_center|LOCUS_06860 22730 21819 gene locus_tag LOCUS_06870 22730 21819 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495987.1 protein_id gnl|my_center|LOCUS_06870 23533 22751 gene locus_tag LOCUS_06880 23533 22751 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408112.1 protein_id gnl|my_center|LOCUS_06880 23919 23530 gene locus_tag LOCUS_06890 gene rplT 23919 23530 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895237.1 protein_id gnl|my_center|LOCUS_06890 24169 23975 gene locus_tag LOCUS_06900 gene rpmI 24169 23975 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408106.1 protein_id gnl|my_center|LOCUS_06900 24710 24192 gene locus_tag LOCUS_06910 24710 24192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 25077 25442 gene locus_tag LOCUS_06920 25077 25442 CDS product DUF1844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729332.1 protein_id gnl|my_center|LOCUS_06920 25550 28801 gene locus_tag LOCUS_06930 gene lysX 25550 28801 CDS product bifunctional lysylphosphatidylglycerol synthetase/lysine--tRNA ligase LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877820.1 protein_id gnl|my_center|LOCUS_06930 29023 29301 gene locus_tag LOCUS_06940 29023 29301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729340.1 protein_id gnl|my_center|LOCUS_06940 32268 29368 gene locus_tag LOCUS_06950 gene uvrA 32268 29368 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895254.1 protein_id gnl|my_center|LOCUS_06950 32314 32991 gene locus_tag LOCUS_06960 32314 32991 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898956.1 protein_id gnl|my_center|LOCUS_06960 33041 34081 gene locus_tag LOCUS_06970 33041 34081 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815524.1 protein_id gnl|my_center|LOCUS_06970 34072 34290 gene locus_tag LOCUS_06980 34072 34290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 34302 35045 gene locus_tag LOCUS_06990 34302 35045 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013663.1 protein_id gnl|my_center|LOCUS_06990 35042 35242 gene locus_tag LOCUS_07000 35042 35242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 35611 35324 gene locus_tag LOCUS_07010 35611 35324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 37157 35727 gene locus_tag LOCUS_07020 37157 35727 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969475.1 protein_id gnl|my_center|LOCUS_07020 37554 37802 gene locus_tag LOCUS_07030 37554 37802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 38349 38588 gene locus_tag LOCUS_07040 38349 38588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 38660 39079 gene locus_tag LOCUS_07050 38660 39079 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894385.1 protein_id gnl|my_center|LOCUS_07050 39329 40363 gene locus_tag LOCUS_07060 39329 40363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 40387 40779 gene locus_tag LOCUS_07070 gene kmtR 40387 40779 CDS product Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404335.1 protein_id gnl|my_center|LOCUS_07070 40776 41813 gene locus_tag LOCUS_07080 40776 41813 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410146.1 protein_id gnl|my_center|LOCUS_07080 41866 42090 gene locus_tag LOCUS_07090 41866 42090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323882.1 protein_id gnl|my_center|LOCUS_07090 >Feature sequence014 <1 963 gene locus_tag LOCUS_07100 <1 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003416051.1:HNH endonuclease signature motif containing protein 2096 981 gene locus_tag LOCUS_07110 2096 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416605.1 protein_id gnl|my_center|LOCUS_07110 3253 2099 gene locus_tag LOCUS_07120 3253 2099 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728110.1 protein_id gnl|my_center|LOCUS_07120 4944 3388 gene locus_tag LOCUS_07130 gene nuoN 4944 3388 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728118.1 protein_id gnl|my_center|LOCUS_07130 6506 4941 gene locus_tag LOCUS_07140 6506 4941 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728119.1 protein_id gnl|my_center|LOCUS_07140 8406 6511 gene locus_tag LOCUS_07150 gene nuoL 8406 6511 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893421.1 protein_id gnl|my_center|LOCUS_07150 8719 8420 gene locus_tag LOCUS_07160 gene nuoK 8719 8420 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893422.1 protein_id gnl|my_center|LOCUS_07160 9378 8716 gene locus_tag LOCUS_07170 9378 8716 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893423.1 protein_id gnl|my_center|LOCUS_07170 9917 9402 gene locus_tag LOCUS_07180 gene nuoI 9917 9402 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893424.1 protein_id gnl|my_center|LOCUS_07180 11139 9910 gene locus_tag LOCUS_07190 gene nuoH 11139 9910 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728120.1 protein_id gnl|my_center|LOCUS_07190 13487 11136 gene locus_tag LOCUS_07200 13487 11136 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728121.1 protein_id gnl|my_center|LOCUS_07200 14928 13594 gene locus_tag LOCUS_07210 gene nuoF 14928 13594 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893427.1 protein_id gnl|my_center|LOCUS_07210 15623 14922 gene locus_tag LOCUS_07220 gene nuoE 15623 14922 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728122.1 protein_id gnl|my_center|LOCUS_07220 16947 15649 gene locus_tag LOCUS_07230 gene nuoD 16947 15649 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728123.1 protein_id gnl|my_center|LOCUS_07230 17624 16947 gene locus_tag LOCUS_07240 17624 16947 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728124.1 protein_id gnl|my_center|LOCUS_07240 18175 17621 gene locus_tag LOCUS_07250 18175 17621 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416420.1 protein_id gnl|my_center|LOCUS_07250 18537 18166 gene locus_tag LOCUS_07260 18537 18166 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416417.1 protein_id gnl|my_center|LOCUS_07260 19000 18593 gene locus_tag LOCUS_07270 19000 18593 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893433.1 protein_id gnl|my_center|LOCUS_07270 19785 19003 gene locus_tag LOCUS_07280 19785 19003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 20209 19862 gene locus_tag LOCUS_07290 20209 19862 CDS product DUF6285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728129.1 protein_id gnl|my_center|LOCUS_07290 21168 20206 gene locus_tag LOCUS_07300 21168 20206 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728130.1 protein_id gnl|my_center|LOCUS_07300 22403 21165 gene locus_tag LOCUS_07310 22403 21165 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893439.1 protein_id gnl|my_center|LOCUS_07310 23000 22404 gene locus_tag LOCUS_07320 23000 22404 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893440.1 protein_id gnl|my_center|LOCUS_07320 23889 22993 gene locus_tag LOCUS_07330 23889 22993 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893441.1 protein_id gnl|my_center|LOCUS_07330 25091 23886 gene locus_tag LOCUS_07340 25091 23886 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095590.1 protein_id gnl|my_center|LOCUS_07340 26215 25088 gene locus_tag LOCUS_07350 26215 25088 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728131.1 protein_id gnl|my_center|LOCUS_07350 27318 26212 gene locus_tag LOCUS_07360 27318 26212 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728132.1 protein_id gnl|my_center|LOCUS_07360 27498 28490 gene locus_tag LOCUS_07370 27498 28490 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893447.1 protein_id gnl|my_center|LOCUS_07370 29766 28552 gene locus_tag LOCUS_07380 29766 28552 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728136.1 protein_id gnl|my_center|LOCUS_07380 31108 29798 gene locus_tag LOCUS_07390 31108 29798 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877291.1 protein_id gnl|my_center|LOCUS_07390 32064 31267 gene locus_tag LOCUS_07400 gene hisN 32064 31267 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917127.1 protein_id gnl|my_center|LOCUS_07400 32091 32456 gene locus_tag LOCUS_07410 32091 32456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728138.1 protein_id gnl|my_center|LOCUS_07410 33907 32540 gene locus_tag LOCUS_07420 gene fprA 33907 32540 CDS product ferredoxin--NADP(+) reductase FprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950826.1 protein_id gnl|my_center|LOCUS_07420 33955 35061 gene locus_tag LOCUS_07430 gene prfB 33955 35061 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728139.1 protein_id gnl|my_center|LOCUS_07430 35051 36016 gene locus_tag LOCUS_07440 35051 36016 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728140.1 protein_id gnl|my_center|LOCUS_07440 36554 36129 gene locus_tag LOCUS_07450 36554 36129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 36544 37236 gene locus_tag LOCUS_07460 gene ftsE 36544 37236 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416120.1 protein_id gnl|my_center|LOCUS_07460 37237 38130 gene locus_tag LOCUS_07470 gene ftsX 37237 38130 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728143.1 protein_id gnl|my_center|LOCUS_07470 38132 38656 gene locus_tag LOCUS_07480 gene smpB 38132 38656 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728144.1 protein_id gnl|my_center|LOCUS_07480 38698 39498 gene locus_tag LOCUS_07490 38698 39498 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351059.1 protein_id gnl|my_center|LOCUS_07490 39509 40366 gene locus_tag LOCUS_07500 39509 40366 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416111.1 protein_id gnl|my_center|LOCUS_07500 40837 40382 gene locus_tag LOCUS_07510 40837 40382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 40970 41338 gene locus_tag LOCUS_tm00010 40970 41338 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence015 1709 549 gene locus_tag LOCUS_07520 1709 549 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897413.1 protein_id gnl|my_center|LOCUS_07520 1770 3338 gene locus_tag LOCUS_07530 gene fadD3 1770 3338 CDS product 3-((3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl)propanoate--CoA ligase FadD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900098.1 protein_id gnl|my_center|LOCUS_07530 3338 4483 gene locus_tag LOCUS_07540 3338 4483 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730973.1 protein_id gnl|my_center|LOCUS_07540 4480 5454 gene locus_tag LOCUS_07550 4480 5454 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730974.1 protein_id gnl|my_center|LOCUS_07550 5454 6401 gene locus_tag LOCUS_07560 5454 6401 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419352.1 protein_id gnl|my_center|LOCUS_07560 6424 7587 gene locus_tag LOCUS_07570 6424 7587 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419356.1 protein_id gnl|my_center|LOCUS_07570 7845 7618 gene locus_tag LOCUS_07580 7845 7618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 7964 8731 gene locus_tag LOCUS_07590 7964 8731 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878534.1 protein_id gnl|my_center|LOCUS_07590 9317 8751 gene locus_tag LOCUS_07600 gene hsaB 9317 8751 CDS product flavin-dependent monooxygenase reductase subunit HsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419374.1 protein_id gnl|my_center|LOCUS_07600 10233 9322 gene locus_tag LOCUS_07610 gene hsaC 10233 9322 CDS product iron-dependent extradiol dioxygenase HsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419378.1 protein_id gnl|my_center|LOCUS_07610 11144 10230 gene locus_tag LOCUS_07620 11144 10230 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730992.1 protein_id gnl|my_center|LOCUS_07620 12342 11158 gene locus_tag LOCUS_07630 gene hsaA 12342 11158 CDS product flavin-dependent monooxygenase oxygenase subunit HsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419383.1 protein_id gnl|my_center|LOCUS_07630 12486 12776 gene locus_tag LOCUS_07640 12486 12776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 13657 12797 gene locus_tag LOCUS_07650 13657 12797 CDS product cyclopropane mycolic acid synthase family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892738.1 protein_id gnl|my_center|LOCUS_07650 15950 13812 gene locus_tag LOCUS_07660 15950 13812 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730994.1 protein_id gnl|my_center|LOCUS_07660 16107 16715 gene locus_tag LOCUS_07670 gene kstR 16107 16715 CDS product cholesterol catabolism transcriptional regulator KstR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878540.1 protein_id gnl|my_center|LOCUS_07670 16781 17755 gene locus_tag LOCUS_07680 16781 17755 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878542.1 protein_id gnl|my_center|LOCUS_07680 17841 18527 gene locus_tag LOCUS_07690 17841 18527 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730999.1 protein_id gnl|my_center|LOCUS_07690 18524 19393 gene locus_tag LOCUS_07700 18524 19393 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730998.1 protein_id gnl|my_center|LOCUS_07700 19403 20161 gene locus_tag LOCUS_07710 19403 20161 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731005.1 protein_id gnl|my_center|LOCUS_07710 20161 21081 gene locus_tag LOCUS_07720 20161 21081 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731014.1 protein_id gnl|my_center|LOCUS_07720 22050 21109 gene locus_tag LOCUS_07730 gene rlmB 22050 21109 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731016.1 protein_id gnl|my_center|LOCUS_07730 23454 22051 gene locus_tag LOCUS_07740 gene cysS 23454 22051 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900108.1 protein_id gnl|my_center|LOCUS_07740 23945 23466 gene locus_tag LOCUS_07750 gene ispF 23945 23466 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064989.1 protein_id gnl|my_center|LOCUS_07750 24604 23942 gene locus_tag LOCUS_07760 gene ispD 24604 23942 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950915.1 protein_id gnl|my_center|LOCUS_07760 25113 24625 gene locus_tag LOCUS_07770 gene carD 25113 24625 CDS product RNA polymerase-binding transcription factor CarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731020.1 protein_id gnl|my_center|LOCUS_07770 25375 25923 gene locus_tag LOCUS_07780 25375 25923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731021.1 protein_id gnl|my_center|LOCUS_07780 26002 27393 gene locus_tag LOCUS_07790 gene radA 26002 27393 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731022.1 protein_id gnl|my_center|LOCUS_07790 28232 27432 gene locus_tag LOCUS_07800 28232 27432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731024.1 protein_id gnl|my_center|LOCUS_07800 28940 28287 gene locus_tag LOCUS_07810 gene canB 28940 28287 CDS product beta-carbonic anhydrase CanB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419492.1 protein_id gnl|my_center|LOCUS_07810 28930 29883 gene locus_tag LOCUS_07820 gene mutY 28930 29883 CDS product A/G-specific adenine glycosylase MutY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731026.1 protein_id gnl|my_center|LOCUS_07820 29870 30634 gene locus_tag LOCUS_07830 29870 30634 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027093.1 protein_id gnl|my_center|LOCUS_07830 31407 30631 gene locus_tag LOCUS_07840 31407 30631 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419499.1 protein_id gnl|my_center|LOCUS_07840 31462 31779 gene locus_tag LOCUS_07850 gene mhuD 31462 31779 CDS product mycobilin-forming heme oxygenase MhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731028.1 protein_id gnl|my_center|LOCUS_07850 32016 31726 gene locus_tag LOCUS_07860 32016 31726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 31931 33097 gene locus_tag LOCUS_07870 31931 33097 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886178.1 protein_id gnl|my_center|LOCUS_07870 35716 33197 gene locus_tag LOCUS_07880 gene clpC1 35716 33197 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731031.1 protein_id gnl|my_center|LOCUS_07880 36287 35943 gene locus_tag LOCUS_07890 36287 35943 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731033.1 protein_id gnl|my_center|LOCUS_07890 37919 36396 gene locus_tag LOCUS_07900 gene lysS 37919 36396 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731034.1 protein_id gnl|my_center|LOCUS_07900 38772 37957 gene locus_tag LOCUS_07910 38772 37957 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897496.1 protein_id gnl|my_center|LOCUS_07910 39745 38816 gene locus_tag LOCUS_07920 gene panC 39745 38816 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731036.1 protein_id gnl|my_center|LOCUS_07920 40677 39742 gene locus_tag LOCUS_07930 40677 39742 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731037.1 protein_id gnl|my_center|LOCUS_07930 >Feature sequence016 1516 656 gene locus_tag LOCUS_07940 1516 656 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730907.1 protein_id gnl|my_center|LOCUS_07940 3209 1506 gene locus_tag LOCUS_07950 gene kstD 3209 1506 CDS product 3-oxosteroid 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730906.1 protein_id gnl|my_center|LOCUS_07950 3285 4070 gene locus_tag LOCUS_07960 3285 4070 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113175.1 protein_id gnl|my_center|LOCUS_07960 4078 4986 gene locus_tag LOCUS_07970 4078 4986 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878495.1 protein_id gnl|my_center|LOCUS_07970 4983 6011 gene locus_tag LOCUS_07980 gene dmpG 4983 6011 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897334.1 protein_id gnl|my_center|LOCUS_07980 6030 8189 gene locus_tag LOCUS_07990 6030 8189 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897332.1 protein_id gnl|my_center|LOCUS_07990 8293 9420 gene locus_tag LOCUS_08000 8293 9420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730900.1 protein_id gnl|my_center|LOCUS_08000 9424 10206 gene locus_tag LOCUS_08010 9424 10206 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419223.1 protein_id gnl|my_center|LOCUS_08010 10203 11348 gene locus_tag LOCUS_08020 10203 11348 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878493.1 protein_id gnl|my_center|LOCUS_08020 11897 11442 gene locus_tag LOCUS_08030 11897 11442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730897.1 protein_id gnl|my_center|LOCUS_08030 13042 11894 gene locus_tag LOCUS_08040 13042 11894 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897322.1 protein_id gnl|my_center|LOCUS_08040 13156 13677 gene locus_tag LOCUS_08050 13156 13677 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419208.1 protein_id gnl|my_center|LOCUS_08050 14877 13681 gene locus_tag LOCUS_08060 14877 13681 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901662.1 protein_id gnl|my_center|LOCUS_08060 15941 14877 gene locus_tag LOCUS_08070 15941 14877 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878491.1 protein_id gnl|my_center|LOCUS_08070 16947 15985 gene locus_tag LOCUS_08080 16947 15985 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730895.1 protein_id gnl|my_center|LOCUS_08080 17045 18076 gene locus_tag LOCUS_08090 17045 18076 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900084.1 protein_id gnl|my_center|LOCUS_08090 18854 18135 gene locus_tag LOCUS_08100 18854 18135 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419190.1 protein_id gnl|my_center|LOCUS_08100 18900 20096 gene locus_tag LOCUS_08110 gene cyp142 18900 20096 CDS product steroid C26-monooxygenase Cyp142 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730892.1 protein_id gnl|my_center|LOCUS_08110 20918 20124 gene locus_tag LOCUS_08120 20918 20124 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419179.1 protein_id gnl|my_center|LOCUS_08120 20991 22640 gene locus_tag LOCUS_08130 20991 22640 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901660.1 protein_id gnl|my_center|LOCUS_08130 22640 23773 gene locus_tag LOCUS_08140 22640 23773 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897309.1 protein_id gnl|my_center|LOCUS_08140 23834 25129 gene locus_tag LOCUS_08150 23834 25129 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210050.1 protein_id gnl|my_center|LOCUS_08150 25144 26700 gene locus_tag LOCUS_08160 25144 26700 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900872.1 protein_id gnl|my_center|LOCUS_08160 27326 26712 gene locus_tag LOCUS_08170 27326 26712 CDS product cutinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093934.1 protein_id gnl|my_center|LOCUS_08170 28948 27428 gene locus_tag LOCUS_08180 gene fadD17 28948 27428 CDS product long-chain-fatty-acid--CoA ligase FadD17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730885.1 protein_id gnl|my_center|LOCUS_08180 30047 28950 gene locus_tag LOCUS_08190 30047 28950 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950903.1 protein_id gnl|my_center|LOCUS_08190 31245 30064 gene locus_tag LOCUS_08200 31245 30064 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418997.1 protein_id gnl|my_center|LOCUS_08200 31439 31630 gene locus_tag LOCUS_08210 31439 31630 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897302.1 protein_id gnl|my_center|LOCUS_08210 31644 32561 gene locus_tag LOCUS_08220 31644 32561 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418990.1 protein_id gnl|my_center|LOCUS_08220 34033 32576 gene locus_tag LOCUS_08230 34033 32576 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730872.1 protein_id gnl|my_center|LOCUS_08230 34198 34034 gene locus_tag LOCUS_08240 34198 34034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418950.1 protein_id gnl|my_center|LOCUS_08240 34680 34246 gene locus_tag LOCUS_08250 34680 34246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 35087 34689 gene locus_tag LOCUS_08260 35087 34689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 35229 36056 gene locus_tag LOCUS_08270 35229 36056 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900075.1 protein_id gnl|my_center|LOCUS_08270 36074 36571 gene locus_tag LOCUS_08280 36074 36571 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142243.1 protein_id gnl|my_center|LOCUS_08280 36692 38008 gene locus_tag LOCUS_08290 36692 38008 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030319.1 protein_id gnl|my_center|LOCUS_08290 38042 39541 gene locus_tag LOCUS_08300 38042 39541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 39974 39552 gene locus_tag LOCUS_08310 39974 39552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 >Feature sequence017 4102 1658 gene locus_tag LOCUS_08320 4102 1658 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225440257.1 protein_id gnl|my_center|LOCUS_08320 4497 4099 gene locus_tag LOCUS_08330 4497 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 4823 4509 gene locus_tag LOCUS_08340 4823 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 5811 4843 gene locus_tag LOCUS_08350 5811 4843 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749591.1 protein_id gnl|my_center|LOCUS_08350 6034 5831 gene locus_tag LOCUS_08360 6034 5831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 7042 7848 gene locus_tag LOCUS_08370 7042 7848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 7942 9099 gene locus_tag LOCUS_08380 7942 9099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 9908 9324 gene locus_tag LOCUS_08390 9908 9324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 10238 11332 gene locus_tag LOCUS_08400 10238 11332 CDS product rep protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296244.1 protein_id gnl|my_center|LOCUS_08400 12402 11872 gene locus_tag LOCUS_08410 12402 11872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 13196 12399 gene locus_tag LOCUS_08420 13196 12399 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110864.1 protein_id gnl|my_center|LOCUS_08420 14191 13832 gene locus_tag LOCUS_08430 14191 13832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 14358 14933 gene locus_tag LOCUS_08440 14358 14933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 15033 15254 gene locus_tag LOCUS_08450 15033 15254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 15406 16464 gene locus_tag LOCUS_08460 15406 16464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 16498 16968 gene locus_tag LOCUS_08470 16498 16968 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400534.1 protein_id gnl|my_center|LOCUS_08470 17111 17425 gene locus_tag LOCUS_08480 17111 17425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 17955 17422 gene locus_tag LOCUS_08490 17955 17422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 18330 18064 gene locus_tag LOCUS_08500 18330 18064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 18625 18870 gene locus_tag LOCUS_08510 18625 18870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 20078 19017 gene locus_tag LOCUS_08520 20078 19017 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804802.1 protein_id gnl|my_center|LOCUS_08520 20693 20370 gene locus_tag LOCUS_08530 20693 20370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 21607 22758 gene locus_tag LOCUS_08540 21607 22758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 22980 24215 gene locus_tag LOCUS_08550 22980 24215 CDS product PE-PPE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730769.1 protein_id gnl|my_center|LOCUS_08550 24254 24535 gene locus_tag LOCUS_08560 24254 24535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 24607 25713 gene locus_tag LOCUS_08570 24607 25713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 25993 26922 gene locus_tag LOCUS_08580 25993 26922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 26970 27815 gene locus_tag LOCUS_08590 26970 27815 CDS product TIGR02569 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893318.1 protein_id gnl|my_center|LOCUS_08590 28634 27846 gene locus_tag LOCUS_08600 gene lipV 28634 27846 CDS product lipase LipV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899968.1 protein_id gnl|my_center|LOCUS_08600 30578 28659 gene locus_tag LOCUS_08610 30578 28659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 32143 30575 gene locus_tag LOCUS_08620 32143 30575 CDS product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727775.1 protein_id gnl|my_center|LOCUS_08620 32282 32707 gene locus_tag LOCUS_08630 32282 32707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 33199 32729 gene locus_tag LOCUS_08640 33199 32729 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085194.1 protein_id gnl|my_center|LOCUS_08640 33311 33661 gene locus_tag LOCUS_08650 33311 33661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 34127 33816 gene locus_tag LOCUS_08660 34127 33816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 34212 34511 gene locus_tag LOCUS_08670 34212 34511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 34621 35829 gene locus_tag LOCUS_08680 gene dnaN 34621 35829 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726602.1 protein_id gnl|my_center|LOCUS_08680 36720 36418 gene locus_tag LOCUS_08690 36720 36418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 36774 38195 gene locus_tag LOCUS_08700 36774 38195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 38244 38780 gene locus_tag LOCUS_08710 38244 38780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 38889 39230 gene locus_tag LOCUS_08720 38889 39230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 >Feature sequence018 1280 129 gene locus_tag LOCUS_08730 1280 129 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893068.1 protein_id gnl|my_center|LOCUS_08730 1168 1386 gene locus_tag LOCUS_08740 1168 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 2383 1346 gene locus_tag LOCUS_08750 2383 1346 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080724.1 protein_id gnl|my_center|LOCUS_08750 3762 2380 gene locus_tag LOCUS_08760 3762 2380 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893069.1 protein_id gnl|my_center|LOCUS_08760 4352 3759 gene locus_tag LOCUS_08770 4352 3759 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111753.1 protein_id gnl|my_center|LOCUS_08770 4315 5787 gene locus_tag LOCUS_08780 4315 5787 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877153.1 protein_id gnl|my_center|LOCUS_08780 7533 5830 gene locus_tag LOCUS_08790 7533 5830 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081393.1 protein_id gnl|my_center|LOCUS_08790 8299 7550 gene locus_tag LOCUS_08800 8299 7550 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417279.1 protein_id gnl|my_center|LOCUS_08800 10067 8313 gene locus_tag LOCUS_08810 gene sdhA 10067 8313 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727811.1 protein_id gnl|my_center|LOCUS_08810 10508 10077 gene locus_tag LOCUS_08820 10508 10077 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080729.1 protein_id gnl|my_center|LOCUS_08820 10843 10505 gene locus_tag LOCUS_08830 gene sdhC 10843 10505 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727812.1 protein_id gnl|my_center|LOCUS_08830 11043 12134 gene locus_tag LOCUS_08840 11043 12134 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877158.1 protein_id gnl|my_center|LOCUS_08840 12186 12515 gene locus_tag LOCUS_08850 12186 12515 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730191.1 protein_id gnl|my_center|LOCUS_08850 13794 12523 gene locus_tag LOCUS_08860 gene satS 13794 12523 CDS product protein export chaperone SatS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727824.1 protein_id gnl|my_center|LOCUS_08860 13828 14451 gene locus_tag LOCUS_08870 gene upp 13828 14451 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893093.1 protein_id gnl|my_center|LOCUS_08870 15233 14448 gene locus_tag LOCUS_08880 15233 14448 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727836.1 protein_id gnl|my_center|LOCUS_08880 15271 16443 gene locus_tag LOCUS_08890 15271 16443 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417220.1 protein_id gnl|my_center|LOCUS_08890 16954 16475 gene locus_tag LOCUS_08900 16954 16475 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907887.1 protein_id gnl|my_center|LOCUS_08900 16984 18411 gene locus_tag LOCUS_08910 16984 18411 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727859.1 protein_id gnl|my_center|LOCUS_08910 18422 20140 gene locus_tag LOCUS_08920 18422 20140 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727860.1 protein_id gnl|my_center|LOCUS_08920 20148 20981 gene locus_tag LOCUS_08930 20148 20981 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417215.1 protein_id gnl|my_center|LOCUS_08930 20978 21814 gene locus_tag LOCUS_08940 20978 21814 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731381.1 protein_id gnl|my_center|LOCUS_08940 21864 22421 gene locus_tag LOCUS_08950 21864 22421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 23154 22390 gene locus_tag LOCUS_08960 gene nei2 23154 22390 CDS product endonuclease VIII Nei2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893139.1 protein_id gnl|my_center|LOCUS_08960 27568 23159 gene locus_tag LOCUS_08970 27568 23159 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727880.1 protein_id gnl|my_center|LOCUS_08970 28930 27671 gene locus_tag LOCUS_08980 28930 27671 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104331.1 protein_id gnl|my_center|LOCUS_08980 30347 28944 gene locus_tag LOCUS_08990 30347 28944 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165781113.1 protein_id gnl|my_center|LOCUS_08990 30559 30344 gene locus_tag LOCUS_09000 30559 30344 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898093.1 protein_id gnl|my_center|LOCUS_09000 30593 31696 gene locus_tag LOCUS_09010 30593 31696 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897072.1 protein_id gnl|my_center|LOCUS_09010 31707 32390 gene locus_tag LOCUS_09020 31707 32390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 32455 32745 gene locus_tag LOCUS_09030 gene usfY 32455 32745 CDS product protein UsfY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727895.1 protein_id gnl|my_center|LOCUS_09030 32905 32756 gene locus_tag LOCUS_09040 32905 32756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 33065 33469 gene locus_tag LOCUS_09050 gene rsbW 33065 33469 CDS product anti-sigma B factor RsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417160.1 protein_id gnl|my_center|LOCUS_09050 33466 34263 gene locus_tag LOCUS_09060 gene sigF 33466 34263 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417158.1 protein_id gnl|my_center|LOCUS_09060 34449 34231 gene locus_tag LOCUS_09070 34449 34231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 36243 34462 gene locus_tag LOCUS_09080 36243 34462 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893197.1 protein_id gnl|my_center|LOCUS_09080 36362 38146 gene locus_tag LOCUS_09090 36362 38146 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223446.1 protein_id gnl|my_center|LOCUS_09090 >Feature sequence019 882 598 gene locus_tag LOCUS_09100 882 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 1919 867 gene locus_tag LOCUS_09110 1919 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 2337 2083 gene locus_tag LOCUS_09120 2337 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 2387 2692 gene locus_tag LOCUS_09130 2387 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 6772 2681 gene locus_tag LOCUS_09140 6772 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 7148 8362 gene locus_tag LOCUS_09150 7148 8362 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896567.1 protein_id gnl|my_center|LOCUS_09150 9926 8370 gene locus_tag LOCUS_09160 9926 8370 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920205.1 protein_id gnl|my_center|LOCUS_09160 10107 10613 gene locus_tag LOCUS_09170 10107 10613 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727307.1 protein_id gnl|my_center|LOCUS_09170 11644 10610 gene locus_tag LOCUS_09180 11644 10610 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892373.1 protein_id gnl|my_center|LOCUS_09180 12741 11647 gene locus_tag LOCUS_09190 12741 11647 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402607.1 protein_id gnl|my_center|LOCUS_09190 13254 12988 gene locus_tag LOCUS_09200 13254 12988 CDS product cell division/environmental response transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908893.1 protein_id gnl|my_center|LOCUS_09200 14245 13394 gene locus_tag LOCUS_09210 gene proC 14245 13394 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727304.1 protein_id gnl|my_center|LOCUS_09210 15115 14255 gene locus_tag LOCUS_09220 15115 14255 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402433.1 protein_id gnl|my_center|LOCUS_09220 15977 15132 gene locus_tag LOCUS_09230 15977 15132 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727302.1 protein_id gnl|my_center|LOCUS_09230 17178 15982 gene locus_tag LOCUS_09240 17178 15982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 18155 17175 gene locus_tag LOCUS_09250 18155 17175 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892366.1 protein_id gnl|my_center|LOCUS_09250 18229 18981 gene locus_tag LOCUS_09260 18229 18981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727299.1 protein_id gnl|my_center|LOCUS_09260 19029 19961 gene locus_tag LOCUS_09270 19029 19961 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113113.1 protein_id gnl|my_center|LOCUS_09270 20168 19968 gene locus_tag LOCUS_09280 20168 19968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 20106 20294 gene locus_tag LOCUS_09290 20106 20294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 20982 20302 gene locus_tag LOCUS_09300 gene regX 20982 20302 CDS product two-component sensory transduction protein RegX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402393.1 protein_id gnl|my_center|LOCUS_09300 22169 20979 gene locus_tag LOCUS_09310 gene senX3 22169 20979 CDS product two-component system sensor histidine kinase SenX3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876913.1 protein_id gnl|my_center|LOCUS_09310 23016 22270 gene locus_tag LOCUS_09320 23016 22270 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892361.1 protein_id gnl|my_center|LOCUS_09320 23592 23029 gene locus_tag LOCUS_09330 23592 23029 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892360.1 protein_id gnl|my_center|LOCUS_09330 24920 23589 gene locus_tag LOCUS_09340 gene mshA 24920 23589 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727296.1 protein_id gnl|my_center|LOCUS_09340 23877 23780 gene locus_tag LOCUS_t00060 23877 23780 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 24976 25725 gene locus_tag LOCUS_09350 24976 25725 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727295.1 protein_id gnl|my_center|LOCUS_09350 26787 25729 gene locus_tag LOCUS_09360 26787 25729 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402354.1 protein_id gnl|my_center|LOCUS_09360 26814 27320 gene locus_tag LOCUS_09370 26814 27320 CDS product DUF2505 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892353.1 protein_id gnl|my_center|LOCUS_09370 27333 27833 gene locus_tag LOCUS_09380 27333 27833 CDS product DUF2505 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112181.1 protein_id gnl|my_center|LOCUS_09380 27853 28620 gene locus_tag LOCUS_09390 27853 28620 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876910.1 protein_id gnl|my_center|LOCUS_09390 28593 29444 gene locus_tag LOCUS_09400 28593 29444 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876909.1 protein_id gnl|my_center|LOCUS_09400 29460 30368 gene locus_tag LOCUS_09410 29460 30368 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727292.1 protein_id gnl|my_center|LOCUS_09410 30781 30380 gene locus_tag LOCUS_09420 30781 30380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 31047 30790 gene locus_tag LOCUS_09430 31047 30790 CDS product DUF2516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908910.1 protein_id gnl|my_center|LOCUS_09430 31148 31314 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gccttcttggccggggcctt 32209 31820 gene locus_tag LOCUS_09440 32209 31820 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727288.1 protein_id gnl|my_center|LOCUS_09440 33627 32302 gene locus_tag LOCUS_09450 33627 32302 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727287.1 protein_id gnl|my_center|LOCUS_09450 33725 34489 gene locus_tag LOCUS_09460 33725 34489 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908912.1 protein_id gnl|my_center|LOCUS_09460 34543 35400 gene locus_tag LOCUS_09470 34543 35400 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727285.1 protein_id gnl|my_center|LOCUS_09470 36300 35419 gene locus_tag LOCUS_09480 36300 35419 CDS product cyclopropane mycolic acid synthase family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892339.1 protein_id gnl|my_center|LOCUS_09480 37311 36448 gene locus_tag LOCUS_09490 gene fadB2 37311 36448 CDS product 3-hydroxybutyryl-CoA dehydrogenase FadB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402318.1 protein_id gnl|my_center|LOCUS_09490 >Feature sequence020 <1 1522 gene locus_tag LOCUS_09500 <1 1522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728029.1:ATP-dependent DNA helicase AdnB 1898 1476 gene locus_tag LOCUS_09510 1898 1476 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085450.1 protein_id gnl|my_center|LOCUS_09510 1984 3045 gene locus_tag LOCUS_09520 1984 3045 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893325.1 protein_id gnl|my_center|LOCUS_09520 3045 3965 gene locus_tag LOCUS_09530 gene nudC 3045 3965 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728031.1 protein_id gnl|my_center|LOCUS_09530 4958 4014 gene locus_tag LOCUS_09540 4958 4014 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058916821.1 protein_id gnl|my_center|LOCUS_09540 5444 5016 gene locus_tag LOCUS_09550 5444 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 8049 5509 gene locus_tag LOCUS_09560 8049 5509 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784478.1 protein_id gnl|my_center|LOCUS_09560 8114 9028 gene locus_tag LOCUS_09570 8114 9028 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899827.1 protein_id gnl|my_center|LOCUS_09570 9025 10338 gene locus_tag LOCUS_09580 gene clcA 9025 10338 CDS product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393094.1 protein_id gnl|my_center|LOCUS_09580 10439 12172 gene locus_tag LOCUS_09590 10439 12172 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114225.1 protein_id gnl|my_center|LOCUS_09590 12743 12195 gene locus_tag LOCUS_09600 12743 12195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 14513 12840 gene locus_tag LOCUS_09610 14513 12840 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011242294.1 protein_id gnl|my_center|LOCUS_09610 14602 14988 gene locus_tag LOCUS_09620 14602 14988 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767605.1 protein_id gnl|my_center|LOCUS_09620 14985 15902 gene locus_tag LOCUS_09630 14985 15902 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_09630 16009 17430 gene locus_tag LOCUS_09640 16009 17430 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898428.1 protein_id gnl|my_center|LOCUS_09640 17450 18109 gene locus_tag LOCUS_09650 17450 18109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 19428 17992 gene locus_tag LOCUS_09660 19428 17992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 19618 20013 gene locus_tag LOCUS_09670 19618 20013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 21261 20026 gene locus_tag LOCUS_09680 21261 20026 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946042.1 protein_id gnl|my_center|LOCUS_09680 21344 23071 gene locus_tag LOCUS_09690 21344 23071 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727411.1 protein_id gnl|my_center|LOCUS_09690 23185 23823 gene locus_tag LOCUS_09700 23185 23823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 23789 26587 gene locus_tag LOCUS_09710 23789 26587 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410027.1 protein_id gnl|my_center|LOCUS_09710 27422 26547 gene locus_tag LOCUS_09720 27422 26547 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729766.1 protein_id gnl|my_center|LOCUS_09720 28537 27419 gene locus_tag LOCUS_09730 28537 27419 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413332.1 protein_id gnl|my_center|LOCUS_09730 29955 28576 gene locus_tag LOCUS_09740 29955 28576 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402992.1 protein_id gnl|my_center|LOCUS_09740 30059 31162 gene locus_tag LOCUS_09750 30059 31162 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899004.1 protein_id gnl|my_center|LOCUS_09750 32274 31180 gene locus_tag LOCUS_09760 gene corA 32274 31180 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003916789.1 protein_id gnl|my_center|LOCUS_09760 32774 32376 gene locus_tag LOCUS_09770 32774 32376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 33955 32897 gene locus_tag LOCUS_09780 33955 32897 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969779.1 protein_id gnl|my_center|LOCUS_09780 34759 33959 gene locus_tag LOCUS_09790 34759 33959 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720513.1 protein_id gnl|my_center|LOCUS_09790 35607 34756 gene locus_tag LOCUS_09800 35607 34756 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310498.1 protein_id gnl|my_center|LOCUS_09800 <36468 35604 gene locus_tag LOCUS_09810 <36468 35604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529685.1:ABC transporter substrate-binding protein >Feature sequence021 2724 3629 gene locus_tag LOCUS_09820 2724 3629 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729625.1 protein_id gnl|my_center|LOCUS_09820 3678 4853 gene locus_tag LOCUS_09830 3678 4853 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731330.1 protein_id gnl|my_center|LOCUS_09830 4861 5964 gene locus_tag LOCUS_09840 4861 5964 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731331.1 protein_id gnl|my_center|LOCUS_09840 7435 5990 gene locus_tag LOCUS_09850 7435 5990 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729626.1 protein_id gnl|my_center|LOCUS_09850 8689 7454 gene locus_tag LOCUS_09860 gene mshC 8689 7454 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729628.1 protein_id gnl|my_center|LOCUS_09860 9452 8691 gene locus_tag LOCUS_09870 9452 8691 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895577.1 protein_id gnl|my_center|LOCUS_09870 9522 9971 gene locus_tag LOCUS_09880 9522 9971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 10817 10011 gene locus_tag LOCUS_09890 10817 10011 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411101.1 protein_id gnl|my_center|LOCUS_09890 11398 10814 gene locus_tag LOCUS_09900 11398 10814 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411102.1 protein_id gnl|my_center|LOCUS_09900 12131 11442 gene locus_tag LOCUS_09910 12131 11442 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086562.1 protein_id gnl|my_center|LOCUS_09910 12975 12142 gene locus_tag LOCUS_09920 12975 12142 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729632.1 protein_id gnl|my_center|LOCUS_09920 13397 13029 gene locus_tag LOCUS_09930 13397 13029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 13477 14508 gene locus_tag LOCUS_09940 13477 14508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411110.1 protein_id gnl|my_center|LOCUS_09940 14505 14786 gene locus_tag LOCUS_09950 14505 14786 CDS product DUF5703 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895584.1 protein_id gnl|my_center|LOCUS_09950 14783 15847 gene locus_tag LOCUS_09960 14783 15847 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877967.1 protein_id gnl|my_center|LOCUS_09960 16473 15940 gene locus_tag LOCUS_09970 16473 15940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730256.1 protein_id gnl|my_center|LOCUS_09970 17180 16650 gene locus_tag LOCUS_09980 17180 16650 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061118.1 protein_id gnl|my_center|LOCUS_09980 18562 17210 gene locus_tag LOCUS_09990 18562 17210 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036453339.1 protein_id gnl|my_center|LOCUS_09990 18673 19362 gene locus_tag LOCUS_10000 18673 19362 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900105.1 protein_id gnl|my_center|LOCUS_10000 19443 19529 gene locus_tag LOCUS_t00070 19443 19529 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 20562 19582 gene locus_tag LOCUS_10010 20562 19582 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897538.1 protein_id gnl|my_center|LOCUS_10010 20991 20596 gene locus_tag LOCUS_10020 20991 20596 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728279.1 protein_id gnl|my_center|LOCUS_10020 21039 21776 gene locus_tag LOCUS_10030 21039 21776 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729647.1 protein_id gnl|my_center|LOCUS_10030 22169 21702 gene locus_tag LOCUS_10040 22169 21702 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895382.1 protein_id gnl|my_center|LOCUS_10040 23455 22166 gene locus_tag LOCUS_10050 23455 22166 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895383.1 protein_id gnl|my_center|LOCUS_10050 24264 23452 gene locus_tag LOCUS_10060 24264 23452 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 protein_id gnl|my_center|LOCUS_10060 25116 24265 gene locus_tag LOCUS_10070 25116 24265 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519602.1 protein_id gnl|my_center|LOCUS_10070 26311 25109 gene locus_tag LOCUS_10080 26311 25109 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510581.1 protein_id gnl|my_center|LOCUS_10080 27739 26372 gene locus_tag LOCUS_10090 27739 26372 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462762.1 protein_id gnl|my_center|LOCUS_10090 28411 27764 gene locus_tag LOCUS_10100 28411 27764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 29222 28449 gene locus_tag LOCUS_10110 gene wag31 29222 28449 CDS product cell wall synthesis protein Wag31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411131.1 protein_id gnl|my_center|LOCUS_10110 29691 29401 gene locus_tag LOCUS_10120 29691 29401 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895609.1 protein_id gnl|my_center|LOCUS_10120 30519 29815 gene locus_tag LOCUS_10130 gene sepF 30519 29815 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411133.1 protein_id gnl|my_center|LOCUS_10130 31368 30595 gene locus_tag LOCUS_10140 31368 30595 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411137.1 protein_id gnl|my_center|LOCUS_10140 32072 31365 gene locus_tag LOCUS_10150 gene pgeF 32072 31365 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729652.1 protein_id gnl|my_center|LOCUS_10150 33298 32102 gene locus_tag LOCUS_10160 gene ftsZ 33298 32102 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895613.1 protein_id gnl|my_center|LOCUS_10160 34471 33512 gene locus_tag LOCUS_10170 gene ftsQ 34471 33512 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411157.1 protein_id gnl|my_center|LOCUS_10170 35862 34468 gene locus_tag LOCUS_10180 gene murC 35862 34468 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729655.1 protein_id gnl|my_center|LOCUS_10180 >Feature sequence022 699 1022 gene locus_tag LOCUS_10190 699 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1182 2534 gene locus_tag LOCUS_10200 1182 2534 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894402.1 protein_id gnl|my_center|LOCUS_10200 2628 4118 gene locus_tag LOCUS_10210 2628 4118 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900464.1 protein_id gnl|my_center|LOCUS_10210 4235 6943 gene locus_tag LOCUS_10220 gene alaS 4235 6943 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728764.1 protein_id gnl|my_center|LOCUS_10220 6952 7446 gene locus_tag LOCUS_10230 gene ruvX 6952 7446 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894407.1 protein_id gnl|my_center|LOCUS_10230 7446 8690 gene locus_tag LOCUS_10240 7446 8690 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894408.1 protein_id gnl|my_center|LOCUS_10240 8697 9497 gene locus_tag LOCUS_10250 8697 9497 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413193.1 protein_id gnl|my_center|LOCUS_10250 9507 9947 gene locus_tag LOCUS_10260 9507 9947 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728766.1 protein_id gnl|my_center|LOCUS_10260 9996 11219 gene locus_tag LOCUS_10270 gene aroC 9996 11219 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894412.1 protein_id gnl|my_center|LOCUS_10270 11225 11905 gene locus_tag LOCUS_10280 11225 11905 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728767.1 protein_id gnl|my_center|LOCUS_10280 11902 12981 gene locus_tag LOCUS_10290 gene aroB 11902 12981 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894414.1 protein_id gnl|my_center|LOCUS_10290 13010 13441 gene locus_tag LOCUS_10300 gene aroQ 13010 13441 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413001.1 protein_id gnl|my_center|LOCUS_10300 14071 13454 gene locus_tag LOCUS_10310 14071 13454 CDS product B-4DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412998.1 protein_id gnl|my_center|LOCUS_10310 14132 15205 gene locus_tag LOCUS_10320 14132 15205 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728770.1 protein_id gnl|my_center|LOCUS_10320 15233 15796 gene locus_tag LOCUS_10330 gene efp 15233 15796 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894417.1 protein_id gnl|my_center|LOCUS_10330 15805 17208 gene locus_tag LOCUS_10340 15805 17208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 18411 17209 gene locus_tag LOCUS_10350 18411 17209 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728774.1 protein_id gnl|my_center|LOCUS_10350 18539 19105 gene locus_tag LOCUS_10360 gene pyrR 18539 19105 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407196.1 protein_id gnl|my_center|LOCUS_10360 19198 20193 gene locus_tag LOCUS_10370 19198 20193 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894427.1 protein_id gnl|my_center|LOCUS_10370 20190 21506 gene locus_tag LOCUS_10380 20190 21506 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728776.1 protein_id gnl|my_center|LOCUS_10380 21503 22045 gene locus_tag LOCUS_10390 21503 22045 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728777.1 protein_id gnl|my_center|LOCUS_10390 22042 23166 gene locus_tag LOCUS_10400 gene carA 22042 23166 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728778.1 protein_id gnl|my_center|LOCUS_10400 23259 26600 gene locus_tag LOCUS_10410 gene carB 23259 26600 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728779.1 protein_id gnl|my_center|LOCUS_10410 26602 27435 gene locus_tag LOCUS_10420 gene pyrF 26602 27435 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407220.1 protein_id gnl|my_center|LOCUS_10420 27795 28106 gene locus_tag LOCUS_10430 27795 28106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10430 28140 28766 gene locus_tag LOCUS_10440 gene gmk 28140 28766 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728781.1 protein_id gnl|my_center|LOCUS_10440 28861 29160 gene locus_tag LOCUS_10450 gene rpoZ 28861 29160 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407248.1 protein_id gnl|my_center|LOCUS_10450 29181 30428 gene locus_tag LOCUS_10460 gene coaBC 29181 30428 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728784.1 protein_id gnl|my_center|LOCUS_10460 30506 31717 gene locus_tag LOCUS_10470 gene metK 30506 31717 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900333.1 protein_id gnl|my_center|LOCUS_10470 32151 31771 gene locus_tag LOCUS_10480 32151 31771 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897999.1 protein_id gnl|my_center|LOCUS_10480 33217 32234 gene locus_tag LOCUS_10490 33217 32234 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407279.1 protein_id gnl|my_center|LOCUS_10490 33273 33938 gene locus_tag LOCUS_10500 33273 33938 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898862.1 protein_id gnl|my_center|LOCUS_10500 33993 34640 gene locus_tag LOCUS_10510 33993 34640 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_10510 >Feature sequence023 923 1960 gene locus_tag LOCUS_10520 923 1960 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900558.1 protein_id gnl|my_center|LOCUS_10520 2036 3520 gene locus_tag LOCUS_10530 gene pap 2036 3520 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941390.1 protein_id gnl|my_center|LOCUS_10530 3697 3624 gene locus_tag LOCUS_t00080 3697 3624 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4892 3738 gene locus_tag LOCUS_10540 4892 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901065.1 protein_id gnl|my_center|LOCUS_10540 5687 5034 gene locus_tag LOCUS_10550 5687 5034 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092841.1 protein_id gnl|my_center|LOCUS_10550 6926 5694 gene locus_tag LOCUS_10560 6926 5694 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730556.1 protein_id gnl|my_center|LOCUS_10560 7895 6975 gene locus_tag LOCUS_10570 7895 6975 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082898.1 protein_id gnl|my_center|LOCUS_10570 7958 8593 gene locus_tag LOCUS_10580 7958 8593 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907581.1 protein_id gnl|my_center|LOCUS_10580 8972 8790 gene locus_tag LOCUS_10590 8972 8790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 9200 8973 gene locus_tag LOCUS_10600 9200 8973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 9144 9698 gene locus_tag LOCUS_10610 9144 9698 CDS product SAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896877.1 protein_id gnl|my_center|LOCUS_10610 9795 10217 gene locus_tag LOCUS_10620 gene mscL 9795 10217 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405128.1 protein_id gnl|my_center|LOCUS_10620 10927 10289 gene locus_tag LOCUS_10630 10927 10289 CDS product MspA family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727317.1 protein_id gnl|my_center|LOCUS_10630 11552 11043 gene locus_tag LOCUS_10640 11552 11043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411608.1 protein_id gnl|my_center|LOCUS_10640 12060 11563 gene locus_tag LOCUS_10650 12060 11563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411608.1 protein_id gnl|my_center|LOCUS_10650 12142 13539 gene locus_tag LOCUS_10660 12142 13539 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730326.1 protein_id gnl|my_center|LOCUS_10660 14559 13618 gene locus_tag LOCUS_10670 gene dapD 14559 13618 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898768.1 protein_id gnl|my_center|LOCUS_10670 14674 15759 gene locus_tag LOCUS_10680 gene dapE 14674 15759 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730316.1 protein_id gnl|my_center|LOCUS_10680 16182 16997 gene locus_tag LOCUS_10690 16182 16997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 19219 16994 gene locus_tag LOCUS_10700 19219 16994 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104277.1 protein_id gnl|my_center|LOCUS_10700 19313 19861 gene locus_tag LOCUS_10710 19313 19861 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730304.1 protein_id gnl|my_center|LOCUS_10710 19851 21650 gene locus_tag LOCUS_10720 gene fadD6 19851 21650 CDS product long-chain-acyl-CoA synthetase FadD6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406240.1 protein_id gnl|my_center|LOCUS_10720 22540 21608 gene locus_tag LOCUS_10730 22540 21608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 22623 23654 gene locus_tag LOCUS_10740 22623 23654 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412408.1 protein_id gnl|my_center|LOCUS_10740 23710 24585 gene locus_tag LOCUS_10750 gene folP 23710 24585 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730302.1 protein_id gnl|my_center|LOCUS_10750 24582 25532 gene locus_tag LOCUS_10760 24582 25532 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896491.1 protein_id gnl|my_center|LOCUS_10760 25529 25891 gene locus_tag LOCUS_10770 25529 25891 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730301.1 protein_id gnl|my_center|LOCUS_10770 25888 26496 gene locus_tag LOCUS_10780 25888 26496 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406244.1 protein_id gnl|my_center|LOCUS_10780 26570 26737 gene locus_tag LOCUS_10790 26570 26737 CDS product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406247.1 protein_id gnl|my_center|LOCUS_10790 27970 26807 gene locus_tag LOCUS_10800 gene glgA 27970 26807 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730300.1 protein_id gnl|my_center|LOCUS_10800 28070 29284 gene locus_tag LOCUS_10810 gene glgC 28070 29284 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730299.1 protein_id gnl|my_center|LOCUS_10810 29984 29370 gene locus_tag LOCUS_10820 29984 29370 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896486.1 protein_id gnl|my_center|LOCUS_10820 30648 29995 gene locus_tag LOCUS_10830 30648 29995 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896481.1 protein_id gnl|my_center|LOCUS_10830 30988 31632 gene locus_tag LOCUS_10840 gene sigE 30988 31632 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406257.1 protein_id gnl|my_center|LOCUS_10840 31720 32121 gene locus_tag LOCUS_10850 gene rseA 31720 32121 CDS product anti-sigma E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896479.1 protein_id gnl|my_center|LOCUS_10850 32184 33677 gene locus_tag LOCUS_10860 gene htrA 32184 33677 CDS product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898779.1 protein_id gnl|my_center|LOCUS_10860 33697 34092 gene locus_tag LOCUS_10870 gene tatB 33697 34092 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896477.1 protein_id gnl|my_center|LOCUS_10870 35242 34109 gene locus_tag LOCUS_10880 35242 34109 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104279.1 protein_id gnl|my_center|LOCUS_10880 >Feature sequence024 713 234 gene locus_tag LOCUS_10890 713 234 CDS product DUF5318 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731617.1 protein_id gnl|my_center|LOCUS_10890 732 1580 gene locus_tag LOCUS_10900 732 1580 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003907183.1 protein_id gnl|my_center|LOCUS_10900 1721 2278 gene locus_tag LOCUS_10910 1721 2278 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898328.1 protein_id gnl|my_center|LOCUS_10910 2294 3385 gene locus_tag LOCUS_10920 2294 3385 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400492.1 protein_id gnl|my_center|LOCUS_10920 3487 4347 gene locus_tag LOCUS_10930 3487 4347 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731621.1 protein_id gnl|my_center|LOCUS_10930 4351 5160 gene locus_tag LOCUS_10940 4351 5160 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878800.1 protein_id gnl|my_center|LOCUS_10940 5198 5653 gene locus_tag LOCUS_10950 5198 5653 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898335.1 protein_id gnl|my_center|LOCUS_10950 7020 5680 gene locus_tag LOCUS_10960 7020 5680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898336.1 protein_id gnl|my_center|LOCUS_10960 7074 7742 gene locus_tag LOCUS_10970 7074 7742 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731625.1 protein_id gnl|my_center|LOCUS_10970 10658 7776 gene locus_tag LOCUS_10980 gene leuS 10658 7776 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731626.1 protein_id gnl|my_center|LOCUS_10980 10849 11745 gene locus_tag LOCUS_10990 10849 11745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 11778 12125 gene locus_tag LOCUS_11000 11778 12125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003907179.1 protein_id gnl|my_center|LOCUS_11000 12834 12229 gene locus_tag LOCUS_11010 12834 12229 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400460.1 protein_id gnl|my_center|LOCUS_11010 12941 14179 gene locus_tag LOCUS_11020 12941 14179 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400431.1 protein_id gnl|my_center|LOCUS_11020 14190 14966 gene locus_tag LOCUS_11030 14190 14966 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731630.1 protein_id gnl|my_center|LOCUS_11030 15475 14963 gene locus_tag LOCUS_11040 15475 14963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400109.1 protein_id gnl|my_center|LOCUS_11040 16996 15479 gene locus_tag LOCUS_11050 16996 15479 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400120.1 protein_id gnl|my_center|LOCUS_11050 17096 17854 gene locus_tag LOCUS_11060 17096 17854 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400124.1 protein_id gnl|my_center|LOCUS_11060 17865 20168 gene locus_tag LOCUS_11070 17865 20168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950965.1 protein_id gnl|my_center|LOCUS_11070 20165 23575 gene locus_tag LOCUS_11080 gene murJ 20165 23575 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400134.1 protein_id gnl|my_center|LOCUS_11080 20448 20538 gene locus_tag LOCUS_t00090 20448 20538 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 23591 24187 gene locus_tag LOCUS_11090 gene sigM 23591 24187 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400144.1 protein_id gnl|my_center|LOCUS_11090 24573 25547 gene locus_tag LOCUS_11100 gene trxB 24573 25547 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900782.1 protein_id gnl|my_center|LOCUS_11100 25544 25864 gene locus_tag LOCUS_11110 gene trxA 25544 25864 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400164.1 protein_id gnl|my_center|LOCUS_11110 26027 27205 gene locus_tag LOCUS_11120 26027 27205 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898354.1 protein_id gnl|my_center|LOCUS_11120 27932 27219 gene locus_tag LOCUS_11130 27932 27219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400171.1 protein_id gnl|my_center|LOCUS_11130 29112 28153 gene locus_tag LOCUS_11140 29112 28153 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400175.1 protein_id gnl|my_center|LOCUS_11140 30044 29112 gene locus_tag LOCUS_11150 gene parA 30044 29112 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400180.1 protein_id gnl|my_center|LOCUS_11150 30751 30041 gene locus_tag LOCUS_11160 gene rsmG 30751 30041 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036454143.1 protein_id gnl|my_center|LOCUS_11160 31380 30841 gene locus_tag LOCUS_11170 31380 30841 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064537.1 protein_id gnl|my_center|LOCUS_11170 32478 31405 gene locus_tag LOCUS_11180 gene yidC 32478 31405 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731644.1 protein_id gnl|my_center|LOCUS_11180 32764 32471 gene locus_tag LOCUS_11190 32764 32471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 33102 32761 gene locus_tag LOCUS_11200 gene rnpA 33102 32761 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296830.1 protein_id gnl|my_center|LOCUS_11200 33284 33141 gene locus_tag LOCUS_11210 gene rpmH 33284 33141 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072119.1 protein_id gnl|my_center|LOCUS_11210 >Feature sequence025 <1 614 gene locus_tag LOCUS_11220 <1 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003900424.1:CoA transferase 611 2074 gene locus_tag LOCUS_11230 611 2074 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228616.1 protein_id gnl|my_center|LOCUS_11230 2238 3713 gene locus_tag LOCUS_11240 2238 3713 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877761.1 protein_id gnl|my_center|LOCUS_11240 4762 3764 gene locus_tag LOCUS_11250 4762 3764 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729176.1 protein_id gnl|my_center|LOCUS_11250 6326 4908 gene locus_tag LOCUS_11260 6326 4908 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729175.1 protein_id gnl|my_center|LOCUS_11260 8509 6323 gene locus_tag LOCUS_11270 8509 6323 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877752.1 protein_id gnl|my_center|LOCUS_11270 9949 8591 gene locus_tag LOCUS_11280 9949 8591 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729172.1 protein_id gnl|my_center|LOCUS_11280 9967 10590 gene locus_tag LOCUS_11290 9967 10590 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729168.1 protein_id gnl|my_center|LOCUS_11290 10598 11308 gene locus_tag LOCUS_11300 10598 11308 CDS product EthD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729166.1 protein_id gnl|my_center|LOCUS_11300 11319 12071 gene locus_tag LOCUS_11310 11319 12071 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729165.1 protein_id gnl|my_center|LOCUS_11310 12255 12055 gene locus_tag LOCUS_11320 12255 12055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 12384 12863 gene locus_tag LOCUS_11330 gene bfrA 12384 12863 CDS product bacterioferritin BfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409398.1 protein_id gnl|my_center|LOCUS_11330 12898 13392 gene locus_tag LOCUS_11340 12898 13392 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729161.1 protein_id gnl|my_center|LOCUS_11340 13362 14714 gene locus_tag LOCUS_11350 13362 14714 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409401.1 protein_id gnl|my_center|LOCUS_11350 14711 15826 gene locus_tag LOCUS_11360 14711 15826 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899061.1 protein_id gnl|my_center|LOCUS_11360 16280 15831 gene locus_tag LOCUS_11370 16280 15831 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082139.1 protein_id gnl|my_center|LOCUS_11370 18039 16270 gene locus_tag LOCUS_11380 18039 16270 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111122.1 protein_id gnl|my_center|LOCUS_11380 19409 18096 gene locus_tag LOCUS_11390 19409 18096 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409406.1 protein_id gnl|my_center|LOCUS_11390 20730 19411 gene locus_tag LOCUS_11400 gene cyp124 20730 19411 CDS product methyl-branched lipid omega-hydroxylase Cyp124 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411654.1 protein_id gnl|my_center|LOCUS_11400 21194 20736 gene locus_tag LOCUS_11410 21194 20736 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165443174.1 protein_id gnl|my_center|LOCUS_11410 22376 21219 gene locus_tag LOCUS_11420 22376 21219 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112974.1 protein_id gnl|my_center|LOCUS_11420 22406 22801 gene locus_tag LOCUS_11430 22406 22801 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942959.1 protein_id gnl|my_center|LOCUS_11430 23306 22833 gene locus_tag LOCUS_11440 23306 22833 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728162.1 protein_id gnl|my_center|LOCUS_11440 24487 23405 gene locus_tag LOCUS_11450 24487 23405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 24665 25231 gene locus_tag LOCUS_11460 24665 25231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 25328 25666 gene locus_tag LOCUS_11470 25328 25666 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410065.1 protein_id gnl|my_center|LOCUS_11470 26048 25686 gene locus_tag LOCUS_11480 26048 25686 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408743.1 protein_id gnl|my_center|LOCUS_11480 26197 26952 gene locus_tag LOCUS_11490 26197 26952 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729134.1 protein_id gnl|my_center|LOCUS_11490 27512 26967 gene locus_tag LOCUS_11500 27512 26967 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409503.1 protein_id gnl|my_center|LOCUS_11500 28179 27541 gene locus_tag LOCUS_11510 28179 27541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 29118 28312 gene locus_tag LOCUS_11520 29118 28312 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226039.1 protein_id gnl|my_center|LOCUS_11520 29437 29126 gene locus_tag LOCUS_11530 29437 29126 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227689.1 protein_id gnl|my_center|LOCUS_11530 30396 29434 gene locus_tag LOCUS_11540 30396 29434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 30536 30979 gene locus_tag LOCUS_11550 30536 30979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409509.1 protein_id gnl|my_center|LOCUS_11550 32128 30995 gene locus_tag LOCUS_11560 32128 30995 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112987.1 protein_id gnl|my_center|LOCUS_11560 32331 32669 gene locus_tag LOCUS_11570 32331 32669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence026 1529 609 gene locus_tag LOCUS_11580 1529 609 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730524.1 protein_id gnl|my_center|LOCUS_11580 5194 1526 gene locus_tag LOCUS_11590 gene mfd 5194 1526 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730525.1 protein_id gnl|my_center|LOCUS_11590 5850 5257 gene locus_tag LOCUS_11600 5850 5257 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405271.1 protein_id gnl|my_center|LOCUS_11600 5936 6008 gene locus_tag LOCUS_t00100 5936 6008 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6174 7634 gene locus_tag LOCUS_11610 gene glmU 6174 7634 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405267.1 protein_id gnl|my_center|LOCUS_11610 7695 8675 gene locus_tag LOCUS_11620 7695 8675 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896824.1 protein_id gnl|my_center|LOCUS_11620 8688 9341 gene locus_tag LOCUS_11630 8688 9341 CDS product LpqN/LpqT family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898691.1 protein_id gnl|my_center|LOCUS_11630 9352 10218 gene locus_tag LOCUS_11640 9352 10218 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730529.1 protein_id gnl|my_center|LOCUS_11640 10348 11004 gene locus_tag LOCUS_11650 10348 11004 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896828.1 protein_id gnl|my_center|LOCUS_11650 11011 11586 gene locus_tag LOCUS_11660 gene pth 11011 11586 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730530.1 protein_id gnl|my_center|LOCUS_11660 11920 11618 gene locus_tag LOCUS_11670 11920 11618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 12208 11981 gene locus_tag LOCUS_11680 12208 11981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 12734 12261 gene locus_tag LOCUS_11690 12734 12261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 14524 12821 gene locus_tag LOCUS_11700 14524 12821 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405202.1 protein_id gnl|my_center|LOCUS_11700 15654 14722 gene locus_tag LOCUS_11710 15654 14722 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045756603.1 protein_id gnl|my_center|LOCUS_11710 16638 15709 gene locus_tag LOCUS_11720 gene rsmA 16638 15709 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049745160.1 protein_id gnl|my_center|LOCUS_11720 17756 16635 gene locus_tag LOCUS_11730 17756 16635 CDS product resuscitation-promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896836.1 protein_id gnl|my_center|LOCUS_11730 18741 17875 gene locus_tag LOCUS_11740 18741 17875 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896837.1 protein_id gnl|my_center|LOCUS_11740 18740 20287 gene locus_tag LOCUS_11750 gene metG 18740 20287 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730537.1 protein_id gnl|my_center|LOCUS_11750 20381 21655 gene locus_tag LOCUS_11760 20381 21655 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003905428.1 protein_id gnl|my_center|LOCUS_11760 22530 21604 gene locus_tag LOCUS_11770 gene rsmI 22530 21604 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730540.1 protein_id gnl|my_center|LOCUS_11770 22514 24073 gene locus_tag LOCUS_11780 22514 24073 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730541.1 protein_id gnl|my_center|LOCUS_11780 25301 24093 gene locus_tag LOCUS_11790 gene arcA 25301 24093 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730543.1 protein_id gnl|my_center|LOCUS_11790 25371 26012 gene locus_tag LOCUS_11800 25371 26012 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896847.1 protein_id gnl|my_center|LOCUS_11800 26687 26037 gene locus_tag LOCUS_11810 26687 26037 CDS product DUF5642 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730544.1 protein_id gnl|my_center|LOCUS_11810 27352 26711 gene locus_tag LOCUS_11820 27352 26711 CDS product DUF5642 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730545.1 protein_id gnl|my_center|LOCUS_11820 27867 27367 gene locus_tag LOCUS_11830 27867 27367 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892495.1 protein_id gnl|my_center|LOCUS_11830 27950 28645 gene locus_tag LOCUS_11840 27950 28645 CDS product LpqN/LpqT family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403052.1 protein_id gnl|my_center|LOCUS_11840 29696 28659 gene locus_tag LOCUS_11850 29696 28659 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405164.1 protein_id gnl|my_center|LOCUS_11850 30736 29717 gene locus_tag LOCUS_11860 30736 29717 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727207.1 protein_id gnl|my_center|LOCUS_11860 31248 30733 gene locus_tag LOCUS_11870 31248 30733 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031817.1 protein_id gnl|my_center|LOCUS_11870 32306 31239 gene locus_tag LOCUS_11880 32306 31239 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727205.1 protein_id gnl|my_center|LOCUS_11880 >Feature sequence027 110 715 gene locus_tag LOCUS_11890 110 715 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908916.1 protein_id gnl|my_center|LOCUS_11890 788 1552 gene locus_tag LOCUS_11900 788 1552 CDS product evbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135362122.1 protein_id gnl|my_center|LOCUS_11900 1566 2780 gene locus_tag LOCUS_11910 1566 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 2941 2711 gene locus_tag LOCUS_11920 2941 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 2973 4865 gene locus_tag LOCUS_11930 2973 4865 CDS product glucose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390207.1 protein_id gnl|my_center|LOCUS_11930 5460 4975 gene locus_tag LOCUS_11940 5460 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 6719 5457 gene locus_tag LOCUS_11950 6719 5457 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742232.1 protein_id gnl|my_center|LOCUS_11950 8678 6861 gene locus_tag LOCUS_11960 8678 6861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 10138 8675 gene locus_tag LOCUS_11970 10138 8675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 10469 10197 gene locus_tag LOCUS_11980 10469 10197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 13800 10540 gene locus_tag LOCUS_11990 13800 10540 CDS product arabinosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462554.1 protein_id gnl|my_center|LOCUS_11990 17097 13831 gene locus_tag LOCUS_12000 17097 13831 CDS product arabinosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731254.1 protein_id gnl|my_center|LOCUS_12000 20466 17212 gene locus_tag LOCUS_12010 gene embC 20466 17212 CDS product arabinosyltransferase EmbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420638.1 protein_id gnl|my_center|LOCUS_12010 22558 20636 gene locus_tag LOCUS_12020 gene aftA 22558 20636 CDS product galactan 5-O-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899694.1 protein_id gnl|my_center|LOCUS_12020 23330 22566 gene locus_tag LOCUS_12030 23330 22566 CDS product decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731251.1 protein_id gnl|my_center|LOCUS_12030 24716 23331 gene locus_tag LOCUS_12040 24716 23331 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897792.1 protein_id gnl|my_center|LOCUS_12040 25152 24733 gene locus_tag LOCUS_12050 25152 24733 CDS product arabinogalactan biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420627.1 protein_id gnl|my_center|LOCUS_12050 25315 25758 gene locus_tag LOCUS_12060 25315 25758 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082943.1 protein_id gnl|my_center|LOCUS_12060 26609 25779 gene locus_tag LOCUS_12070 26609 25779 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731237.1 protein_id gnl|my_center|LOCUS_12070 27523 26606 gene locus_tag LOCUS_12080 27523 26606 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731236.1 protein_id gnl|my_center|LOCUS_12080 28335 27520 gene locus_tag LOCUS_12090 28335 27520 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731235.1 protein_id gnl|my_center|LOCUS_12090 28867 28349 gene locus_tag LOCUS_12100 28867 28349 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731234.1 protein_id gnl|my_center|LOCUS_12100 30869 28893 gene locus_tag LOCUS_12110 30869 28893 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420597.1 protein_id gnl|my_center|LOCUS_12110 30966 32162 gene locus_tag LOCUS_12120 30966 32162 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731233.1 protein_id gnl|my_center|LOCUS_12120 >Feature sequence028 1094 2935 gene locus_tag LOCUS_12130 gene ctaD 1094 2935 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415946.1 protein_id gnl|my_center|LOCUS_12130 2965 4197 gene locus_tag LOCUS_12140 gene serB 2965 4197 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893690.1 protein_id gnl|my_center|LOCUS_12140 4240 5079 gene locus_tag LOCUS_12150 4240 5079 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727371.1 protein_id gnl|my_center|LOCUS_12150 5076 5966 gene locus_tag LOCUS_12160 5076 5966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415943.1 protein_id gnl|my_center|LOCUS_12160 5970 6683 gene locus_tag LOCUS_12170 5970 6683 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415942.1 protein_id gnl|my_center|LOCUS_12170 6694 7662 gene locus_tag LOCUS_12180 6694 7662 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727373.1 protein_id gnl|my_center|LOCUS_12180 7620 8846 gene locus_tag LOCUS_12190 7620 8846 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727374.1 protein_id gnl|my_center|LOCUS_12190 8856 9542 gene locus_tag LOCUS_12200 8856 9542 CDS product RsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415939.1 protein_id gnl|my_center|LOCUS_12200 10935 9430 gene locus_tag LOCUS_12210 10935 9430 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113389.1 protein_id gnl|my_center|LOCUS_12210 12273 10984 gene locus_tag LOCUS_12220 12273 10984 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727377.1 protein_id gnl|my_center|LOCUS_12220 12358 13095 gene locus_tag LOCUS_12230 12358 13095 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902399.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12230 14335 13106 gene locus_tag LOCUS_12240 14335 13106 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415928.1 protein_id gnl|my_center|LOCUS_12240 15980 14436 gene locus_tag LOCUS_12250 15980 14436 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899891.1 protein_id gnl|my_center|LOCUS_12250 16927 16049 gene locus_tag LOCUS_12260 16927 16049 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893717.1 protein_id gnl|my_center|LOCUS_12260 17033 17824 gene locus_tag LOCUS_12270 17033 17824 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728286.1 protein_id gnl|my_center|LOCUS_12270 17876 18832 gene locus_tag LOCUS_12280 17876 18832 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899889.1 protein_id gnl|my_center|LOCUS_12280 19588 18908 gene locus_tag LOCUS_12290 19588 18908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 19694 20908 gene locus_tag LOCUS_12300 19694 20908 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728292.1 protein_id gnl|my_center|LOCUS_12300 20923 21996 gene locus_tag LOCUS_12310 gene mnmA 20923 21996 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893725.1 protein_id gnl|my_center|LOCUS_12310 22006 23016 gene locus_tag LOCUS_12320 22006 23016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415268.1 protein_id gnl|my_center|LOCUS_12320 23042 24598 gene locus_tag LOCUS_12330 23042 24598 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898989.1 protein_id gnl|my_center|LOCUS_12330 24883 24629 gene locus_tag LOCUS_12340 24883 24629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 25285 24950 gene locus_tag LOCUS_12350 25285 24950 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084922.1 protein_id gnl|my_center|LOCUS_12350 25453 27549 gene locus_tag LOCUS_12360 gene ligA 25453 27549 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728295.1 protein_id gnl|my_center|LOCUS_12360 28235 27546 gene locus_tag LOCUS_12370 28235 27546 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519583.1 protein_id gnl|my_center|LOCUS_12370 28296 28595 gene locus_tag LOCUS_12380 gene gatC 28296 28595 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893732.1 protein_id gnl|my_center|LOCUS_12380 28595 30079 gene locus_tag LOCUS_12390 gene gatA 28595 30079 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893733.1 protein_id gnl|my_center|LOCUS_12390 31703 30135 gene locus_tag LOCUS_12400 31703 30135 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085748.1 protein_id gnl|my_center|LOCUS_12400 >Feature sequence029 1 381 gene locus_tag LOCUS_12410 1 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 2030 378 gene locus_tag LOCUS_12420 2030 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 2256 4427 gene locus_tag LOCUS_12430 2256 4427 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027934.1 protein_id gnl|my_center|LOCUS_12430 5115 4444 gene locus_tag LOCUS_12440 5115 4444 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726755.1 protein_id gnl|my_center|LOCUS_12440 5636 5136 gene locus_tag LOCUS_12450 5636 5136 CDS product TIGR04338 family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401120.1 protein_id gnl|my_center|LOCUS_12450 6385 5633 gene locus_tag LOCUS_12460 6385 5633 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401116.1 protein_id gnl|my_center|LOCUS_12460 7554 6511 gene locus_tag LOCUS_12470 7554 6511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104120.1 protein_id gnl|my_center|LOCUS_12470 8390 7551 gene locus_tag LOCUS_12480 8390 7551 CDS product monoacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401112.1 protein_id gnl|my_center|LOCUS_12480 8624 9700 gene locus_tag LOCUS_12490 8624 9700 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899845.1 protein_id gnl|my_center|LOCUS_12490 10451 9711 gene locus_tag LOCUS_12500 10451 9711 CDS product Mce associated membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899844.1 protein_id gnl|my_center|LOCUS_12500 10966 10418 gene locus_tag LOCUS_12510 10966 10418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726697.1 protein_id gnl|my_center|LOCUS_12510 12129 10963 gene locus_tag LOCUS_12520 12129 10963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 12635 12126 gene locus_tag LOCUS_12530 12635 12126 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891472.1 protein_id gnl|my_center|LOCUS_12530 14302 12719 gene locus_tag LOCUS_12540 14302 12719 CDS product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401091.1 protein_id gnl|my_center|LOCUS_12540 15466 14315 gene locus_tag LOCUS_12550 15466 14315 CDS product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891470.1 protein_id gnl|my_center|LOCUS_12550 17076 15463 gene locus_tag LOCUS_12560 17076 15463 CDS product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726693.1 protein_id gnl|my_center|LOCUS_12560 18546 17080 gene locus_tag LOCUS_12570 18546 17080 CDS product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726692.1 protein_id gnl|my_center|LOCUS_12570 19583 18543 gene locus_tag LOCUS_12580 19583 18543 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726691.1 protein_id gnl|my_center|LOCUS_12580 20794 19580 gene locus_tag LOCUS_12590 20794 19580 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003915845.1 protein_id gnl|my_center|LOCUS_12590 21597 20797 gene locus_tag LOCUS_12600 21597 20797 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891465.1 protein_id gnl|my_center|LOCUS_12600 22452 21658 gene locus_tag LOCUS_12610 22452 21658 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726689.1 protein_id gnl|my_center|LOCUS_12610 24248 22629 gene locus_tag LOCUS_12620 gene fadD5 24248 22629 CDS product fatty-acid--CoA ligase FadD5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726688.1 protein_id gnl|my_center|LOCUS_12620 24785 24342 gene locus_tag LOCUS_12630 24785 24342 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323537.1 protein_id gnl|my_center|LOCUS_12630 25444 24785 gene locus_tag LOCUS_12640 25444 24785 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401044.1 protein_id gnl|my_center|LOCUS_12640 25570 25692 gene locus_tag LOCUS_12650 25570 25692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726678.1 protein_id gnl|my_center|LOCUS_12650 27226 25775 gene locus_tag LOCUS_12660 27226 25775 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977903.1 protein_id gnl|my_center|LOCUS_12660 27266 27748 gene locus_tag LOCUS_12670 27266 27748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 29162 27735 gene locus_tag LOCUS_12680 29162 27735 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071687.1 protein_id gnl|my_center|LOCUS_12680 29494 29159 gene locus_tag LOCUS_12690 29494 29159 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891483.1 protein_id gnl|my_center|LOCUS_12690 30585 29494 gene locus_tag LOCUS_12700 30585 29494 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063775.1 protein_id gnl|my_center|LOCUS_12700 >Feature sequence030 206 805 gene locus_tag LOCUS_12710 206 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 3718 830 gene locus_tag LOCUS_12720 gene mmpL5 3718 830 CDS product siderophore RND transporter MmpL5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900997.1 protein_id gnl|my_center|LOCUS_12720 4143 3715 gene locus_tag LOCUS_12730 gene mmpS5 4143 3715 CDS product siderophore transporter accessory protein MmpS5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403439.1 protein_id gnl|my_center|LOCUS_12730 4619 4140 gene locus_tag LOCUS_12740 gene mmpR5 4619 4140 CDS product siderophore transport transcriptional regulator MmpR5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403442.1 protein_id gnl|my_center|LOCUS_12740 4693 6954 gene locus_tag LOCUS_12750 4693 6954 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086677.1 protein_id gnl|my_center|LOCUS_12750 6951 7391 gene locus_tag LOCUS_12760 6951 7391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 7478 7861 gene locus_tag LOCUS_12770 7478 7861 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866702.1 protein_id gnl|my_center|LOCUS_12770 7887 9134 gene locus_tag LOCUS_12780 7887 9134 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_12780 9146 9757 gene locus_tag LOCUS_12790 9146 9757 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225458.1 protein_id gnl|my_center|LOCUS_12790 10011 9784 gene locus_tag LOCUS_12800 10011 9784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 9911 11401 gene locus_tag LOCUS_12810 9911 11401 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811563.1 protein_id gnl|my_center|LOCUS_12810 11398 12174 gene locus_tag LOCUS_12820 11398 12174 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920196.1 protein_id gnl|my_center|LOCUS_12820 13182 12292 gene locus_tag LOCUS_12830 13182 12292 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026311868.1 protein_id gnl|my_center|LOCUS_12830 14111 13179 gene locus_tag LOCUS_12840 14111 13179 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065472.1 protein_id gnl|my_center|LOCUS_12840 15658 14114 gene locus_tag LOCUS_12850 15658 14114 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065470.1 protein_id gnl|my_center|LOCUS_12850 15786 18113 gene locus_tag LOCUS_12860 15786 18113 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844465.1 protein_id gnl|my_center|LOCUS_12860 18115 18792 gene locus_tag LOCUS_12870 18115 18792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 18805 21156 gene locus_tag LOCUS_12880 18805 21156 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022605.1 protein_id gnl|my_center|LOCUS_12880 22596 21184 gene locus_tag LOCUS_12890 22596 21184 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727675.1 protein_id gnl|my_center|LOCUS_12890 23301 22879 gene locus_tag LOCUS_12900 23301 22879 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227971.1 protein_id gnl|my_center|LOCUS_12900 23528 23298 gene locus_tag LOCUS_12910 23528 23298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 23927 23538 gene locus_tag LOCUS_12920 23927 23538 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409778.1 protein_id gnl|my_center|LOCUS_12920 24136 23900 gene locus_tag LOCUS_12930 24136 23900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 24525 24157 gene locus_tag LOCUS_12940 24525 24157 CDS product DUF4345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728109.1 protein_id gnl|my_center|LOCUS_12940 25362 24655 gene locus_tag LOCUS_12950 25362 24655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 25820 25359 gene locus_tag LOCUS_12960 25820 25359 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008130072.1 protein_id gnl|my_center|LOCUS_12960 25943 26575 gene locus_tag LOCUS_12970 25943 26575 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083497.1 protein_id gnl|my_center|LOCUS_12970 27702 26593 gene locus_tag LOCUS_12980 27702 26593 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728430.1 protein_id gnl|my_center|LOCUS_12980 28813 28202 gene locus_tag LOCUS_12990 28813 28202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 30002 28884 gene locus_tag LOCUS_13000 30002 28884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 >Feature sequence031 1880 720 gene locus_tag LOCUS_13010 1880 720 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104375.1 protein_id gnl|my_center|LOCUS_13010 2719 1877 gene locus_tag LOCUS_13020 2719 1877 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729686.1 protein_id gnl|my_center|LOCUS_13020 3276 2734 gene locus_tag LOCUS_13030 3276 2734 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729685.1 protein_id gnl|my_center|LOCUS_13030 6336 4426 gene locus_tag LOCUS_13040 6336 4426 CDS product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901350.1 protein_id gnl|my_center|LOCUS_13040 6473 6703 gene locus_tag LOCUS_13050 6473 6703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104374.1 protein_id gnl|my_center|LOCUS_13050 6877 7983 gene locus_tag LOCUS_13060 gene ripC 6877 7983 CDS product peptidoglycan hydrolase RipC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907994.1 protein_id gnl|my_center|LOCUS_13060 8162 8866 gene locus_tag LOCUS_13070 8162 8866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411371.1 protein_id gnl|my_center|LOCUS_13070 8893 10041 gene locus_tag LOCUS_13080 gene pimB 8893 10041 CDS product GDP-mannose-dependent alpha-(1-6)-phosphatidylinositol monomannoside mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411369.1 protein_id gnl|my_center|LOCUS_13080 10052 10441 gene locus_tag LOCUS_13090 10052 10441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411357.1 protein_id gnl|my_center|LOCUS_13090 10527 10976 gene locus_tag LOCUS_13100 10527 10976 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729676.1 protein_id gnl|my_center|LOCUS_13100 10963 12243 gene locus_tag LOCUS_13110 10963 12243 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729675.1 protein_id gnl|my_center|LOCUS_13110 12240 12698 gene locus_tag LOCUS_13120 12240 12698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729674.1 protein_id gnl|my_center|LOCUS_13120 12794 13540 gene locus_tag LOCUS_13130 12794 13540 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411341.1 protein_id gnl|my_center|LOCUS_13130 14792 13482 gene locus_tag LOCUS_13140 14792 13482 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877982.1 protein_id gnl|my_center|LOCUS_13140 14833 15786 gene locus_tag LOCUS_13150 14833 15786 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729672.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13150 15794 16336 gene locus_tag LOCUS_13160 15794 16336 CDS product polyadenylate-specific 3'-exoribonuclease AS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411331.1 protein_id gnl|my_center|LOCUS_13160 16356 17741 gene locus_tag LOCUS_13170 16356 17741 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411323.1 protein_id gnl|my_center|LOCUS_13170 18968 17760 gene locus_tag LOCUS_13180 18968 17760 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877981.1 protein_id gnl|my_center|LOCUS_13180 19058 19468 gene locus_tag LOCUS_13190 19058 19468 CDS product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900481.1 protein_id gnl|my_center|LOCUS_13190 20965 19481 gene locus_tag LOCUS_13200 20965 19481 CDS product alpha-(1->6)-mannopyranosyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729668.1 protein_id gnl|my_center|LOCUS_13200 22094 20970 gene locus_tag LOCUS_13210 22094 20970 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729667.1 protein_id gnl|my_center|LOCUS_13210 22811 22113 gene locus_tag LOCUS_13220 gene lppM 22811 22113 CDS product lipoprotein LppM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411238.1 protein_id gnl|my_center|LOCUS_13220 23438 22839 gene locus_tag LOCUS_13230 23438 22839 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895631.1 protein_id gnl|my_center|LOCUS_13230 23767 24168 gene locus_tag LOCUS_13240 23767 24168 CDS product DUF3040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729665.1 protein_id gnl|my_center|LOCUS_13240 24432 24863 gene locus_tag LOCUS_13250 gene mraZ 24432 24863 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908012.1 protein_id gnl|my_center|LOCUS_13250 25000 26007 gene locus_tag LOCUS_13260 gene rsmH 25000 26007 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729663.1 protein_id gnl|my_center|LOCUS_13260 26004 27206 gene locus_tag LOCUS_13270 26004 27206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13270 27359 29179 gene locus_tag LOCUS_13280 27359 29179 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729661.1 protein_id gnl|my_center|LOCUS_13280 >Feature sequence032 1418 2695 gene locus_tag LOCUS_13290 1418 2695 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731035.1 protein_id gnl|my_center|LOCUS_13290 4458 2701 gene locus_tag LOCUS_13300 4458 2701 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730611.1 protein_id gnl|my_center|LOCUS_13300 4602 4799 gene locus_tag LOCUS_13310 4602 4799 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405863.1 protein_id gnl|my_center|LOCUS_13310 4796 5167 gene locus_tag LOCUS_13320 4796 5167 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405865.1 protein_id gnl|my_center|LOCUS_13320 5586 5176 gene locus_tag LOCUS_13330 5586 5176 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888560.1 protein_id gnl|my_center|LOCUS_13330 6854 5613 gene locus_tag LOCUS_13340 6854 5613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 7698 6865 gene locus_tag LOCUS_13350 7698 6865 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227801.1 protein_id gnl|my_center|LOCUS_13350 7790 8509 gene locus_tag LOCUS_13360 7790 8509 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030151.1 protein_id gnl|my_center|LOCUS_13360 9516 8506 gene locus_tag LOCUS_13370 9516 8506 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229398.1 protein_id gnl|my_center|LOCUS_13370 9550 10041 gene locus_tag LOCUS_13380 9550 10041 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227904.1 protein_id gnl|my_center|LOCUS_13380 10055 11572 gene locus_tag LOCUS_13390 10055 11572 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098598.1 protein_id gnl|my_center|LOCUS_13390 13011 11590 gene locus_tag LOCUS_13400 13011 11590 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104502.1 protein_id gnl|my_center|LOCUS_13400 14096 13074 gene locus_tag LOCUS_13410 14096 13074 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727499.1 protein_id gnl|my_center|LOCUS_13410 15190 14093 gene locus_tag LOCUS_13420 15190 14093 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727498.1 protein_id gnl|my_center|LOCUS_13420 15757 15509 gene locus_tag LOCUS_13430 15757 15509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 15916 15782 gene locus_tag LOCUS_13440 15916 15782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 16427 16011 gene locus_tag LOCUS_13450 16427 16011 CDS product ribonuclease VapC6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403365.1 protein_id gnl|my_center|LOCUS_13450 16645 16424 gene locus_tag LOCUS_13460 16645 16424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 16749 17117 gene locus_tag LOCUS_13470 16749 17117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 17146 19323 gene locus_tag LOCUS_13480 17146 19323 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796108.1 protein_id gnl|my_center|LOCUS_13480 20332 19364 gene locus_tag LOCUS_13490 20332 19364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 20585 20875 gene locus_tag LOCUS_13500 20585 20875 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259052.1 protein_id gnl|my_center|LOCUS_13500 21617 20877 gene locus_tag LOCUS_13510 21617 20877 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974589.1 protein_id gnl|my_center|LOCUS_13510 22066 21677 gene locus_tag LOCUS_13520 22066 21677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 22332 22063 gene locus_tag LOCUS_13530 22332 22063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 22563 22420 gene locus_tag LOCUS_13540 22563 22420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 22668 23435 gene locus_tag LOCUS_13550 22668 23435 CDS product DUF1906 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082750.1 protein_id gnl|my_center|LOCUS_13550 23447 24184 gene locus_tag LOCUS_13560 23447 24184 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203367.1 protein_id gnl|my_center|LOCUS_13560 24797 24243 gene locus_tag LOCUS_13570 24797 24243 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893663.1 protein_id gnl|my_center|LOCUS_13570 26184 24844 gene locus_tag LOCUS_13580 26184 24844 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727104.1 protein_id gnl|my_center|LOCUS_13580 26490 26717 gene locus_tag LOCUS_13590 26490 26717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 26707 27135 gene locus_tag LOCUS_13600 26707 27135 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410811.1 protein_id gnl|my_center|LOCUS_13600 27890 27159 gene locus_tag LOCUS_13610 27890 27159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403862.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence033 288 560 gene locus_tag LOCUS_13620 288 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730324.1 protein_id gnl|my_center|LOCUS_13620 2861 651 gene locus_tag LOCUS_13630 gene katG 2861 651 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731250.1 protein_id gnl|my_center|LOCUS_13630 3383 2940 gene locus_tag LOCUS_13640 3383 2940 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899076.1 protein_id gnl|my_center|LOCUS_13640 3447 4334 gene locus_tag LOCUS_13650 3447 4334 CDS product 5,10-methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731390.1 protein_id gnl|my_center|LOCUS_13650 4331 5308 gene locus_tag LOCUS_13660 4331 5308 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729102.1 protein_id gnl|my_center|LOCUS_13660 6682 5327 gene locus_tag LOCUS_13670 6682 5327 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899094.1 protein_id gnl|my_center|LOCUS_13670 7737 6754 gene locus_tag LOCUS_13680 7737 6754 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726700.1 protein_id gnl|my_center|LOCUS_13680 7893 8816 gene locus_tag LOCUS_13690 7893 8816 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728516.1 protein_id gnl|my_center|LOCUS_13690 10486 8834 gene locus_tag LOCUS_13700 10486 8834 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406598.1 protein_id gnl|my_center|LOCUS_13700 10440 11366 gene locus_tag LOCUS_13710 10440 11366 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228883.1 protein_id gnl|my_center|LOCUS_13710 11435 11728 gene locus_tag LOCUS_13720 11435 11728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 13159 11750 gene locus_tag LOCUS_13730 13159 11750 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893816.1 protein_id gnl|my_center|LOCUS_13730 13438 13920 gene locus_tag LOCUS_13740 13438 13920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 14239 13943 gene locus_tag LOCUS_13750 14239 13943 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057245.1 protein_id gnl|my_center|LOCUS_13750 15142 14354 gene locus_tag LOCUS_13760 15142 14354 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731119.1 protein_id gnl|my_center|LOCUS_13760 15141 17033 gene locus_tag LOCUS_13770 15141 17033 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894908.1 protein_id gnl|my_center|LOCUS_13770 17037 17999 gene locus_tag LOCUS_13780 17037 17999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 17297 17374 gene locus_tag LOCUS_t00110 17297 17374 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 18880 18275 gene locus_tag LOCUS_13790 18880 18275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 18798 19766 gene locus_tag LOCUS_13800 18798 19766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 20101 21357 gene locus_tag LOCUS_13810 gene arcA 20101 21357 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111744.1 protein_id gnl|my_center|LOCUS_13810 21384 22388 gene locus_tag LOCUS_13820 21384 22388 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005651072.1 protein_id gnl|my_center|LOCUS_13820 22385 23290 gene locus_tag LOCUS_13830 gene arcC 22385 23290 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100033.1 protein_id gnl|my_center|LOCUS_13830 23353 24870 gene locus_tag LOCUS_13840 23353 24870 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727738.1 protein_id gnl|my_center|LOCUS_13840 25429 24887 gene locus_tag LOCUS_13850 25429 24887 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729065.1 protein_id gnl|my_center|LOCUS_13850 25917 25549 gene locus_tag LOCUS_13860 25917 25549 CDS product thiocyanate hydrolase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897690.1 protein_id gnl|my_center|LOCUS_13860 26585 25923 gene locus_tag LOCUS_13870 gene scnC 26585 25923 CDS product thiocyanate hydrolase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731167.1 protein_id gnl|my_center|LOCUS_13870 27531 26692 gene locus_tag LOCUS_13880 27531 26692 CDS product nitrile hydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104591.1 protein_id gnl|my_center|LOCUS_13880 28486 27611 gene locus_tag LOCUS_13890 28486 27611 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104122.1 protein_id gnl|my_center|LOCUS_13890 <29473 28515 gene locus_tag LOCUS_13900 <29473 28515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005089938.1:2-aminoethylphosphonate ABC transporter substrate-binding protein >Feature sequence034 290 925 gene locus_tag LOCUS_13910 290 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 2476 938 gene locus_tag LOCUS_13920 2476 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 3003 2551 gene locus_tag LOCUS_13930 3003 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 3478 3194 gene locus_tag LOCUS_13940 3478 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 4103 3618 gene locus_tag LOCUS_13950 4103 3618 CDS product TIGR04338 family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401120.1 protein_id gnl|my_center|LOCUS_13950 4918 4100 gene locus_tag LOCUS_13960 4918 4100 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401116.1 protein_id gnl|my_center|LOCUS_13960 5814 4930 gene locus_tag LOCUS_13970 5814 4930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 6950 5940 gene locus_tag LOCUS_13980 6950 5940 CDS product DUF4192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413965.1 protein_id gnl|my_center|LOCUS_13980 7303 7094 gene locus_tag LOCUS_13990 7303 7094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 7688 7296 gene locus_tag LOCUS_14000 7688 7296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 7951 7685 gene locus_tag LOCUS_14010 7951 7685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 8544 8092 gene locus_tag LOCUS_14020 8544 8092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 8938 8597 gene locus_tag LOCUS_14030 8938 8597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 9346 8954 gene locus_tag LOCUS_14040 9346 8954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 9881 9459 gene locus_tag LOCUS_14050 9881 9459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 10167 9874 gene locus_tag LOCUS_14060 10167 9874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 10361 10164 gene locus_tag LOCUS_14070 10361 10164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 10925 10500 gene locus_tag LOCUS_14080 10925 10500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 12136 11048 gene locus_tag LOCUS_14090 12136 11048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 13557 12190 gene locus_tag LOCUS_14100 13557 12190 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975990.1 protein_id gnl|my_center|LOCUS_14100 14842 13664 gene locus_tag LOCUS_14110 14842 13664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 15018 14839 gene locus_tag LOCUS_14120 15018 14839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 16514 15135 gene locus_tag LOCUS_14130 16514 15135 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809081.1 protein_id gnl|my_center|LOCUS_14130 17620 16511 gene locus_tag LOCUS_14140 17620 16511 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809085.1 protein_id gnl|my_center|LOCUS_14140 18067 17744 gene locus_tag LOCUS_14150 18067 17744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 18647 18952 gene locus_tag LOCUS_14160 18647 18952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 19837 19178 gene locus_tag LOCUS_14170 19837 19178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 20329 19940 gene locus_tag LOCUS_14180 20329 19940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 20940 20506 gene locus_tag LOCUS_14190 20940 20506 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813311.1 protein_id gnl|my_center|LOCUS_14190 21480 20977 gene locus_tag LOCUS_14200 21480 20977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 21756 21484 gene locus_tag LOCUS_14210 21756 21484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 22448 22173 gene locus_tag LOCUS_14220 22448 22173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 24749 22608 gene locus_tag LOCUS_14230 24749 22608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 24964 24746 gene locus_tag LOCUS_14240 24964 24746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 25338 24970 gene locus_tag LOCUS_14250 25338 24970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 26045 25335 gene locus_tag LOCUS_14260 26045 25335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 26389 26042 gene locus_tag LOCUS_14270 26389 26042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 27582 26611 gene locus_tag LOCUS_14280 27582 26611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 28178 27783 gene locus_tag LOCUS_14290 28178 27783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 28486 28217 gene locus_tag LOCUS_14300 28486 28217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 >Feature sequence035 1238 1846 gene locus_tag LOCUS_14310 1238 1846 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729921.1 protein_id gnl|my_center|LOCUS_14310 2302 1847 gene locus_tag LOCUS_14320 2302 1847 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224278.1 protein_id gnl|my_center|LOCUS_14320 2388 3212 gene locus_tag LOCUS_14330 2388 3212 CDS product Rv2407 family type 3 sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412350.1 protein_id gnl|my_center|LOCUS_14330 4056 3217 gene locus_tag LOCUS_14340 4056 3217 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729930.1 protein_id gnl|my_center|LOCUS_14340 5045 4056 gene locus_tag LOCUS_14350 5045 4056 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895947.1 protein_id gnl|my_center|LOCUS_14350 6700 5045 gene locus_tag LOCUS_14360 6700 5045 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084969.1 protein_id gnl|my_center|LOCUS_14360 6862 7122 gene locus_tag LOCUS_14370 gene rpsT 6862 7122 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899314.1 protein_id gnl|my_center|LOCUS_14370 8125 7127 gene locus_tag LOCUS_14380 gene holA 8125 7127 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729932.1 protein_id gnl|my_center|LOCUS_14380 9661 8138 gene locus_tag LOCUS_14390 9661 8138 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412371.1 protein_id gnl|my_center|LOCUS_14390 10520 9666 gene locus_tag LOCUS_14400 10520 9666 CDS product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412373.1 protein_id gnl|my_center|LOCUS_14400 10663 11730 gene locus_tag LOCUS_14410 10663 11730 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727034.1 protein_id gnl|my_center|LOCUS_14410 12560 11727 gene locus_tag LOCUS_14420 12560 11727 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412381.1 protein_id gnl|my_center|LOCUS_14420 13314 12565 gene locus_tag LOCUS_14430 13314 12565 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412384.1 protein_id gnl|my_center|LOCUS_14430 13981 13304 gene locus_tag LOCUS_14440 13981 13304 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895958.1 protein_id gnl|my_center|LOCUS_14440 14355 13978 gene locus_tag LOCUS_14450 gene rsfS 14355 13978 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729939.1 protein_id gnl|my_center|LOCUS_14450 15008 14352 gene locus_tag LOCUS_14460 gene nadD 15008 14352 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908347.1 protein_id gnl|my_center|LOCUS_14460 16466 15027 gene locus_tag LOCUS_14470 16466 15027 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412513.1 protein_id gnl|my_center|LOCUS_14470 17366 16476 gene locus_tag LOCUS_14480 17366 16476 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895962.1 protein_id gnl|my_center|LOCUS_14480 18634 17384 gene locus_tag LOCUS_14490 18634 17384 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729942.1 protein_id gnl|my_center|LOCUS_14490 18701 19303 gene locus_tag LOCUS_14500 18701 19303 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495802.1 protein_id gnl|my_center|LOCUS_14500 19374 20348 gene locus_tag LOCUS_14510 19374 20348 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898002.1 protein_id gnl|my_center|LOCUS_14510 22393 20351 gene locus_tag LOCUS_14520 22393 20351 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729965.1 protein_id gnl|my_center|LOCUS_14520 22518 23396 gene locus_tag LOCUS_14530 22518 23396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729967.1 protein_id gnl|my_center|LOCUS_14530 23432 24688 gene locus_tag LOCUS_14540 23432 24688 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410095.1 protein_id gnl|my_center|LOCUS_14540 24780 25502 gene locus_tag LOCUS_14550 24780 25502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 26575 25475 gene locus_tag LOCUS_14560 gene proB 26575 25475 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412568.1 protein_id gnl|my_center|LOCUS_14560 28032 26572 gene locus_tag LOCUS_14570 gene obgE 28032 26572 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729970.1 protein_id gnl|my_center|LOCUS_14570 28384 28121 gene locus_tag LOCUS_14580 gene rpmA 28384 28121 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896001.1 protein_id gnl|my_center|LOCUS_14580 28725 28402 gene locus_tag LOCUS_14590 gene rplU 28725 28402 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060209.1 protein_id gnl|my_center|LOCUS_14590 >Feature sequence036 1192 923 gene locus_tag LOCUS_14600 1192 923 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878424.1 protein_id gnl|my_center|LOCUS_14600 2259 1195 gene locus_tag LOCUS_14610 gene moaA 2259 1195 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730719.1 protein_id gnl|my_center|LOCUS_14610 2666 2256 gene locus_tag LOCUS_14620 2666 2256 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897109.1 protein_id gnl|my_center|LOCUS_14620 2795 3208 gene locus_tag LOCUS_14630 2795 3208 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897108.1 protein_id gnl|my_center|LOCUS_14630 3721 3227 gene locus_tag LOCUS_14640 3721 3227 CDS product DUF2771 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404591.1 protein_id gnl|my_center|LOCUS_14640 5385 3718 gene locus_tag LOCUS_14650 5385 3718 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900225.1 protein_id gnl|my_center|LOCUS_14650 5421 6353 gene locus_tag LOCUS_14660 5421 6353 CDS product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104387.1 protein_id gnl|my_center|LOCUS_14660 6805 6350 gene locus_tag LOCUS_14670 6805 6350 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897102.1 protein_id gnl|my_center|LOCUS_14670 7085 6819 gene locus_tag LOCUS_14680 7085 6819 CDS product DUF2530 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897101.1 protein_id gnl|my_center|LOCUS_14680 7130 7963 gene locus_tag LOCUS_14690 7130 7963 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730712.1 protein_id gnl|my_center|LOCUS_14690 7968 8237 gene locus_tag LOCUS_14700 7968 8237 CDS product DUF2537 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730711.1 protein_id gnl|my_center|LOCUS_14700 9001 8234 gene locus_tag LOCUS_14710 gene sepH 9001 8234 CDS product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404617.1 protein_id gnl|my_center|LOCUS_14710 10124 9078 gene locus_tag LOCUS_14720 gene serC 10124 9078 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404623.1 protein_id gnl|my_center|LOCUS_14720 10011 10313 gene locus_tag LOCUS_14730 10011 10313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 10337 11350 gene locus_tag LOCUS_14740 10337 11350 CDS product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897094.1 protein_id gnl|my_center|LOCUS_14740 11411 13039 gene locus_tag LOCUS_14750 11411 13039 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908727.1 protein_id gnl|my_center|LOCUS_14750 14191 13070 gene locus_tag LOCUS_14760 14191 13070 CDS product citrate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730703.1 protein_id gnl|my_center|LOCUS_14760 14242 14919 gene locus_tag LOCUS_14770 gene pdxH 14242 14919 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730702.1 protein_id gnl|my_center|LOCUS_14770 14995 15669 gene locus_tag LOCUS_14780 14995 15669 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730700.1 protein_id gnl|my_center|LOCUS_14780 15752 17044 gene locus_tag LOCUS_14790 15752 17044 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897085.1 protein_id gnl|my_center|LOCUS_14790 18660 17047 gene locus_tag LOCUS_14800 18660 17047 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900230.1 protein_id gnl|my_center|LOCUS_14800 18607 19092 gene locus_tag LOCUS_14810 18607 19092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 19226 20173 gene locus_tag LOCUS_14820 gene arfA 19226 20173 CDS product peptidoglycan-binding protein ArfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404684.1 protein_id gnl|my_center|LOCUS_14820 20185 20337 gene locus_tag LOCUS_14830 20185 20337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404687.1 protein_id gnl|my_center|LOCUS_14830 20337 21284 gene locus_tag LOCUS_14840 20337 21284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 22647 21307 gene locus_tag LOCUS_14850 22647 21307 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730694.1 protein_id gnl|my_center|LOCUS_14850 23379 22678 gene locus_tag LOCUS_14860 gene prrA 23379 22678 CDS product two-component system response regulator PrrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168189073.1 protein_id gnl|my_center|LOCUS_14860 23490 25448 gene locus_tag LOCUS_14870 23490 25448 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730691.1 protein_id gnl|my_center|LOCUS_14870 25445 27256 gene locus_tag LOCUS_14880 25445 27256 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730690.1 protein_id gnl|my_center|LOCUS_14880 27262 27936 gene locus_tag LOCUS_14890 27262 27936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 27947 28678 gene locus_tag LOCUS_14900 27947 28678 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897046.1 protein_id gnl|my_center|LOCUS_14900 >Feature sequence037 1760 2536 gene locus_tag LOCUS_14910 1760 2536 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891419.1 protein_id gnl|my_center|LOCUS_14910 2533 3528 gene locus_tag LOCUS_14920 2533 3528 CDS product hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891418.1 protein_id gnl|my_center|LOCUS_14920 3525 5546 gene locus_tag LOCUS_14930 3525 5546 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726656.1 protein_id gnl|my_center|LOCUS_14930 5610 5867 gene locus_tag LOCUS_14940 5610 5867 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726655.1 protein_id gnl|my_center|LOCUS_14940 7088 5886 gene locus_tag LOCUS_14950 7088 5886 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_14950 8503 7124 gene locus_tag LOCUS_14960 8503 7124 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896784.1 protein_id gnl|my_center|LOCUS_14960 8799 8533 gene locus_tag LOCUS_14970 8799 8533 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878317.1 protein_id gnl|my_center|LOCUS_14970 9749 8937 gene locus_tag LOCUS_14980 9749 8937 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897816.1 protein_id gnl|my_center|LOCUS_14980 10590 9820 gene locus_tag LOCUS_14990 10590 9820 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420827.1 protein_id gnl|my_center|LOCUS_14990 10657 12207 gene locus_tag LOCUS_15000 10657 12207 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084106.1 protein_id gnl|my_center|LOCUS_15000 12204 12548 gene locus_tag LOCUS_15010 12204 12548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897820.1 protein_id gnl|my_center|LOCUS_15010 13385 12570 gene locus_tag LOCUS_15020 13385 12570 CDS product DUF5718 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897821.1 protein_id gnl|my_center|LOCUS_15020 14671 13382 gene locus_tag LOCUS_15030 gene serS 14671 13382 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897822.1 protein_id gnl|my_center|LOCUS_15030 14769 15857 gene locus_tag LOCUS_15040 14769 15857 CDS product septum formation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420892.1 protein_id gnl|my_center|LOCUS_15040 15854 16192 gene locus_tag LOCUS_15050 15854 16192 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878637.1 protein_id gnl|my_center|LOCUS_15050 18100 16223 gene locus_tag LOCUS_15060 18100 16223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 19746 18148 gene locus_tag LOCUS_15070 19746 18148 CDS product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727775.1 protein_id gnl|my_center|LOCUS_15070 20035 19775 gene locus_tag LOCUS_15080 20035 19775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 21254 20079 gene locus_tag LOCUS_15090 21254 20079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 21981 21295 gene locus_tag LOCUS_15100 21981 21295 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897826.1 protein_id gnl|my_center|LOCUS_15100 22895 21978 gene locus_tag LOCUS_15110 gene pheA 22895 21978 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897827.1 protein_id gnl|my_center|LOCUS_15110 22959 23726 gene locus_tag LOCUS_15120 22959 23726 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731271.1 protein_id gnl|my_center|LOCUS_15120 24192 23887 gene locus_tag LOCUS_15130 24192 23887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 24279 25181 gene locus_tag LOCUS_15140 24279 25181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15140 25974 25189 gene locus_tag LOCUS_15150 25974 25189 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897832.1 protein_id gnl|my_center|LOCUS_15150 <26950 26018 gene locus_tag LOCUS_15160 <26950 26018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003899726.1:DUF4328 domain-containing protein >Feature sequence038 2 1102 gene locus_tag LOCUS_15170 gene secY 2 1102 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892870.1 protein_id gnl|my_center|LOCUS_15170 1099 1644 gene locus_tag LOCUS_15180 1099 1644 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403726.1 protein_id gnl|my_center|LOCUS_15180 1660 2457 gene locus_tag LOCUS_15190 gene map 1660 2457 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727693.1 protein_id gnl|my_center|LOCUS_15190 2468 2965 gene locus_tag LOCUS_15200 2468 2965 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892879.1 protein_id gnl|my_center|LOCUS_15200 3937 3068 gene locus_tag LOCUS_15210 gene mmsB 3937 3068 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727701.1 protein_id gnl|my_center|LOCUS_15210 5122 3953 gene locus_tag LOCUS_15220 5122 3953 CDS product isobutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727702.1 protein_id gnl|my_center|LOCUS_15220 6651 5131 gene locus_tag LOCUS_15230 6651 5131 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727703.1 protein_id gnl|my_center|LOCUS_15230 7380 6763 gene locus_tag LOCUS_15240 7380 6763 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727714.1 protein_id gnl|my_center|LOCUS_15240 8377 7382 gene locus_tag LOCUS_15250 gene rfbB 8377 7382 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080535.1 protein_id gnl|my_center|LOCUS_15250 8572 8793 gene locus_tag LOCUS_15260 gene infA 8572 8793 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418601.1 protein_id gnl|my_center|LOCUS_15260 9129 9503 gene locus_tag LOCUS_15270 gene rpsM 9129 9503 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055954.1 protein_id gnl|my_center|LOCUS_15270 9503 9919 gene locus_tag LOCUS_15280 gene rpsK 9503 9919 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055956.1 protein_id gnl|my_center|LOCUS_15280 9949 10554 gene locus_tag LOCUS_15290 gene rpsD 9949 10554 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892911.1 protein_id gnl|my_center|LOCUS_15290 10684 11736 gene locus_tag LOCUS_15300 10684 11736 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055961.1 protein_id gnl|my_center|LOCUS_15300 11802 12404 gene locus_tag LOCUS_15310 11802 12404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 12409 13338 gene locus_tag LOCUS_15320 gene truA 12409 13338 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727720.1 protein_id gnl|my_center|LOCUS_15320 13883 13281 gene locus_tag LOCUS_15330 13883 13281 CDS product cutinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411863.1 protein_id gnl|my_center|LOCUS_15330 13807 13986 gene locus_tag LOCUS_15340 13807 13986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 14654 14004 gene locus_tag LOCUS_15350 14654 14004 CDS product cutinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165447246.1 protein_id gnl|my_center|LOCUS_15350 15363 14701 gene locus_tag LOCUS_15360 15363 14701 CDS product cutinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727721.1 protein_id gnl|my_center|LOCUS_15360 16387 15365 gene locus_tag LOCUS_15370 16387 15365 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892918.1 protein_id gnl|my_center|LOCUS_15370 16463 17050 gene locus_tag LOCUS_15380 16463 17050 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892919.1 protein_id gnl|my_center|LOCUS_15380 17126 18076 gene locus_tag LOCUS_15390 17126 18076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 18359 18802 gene locus_tag LOCUS_15400 gene rplM 18359 18802 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892944.1 protein_id gnl|my_center|LOCUS_15400 18799 19314 gene locus_tag LOCUS_15410 gene rpsI 18799 19314 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892945.1 protein_id gnl|my_center|LOCUS_15410 19429 20766 gene locus_tag LOCUS_15420 gene glmM 19429 20766 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892947.1 protein_id gnl|my_center|LOCUS_15420 20828 21052 gene locus_tag LOCUS_15430 20828 21052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 21049 21879 gene locus_tag LOCUS_15440 21049 21879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 22924 21884 gene locus_tag LOCUS_15450 22924 21884 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877116.1 protein_id gnl|my_center|LOCUS_15450 23772 22936 gene locus_tag LOCUS_15460 23772 22936 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418298.1 protein_id gnl|my_center|LOCUS_15460 23827 25695 gene locus_tag LOCUS_15470 gene glmS 23827 25695 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892956.1 protein_id gnl|my_center|LOCUS_15470 >Feature sequence039 322 957 gene locus_tag LOCUS_15480 322 957 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727174.1 protein_id gnl|my_center|LOCUS_15480 977 1645 gene locus_tag LOCUS_15490 977 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 3755 1590 gene locus_tag LOCUS_15500 3755 1590 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876865.1 protein_id gnl|my_center|LOCUS_15500 3798 4919 gene locus_tag LOCUS_15510 3798 4919 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109755.1 protein_id gnl|my_center|LOCUS_15510 4942 5379 gene locus_tag LOCUS_15520 4942 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892191.1 protein_id gnl|my_center|LOCUS_15520 5747 5403 gene locus_tag LOCUS_15530 5747 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 6115 5744 gene locus_tag LOCUS_15540 6115 5744 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223738.1 protein_id gnl|my_center|LOCUS_15540 6229 6639 gene locus_tag LOCUS_15550 6229 6639 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892192.1 protein_id gnl|my_center|LOCUS_15550 6636 7862 gene locus_tag LOCUS_15560 6636 7862 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727178.1 protein_id gnl|my_center|LOCUS_15560 8830 7943 gene locus_tag LOCUS_15570 8830 7943 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727857.1 protein_id gnl|my_center|LOCUS_15570 9849 8992 gene locus_tag LOCUS_15580 9849 8992 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892195.1 protein_id gnl|my_center|LOCUS_15580 10583 9861 gene locus_tag LOCUS_15590 10583 9861 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727181.1 protein_id gnl|my_center|LOCUS_15590 10630 11640 gene locus_tag LOCUS_15600 gene fgd 10630 11640 CDS product glucose-6-phosphate dehydrogenase (coenzyme-F420) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898438.1 protein_id gnl|my_center|LOCUS_15600 11660 13750 gene locus_tag LOCUS_15610 gene pta 11660 13750 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727187.1 protein_id gnl|my_center|LOCUS_15610 13783 14922 gene locus_tag LOCUS_15620 13783 14922 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727188.1 protein_id gnl|my_center|LOCUS_15620 17193 14941 gene locus_tag LOCUS_15630 17193 14941 CDS product serine/threonine-protein kinase PknG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727190.1 protein_id gnl|my_center|LOCUS_15630 18172 17207 gene locus_tag LOCUS_15640 18172 17207 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727191.1 protein_id gnl|my_center|LOCUS_15640 19491 18172 gene locus_tag LOCUS_15650 gene glnX 19491 18172 CDS product protein kinase G-activating protein GlnX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876871.1 protein_id gnl|my_center|LOCUS_15650 19640 20185 gene locus_tag LOCUS_15660 19640 20185 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402111.1 protein_id gnl|my_center|LOCUS_15660 20852 20172 gene locus_tag LOCUS_15670 gene thiE 20852 20172 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727194.1 protein_id gnl|my_center|LOCUS_15670 20893 22419 gene locus_tag LOCUS_15680 20893 22419 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402133.1 protein_id gnl|my_center|LOCUS_15680 23647 22436 gene locus_tag LOCUS_15690 23647 22436 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727209.1 protein_id gnl|my_center|LOCUS_15690 23924 23670 gene locus_tag LOCUS_15700 23924 23670 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727212.1 protein_id gnl|my_center|LOCUS_15700 25440 23953 gene locus_tag LOCUS_15710 25440 23953 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727213.1 protein_id gnl|my_center|LOCUS_15710 26091 25459 gene locus_tag LOCUS_15720 26091 25459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402145.1 protein_id gnl|my_center|LOCUS_15720 26768 26088 gene locus_tag LOCUS_15730 gene thiD 26768 26088 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727221.1 protein_id gnl|my_center|LOCUS_15730 >Feature sequence040 975 4037 gene locus_tag LOCUS_15740 975 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 4407 4111 gene locus_tag LOCUS_15750 gene rpsQ 4407 4111 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727674.1 protein_id gnl|my_center|LOCUS_15750 4637 4407 gene locus_tag LOCUS_15760 gene rpmC 4637 4407 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892831.1 protein_id gnl|my_center|LOCUS_15760 5053 4637 gene locus_tag LOCUS_15770 gene rplP 5053 4637 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403592.1 protein_id gnl|my_center|LOCUS_15770 5879 5055 gene locus_tag LOCUS_15780 gene rpsC 5879 5055 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403590.1 protein_id gnl|my_center|LOCUS_15780 6382 5879 gene locus_tag LOCUS_15790 gene rplV 6382 5879 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727673.1 protein_id gnl|my_center|LOCUS_15790 6701 6420 gene locus_tag LOCUS_15800 gene rpsS 6701 6420 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908582.1 protein_id gnl|my_center|LOCUS_15800 7552 6716 gene locus_tag LOCUS_15810 gene rplB 7552 6716 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727672.1 protein_id gnl|my_center|LOCUS_15810 7898 7596 gene locus_tag LOCUS_15820 gene rplW 7898 7596 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892825.1 protein_id gnl|my_center|LOCUS_15820 8578 7898 gene locus_tag LOCUS_15830 gene rplD 8578 7898 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727671.1 protein_id gnl|my_center|LOCUS_15830 9231 8578 gene locus_tag LOCUS_15840 gene rplC 9231 8578 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055632.1 protein_id gnl|my_center|LOCUS_15840 9548 9243 gene locus_tag LOCUS_15850 gene rpsJ 9548 9243 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003883485.1 protein_id gnl|my_center|LOCUS_15850 10002 12419 gene locus_tag LOCUS_15860 10002 12419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 12486 13553 gene locus_tag LOCUS_15870 12486 13553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405629.1 protein_id gnl|my_center|LOCUS_15870 13722 16025 gene locus_tag LOCUS_15880 13722 16025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 17590 16022 gene locus_tag LOCUS_15890 17590 16022 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727668.1 protein_id gnl|my_center|LOCUS_15890 17707 19413 gene locus_tag LOCUS_15900 17707 19413 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083151429.1 protein_id gnl|my_center|LOCUS_15900 19772 19374 gene locus_tag LOCUS_15910 19772 19374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 20037 19765 gene locus_tag LOCUS_15920 20037 19765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 20179 21441 gene locus_tag LOCUS_15930 20179 21441 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877073.1 protein_id gnl|my_center|LOCUS_15930 22880 21543 gene locus_tag LOCUS_15940 gene mftG 22880 21543 CDS product mycofactocin system GMC family oxidoreductase MftG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403503.1 protein_id gnl|my_center|LOCUS_15940 24283 22877 gene locus_tag LOCUS_15950 gene mftF 24283 22877 CDS product mycofactocin biosynthesis glycosyltransferase MftF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403501.1 protein_id gnl|my_center|LOCUS_15950 24981 24280 gene locus_tag LOCUS_15960 gene mftE 24981 24280 CDS product mycofactocin biosynthesis peptidyl-dipeptidase MftE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403497.1 protein_id gnl|my_center|LOCUS_15960 26174 24978 gene locus_tag LOCUS_15970 gene mftD 26174 24978 CDS product mycofactocin biosynthesis FMN-dependent deaminase MftD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877068.1 protein_id gnl|my_center|LOCUS_15970 <26761 26174 gene locus_tag LOCUS_15980 <26761 26174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003403490.1:mycofactocin radical SAM maturase >Feature sequence041 422 754 gene locus_tag LOCUS_15990 422 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729701.1 protein_id gnl|my_center|LOCUS_15990 762 2513 gene locus_tag LOCUS_16000 762 2513 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411445.1 protein_id gnl|my_center|LOCUS_16000 2637 2822 gene locus_tag LOCUS_16010 2637 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 4327 2819 gene locus_tag LOCUS_16020 4327 2819 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877992.1 protein_id gnl|my_center|LOCUS_16020 4486 5499 gene locus_tag LOCUS_16030 gene gcvT 4486 5499 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729697.1 protein_id gnl|my_center|LOCUS_16030 5521 6627 gene locus_tag LOCUS_16040 5521 6627 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729696.1 protein_id gnl|my_center|LOCUS_16040 7634 6624 gene locus_tag LOCUS_16050 7634 6624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 8441 7695 gene locus_tag LOCUS_16060 8441 7695 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729695.1 protein_id gnl|my_center|LOCUS_16060 9493 8438 gene locus_tag LOCUS_16070 gene cobT 9493 8438 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729694.1 protein_id gnl|my_center|LOCUS_16070 10035 9490 gene locus_tag LOCUS_16080 gene cobU 10035 9490 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163803955.1 protein_id gnl|my_center|LOCUS_16080 10756 10043 gene locus_tag LOCUS_16090 10756 10043 CDS product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729692.1 protein_id gnl|my_center|LOCUS_16090 10772 11845 gene locus_tag LOCUS_16100 10772 11845 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411420.1 protein_id gnl|my_center|LOCUS_16100 11924 12301 gene locus_tag LOCUS_16110 11924 12301 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895666.1 protein_id gnl|my_center|LOCUS_16110 12957 12325 gene locus_tag LOCUS_16120 12957 12325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 13111 14085 gene locus_tag LOCUS_16130 13111 14085 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411414.1 protein_id gnl|my_center|LOCUS_16130 14775 14092 gene locus_tag LOCUS_16140 14775 14092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 16385 14772 gene locus_tag LOCUS_16150 16385 14772 CDS product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727775.1 protein_id gnl|my_center|LOCUS_16150 17566 16388 gene locus_tag LOCUS_16160 17566 16388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 19539 17608 gene locus_tag LOCUS_16170 gene asnB 19539 17608 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729689.1 protein_id gnl|my_center|LOCUS_16170 19731 20816 gene locus_tag LOCUS_16180 19731 20816 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899214.1 protein_id gnl|my_center|LOCUS_16180 20828 21250 gene locus_tag LOCUS_16190 20828 21250 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895661.1 protein_id gnl|my_center|LOCUS_16190 21402 22247 gene locus_tag LOCUS_16200 21402 22247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 22247 22879 gene locus_tag LOCUS_16210 22247 22879 CDS product DUF2561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411401.1 protein_id gnl|my_center|LOCUS_16210 24579 22906 gene locus_tag LOCUS_16220 24579 22906 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049746009.1 protein_id gnl|my_center|LOCUS_16220 <26511 24816 gene locus_tag LOCUS_16230 <26511 24816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003895658.1:cytochrome bc complex cytochrome b subunit >Feature sequence042 1353 55 gene locus_tag LOCUS_16240 1353 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 2288 1461 gene locus_tag LOCUS_16250 2288 1461 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893772.1 protein_id gnl|my_center|LOCUS_16250 2405 3475 gene locus_tag LOCUS_16260 gene lipN 2405 3475 CDS product lipase/esterase LipN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415015.1 protein_id gnl|my_center|LOCUS_16260 3558 4325 gene locus_tag LOCUS_16270 3558 4325 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893775.1 protein_id gnl|my_center|LOCUS_16270 4322 4954 gene locus_tag LOCUS_16280 4322 4954 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728325.1 protein_id gnl|my_center|LOCUS_16280 4981 5556 gene locus_tag LOCUS_16290 gene rsmD 4981 5556 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415001.1 protein_id gnl|my_center|LOCUS_16290 5568 6047 gene locus_tag LOCUS_16300 gene coaD 5568 6047 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728327.1 protein_id gnl|my_center|LOCUS_16300 6136 6873 gene locus_tag LOCUS_16310 6136 6873 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893781.1 protein_id gnl|my_center|LOCUS_16310 6906 7499 gene locus_tag LOCUS_16320 6906 7499 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728328.1 protein_id gnl|my_center|LOCUS_16320 7496 8221 gene locus_tag LOCUS_16330 gene rnc 7496 8221 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414820.1 protein_id gnl|my_center|LOCUS_16330 8214 9065 gene locus_tag LOCUS_16340 gene mutM 8214 9065 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728330.1 protein_id gnl|my_center|LOCUS_16340 9075 9488 gene locus_tag LOCUS_16350 9075 9488 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893786.1 protein_id gnl|my_center|LOCUS_16350 9485 9763 gene locus_tag LOCUS_16360 9485 9763 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414811.1 protein_id gnl|my_center|LOCUS_16360 9834 11309 gene locus_tag LOCUS_16370 9834 11309 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027250.1 protein_id gnl|my_center|LOCUS_16370 11367 14954 gene locus_tag LOCUS_16380 gene smc 11367 14954 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728333.1 protein_id gnl|my_center|LOCUS_16380 14997 16511 gene locus_tag LOCUS_16390 14997 16511 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900464.1 protein_id gnl|my_center|LOCUS_16390 17534 16518 gene locus_tag LOCUS_16400 gene fni 17534 16518 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049747543.1 protein_id gnl|my_center|LOCUS_16400 17604 18956 gene locus_tag LOCUS_16410 gene ftsY 17604 18956 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908441.1 protein_id gnl|my_center|LOCUS_16410 19101 20480 gene locus_tag LOCUS_16420 19101 20480 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087724.1 protein_id gnl|my_center|LOCUS_16420 20487 20825 gene locus_tag LOCUS_16430 20487 20825 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893792.1 protein_id gnl|my_center|LOCUS_16430 20853 23318 gene locus_tag LOCUS_16440 20853 23318 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893793.1 protein_id gnl|my_center|LOCUS_16440 23411 24970 gene locus_tag LOCUS_16450 gene ffh 23411 24970 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728337.1 protein_id gnl|my_center|LOCUS_16450 24967 26076 gene locus_tag LOCUS_16460 24967 26076 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899537.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence043 38 871 gene locus_tag LOCUS_16470 38 871 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410171.1 protein_id gnl|my_center|LOCUS_16470 913 1560 gene locus_tag LOCUS_16480 gene devR 913 1560 CDS product two-component system response regulator DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896645.1 protein_id gnl|my_center|LOCUS_16480 1560 3290 gene locus_tag LOCUS_16490 1560 3290 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730409.1 protein_id gnl|my_center|LOCUS_16490 4191 3310 gene locus_tag LOCUS_16500 4191 3310 CDS product universal stress protein TB31.7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413592.1 protein_id gnl|my_center|LOCUS_16500 4338 8360 gene locus_tag LOCUS_16510 gene otsB 4338 8360 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084493241.1 protein_id gnl|my_center|LOCUS_16510 9246 8407 gene locus_tag LOCUS_16520 9246 8407 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729429.1 protein_id gnl|my_center|LOCUS_16520 9997 9338 gene locus_tag LOCUS_16530 9997 9338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 10653 9994 gene locus_tag LOCUS_16540 10653 9994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 10721 11131 gene locus_tag LOCUS_16550 10721 11131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896184.1 protein_id gnl|my_center|LOCUS_16550 11506 11135 gene locus_tag LOCUS_16560 11506 11135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519661.1 protein_id gnl|my_center|LOCUS_16560 11598 12287 gene locus_tag LOCUS_16570 11598 12287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 12290 14221 gene locus_tag LOCUS_16580 12290 14221 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005134046.1 protein_id gnl|my_center|LOCUS_16580 14214 15005 gene locus_tag LOCUS_16590 14214 15005 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208394.1 protein_id gnl|my_center|LOCUS_16590 15309 15025 gene locus_tag LOCUS_16600 15309 15025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 15367 15855 gene locus_tag LOCUS_16610 15367 15855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 15864 16460 gene locus_tag LOCUS_16620 15864 16460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 16509 18881 gene locus_tag LOCUS_16630 16509 18881 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727490.1 protein_id gnl|my_center|LOCUS_16630 18911 19681 gene locus_tag LOCUS_16640 18911 19681 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921209.1 protein_id gnl|my_center|LOCUS_16640 20619 19741 gene locus_tag LOCUS_16650 20619 19741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 20564 21121 gene locus_tag LOCUS_16660 20564 21121 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730387.1 protein_id gnl|my_center|LOCUS_16660 21702 21334 gene locus_tag LOCUS_16670 21702 21334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 22505 21933 gene locus_tag LOCUS_16680 22505 21933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728866.1 protein_id gnl|my_center|LOCUS_16680 23894 22560 gene locus_tag LOCUS_16690 23894 22560 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144955419.1 protein_id gnl|my_center|LOCUS_16690 25144 24095 gene locus_tag LOCUS_16700 25144 24095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 25868 25236 gene locus_tag LOCUS_16710 25868 25236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 >Feature sequence044 <1 1093 gene locus_tag LOCUS_16720 <1 1093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222778.1:DEAD/DEAH box helicase 1615 1115 gene locus_tag LOCUS_16730 1615 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 2864 1629 gene locus_tag LOCUS_16740 gene tet(V) 2864 1629 CDS product tetracycline efflux MFS transporter Tet(V) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896589.1 protein_id gnl|my_center|LOCUS_16740 3511 3074 gene locus_tag LOCUS_16750 3511 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895392.1 protein_id gnl|my_center|LOCUS_16750 4022 3606 gene locus_tag LOCUS_16760 gene vapC1 4022 3606 CDS product type II toxin-antitoxin system ribonuclease VapC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400580.1 protein_id gnl|my_center|LOCUS_16760 4252 4019 gene locus_tag LOCUS_16770 4252 4019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 5310 4315 gene locus_tag LOCUS_16780 5310 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16780 7364 5373 gene locus_tag LOCUS_16790 7364 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 7869 7471 gene locus_tag LOCUS_16800 7869 7471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 8120 7866 gene locus_tag LOCUS_16810 8120 7866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 8856 8254 gene locus_tag LOCUS_16820 8856 8254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 9449 9117 gene locus_tag LOCUS_16830 9449 9117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 9631 10404 gene locus_tag LOCUS_16840 9631 10404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 10443 11309 gene locus_tag LOCUS_16850 10443 11309 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727501.1 protein_id gnl|my_center|LOCUS_16850 11386 11778 gene locus_tag LOCUS_16860 11386 11778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 12201 11800 gene locus_tag LOCUS_16870 gene vapC30 12201 11800 CDS product type II toxin-antitoxin system toxin ribonuclease C30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403236.1 protein_id gnl|my_center|LOCUS_16870 12455 12201 gene locus_tag LOCUS_16880 gene vapB30 12455 12201 CDS product type II toxin-antitoxin system antitoxin VapB30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403235.1 protein_id gnl|my_center|LOCUS_16880 12558 13148 gene locus_tag LOCUS_16890 12558 13148 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730127.1 protein_id gnl|my_center|LOCUS_16890 13545 14567 gene locus_tag LOCUS_16900 13545 14567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 15247 14768 gene locus_tag LOCUS_16910 15247 14768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 16241 15237 gene locus_tag LOCUS_16920 16241 15237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922267.1 protein_id gnl|my_center|LOCUS_16920 16902 16243 gene locus_tag LOCUS_16930 16902 16243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 16972 17673 gene locus_tag LOCUS_16940 16972 17673 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727552.1 protein_id gnl|my_center|LOCUS_16940 17735 18655 gene locus_tag LOCUS_16950 17735 18655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 18739 19572 gene locus_tag LOCUS_16960 18739 19572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 19569 20024 gene locus_tag LOCUS_16970 19569 20024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403489.1 protein_id gnl|my_center|LOCUS_16970 20029 21429 gene locus_tag LOCUS_16980 20029 21429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 24085 21509 gene locus_tag LOCUS_16990 24085 21509 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900188.1 protein_id gnl|my_center|LOCUS_16990 24375 23989 gene locus_tag LOCUS_17000 24375 23989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 25352 24378 gene locus_tag LOCUS_17010 25352 24378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 >Feature sequence045 1938 520 gene locus_tag LOCUS_17020 gene tcrY 1938 520 CDS product two-component system sensor histidine kinase TcrY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886181.1 protein_id gnl|my_center|LOCUS_17020 2767 1982 gene locus_tag LOCUS_17030 gene tcrX 2767 1982 CDS product two-component system response regulator TcrX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420552.1 protein_id gnl|my_center|LOCUS_17030 3147 3073 gene locus_tag LOCUS_t00120 3147 3073 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4009 3227 gene locus_tag LOCUS_17040 4009 3227 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729298.1 protein_id gnl|my_center|LOCUS_17040 4096 5211 gene locus_tag LOCUS_17050 4096 5211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404253.1 protein_id gnl|my_center|LOCUS_17050 5242 5931 gene locus_tag LOCUS_17060 5242 5931 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080706.1 protein_id gnl|my_center|LOCUS_17060 5971 7320 gene locus_tag LOCUS_17070 5971 7320 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092091.1 protein_id gnl|my_center|LOCUS_17070 8737 7331 gene locus_tag LOCUS_17080 gene der 8737 7331 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729299.1 protein_id gnl|my_center|LOCUS_17080 9414 8734 gene locus_tag LOCUS_17090 gene cmk 9414 8734 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729300.1 protein_id gnl|my_center|LOCUS_17090 10166 9411 gene locus_tag LOCUS_17100 10166 9411 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895185.1 protein_id gnl|my_center|LOCUS_17100 10875 10159 gene locus_tag LOCUS_17110 gene scpB 10875 10159 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408436.1 protein_id gnl|my_center|LOCUS_17110 11699 10872 gene locus_tag LOCUS_17120 11699 10872 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729302.1 protein_id gnl|my_center|LOCUS_17120 12571 11711 gene locus_tag LOCUS_17130 12571 11711 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898982.1 protein_id gnl|my_center|LOCUS_17130 13646 12690 gene locus_tag LOCUS_17140 gene xerD 13646 12690 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729303.1 protein_id gnl|my_center|LOCUS_17140 14302 13643 gene locus_tag LOCUS_17150 14302 13643 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408399.1 protein_id gnl|my_center|LOCUS_17150 16028 14274 gene locus_tag LOCUS_17160 16028 14274 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895192.1 protein_id gnl|my_center|LOCUS_17160 17105 16170 gene locus_tag LOCUS_17170 17105 16170 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908293.1 protein_id gnl|my_center|LOCUS_17170 18351 17107 gene locus_tag LOCUS_17180 gene steA 18351 17107 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729304.1 protein_id gnl|my_center|LOCUS_17180 20186 18417 gene locus_tag LOCUS_17190 gene recN 20186 18417 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408385.1 protein_id gnl|my_center|LOCUS_17190 21119 20187 gene locus_tag LOCUS_17200 21119 20187 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408383.1 protein_id gnl|my_center|LOCUS_17200 21925 21116 gene locus_tag LOCUS_17210 gene tlyA 21925 21116 CDS product 16S/23S rRNA (cytidine-2'-O)-methyltransferase TlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408382.1 protein_id gnl|my_center|LOCUS_17210 22142 21933 gene locus_tag LOCUS_17220 22142 21933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 23164 22139 gene locus_tag LOCUS_17230 23164 22139 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408380.1 protein_id gnl|my_center|LOCUS_17230 23999 23166 gene locus_tag LOCUS_17240 23999 23166 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495647.1 protein_id gnl|my_center|LOCUS_17240 24222 24147 gene locus_tag LOCUS_r00010 24222 24147 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 63 percent of the 5S ribosomal RNA >Feature sequence046 1640 3013 gene locus_tag LOCUS_17250 1640 3013 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893950.1 protein_id gnl|my_center|LOCUS_17250 3000 3746 gene locus_tag LOCUS_17260 3000 3746 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893951.1 protein_id gnl|my_center|LOCUS_17260 3743 5110 gene locus_tag LOCUS_17270 3743 5110 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728460.1 protein_id gnl|my_center|LOCUS_17270 5107 5886 gene locus_tag LOCUS_17280 5107 5886 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893953.1 protein_id gnl|my_center|LOCUS_17280 6297 5890 gene locus_tag LOCUS_17290 6297 5890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 7335 6340 gene locus_tag LOCUS_17300 7335 6340 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728471.1 protein_id gnl|my_center|LOCUS_17300 7508 8953 gene locus_tag LOCUS_17310 gene mqo 7508 8953 CDS product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624310.1 protein_id gnl|my_center|LOCUS_17310 8950 9402 gene locus_tag LOCUS_17320 8950 9402 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728473.1 protein_id gnl|my_center|LOCUS_17320 9393 11228 gene locus_tag LOCUS_17330 9393 11228 CDS product magnesium chelatase subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728474.1 protein_id gnl|my_center|LOCUS_17330 11266 11880 gene locus_tag LOCUS_17340 gene cobO 11266 11880 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893997.1 protein_id gnl|my_center|LOCUS_17340 11874 13247 gene locus_tag LOCUS_17350 11874 13247 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728476.1 protein_id gnl|my_center|LOCUS_17350 13244 14467 gene locus_tag LOCUS_17360 gene cobA 13244 14467 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893999.1 protein_id gnl|my_center|LOCUS_17360 14513 16123 gene locus_tag LOCUS_17370 gene efpA 14513 16123 CDS product multidrug efflux MFS transporter EfpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950788.1 protein_id gnl|my_center|LOCUS_17370 16179 17672 gene locus_tag LOCUS_17380 16179 17672 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728477.1 protein_id gnl|my_center|LOCUS_17380 17800 19722 gene locus_tag LOCUS_17390 gene htpG 17800 19722 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411855.1 protein_id gnl|my_center|LOCUS_17390 20285 19746 gene locus_tag LOCUS_17400 20285 19746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17400 21751 20294 gene locus_tag LOCUS_17410 21751 20294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17410 22482 21754 gene locus_tag LOCUS_17420 22482 21754 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897054.1 protein_id gnl|my_center|LOCUS_17420 22614 24377 gene locus_tag LOCUS_17430 22614 24377 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894002.1 protein_id gnl|my_center|LOCUS_17430 24872 24387 gene locus_tag LOCUS_17440 24872 24387 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728479.1 protein_id gnl|my_center|LOCUS_17440 >Feature sequence047 5 613 gene locus_tag LOCUS_17450 5 613 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225371.1 protein_id gnl|my_center|LOCUS_17450 615 905 gene locus_tag LOCUS_17460 615 905 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726761.1 protein_id gnl|my_center|LOCUS_17460 1026 2270 gene locus_tag LOCUS_17470 1026 2270 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726763.1 protein_id gnl|my_center|LOCUS_17470 2410 3450 gene locus_tag LOCUS_17480 2410 3450 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726764.1 protein_id gnl|my_center|LOCUS_17480 5482 3473 gene locus_tag LOCUS_17490 5482 3473 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726765.1 protein_id gnl|my_center|LOCUS_17490 5441 6154 gene locus_tag LOCUS_17500 5441 6154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 6169 6840 gene locus_tag LOCUS_17510 6169 6840 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726767.1 protein_id gnl|my_center|LOCUS_17510 7255 6827 gene locus_tag LOCUS_17520 7255 6827 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891579.1 protein_id gnl|my_center|LOCUS_17520 7757 7227 gene locus_tag LOCUS_17530 7757 7227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 10709 7848 gene locus_tag LOCUS_17540 10709 7848 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726771.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17540 10908 11273 gene locus_tag LOCUS_17550 10908 11273 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891584.1 protein_id gnl|my_center|LOCUS_17550 11670 11278 gene locus_tag LOCUS_17560 11670 11278 CDS product DUF3054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891587.1 protein_id gnl|my_center|LOCUS_17560 12822 11686 gene locus_tag LOCUS_17570 12822 11686 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726777.1 protein_id gnl|my_center|LOCUS_17570 12975 14189 gene locus_tag LOCUS_17580 12975 14189 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891590.1 protein_id gnl|my_center|LOCUS_17580 14327 14500 gene locus_tag LOCUS_17590 14327 14500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 14509 15309 gene locus_tag LOCUS_17600 14509 15309 CDS product DUF4344 domain-containing metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726965.1 protein_id gnl|my_center|LOCUS_17600 18165 15352 gene locus_tag LOCUS_17610 18165 15352 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726778.1 protein_id gnl|my_center|LOCUS_17610 18919 18230 gene locus_tag LOCUS_17620 18919 18230 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104288.1 protein_id gnl|my_center|LOCUS_17620 19698 18931 gene locus_tag LOCUS_17630 gene trmB 19698 18931 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104289.1 protein_id gnl|my_center|LOCUS_17630 19838 20974 gene locus_tag LOCUS_17640 19838 20974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 21080 22903 gene locus_tag LOCUS_17650 21080 22903 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726783.1 protein_id gnl|my_center|LOCUS_17650 22928 24493 gene locus_tag LOCUS_17660 gene fadD4 22928 24493 CDS product fatty-acid--CoA ligase FadD4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726785.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence048 32 868 gene locus_tag LOCUS_17670 32 868 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404769.1 protein_id gnl|my_center|LOCUS_17670 897 1973 gene locus_tag LOCUS_17680 897 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404767.1 protein_id gnl|my_center|LOCUS_17680 1993 2301 gene locus_tag LOCUS_17690 1993 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 2298 2549 gene locus_tag LOCUS_17700 2298 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 2680 3462 gene locus_tag LOCUS_17710 2680 3462 CDS product DUF1365 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402266.1 protein_id gnl|my_center|LOCUS_17710 3447 4076 gene locus_tag LOCUS_17720 gene sigK 3447 4076 CDS product sigma-70 family RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402246.1 protein_id gnl|my_center|LOCUS_17720 4087 4821 gene locus_tag LOCUS_17730 gene rskA 4087 4821 CDS product anti-sigma-K factor RskA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898455.1 protein_id gnl|my_center|LOCUS_17730 4980 5053 gene locus_tag LOCUS_t00130 4980 5053 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5219 6622 gene locus_tag LOCUS_17740 5219 6622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 6952 7437 gene locus_tag LOCUS_17750 6952 7437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 7434 8660 gene locus_tag LOCUS_17760 7434 8660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17760 8664 9347 gene locus_tag LOCUS_17770 8664 9347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17770 10950 9355 gene locus_tag LOCUS_17780 10950 9355 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412717.1 protein_id gnl|my_center|LOCUS_17780 11050 12282 gene locus_tag LOCUS_17790 11050 12282 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730652.1 protein_id gnl|my_center|LOCUS_17790 12282 13799 gene locus_tag LOCUS_17800 12282 13799 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404742.1 protein_id gnl|my_center|LOCUS_17800 13799 14755 gene locus_tag LOCUS_17810 13799 14755 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897017.1 protein_id gnl|my_center|LOCUS_17810 15392 14724 gene locus_tag LOCUS_17820 15392 14724 CDS product LpqN/LpqT family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730587.1 protein_id gnl|my_center|LOCUS_17820 15888 15439 gene locus_tag LOCUS_17830 15888 15439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404738.1 protein_id gnl|my_center|LOCUS_17830 15919 16356 gene locus_tag LOCUS_17840 15919 16356 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897021.1 protein_id gnl|my_center|LOCUS_17840 16392 18152 gene locus_tag LOCUS_17850 16392 18152 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029118.1 protein_id gnl|my_center|LOCUS_17850 19016 18105 gene locus_tag LOCUS_17860 gene couO 19016 18105 CDS product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225127.1 protein_id gnl|my_center|LOCUS_17860 19497 19051 gene locus_tag LOCUS_17870 19497 19051 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730672.1 protein_id gnl|my_center|LOCUS_17870 19801 19505 gene locus_tag LOCUS_17880 19801 19505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 22275 19873 gene locus_tag LOCUS_17890 22275 19873 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730674.1 protein_id gnl|my_center|LOCUS_17890 23896 22331 gene locus_tag LOCUS_17900 23896 22331 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139558.1 protein_id gnl|my_center|LOCUS_17900 <25012 23916 gene locus_tag LOCUS_17910 <25012 23916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003404705.1:MBL fold metallo-hydrolase >Feature sequence049 660 1457 gene locus_tag LOCUS_17920 660 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 1447 2943 gene locus_tag LOCUS_17930 gene crtI 1447 2943 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066789316.1 protein_id gnl|my_center|LOCUS_17930 2972 3358 gene locus_tag LOCUS_17940 2972 3358 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728346.1 protein_id gnl|my_center|LOCUS_17940 4144 3485 gene locus_tag LOCUS_17950 4144 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 4110 4541 gene locus_tag LOCUS_17960 4110 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413586.1 protein_id gnl|my_center|LOCUS_17960 4565 4912 gene locus_tag LOCUS_17970 4565 4912 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413583.1 protein_id gnl|my_center|LOCUS_17970 5964 4903 gene locus_tag LOCUS_17980 5964 4903 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901532.1 protein_id gnl|my_center|LOCUS_17980 6326 5961 gene locus_tag LOCUS_17990 gene crcB 6326 5961 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416046.1 protein_id gnl|my_center|LOCUS_17990 6760 6323 gene locus_tag LOCUS_18000 gene crcB 6760 6323 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893508.1 protein_id gnl|my_center|LOCUS_18000 6759 8393 gene locus_tag LOCUS_18010 gene pgm 6759 8393 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728182.1 protein_id gnl|my_center|LOCUS_18010 8390 9649 gene locus_tag LOCUS_18020 8390 9649 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728183.1 protein_id gnl|my_center|LOCUS_18020 9719 9794 gene locus_tag LOCUS_t00140 9719 9794 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 11186 10008 gene locus_tag LOCUS_18030 11186 10008 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940843.1 protein_id gnl|my_center|LOCUS_18030 11264 11428 gene locus_tag LOCUS_18040 11264 11428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 11418 11654 gene locus_tag LOCUS_18050 11418 11654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_18050 11774 12031 gene locus_tag LOCUS_18060 11774 12031 CDS product DUF3297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058085.1 protein_id gnl|my_center|LOCUS_18060 12090 12752 gene locus_tag LOCUS_18070 12090 12752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 12889 14313 gene locus_tag LOCUS_18080 12889 14313 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083311.1 protein_id gnl|my_center|LOCUS_18080 14335 15990 gene locus_tag LOCUS_18090 14335 15990 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222206.1 protein_id gnl|my_center|LOCUS_18090 15987 16667 gene locus_tag LOCUS_18100 15987 16667 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222205.1 protein_id gnl|my_center|LOCUS_18100 17150 16713 gene locus_tag LOCUS_18110 17150 16713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 17681 17265 gene locus_tag LOCUS_18120 17681 17265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 17891 18580 gene locus_tag LOCUS_18130 gene mpt64 17891 18580 CDS product immunoprotective protein Mpt64 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409954.1 protein_id gnl|my_center|LOCUS_18130 18639 19028 gene locus_tag LOCUS_18140 18639 19028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 19052 20014 gene locus_tag LOCUS_18150 19052 20014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 20053 20778 gene locus_tag LOCUS_18160 20053 20778 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225434.1 protein_id gnl|my_center|LOCUS_18160 20905 22530 gene locus_tag LOCUS_18170 20905 22530 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405217.1 protein_id gnl|my_center|LOCUS_18170 23122 22463 gene locus_tag LOCUS_18180 23122 22463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 >Feature sequence050 3462 2701 gene locus_tag LOCUS_18190 gene fabG 3462 2701 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_18190 4649 3459 gene locus_tag LOCUS_18200 4649 3459 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083642.1 protein_id gnl|my_center|LOCUS_18200 5688 4642 gene locus_tag LOCUS_18210 5688 4642 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163719979.1 protein_id gnl|my_center|LOCUS_18210 7008 5704 gene locus_tag LOCUS_18220 7008 5704 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072408.1 protein_id gnl|my_center|LOCUS_18220 7376 7005 gene locus_tag LOCUS_18230 7376 7005 CDS product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199254442.1 protein_id gnl|my_center|LOCUS_18230 7506 8207 gene locus_tag LOCUS_18240 7506 8207 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878204.1 protein_id gnl|my_center|LOCUS_18240 8188 9693 gene locus_tag LOCUS_18250 gene tcrY 8188 9693 CDS product two-component system sensor histidine kinase TcrY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886181.1 protein_id gnl|my_center|LOCUS_18250 9727 11604 gene locus_tag LOCUS_18260 9727 11604 CDS product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731217.1 protein_id gnl|my_center|LOCUS_18260 11753 12358 gene locus_tag LOCUS_18270 11753 12358 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731215.1 protein_id gnl|my_center|LOCUS_18270 12734 12375 gene locus_tag LOCUS_18280 12734 12375 CDS product DUF1049 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897753.1 protein_id gnl|my_center|LOCUS_18280 12885 13820 gene locus_tag LOCUS_18290 12885 13820 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049743594.1 protein_id gnl|my_center|LOCUS_18290 13821 14990 gene locus_tag LOCUS_18300 13821 14990 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731211.1 protein_id gnl|my_center|LOCUS_18300 14996 15643 gene locus_tag LOCUS_18310 14996 15643 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731210.1 protein_id gnl|my_center|LOCUS_18310 15640 16416 gene locus_tag LOCUS_18320 15640 16416 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731209.1 protein_id gnl|my_center|LOCUS_18320 16410 17015 gene locus_tag LOCUS_18330 16410 17015 CDS product putative glycolipid-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420517.1 protein_id gnl|my_center|LOCUS_18330 17973 16978 gene locus_tag LOCUS_18340 17973 16978 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731208.1 protein_id gnl|my_center|LOCUS_18340 18019 18537 gene locus_tag LOCUS_18350 18019 18537 CDS product tRNA adenosine deaminase-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731207.1 protein_id gnl|my_center|LOCUS_18350 18534 19019 gene locus_tag LOCUS_18360 18534 19019 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112945.1 protein_id gnl|my_center|LOCUS_18360 19030 19120 gene locus_tag LOCUS_t00150 19030 19120 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 19878 19363 gene locus_tag LOCUS_18370 19878 19363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 19823 21865 gene locus_tag LOCUS_18380 19823 21865 CDS product beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271984.1 protein_id gnl|my_center|LOCUS_18380 22049 23491 gene locus_tag LOCUS_18390 22049 23491 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878617.1 protein_id gnl|my_center|LOCUS_18390 23972 23478 gene locus_tag LOCUS_18400 23972 23478 CDS product lipoprotein LpqH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088888.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence051 119 2926 gene locus_tag LOCUS_18410 gene ppc 119 2926 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728811.1 protein_id gnl|my_center|LOCUS_18410 3264 2929 gene locus_tag LOCUS_18420 3264 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728812.1 protein_id gnl|my_center|LOCUS_18420 4007 3270 gene locus_tag LOCUS_18430 gene pgl 4007 3270 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894486.1 protein_id gnl|my_center|LOCUS_18430 4921 4010 gene locus_tag LOCUS_18440 gene opcA 4921 4010 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894487.1 protein_id gnl|my_center|LOCUS_18440 6527 4962 gene locus_tag LOCUS_18450 gene zwf 6527 4962 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728813.1 protein_id gnl|my_center|LOCUS_18450 7654 6536 gene locus_tag LOCUS_18460 gene tal 7654 6536 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728814.1 protein_id gnl|my_center|LOCUS_18460 9772 7679 gene locus_tag LOCUS_18470 gene tkt 9772 7679 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728815.1 protein_id gnl|my_center|LOCUS_18470 9940 10887 gene locus_tag LOCUS_18480 9940 10887 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894492.1 protein_id gnl|my_center|LOCUS_18480 11881 10907 gene locus_tag LOCUS_18490 11881 10907 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877580.1 protein_id gnl|my_center|LOCUS_18490 11929 12879 gene locus_tag LOCUS_18500 11929 12879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877581.1 protein_id gnl|my_center|LOCUS_18500 13785 12829 gene locus_tag LOCUS_18510 13785 12829 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728826.1 protein_id gnl|my_center|LOCUS_18510 14608 13835 gene locus_tag LOCUS_18520 14608 13835 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407475.1 protein_id gnl|my_center|LOCUS_18520 15513 14605 gene locus_tag LOCUS_18530 15513 14605 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407477.1 protein_id gnl|my_center|LOCUS_18530 17324 15534 gene locus_tag LOCUS_18540 gene mptB 17324 15534 CDS product polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877585.1 protein_id gnl|my_center|LOCUS_18540 17419 18159 gene locus_tag LOCUS_18550 gene sufR 17419 18159 CDS product suf operon transcriptional regulator SufR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902080.1 protein_id gnl|my_center|LOCUS_18550 18156 19589 gene locus_tag LOCUS_18560 gene sufB 18156 19589 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894509.1 protein_id gnl|my_center|LOCUS_18560 19589 20836 gene locus_tag LOCUS_18570 gene sufD 19589 20836 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728831.1 protein_id gnl|my_center|LOCUS_18570 20833 21603 gene locus_tag LOCUS_18580 gene sufC 20833 21603 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057836.1 protein_id gnl|my_center|LOCUS_18580 21611 22903 gene locus_tag LOCUS_18590 21611 22903 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894512.1 protein_id gnl|my_center|LOCUS_18590 22915 23391 gene locus_tag LOCUS_18600 22915 23391 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894513.1 protein_id gnl|my_center|LOCUS_18600 23388 23738 gene locus_tag LOCUS_18610 23388 23738 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894514.1 protein_id gnl|my_center|LOCUS_18610 >Feature sequence052 1508 489 gene locus_tag LOCUS_18620 1508 489 CDS product ParB/Srx family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194141.1 protein_id gnl|my_center|LOCUS_18620 2825 1539 gene locus_tag LOCUS_18630 2825 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763647.1 protein_id gnl|my_center|LOCUS_18630 3140 3778 gene locus_tag LOCUS_18640 3140 3778 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_18640 4668 3790 gene locus_tag LOCUS_18650 4668 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 4721 5257 gene locus_tag LOCUS_18660 4721 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 5449 5258 gene locus_tag LOCUS_18670 5449 5258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 6738 5446 gene locus_tag LOCUS_18680 6738 5446 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895997.1 protein_id gnl|my_center|LOCUS_18680 6791 7468 gene locus_tag LOCUS_18690 6791 7468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 7998 7465 gene locus_tag LOCUS_18700 7998 7465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730617.1 protein_id gnl|my_center|LOCUS_18700 9294 8044 gene locus_tag LOCUS_18710 9294 8044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 9648 9376 gene locus_tag LOCUS_18720 9648 9376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 10760 9783 gene locus_tag LOCUS_18730 10760 9783 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112440.1 protein_id gnl|my_center|LOCUS_18730 10868 11383 gene locus_tag LOCUS_18740 10868 11383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 11451 11696 gene locus_tag LOCUS_18750 11451 11696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 11769 13157 gene locus_tag LOCUS_18760 11769 13157 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977257.1 protein_id gnl|my_center|LOCUS_18760 13867 13148 gene locus_tag LOCUS_18770 13867 13148 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731009.1 protein_id gnl|my_center|LOCUS_18770 14847 13867 gene locus_tag LOCUS_18780 14847 13867 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091041.1 protein_id gnl|my_center|LOCUS_18780 14984 15898 gene locus_tag LOCUS_18790 14984 15898 CDS product streptomycin 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729101.1 protein_id gnl|my_center|LOCUS_18790 15952 16515 gene locus_tag LOCUS_18800 15952 16515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730383.1 protein_id gnl|my_center|LOCUS_18800 16512 17171 gene locus_tag LOCUS_18810 16512 17171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624115.1 protein_id gnl|my_center|LOCUS_18810 18283 17168 gene locus_tag LOCUS_18820 18283 17168 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530638.1 protein_id gnl|my_center|LOCUS_18820 18754 18401 gene locus_tag LOCUS_18830 18754 18401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 19263 18856 gene locus_tag LOCUS_18840 19263 18856 CDS product mycolyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005097922.1 protein_id gnl|my_center|LOCUS_18840 19196 19597 gene locus_tag LOCUS_18850 19196 19597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 19841 20797 gene locus_tag LOCUS_18860 19841 20797 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416610.1 protein_id gnl|my_center|LOCUS_18860 22130 20787 gene locus_tag LOCUS_18870 22130 20787 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899946.1 protein_id gnl|my_center|LOCUS_18870 22212 23207 gene locus_tag LOCUS_18880 22212 23207 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104523.1 protein_id gnl|my_center|LOCUS_18880 23630 23217 gene locus_tag LOCUS_18890 23630 23217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 >Feature sequence053 <1 887 gene locus_tag LOCUS_18900 <1 887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728302.1:NAD(P)/FAD-dependent oxidoreductase 951 2735 gene locus_tag LOCUS_18910 951 2735 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073255020.1 protein_id gnl|my_center|LOCUS_18910 2735 4390 gene locus_tag LOCUS_18920 2735 4390 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776426.1 protein_id gnl|my_center|LOCUS_18920 4422 4820 gene locus_tag LOCUS_18930 4422 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 4817 5089 gene locus_tag LOCUS_18940 4817 5089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 6138 5113 gene locus_tag LOCUS_18950 gene ilvC 6138 5113 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069737.1 protein_id gnl|my_center|LOCUS_18950 6678 6166 gene locus_tag LOCUS_18960 gene ilvN 6678 6166 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893741.1 protein_id gnl|my_center|LOCUS_18960 8564 6678 gene locus_tag LOCUS_18970 8564 6678 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415168.1 protein_id gnl|my_center|LOCUS_18970 8934 9275 gene locus_tag LOCUS_18980 8934 9275 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104354.1 protein_id gnl|my_center|LOCUS_18980 10247 9285 gene locus_tag LOCUS_18990 10247 9285 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893738.1 protein_id gnl|my_center|LOCUS_18990 10290 11390 gene locus_tag LOCUS_19000 10290 11390 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950811.1 protein_id gnl|my_center|LOCUS_19000 12265 11402 gene locus_tag LOCUS_19010 12265 11402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104265.1 protein_id gnl|my_center|LOCUS_19010 13434 12247 gene locus_tag LOCUS_19020 13434 12247 CDS product NHL repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104264.1 protein_id gnl|my_center|LOCUS_19020 14309 13431 gene locus_tag LOCUS_19030 14309 13431 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728268.1 protein_id gnl|my_center|LOCUS_19030 15558 14302 gene locus_tag LOCUS_19040 15558 14302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728267.1 protein_id gnl|my_center|LOCUS_19040 15829 15575 gene locus_tag LOCUS_19050 15829 15575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877348.1 protein_id gnl|my_center|LOCUS_19050 16641 15826 gene locus_tag LOCUS_19060 16641 15826 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893635.1 protein_id gnl|my_center|LOCUS_19060 18245 16638 gene locus_tag LOCUS_19070 18245 16638 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728265.1 protein_id gnl|my_center|LOCUS_19070 19278 18307 gene locus_tag LOCUS_19080 19278 18307 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893633.1 protein_id gnl|my_center|LOCUS_19080 20707 19481 gene locus_tag LOCUS_19090 20707 19481 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727698.1 protein_id gnl|my_center|LOCUS_19090 21354 20704 gene locus_tag LOCUS_19100 21354 20704 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727699.1 protein_id gnl|my_center|LOCUS_19100 21462 22010 gene locus_tag LOCUS_19110 21462 22010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 23600 22089 gene locus_tag LOCUS_19120 gene gatB 23600 22089 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415248.1 protein_id gnl|my_center|LOCUS_19120 >Feature sequence054 132 863 gene locus_tag LOCUS_19130 132 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 895 2895 gene locus_tag LOCUS_19140 895 2895 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878112.1 protein_id gnl|my_center|LOCUS_19140 2989 3585 gene locus_tag LOCUS_19150 2989 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 3667 5343 gene locus_tag LOCUS_19160 gene ettA 3667 5343 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412708.1 protein_id gnl|my_center|LOCUS_19160 5354 10150 gene locus_tag LOCUS_19170 5354 10150 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730019.1 protein_id gnl|my_center|LOCUS_19170 10143 10568 gene locus_tag LOCUS_19180 10143 10568 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412703.1 protein_id gnl|my_center|LOCUS_19180 10565 11191 gene locus_tag LOCUS_19190 10565 11191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412698.1 protein_id gnl|my_center|LOCUS_19190 11240 12892 gene locus_tag LOCUS_19200 11240 12892 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272763.1 protein_id gnl|my_center|LOCUS_19200 13307 12900 gene locus_tag LOCUS_19210 13307 12900 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060114.1 protein_id gnl|my_center|LOCUS_19210 13381 13983 gene locus_tag LOCUS_19220 13381 13983 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878108.1 protein_id gnl|my_center|LOCUS_19220 14005 14247 gene locus_tag LOCUS_19230 14005 14247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412671.1 protein_id gnl|my_center|LOCUS_19230 14255 14707 gene locus_tag LOCUS_19240 14255 14707 CDS product DUF5130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896073.1 protein_id gnl|my_center|LOCUS_19240 17282 14721 gene locus_tag LOCUS_19250 gene pepN 17282 14721 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730013.1 protein_id gnl|my_center|LOCUS_19250 17306 17935 gene locus_tag LOCUS_19260 17306 17935 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730011.1 protein_id gnl|my_center|LOCUS_19260 17971 18447 gene locus_tag LOCUS_19270 17971 18447 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730007.1 protein_id gnl|my_center|LOCUS_19270 18453 19259 gene locus_tag LOCUS_19280 18453 19259 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412657.1 protein_id gnl|my_center|LOCUS_19280 20079 19264 gene locus_tag LOCUS_19290 20079 19264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730005.1 protein_id gnl|my_center|LOCUS_19290 21296 20109 gene locus_tag LOCUS_19300 21296 20109 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730004.1 protein_id gnl|my_center|LOCUS_19300 21658 21587 gene locus_tag LOCUS_t00160 21658 21587 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 21789 21863 gene locus_tag LOCUS_t00170 21789 21863 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 21904 23265 gene locus_tag LOCUS_19310 gene tig 21904 23265 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730000.1 protein_id gnl|my_center|LOCUS_19310 >Feature sequence055 1912 488 gene locus_tag LOCUS_19320 1912 488 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729712.1 protein_id gnl|my_center|LOCUS_19320 2061 2909 gene locus_tag LOCUS_19330 gene panB 2061 2909 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411489.1 protein_id gnl|my_center|LOCUS_19330 2944 4452 gene locus_tag LOCUS_19340 2944 4452 CDS product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911786.1 protein_id gnl|my_center|LOCUS_19340 5932 4901 gene locus_tag LOCUS_19350 5932 4901 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412408.1 protein_id gnl|my_center|LOCUS_19350 6579 5938 gene locus_tag LOCUS_19360 6579 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 7720 6593 gene locus_tag LOCUS_19370 7720 6593 CDS product bifunctional RNase H/acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729720.1 protein_id gnl|my_center|LOCUS_19370 8483 7743 gene locus_tag LOCUS_19380 8483 7743 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411501.1 protein_id gnl|my_center|LOCUS_19380 9613 8480 gene locus_tag LOCUS_19390 9613 8480 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729722.1 protein_id gnl|my_center|LOCUS_19390 10656 9610 gene locus_tag LOCUS_19400 gene cobC 10656 9610 CDS product Rv2231c family pyridoxal phosphate-dependent protein CobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005129968.1 protein_id gnl|my_center|LOCUS_19400 10723 11391 gene locus_tag LOCUS_19410 10723 11391 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729723.1 protein_id gnl|my_center|LOCUS_19410 11384 11902 gene locus_tag LOCUS_19420 gene ptpA 11384 11902 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411510.1 protein_id gnl|my_center|LOCUS_19420 11902 12747 gene locus_tag LOCUS_19430 11902 12747 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729725.1 protein_id gnl|my_center|LOCUS_19430 13576 12701 gene locus_tag LOCUS_19440 13576 12701 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729726.1 protein_id gnl|my_center|LOCUS_19440 13725 15542 gene locus_tag LOCUS_19450 13725 15542 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114225.1 protein_id gnl|my_center|LOCUS_19450 15605 17218 gene locus_tag LOCUS_19460 15605 17218 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706470.1 protein_id gnl|my_center|LOCUS_19460 17335 17700 gene locus_tag LOCUS_19470 17335 17700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 17738 18640 gene locus_tag LOCUS_19480 17738 18640 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_19480 18671 18597 gene locus_tag LOCUS_t00180 18671 18597 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 19209 18745 gene locus_tag LOCUS_19490 gene ahpE 19209 18745 CDS product peroxiredoxin AhpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411527.1 protein_id gnl|my_center|LOCUS_19490 19637 19206 gene locus_tag LOCUS_19500 19637 19206 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895716.1 protein_id gnl|my_center|LOCUS_19500 20395 19721 gene locus_tag LOCUS_19510 20395 19721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895717.1 protein_id gnl|my_center|LOCUS_19510 >Feature sequence056 513 1358 gene locus_tag LOCUS_19520 gene rpsB 513 1358 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893880.1 protein_id gnl|my_center|LOCUS_19520 1360 2175 gene locus_tag LOCUS_19530 gene tsf 1360 2175 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893881.1 protein_id gnl|my_center|LOCUS_19530 2190 3620 gene locus_tag LOCUS_19540 2190 3620 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908420.1 protein_id gnl|my_center|LOCUS_19540 4261 3617 gene locus_tag LOCUS_19550 4261 3617 CDS product ScbR family autoregulator-binding transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893568.1 protein_id gnl|my_center|LOCUS_19550 4484 5215 gene locus_tag LOCUS_19560 gene pyrH 4484 5215 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057025.1 protein_id gnl|my_center|LOCUS_19560 5238 5795 gene locus_tag LOCUS_19570 gene frr 5238 5795 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414663.1 protein_id gnl|my_center|LOCUS_19570 5815 6663 gene locus_tag LOCUS_19580 5815 6663 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728419.1 protein_id gnl|my_center|LOCUS_19580 6677 7768 gene locus_tag LOCUS_19590 gene rlmN 6677 7768 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728422.1 protein_id gnl|my_center|LOCUS_19590 8019 7765 gene locus_tag LOCUS_19600 8019 7765 CDS product DUF2631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899522.1 protein_id gnl|my_center|LOCUS_19600 9446 8091 gene locus_tag LOCUS_19610 9446 8091 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728446.1 protein_id gnl|my_center|LOCUS_19610 10198 9611 gene locus_tag LOCUS_19620 10198 9611 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414644.1 protein_id gnl|my_center|LOCUS_19620 11100 10384 gene locus_tag LOCUS_19630 11100 10384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 11193 12467 gene locus_tag LOCUS_19640 gene dxr 11193 12467 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414613.1 protein_id gnl|my_center|LOCUS_19640 12481 13722 gene locus_tag LOCUS_19650 12481 13722 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893934.1 protein_id gnl|my_center|LOCUS_19650 13732 14922 gene locus_tag LOCUS_19660 gene ispG 13732 14922 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899517.1 protein_id gnl|my_center|LOCUS_19660 14978 15832 gene locus_tag LOCUS_19670 14978 15832 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899516.1 protein_id gnl|my_center|LOCUS_19670 15897 17714 gene locus_tag LOCUS_19680 15897 17714 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893939.1 protein_id gnl|my_center|LOCUS_19680 18111 17719 gene locus_tag LOCUS_19690 18111 17719 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731351.1 protein_id gnl|my_center|LOCUS_19690 18199 18786 gene locus_tag LOCUS_19700 18199 18786 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728451.1 protein_id gnl|my_center|LOCUS_19700 18799 19656 gene locus_tag LOCUS_19710 gene map 18799 19656 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728452.1 protein_id gnl|my_center|LOCUS_19710 19745 21253 gene locus_tag LOCUS_19720 19745 21253 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728453.1 protein_id gnl|my_center|LOCUS_19720 21282 21926 gene locus_tag LOCUS_19730 21282 21926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157890715.1 protein_id gnl|my_center|LOCUS_19730 22003 22554 gene locus_tag LOCUS_19740 22003 22554 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728457.1 protein_id gnl|my_center|LOCUS_19740 >Feature sequence057 <1 669 gene locus_tag LOCUS_19750 <1 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730319.1:HNH endonuclease signature motif containing protein 3155 666 gene locus_tag LOCUS_19760 3155 666 CDS product ATP transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408545.1 protein_id gnl|my_center|LOCUS_19760 4369 3167 gene locus_tag LOCUS_19770 4369 3167 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727796.1 protein_id gnl|my_center|LOCUS_19770 4385 5236 gene locus_tag LOCUS_19780 4385 5236 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893053.1 protein_id gnl|my_center|LOCUS_19780 5233 5499 gene locus_tag LOCUS_19790 5233 5499 CDS product DUF3017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417749.1 protein_id gnl|my_center|LOCUS_19790 6251 5496 gene locus_tag LOCUS_19800 6251 5496 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417461.1 protein_id gnl|my_center|LOCUS_19800 7345 6248 gene locus_tag LOCUS_19810 7345 6248 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417458.1 protein_id gnl|my_center|LOCUS_19810 8652 7357 gene locus_tag LOCUS_19820 8652 7357 CDS product bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893059.1 protein_id gnl|my_center|LOCUS_19820 9009 11249 gene locus_tag LOCUS_19830 9009 11249 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899797.1 protein_id gnl|my_center|LOCUS_19830 11346 12578 gene locus_tag LOCUS_19840 11346 12578 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417452.1 protein_id gnl|my_center|LOCUS_19840 13416 12580 gene locus_tag LOCUS_19850 13416 12580 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044081650.1 protein_id gnl|my_center|LOCUS_19850 13440 14240 gene locus_tag LOCUS_19860 13440 14240 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080720.1 protein_id gnl|my_center|LOCUS_19860 19267 14237 gene locus_tag LOCUS_19870 19267 14237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 19349 19939 gene locus_tag LOCUS_19880 19349 19939 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892743.1 protein_id gnl|my_center|LOCUS_19880 20991 19936 gene locus_tag LOCUS_19890 20991 19936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 21009 22019 gene locus_tag LOCUS_19900 gene trpS 21009 22019 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417440.1 protein_id gnl|my_center|LOCUS_19900 22016 22861 gene locus_tag LOCUS_19910 gene yhjD 22016 22861 CDS product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727805.1 protein_id gnl|my_center|LOCUS_19910 >Feature sequence058 2675 513 gene locus_tag LOCUS_19920 gene uvrB 2675 513 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895262.1 protein_id gnl|my_center|LOCUS_19920 2797 4668 gene locus_tag LOCUS_19930 2797 4668 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089295.1 protein_id gnl|my_center|LOCUS_19930 4679 5116 gene locus_tag LOCUS_19940 4679 5116 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110813.1 protein_id gnl|my_center|LOCUS_19940 5185 5721 gene locus_tag LOCUS_19950 5185 5721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 6865 5714 gene locus_tag LOCUS_19960 gene coaE 6865 5714 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408069.1 protein_id gnl|my_center|LOCUS_19960 8317 6872 gene locus_tag LOCUS_19970 gene rpsA 8317 6872 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895279.1 protein_id gnl|my_center|LOCUS_19970 8465 9622 gene locus_tag LOCUS_19980 8465 9622 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729357.1 protein_id gnl|my_center|LOCUS_19980 12318 9628 gene locus_tag LOCUS_19990 gene polA 12318 9628 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408063.1 protein_id gnl|my_center|LOCUS_19990 12398 12862 gene locus_tag LOCUS_20000 12398 12862 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729363.1 protein_id gnl|my_center|LOCUS_20000 12859 14091 gene locus_tag LOCUS_20010 12859 14091 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408054.1 protein_id gnl|my_center|LOCUS_20010 14092 14319 gene locus_tag LOCUS_20020 14092 14319 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895291.1 protein_id gnl|my_center|LOCUS_20020 15087 14344 gene locus_tag LOCUS_20030 15087 14344 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728924.1 protein_id gnl|my_center|LOCUS_20030 15910 15074 gene locus_tag LOCUS_20040 15910 15074 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728923.1 protein_id gnl|my_center|LOCUS_20040 17070 15907 gene locus_tag LOCUS_20050 17070 15907 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894640.1 protein_id gnl|my_center|LOCUS_20050 18104 17067 gene locus_tag LOCUS_20060 18104 17067 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728922.1 protein_id gnl|my_center|LOCUS_20060 19301 18111 gene locus_tag LOCUS_20070 19301 18111 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877617.1 protein_id gnl|my_center|LOCUS_20070 20671 19424 gene locus_tag LOCUS_20080 20671 19424 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877617.1 protein_id gnl|my_center|LOCUS_20080 21436 20807 gene locus_tag LOCUS_20090 21436 20807 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894637.1 protein_id gnl|my_center|LOCUS_20090 21538 21614 gene locus_tag LOCUS_t00190 21538 21614 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 22275 21643 gene locus_tag LOCUS_20100 22275 21643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 >Feature sequence059 691 885 gene locus_tag LOCUS_20110 gene rpmB 691 885 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056915.1 protein_id gnl|my_center|LOCUS_20110 1591 908 gene locus_tag LOCUS_20120 1591 908 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899565.1 protein_id gnl|my_center|LOCUS_20120 2580 1624 gene locus_tag LOCUS_20130 2580 1624 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415034.1 protein_id gnl|my_center|LOCUS_20130 2641 3246 gene locus_tag LOCUS_20140 2641 3246 CDS product DUF3515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415041.1 protein_id gnl|my_center|LOCUS_20140 4303 3251 gene locus_tag LOCUS_20150 4303 3251 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728314.1 protein_id gnl|my_center|LOCUS_20150 5443 4316 gene locus_tag LOCUS_20160 5443 4316 CDS product cystathionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728313.1 protein_id gnl|my_center|LOCUS_20160 6467 5457 gene locus_tag LOCUS_20170 6467 5457 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104352.1 protein_id gnl|my_center|LOCUS_20170 6536 7165 gene locus_tag LOCUS_20180 gene cofC 6536 7165 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893758.1 protein_id gnl|my_center|LOCUS_20180 7242 9395 gene locus_tag LOCUS_20190 7242 9395 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415097.1 protein_id gnl|my_center|LOCUS_20190 9397 10320 gene locus_tag LOCUS_20200 9397 10320 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899569.1 protein_id gnl|my_center|LOCUS_20200 11023 10373 gene locus_tag LOCUS_20210 11023 10373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 11820 11224 gene locus_tag LOCUS_20220 gene leuD 11820 11224 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893754.1 protein_id gnl|my_center|LOCUS_20220 13272 11839 gene locus_tag LOCUS_20230 gene leuC 13272 11839 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728310.1 protein_id gnl|my_center|LOCUS_20230 13394 14071 gene locus_tag LOCUS_20240 13394 14071 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728309.1 protein_id gnl|my_center|LOCUS_20240 14182 14676 gene locus_tag LOCUS_20250 14182 14676 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899572.1 protein_id gnl|my_center|LOCUS_20250 14828 14755 gene locus_tag LOCUS_t00200 14828 14755 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 14957 14883 gene locus_tag LOCUS_t00210 14957 14883 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 16508 15021 gene locus_tag LOCUS_20260 gene gltX 16508 15021 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728308.1 protein_id gnl|my_center|LOCUS_20260 17305 16505 gene locus_tag LOCUS_20270 17305 16505 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728307.1 protein_id gnl|my_center|LOCUS_20270 17364 18503 gene locus_tag LOCUS_20280 17364 18503 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893748.1 protein_id gnl|my_center|LOCUS_20280 19585 18587 gene locus_tag LOCUS_20290 19585 18587 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893747.1 protein_id gnl|my_center|LOCUS_20290 21195 19597 gene locus_tag LOCUS_20300 gene serA 21195 19597 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728303.1 protein_id gnl|my_center|LOCUS_20300 21695 21192 gene locus_tag LOCUS_20310 21695 21192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 >Feature sequence060 <1 1290 gene locus_tag LOCUS_20320 <1 1290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003411486.1:carboxylesterase CaeA 1437 2888 gene locus_tag LOCUS_20330 gene caeB 1437 2888 CDS product carboxylesterase CaeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411484.1 protein_id gnl|my_center|LOCUS_20330 2952 4292 gene locus_tag LOCUS_20340 gene glnA 2952 4292 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729709.1 protein_id gnl|my_center|LOCUS_20340 4341 7310 gene locus_tag LOCUS_20350 4341 7310 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729708.1 protein_id gnl|my_center|LOCUS_20350 7329 8189 gene locus_tag LOCUS_20360 7329 8189 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228576.1 protein_id gnl|my_center|LOCUS_20360 8510 8199 gene locus_tag LOCUS_20370 8510 8199 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225051.1 protein_id gnl|my_center|LOCUS_20370 8643 10154 gene locus_tag LOCUS_20380 8643 10154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 10151 12709 gene locus_tag LOCUS_20390 10151 12709 CDS product DUF2309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404785.1 protein_id gnl|my_center|LOCUS_20390 12706 13029 gene locus_tag LOCUS_20400 12706 13029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945981.1 protein_id gnl|my_center|LOCUS_20400 13062 13688 gene locus_tag LOCUS_20410 gene canB 13062 13688 CDS product beta-carbonic anhydrase CanB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419492.1 protein_id gnl|my_center|LOCUS_20410 14351 13689 gene locus_tag LOCUS_20420 14351 13689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 15896 14460 gene locus_tag LOCUS_20430 gene glnA 15896 14460 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895686.1 protein_id gnl|my_center|LOCUS_20430 15996 16475 gene locus_tag LOCUS_20440 15996 16475 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411466.1 protein_id gnl|my_center|LOCUS_20440 16607 17443 gene locus_tag LOCUS_20450 16607 17443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405722.1 protein_id gnl|my_center|LOCUS_20450 18269 17517 gene locus_tag LOCUS_20460 18269 17517 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895683.1 protein_id gnl|my_center|LOCUS_20460 19246 18296 gene locus_tag LOCUS_20470 gene lipA 19246 18296 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729704.1 protein_id gnl|my_center|LOCUS_20470 19929 19243 gene locus_tag LOCUS_20480 gene lipB 19929 19243 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895681.1 protein_id gnl|my_center|LOCUS_20480 20863 19943 gene locus_tag LOCUS_20490 20863 19943 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411454.1 protein_id gnl|my_center|LOCUS_20490 <21660 20877 gene locus_tag LOCUS_20500 <21660 20877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729702.1:2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase >Feature sequence061 84 947 gene locus_tag LOCUS_20510 84 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 944 2362 gene locus_tag LOCUS_20520 944 2362 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053543833.1 protein_id gnl|my_center|LOCUS_20520 2359 4293 gene locus_tag LOCUS_20530 2359 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 4290 5990 gene locus_tag LOCUS_20540 4290 5990 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013414.1 protein_id gnl|my_center|LOCUS_20540 6064 6804 gene locus_tag LOCUS_20550 6064 6804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 6965 7672 gene locus_tag LOCUS_20560 6965 7672 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531816.1 protein_id gnl|my_center|LOCUS_20560 7731 8543 gene locus_tag LOCUS_20570 7731 8543 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088305.1 protein_id gnl|my_center|LOCUS_20570 9732 8590 gene locus_tag LOCUS_20580 9732 8590 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727419.1 protein_id gnl|my_center|LOCUS_20580 10022 9723 gene locus_tag LOCUS_20590 10022 9723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 10582 10019 gene locus_tag LOCUS_20600 10582 10019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 10735 11568 gene locus_tag LOCUS_20610 10735 11568 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877365.1 protein_id gnl|my_center|LOCUS_20610 11565 12398 gene locus_tag LOCUS_20620 11565 12398 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728291.1 protein_id gnl|my_center|LOCUS_20620 12483 16967 gene locus_tag LOCUS_20630 12483 16967 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911174.1 protein_id gnl|my_center|LOCUS_20630 17060 16851 gene locus_tag LOCUS_20640 17060 16851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 17098 17589 gene locus_tag LOCUS_20650 17098 17589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 18273 17608 gene locus_tag LOCUS_20660 gene phoU 18273 17608 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404314.1 protein_id gnl|my_center|LOCUS_20660 18469 19557 gene locus_tag LOCUS_20670 18469 19557 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229652.1 protein_id gnl|my_center|LOCUS_20670 20072 19710 gene locus_tag LOCUS_20680 20072 19710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 20338 20946 gene locus_tag LOCUS_20690 20338 20946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 >Feature sequence062 <1 534 gene locus_tag LOCUS_20700 <1 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003416897.1:sigma-70 family RNA polymerase sigma factor SigH 531 827 gene locus_tag LOCUS_20710 gene rsrA 531 827 CDS product mycothiol system anti-sigma-R factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728007.1 protein_id gnl|my_center|LOCUS_20710 1006 1248 gene locus_tag LOCUS_20720 1006 1248 CDS product biotin/lipoyl-binding carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877243.1 protein_id gnl|my_center|LOCUS_20720 1257 2702 gene locus_tag LOCUS_20730 1257 2702 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728009.1 protein_id gnl|my_center|LOCUS_20730 2714 3316 gene locus_tag LOCUS_20740 2714 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 3629 3375 gene locus_tag LOCUS_20750 gene whiB1 3629 3375 CDS product transcriptional regulator WhiB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893300.1 protein_id gnl|my_center|LOCUS_20750 4831 3872 gene locus_tag LOCUS_20760 4831 3872 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728010.1 protein_id gnl|my_center|LOCUS_20760 4892 5488 gene locus_tag LOCUS_20770 4892 5488 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005099244.1 protein_id gnl|my_center|LOCUS_20770 5498 5917 gene locus_tag LOCUS_20780 5498 5917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056347.1 protein_id gnl|my_center|LOCUS_20780 6363 5872 gene locus_tag LOCUS_20790 6363 5872 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728014.1 protein_id gnl|my_center|LOCUS_20790 7442 6366 gene locus_tag LOCUS_20800 7442 6366 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728015.1 protein_id gnl|my_center|LOCUS_20800 8059 7463 gene locus_tag LOCUS_20810 8059 7463 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728016.1 protein_id gnl|my_center|LOCUS_20810 8083 8883 gene locus_tag LOCUS_20820 8083 8883 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901572.1 protein_id gnl|my_center|LOCUS_20820 10106 8880 gene locus_tag LOCUS_20830 10106 8880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416876.1 protein_id gnl|my_center|LOCUS_20830 11610 10111 gene locus_tag LOCUS_20840 11610 10111 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728020.1 protein_id gnl|my_center|LOCUS_20840 11788 12462 gene locus_tag LOCUS_20850 11788 12462 CDS product ferritin-like fold-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416873.1 protein_id gnl|my_center|LOCUS_20850 12980 12489 gene locus_tag LOCUS_20860 12980 12489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 13204 13428 gene locus_tag LOCUS_20870 13204 13428 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893314.1 protein_id gnl|my_center|LOCUS_20870 14087 13452 gene locus_tag LOCUS_20880 14087 13452 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893315.1 protein_id gnl|my_center|LOCUS_20880 14233 15222 gene locus_tag LOCUS_20890 14233 15222 CDS product DUF3152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728024.1 protein_id gnl|my_center|LOCUS_20890 15227 16378 gene locus_tag LOCUS_20900 gene moeZ 15227 16378 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085976174.1 protein_id gnl|my_center|LOCUS_20900 16441 17295 gene locus_tag LOCUS_20910 16441 17295 CDS product TIGR02569 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893318.1 protein_id gnl|my_center|LOCUS_20910 17591 17292 gene locus_tag LOCUS_20920 17591 17292 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728026.1 protein_id gnl|my_center|LOCUS_20920 18375 17593 gene locus_tag LOCUS_20930 gene lipV 18375 17593 CDS product lipase LipV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899968.1 protein_id gnl|my_center|LOCUS_20930 18367 19761 gene locus_tag LOCUS_20940 18367 19761 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926478.1 protein_id gnl|my_center|LOCUS_20940 >Feature sequence063 2 385 gene locus_tag LOCUS_20950 2 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 378 1046 gene locus_tag LOCUS_20960 378 1046 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896046.1 protein_id gnl|my_center|LOCUS_20960 1314 2594 gene locus_tag LOCUS_20970 gene clpX 1314 2594 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896045.1 protein_id gnl|my_center|LOCUS_20970 3507 2689 gene locus_tag LOCUS_20980 gene fdhD 3507 2689 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896043.1 protein_id gnl|my_center|LOCUS_20980 5809 3512 gene locus_tag LOCUS_20990 5809 3512 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899532.1 protein_id gnl|my_center|LOCUS_20990 5971 8145 gene locus_tag LOCUS_21000 5971 8145 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938554.1 protein_id gnl|my_center|LOCUS_21000 8389 10341 gene locus_tag LOCUS_21010 8389 10341 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896022.1 protein_id gnl|my_center|LOCUS_21010 10338 11411 gene locus_tag LOCUS_21020 10338 11411 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878091.1 protein_id gnl|my_center|LOCUS_21020 11417 11974 gene locus_tag LOCUS_21030 11417 11974 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412618.1 protein_id gnl|my_center|LOCUS_21030 12371 12694 gene locus_tag LOCUS_21040 12371 12694 CDS product transglycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896019.1 protein_id gnl|my_center|LOCUS_21040 12868 13362 gene locus_tag LOCUS_21050 12868 13362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 13399 14649 gene locus_tag LOCUS_21060 13399 14649 CDS product trans-acting enoyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412609.1 protein_id gnl|my_center|LOCUS_21060 14737 15351 gene locus_tag LOCUS_21070 14737 15351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 15411 18080 gene locus_tag LOCUS_21080 15411 18080 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896007.1 protein_id gnl|my_center|LOCUS_21080 18077 19492 gene locus_tag LOCUS_21090 gene folC 18077 19492 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899324.1 protein_id gnl|my_center|LOCUS_21090 19489 19881 gene locus_tag LOCUS_21100 19489 19881 CDS product DUF4233 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074540.1 protein_id gnl|my_center|LOCUS_21100 19899 20309 gene locus_tag LOCUS_21110 gene ndk 19899 20309 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729972.1 protein_id gnl|my_center|LOCUS_21110 >Feature sequence064 <1 3226 gene locus_tag LOCUS_21120 <1 3226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014878656.1:glutamate synthase large subunit 3219 4670 gene locus_tag LOCUS_21130 3219 4670 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899732.1 protein_id gnl|my_center|LOCUS_21130 4746 4985 gene locus_tag LOCUS_21140 4746 4985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 5839 4982 gene locus_tag LOCUS_21150 5839 4982 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897866.1 protein_id gnl|my_center|LOCUS_21150 6145 6408 gene locus_tag LOCUS_21160 6145 6408 CDS product DUF2710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400413.1 protein_id gnl|my_center|LOCUS_21160 6425 7915 gene locus_tag LOCUS_21170 gene eccB2 6425 7915 CDS product type VII secretion system ESX-2 subunit EccB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400065.1 protein_id gnl|my_center|LOCUS_21170 7918 12000 gene locus_tag LOCUS_21180 gene eccC2 7918 12000 CDS product type VII secretion system ESX-2 FtsK/SpoIIIE family ATPase EccC2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014002018.1 protein_id gnl|my_center|LOCUS_21180 12023 12802 gene locus_tag LOCUS_21190 12023 12802 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899864.1 protein_id gnl|my_center|LOCUS_21190 14011 12830 gene locus_tag LOCUS_21200 14011 12830 CDS product osmoprotectant NAGGN system M42 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111432.1 protein_id gnl|my_center|LOCUS_21200 15870 14008 gene locus_tag LOCUS_21210 gene ngg 15870 14008 CDS product N-acetylglutaminylglutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728458.1 protein_id gnl|my_center|LOCUS_21210 17659 15878 gene locus_tag LOCUS_21220 17659 15878 CDS product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728459.1 protein_id gnl|my_center|LOCUS_21220 18805 17738 gene locus_tag LOCUS_21230 18805 17738 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728648.1 protein_id gnl|my_center|LOCUS_21230 19976 18813 gene locus_tag LOCUS_21240 19976 18813 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728649.1 protein_id gnl|my_center|LOCUS_21240 20815 19973 gene locus_tag LOCUS_21250 20815 19973 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731296.1 protein_id gnl|my_center|LOCUS_21250 >Feature sequence065 302 751 gene locus_tag LOCUS_21260 302 751 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407340.1 protein_id gnl|my_center|LOCUS_21260 761 2797 gene locus_tag LOCUS_21270 gene uvrC 761 2797 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407347.1 protein_id gnl|my_center|LOCUS_21270 2839 3774 gene locus_tag LOCUS_21280 gene rapZ 2839 3774 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093536.1 protein_id gnl|my_center|LOCUS_21280 3771 4772 gene locus_tag LOCUS_21290 gene yvcK 3771 4772 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728801.1 protein_id gnl|my_center|LOCUS_21290 4785 5762 gene locus_tag LOCUS_21300 gene whiA 4785 5762 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877572.1 protein_id gnl|my_center|LOCUS_21300 6701 5796 gene locus_tag LOCUS_21310 6701 5796 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522101.1 protein_id gnl|my_center|LOCUS_21310 6813 7829 gene locus_tag LOCUS_21320 gene gap 6813 7829 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894472.1 protein_id gnl|my_center|LOCUS_21320 7844 9067 gene locus_tag LOCUS_21330 7844 9067 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894473.1 protein_id gnl|my_center|LOCUS_21330 9075 9860 gene locus_tag LOCUS_21340 gene tpiA 9075 9860 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407398.1 protein_id gnl|my_center|LOCUS_21340 9892 10125 gene locus_tag LOCUS_21350 gene secG 9892 10125 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894475.1 protein_id gnl|my_center|LOCUS_21350 10698 10300 gene locus_tag LOCUS_21360 10698 10300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 10701 11405 gene locus_tag LOCUS_21370 10701 11405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 11660 12919 gene locus_tag LOCUS_21380 11660 12919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 13192 14085 gene locus_tag LOCUS_21390 13192 14085 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112110.1 protein_id gnl|my_center|LOCUS_21390 14878 14624 gene locus_tag LOCUS_21400 14878 14624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 15489 14908 gene locus_tag LOCUS_21410 15489 14908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 16176 15832 gene locus_tag LOCUS_21420 16176 15832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 16983 16183 gene locus_tag LOCUS_21430 16983 16183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 17192 17013 gene locus_tag LOCUS_21440 17192 17013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 17750 17445 gene locus_tag LOCUS_21450 17750 17445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 19362 17965 gene locus_tag LOCUS_21460 19362 17965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 20150 19359 gene locus_tag LOCUS_21470 20150 19359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 20512 20147 gene locus_tag LOCUS_21480 20512 20147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 20801 20505 gene locus_tag LOCUS_21490 20801 20505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 >Feature sequence066 152 1186 gene locus_tag LOCUS_21500 152 1186 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537727.1 protein_id gnl|my_center|LOCUS_21500 1240 1692 gene locus_tag LOCUS_21510 1240 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 1695 3200 gene locus_tag LOCUS_21520 1695 3200 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969731.1 protein_id gnl|my_center|LOCUS_21520 3348 3872 gene locus_tag LOCUS_21530 3348 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21530 3851 4096 gene locus_tag LOCUS_21540 3851 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 4133 4312 gene locus_tag LOCUS_21550 4133 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 5408 4677 gene locus_tag LOCUS_21560 5408 4677 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083146.1 protein_id gnl|my_center|LOCUS_21560 6725 5532 gene locus_tag LOCUS_21570 6725 5532 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234976.1 protein_id gnl|my_center|LOCUS_21570 6658 6864 gene locus_tag LOCUS_21580 6658 6864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 8037 7021 gene locus_tag LOCUS_21590 8037 7021 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727331.1 protein_id gnl|my_center|LOCUS_21590 10016 8034 gene locus_tag LOCUS_21600 10016 8034 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892409.1 protein_id gnl|my_center|LOCUS_21600 10274 10083 gene locus_tag LOCUS_21610 10274 10083 CDS product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728261.1 protein_id gnl|my_center|LOCUS_21610 12511 10220 gene locus_tag LOCUS_21620 12511 10220 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728262.1 protein_id gnl|my_center|LOCUS_21620 12928 12629 gene locus_tag LOCUS_21630 12928 12629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 12980 13168 gene locus_tag LOCUS_21640 12980 13168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 14644 13187 gene locus_tag LOCUS_21650 14644 13187 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727250.1 protein_id gnl|my_center|LOCUS_21650 15054 14641 gene locus_tag LOCUS_21660 15054 14641 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727249.1 protein_id gnl|my_center|LOCUS_21660 15393 16202 gene locus_tag LOCUS_21670 15393 16202 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054642.1 protein_id gnl|my_center|LOCUS_21670 16295 18013 gene locus_tag LOCUS_21680 16295 18013 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110516.1 protein_id gnl|my_center|LOCUS_21680 18010 19089 gene locus_tag LOCUS_21690 18010 19089 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726948.1 protein_id gnl|my_center|LOCUS_21690 19136 20017 gene locus_tag LOCUS_21700 19136 20017 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730749.1 protein_id gnl|my_center|LOCUS_21700 >Feature sequence067 637 50 gene locus_tag LOCUS_21710 637 50 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894623.1 protein_id gnl|my_center|LOCUS_21710 755 1684 gene locus_tag LOCUS_21720 755 1684 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894624.1 protein_id gnl|my_center|LOCUS_21720 1690 2607 gene locus_tag LOCUS_21730 1690 2607 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894625.1 protein_id gnl|my_center|LOCUS_21730 2604 3377 gene locus_tag LOCUS_21740 2604 3377 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894626.1 protein_id gnl|my_center|LOCUS_21740 4701 3385 gene locus_tag LOCUS_21750 gene cya 4701 3385 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408035.1 protein_id gnl|my_center|LOCUS_21750 5070 4792 gene locus_tag LOCUS_21760 5070 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 5552 6187 gene locus_tag LOCUS_21770 5552 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 7302 6532 gene locus_tag LOCUS_21780 7302 6532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 7724 7347 gene locus_tag LOCUS_21790 7724 7347 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900347.1 protein_id gnl|my_center|LOCUS_21790 7896 8942 gene locus_tag LOCUS_21800 7896 8942 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899194.1 protein_id gnl|my_center|LOCUS_21800 9748 9332 gene locus_tag LOCUS_21810 9748 9332 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141677.1 protein_id gnl|my_center|LOCUS_21810 9996 9745 gene locus_tag LOCUS_21820 9996 9745 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141676.1 protein_id gnl|my_center|LOCUS_21820 10149 10499 gene locus_tag LOCUS_21830 10149 10499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 10572 11567 gene locus_tag LOCUS_21840 10572 11567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 13389 11719 gene locus_tag LOCUS_21850 13389 11719 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011242294.1 protein_id gnl|my_center|LOCUS_21850 13643 14023 gene locus_tag LOCUS_21860 13643 14023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 14647 14072 gene locus_tag LOCUS_21870 14647 14072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 15361 15981 gene locus_tag LOCUS_21880 15361 15981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 15978 16526 gene locus_tag LOCUS_21890 15978 16526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875932.1 protein_id gnl|my_center|LOCUS_21890 16532 16786 gene locus_tag LOCUS_21900 16532 16786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 17681 16809 gene locus_tag LOCUS_21910 17681 16809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 17931 17692 gene locus_tag LOCUS_21920 17931 17692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 18938 18705 gene locus_tag LOCUS_21930 18938 18705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 19741 19283 gene locus_tag LOCUS_21940 19741 19283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21940 19677 20003 gene locus_tag LOCUS_21950 19677 20003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence068 1237 212 gene locus_tag LOCUS_21960 1237 212 CDS product DUF5628 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419657.1 protein_id gnl|my_center|LOCUS_21960 3898 1550 gene locus_tag LOCUS_21970 3898 1550 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419652.1 protein_id gnl|my_center|LOCUS_21970 4144 4347 gene locus_tag LOCUS_21980 4144 4347 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011562175.1 protein_id gnl|my_center|LOCUS_21980 4516 5094 gene locus_tag LOCUS_21990 4516 5094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419642.1 protein_id gnl|my_center|LOCUS_21990 5236 8049 gene locus_tag LOCUS_22000 gene topA 5236 8049 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731080.1 protein_id gnl|my_center|LOCUS_22000 8434 8063 gene locus_tag LOCUS_22010 8434 8063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 10025 8439 gene locus_tag LOCUS_22020 10025 8439 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731079.1 protein_id gnl|my_center|LOCUS_22020 10118 11332 gene locus_tag LOCUS_22030 10118 11332 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731078.1 protein_id gnl|my_center|LOCUS_22030 11389 11464 gene locus_tag LOCUS_t00220 11389 11464 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 11806 12057 gene locus_tag LOCUS_22040 11806 12057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420563.1 protein_id gnl|my_center|LOCUS_22040 13430 12363 gene locus_tag LOCUS_22050 13430 12363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 14518 13451 gene locus_tag LOCUS_22060 14518 13451 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729219.1 protein_id gnl|my_center|LOCUS_22060 16095 14515 gene locus_tag LOCUS_22070 16095 14515 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729220.1 protein_id gnl|my_center|LOCUS_22070 17135 16092 gene locus_tag LOCUS_22080 17135 16092 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729221.1 protein_id gnl|my_center|LOCUS_22080 17026 17304 gene locus_tag LOCUS_22090 17026 17304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 17955 17515 gene locus_tag LOCUS_22100 17955 17515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 19329 18061 gene locus_tag LOCUS_22110 19329 18061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 >Feature sequence069 1987 5106 gene locus_tag LOCUS_22120 gene ileS 1987 5106 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728863.1 protein_id gnl|my_center|LOCUS_22120 5108 6427 gene locus_tag LOCUS_22130 5108 6427 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728865.1 protein_id gnl|my_center|LOCUS_22130 7382 6444 gene locus_tag LOCUS_22140 7382 6444 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407720.1 protein_id gnl|my_center|LOCUS_22140 7409 7945 gene locus_tag LOCUS_22150 7409 7945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 7945 8868 gene locus_tag LOCUS_22160 7945 8868 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728869.1 protein_id gnl|my_center|LOCUS_22160 8882 9796 gene locus_tag LOCUS_22170 gene rarD 8882 9796 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075908.1 protein_id gnl|my_center|LOCUS_22170 9793 10377 gene locus_tag LOCUS_22180 9793 10377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 10452 13997 gene locus_tag LOCUS_22190 gene dnaE 10452 13997 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407751.1 protein_id gnl|my_center|LOCUS_22190 14420 14019 gene locus_tag LOCUS_22200 14420 14019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893268.1 protein_id gnl|my_center|LOCUS_22200 14523 14960 gene locus_tag LOCUS_22210 14523 14960 CDS product F420H(2)-dependent quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407780.1 protein_id gnl|my_center|LOCUS_22210 14990 16303 gene locus_tag LOCUS_22220 gene ilvA 14990 16303 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407781.1 protein_id gnl|my_center|LOCUS_22220 16742 16323 gene locus_tag LOCUS_22230 16742 16323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 18954 16810 gene locus_tag LOCUS_22240 gene glgX 18954 16810 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462534.1 protein_id gnl|my_center|LOCUS_22240 >Feature sequence070 165 1481 gene locus_tag LOCUS_22250 165 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 2678 1512 gene locus_tag LOCUS_22260 2678 1512 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902894.1 protein_id gnl|my_center|LOCUS_22260 2706 3731 gene locus_tag LOCUS_22270 2706 3731 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726789.1 protein_id gnl|my_center|LOCUS_22270 3788 5311 gene locus_tag LOCUS_22280 3788 5311 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211696200.1 protein_id gnl|my_center|LOCUS_22280 6492 5320 gene locus_tag LOCUS_22290 6492 5320 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727996.1 protein_id gnl|my_center|LOCUS_22290 7640 6489 gene locus_tag LOCUS_22300 7640 6489 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225727.1 protein_id gnl|my_center|LOCUS_22300 8597 7647 gene locus_tag LOCUS_22310 8597 7647 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726805.1 protein_id gnl|my_center|LOCUS_22310 9294 8725 gene locus_tag LOCUS_22320 gene aac(2')-Ic 9294 8725 CDS product aminoglycoside N-acetyltransferase AAC(2')-Ic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899880.1 protein_id gnl|my_center|LOCUS_22320 10198 9305 gene locus_tag LOCUS_22330 10198 9305 CDS product 5-oxoprolinase/urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891754.1 protein_id gnl|my_center|LOCUS_22330 10827 10195 gene locus_tag LOCUS_22340 10827 10195 CDS product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104243.1 protein_id gnl|my_center|LOCUS_22340 11519 10827 gene locus_tag LOCUS_22350 11519 10827 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070188143.1 protein_id gnl|my_center|LOCUS_22350 12163 11555 gene locus_tag LOCUS_22360 12163 11555 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033261752.1 protein_id gnl|my_center|LOCUS_22360 12242 12880 gene locus_tag LOCUS_22370 12242 12880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22370 12855 13718 gene locus_tag LOCUS_22380 12855 13718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22380 14045 13740 gene locus_tag LOCUS_22390 14045 13740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 15502 14042 gene locus_tag LOCUS_22400 15502 14042 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731462.1 protein_id gnl|my_center|LOCUS_22400 16737 15532 gene locus_tag LOCUS_22410 16737 15532 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731461.1 protein_id gnl|my_center|LOCUS_22410 18659 16896 gene locus_tag LOCUS_22420 18659 16896 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901535.1 protein_id gnl|my_center|LOCUS_22420 >Feature sequence071 733 326 gene locus_tag LOCUS_22430 733 326 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731058.1 protein_id gnl|my_center|LOCUS_22430 1204 1851 gene locus_tag LOCUS_22440 1204 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 1905 3716 gene locus_tag LOCUS_22450 1905 3716 CDS product peroxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094611.1 protein_id gnl|my_center|LOCUS_22450 3724 5043 gene locus_tag LOCUS_22460 3724 5043 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226936.1 protein_id gnl|my_center|LOCUS_22460 5087 7036 gene locus_tag LOCUS_22470 5087 7036 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729863.1 protein_id gnl|my_center|LOCUS_22470 7033 8154 gene locus_tag LOCUS_22480 7033 8154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 8155 8991 gene locus_tag LOCUS_22490 8155 8991 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060018.1 protein_id gnl|my_center|LOCUS_22490 9268 11301 gene locus_tag LOCUS_22500 9268 11301 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726956.1 protein_id gnl|my_center|LOCUS_22500 11314 13446 gene locus_tag LOCUS_22510 11314 13446 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891777.1 protein_id gnl|my_center|LOCUS_22510 13584 15197 gene locus_tag LOCUS_22520 13584 15197 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405217.1 protein_id gnl|my_center|LOCUS_22520 15208 16167 gene locus_tag LOCUS_22530 15208 16167 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057677989.1 protein_id gnl|my_center|LOCUS_22530 16353 16279 gene locus_tag LOCUS_t00230 16353 16279 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 16506 16579 gene locus_tag LOCUS_t00240 16506 16579 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 16608 16680 gene locus_tag LOCUS_t00250 16608 16680 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 16693 16767 gene locus_tag LOCUS_t00260 16693 16767 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 17055 17549 gene locus_tag LOCUS_22540 17055 17549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 17762 18349 gene locus_tag LOCUS_22550 17762 18349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 >Feature sequence072 4204 227 gene locus_tag LOCUS_22560 4204 227 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731067.1 protein_id gnl|my_center|LOCUS_22560 4367 5335 gene locus_tag LOCUS_22570 4367 5335 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113122.1 protein_id gnl|my_center|LOCUS_22570 5868 5341 gene locus_tag LOCUS_22580 5868 5341 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897516.1 protein_id gnl|my_center|LOCUS_22580 6445 5957 gene locus_tag LOCUS_22590 6445 5957 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064895.1 protein_id gnl|my_center|LOCUS_22590 6590 7939 gene locus_tag LOCUS_22600 gene dacB 6590 7939 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104179.1 protein_id gnl|my_center|LOCUS_22600 8036 9055 gene locus_tag LOCUS_22610 8036 9055 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419571.1 protein_id gnl|my_center|LOCUS_22610 9061 9996 gene locus_tag LOCUS_22620 gene tilS 9061 9996 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899608.1 protein_id gnl|my_center|LOCUS_22620 10027 10602 gene locus_tag LOCUS_22630 gene hpt 10027 10602 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878560.1 protein_id gnl|my_center|LOCUS_22630 11343 10612 gene locus_tag LOCUS_22640 11343 10612 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897510.1 protein_id gnl|my_center|LOCUS_22640 12333 11365 gene locus_tag LOCUS_22650 gene ephA 12333 11365 CDS product epoxide hydrolase EphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899600.1 protein_id gnl|my_center|LOCUS_22650 12502 14850 gene locus_tag LOCUS_22660 gene ftsH 12502 14850 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897506.1 protein_id gnl|my_center|LOCUS_22660 14869 15471 gene locus_tag LOCUS_22670 gene folE 14869 15471 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899597.1 protein_id gnl|my_center|LOCUS_22670 15498 16313 gene locus_tag LOCUS_22680 gene folP 15498 16313 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175048402.1 protein_id gnl|my_center|LOCUS_22680 16306 16701 gene locus_tag LOCUS_22690 gene folB 16306 16701 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897503.1 protein_id gnl|my_center|LOCUS_22690 16698 17240 gene locus_tag LOCUS_22700 gene folK 16698 17240 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897502.1 protein_id gnl|my_center|LOCUS_22700 17240 17716 gene locus_tag LOCUS_22710 17240 17716 CDS product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897501.1 protein_id gnl|my_center|LOCUS_22710 >Feature sequence073 1146 73 gene locus_tag LOCUS_22720 1146 73 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727350.1 protein_id gnl|my_center|LOCUS_22720 2229 1153 gene locus_tag LOCUS_22730 gene hypE 2229 1153 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893646.1 protein_id gnl|my_center|LOCUS_22730 3338 2235 gene locus_tag LOCUS_22740 gene hypD 3338 2235 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893645.1 protein_id gnl|my_center|LOCUS_22740 3583 3335 gene locus_tag LOCUS_22750 3583 3335 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893644.1 protein_id gnl|my_center|LOCUS_22750 6039 3556 gene locus_tag LOCUS_22760 gene hypF 6039 3556 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728273.1 protein_id gnl|my_center|LOCUS_22760 5996 6343 gene locus_tag LOCUS_22770 5996 6343 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728272.1 protein_id gnl|my_center|LOCUS_22770 6348 7133 gene locus_tag LOCUS_22780 gene hypB 6348 7133 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728271.1 protein_id gnl|my_center|LOCUS_22780 9351 7141 gene locus_tag LOCUS_22790 9351 7141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 11520 9391 gene locus_tag LOCUS_22800 11520 9391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 12182 11520 gene locus_tag LOCUS_22810 12182 11520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 14493 12307 gene locus_tag LOCUS_22820 14493 12307 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902404.1 protein_id gnl|my_center|LOCUS_22820 14913 14629 gene locus_tag LOCUS_22830 14913 14629 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225051.1 protein_id gnl|my_center|LOCUS_22830 16237 14960 gene locus_tag LOCUS_22840 16237 14960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 16594 17826 gene locus_tag LOCUS_22850 16594 17826 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728213.1 protein_id gnl|my_center|LOCUS_22850 >Feature sequence074 711 1298 gene locus_tag LOCUS_22860 711 1298 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897770.1 protein_id gnl|my_center|LOCUS_22860 1333 1420 gene locus_tag LOCUS_t00270 1333 1420 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1482 1715 gene locus_tag LOCUS_22870 1482 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 1726 2094 gene locus_tag LOCUS_22880 1726 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 3322 2108 gene locus_tag LOCUS_22890 3322 2108 CDS product lycopene cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257690.1 protein_id gnl|my_center|LOCUS_22890 4181 3351 gene locus_tag LOCUS_22900 4181 3351 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731225.1 protein_id gnl|my_center|LOCUS_22900 4805 4221 gene locus_tag LOCUS_22910 gene cysE 4805 4221 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006286028.1 protein_id gnl|my_center|LOCUS_22910 5745 4810 gene locus_tag LOCUS_22920 gene cysK 5745 4810 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567803.1 protein_id gnl|my_center|LOCUS_22920 6890 5826 gene locus_tag LOCUS_22930 gene hisC 6890 5826 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731224.1 protein_id gnl|my_center|LOCUS_22930 6976 7066 gene locus_tag LOCUS_t00280 6976 7066 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7103 7176 gene locus_tag LOCUS_t00290 7103 7176 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7519 8700 gene locus_tag LOCUS_22940 7519 8700 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461029.1 protein_id gnl|my_center|LOCUS_22940 8801 9127 gene locus_tag LOCUS_22950 8801 9127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22950 9486 9821 gene locus_tag LOCUS_22960 9486 9821 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265672.1 protein_id gnl|my_center|LOCUS_22960 9835 10122 gene locus_tag LOCUS_22970 9835 10122 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 protein_id gnl|my_center|LOCUS_22970 11637 10282 gene locus_tag LOCUS_22980 11637 10282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084962.1 protein_id gnl|my_center|LOCUS_22980 12062 11637 gene locus_tag LOCUS_22990 12062 11637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731324.1 protein_id gnl|my_center|LOCUS_22990 12705 12067 gene locus_tag LOCUS_23000 12705 12067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 14078 12819 gene locus_tag LOCUS_23010 14078 12819 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404402.1 protein_id gnl|my_center|LOCUS_23010 15193 14078 gene locus_tag LOCUS_23020 gene cysK2 15193 14078 CDS product S-sulfocysteine synthase CysK2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935595.1 protein_id gnl|my_center|LOCUS_23020 15403 15636 gene locus_tag LOCUS_23030 15403 15636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 16279 15884 gene locus_tag LOCUS_23040 16279 15884 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730501.1 protein_id gnl|my_center|LOCUS_23040 16477 17151 gene locus_tag LOCUS_23050 16477 17151 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225371.1 protein_id gnl|my_center|LOCUS_23050 <18170 17216 gene locus_tag LOCUS_23060 <18170 17216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005091654.1:HAMP domain-containing sensor histidine kinase >Feature sequence075 585 373 gene locus_tag LOCUS_23070 585 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 475 1998 gene locus_tag LOCUS_23080 gene fadD1 475 1998 CDS product fatty-acid--CoA ligase FadD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730208.1 protein_id gnl|my_center|LOCUS_23080 1991 2374 gene locus_tag LOCUS_23090 1991 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 2470 3549 gene locus_tag LOCUS_23100 gene prfA 2470 3549 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730207.1 protein_id gnl|my_center|LOCUS_23100 3546 4397 gene locus_tag LOCUS_23110 gene prmC 3546 4397 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406673.1 protein_id gnl|my_center|LOCUS_23110 4394 5047 gene locus_tag LOCUS_23120 4394 5047 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406678.1 protein_id gnl|my_center|LOCUS_23120 5087 6289 gene locus_tag LOCUS_23130 gene rfe 5087 6289 CDS product UDP-N-acetylglucosamine--decaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730204.1 protein_id gnl|my_center|LOCUS_23130 6426 6881 gene locus_tag LOCUS_23140 6426 6881 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908156.1 protein_id gnl|my_center|LOCUS_23140 6887 7642 gene locus_tag LOCUS_23150 gene atpB 6887 7642 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406681.1 protein_id gnl|my_center|LOCUS_23150 7750 8001 gene locus_tag LOCUS_23160 7750 8001 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059842.1 protein_id gnl|my_center|LOCUS_23160 8008 8529 gene locus_tag LOCUS_23170 8008 8529 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896332.1 protein_id gnl|my_center|LOCUS_23170 8535 9869 gene locus_tag LOCUS_23180 8535 9869 CDS product F0F1 ATP synthase subunit B/delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896331.1 protein_id gnl|my_center|LOCUS_23180 9916 11562 gene locus_tag LOCUS_23190 gene atpA 9916 11562 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406699.1 protein_id gnl|my_center|LOCUS_23190 11563 12489 gene locus_tag LOCUS_23200 11563 12489 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896329.1 protein_id gnl|my_center|LOCUS_23200 12524 13960 gene locus_tag LOCUS_23210 gene atpD 12524 13960 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896328.1 protein_id gnl|my_center|LOCUS_23210 13994 14359 gene locus_tag LOCUS_23220 13994 14359 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730202.1 protein_id gnl|my_center|LOCUS_23220 14388 14819 gene locus_tag LOCUS_23230 14388 14819 CDS product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406722.1 protein_id gnl|my_center|LOCUS_23230 15417 14827 gene locus_tag LOCUS_23240 15417 14827 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089979.1 protein_id gnl|my_center|LOCUS_23240 15479 16732 gene locus_tag LOCUS_23250 gene murA 15479 16732 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730199.1 protein_id gnl|my_center|LOCUS_23250 >Feature sequence076 <1 1623 gene locus_tag LOCUS_23260 <1 1623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003901256.1:PPE family protein 1728 3761 gene locus_tag LOCUS_23270 1728 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 4957 3788 gene locus_tag LOCUS_23280 4957 3788 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419287.1 protein_id gnl|my_center|LOCUS_23280 5391 4957 gene locus_tag LOCUS_23290 5391 4957 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730956.1 protein_id gnl|my_center|LOCUS_23290 6332 5358 gene locus_tag LOCUS_23300 6332 5358 CDS product bifunctional MaoC family dehydratase N-terminal/OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730957.1 protein_id gnl|my_center|LOCUS_23300 7495 6332 gene locus_tag LOCUS_23310 7495 6332 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419296.1 protein_id gnl|my_center|LOCUS_23310 8499 7486 gene locus_tag LOCUS_23320 8499 7486 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730959.1 protein_id gnl|my_center|LOCUS_23320 9800 8526 gene locus_tag LOCUS_23330 gene cyp125 9800 8526 CDS product steroid C26-monooxygenase Cyp125 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419304.1 protein_id gnl|my_center|LOCUS_23330 9922 11085 gene locus_tag LOCUS_23340 9922 11085 CDS product steroid 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730961.1 protein_id gnl|my_center|LOCUS_23340 11037 11957 gene locus_tag LOCUS_23350 11037 11957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 12876 11971 gene locus_tag LOCUS_23360 12876 11971 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900711.1 protein_id gnl|my_center|LOCUS_23360 13704 12889 gene locus_tag LOCUS_23370 13704 12889 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730965.1 protein_id gnl|my_center|LOCUS_23370 13703 14458 gene locus_tag LOCUS_23380 13703 14458 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897402.1 protein_id gnl|my_center|LOCUS_23380 14455 15342 gene locus_tag LOCUS_23390 14455 15342 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730966.1 protein_id gnl|my_center|LOCUS_23390 15339 16085 gene locus_tag LOCUS_23400 15339 16085 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730967.1 protein_id gnl|my_center|LOCUS_23400 16082 17170 gene locus_tag LOCUS_23410 16082 17170 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419324.1 protein_id gnl|my_center|LOCUS_23410 17646 17179 gene locus_tag LOCUS_23420 17646 17179 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926981.1 protein_id gnl|my_center|LOCUS_23420 >Feature sequence077 302 120 gene locus_tag LOCUS_23430 302 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 240 4559 gene locus_tag LOCUS_23440 240 4559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 4441 5208 gene locus_tag LOCUS_23450 4441 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 5211 6380 gene locus_tag LOCUS_23460 5211 6380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 6561 6872 gene locus_tag LOCUS_23470 6561 6872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 6869 7387 gene locus_tag LOCUS_23480 6869 7387 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404756.1 protein_id gnl|my_center|LOCUS_23480 8711 7389 gene locus_tag LOCUS_23490 8711 7389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 8904 12125 gene locus_tag LOCUS_23500 8904 12125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 12133 15897 gene locus_tag LOCUS_23510 12133 15897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 15983 16234 gene locus_tag LOCUS_23520 15983 16234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 17746 16127 gene locus_tag LOCUS_23530 17746 16127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23530 >Feature sequence078 1266 136 gene locus_tag LOCUS_23540 1266 136 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104228.1 protein_id gnl|my_center|LOCUS_23540 2153 1263 gene locus_tag LOCUS_23550 2153 1263 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742172.1 protein_id gnl|my_center|LOCUS_23550 2261 3490 gene locus_tag LOCUS_23560 2261 3490 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731379.1 protein_id gnl|my_center|LOCUS_23560 3483 4631 gene locus_tag LOCUS_23570 3483 4631 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462348.1 protein_id gnl|my_center|LOCUS_23570 4670 5122 gene locus_tag LOCUS_23580 4670 5122 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730752.1 protein_id gnl|my_center|LOCUS_23580 9101 5154 gene locus_tag LOCUS_23590 gene hrpA 9101 5154 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731383.1 protein_id gnl|my_center|LOCUS_23590 9225 9416 gene locus_tag LOCUS_23600 9225 9416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 11061 9406 gene locus_tag LOCUS_23610 11061 9406 CDS product IS200/IS605 family element transposase accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028271.1 protein_id gnl|my_center|LOCUS_23610 11684 11373 gene locus_tag LOCUS_23620 11684 11373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 12969 11851 gene locus_tag LOCUS_23630 gene oxdD 12969 11851 CDS product oxalate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231409.1 protein_id gnl|my_center|LOCUS_23630 14877 13018 gene locus_tag LOCUS_23640 14877 13018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 15893 14907 gene locus_tag LOCUS_23650 15893 14907 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058109.1 protein_id gnl|my_center|LOCUS_23650 16903 15890 gene locus_tag LOCUS_23660 16903 15890 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021942.1 protein_id gnl|my_center|LOCUS_23660 >Feature sequence079 461 99 gene locus_tag LOCUS_23670 461 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104250.1 protein_id gnl|my_center|LOCUS_23670 548 1039 gene locus_tag LOCUS_23680 548 1039 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897761.1 protein_id gnl|my_center|LOCUS_23680 2794 1052 gene locus_tag LOCUS_23690 gene recD 2794 1052 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727604.1 protein_id gnl|my_center|LOCUS_23690 6111 2791 gene locus_tag LOCUS_23700 gene recB 6111 2791 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727605.1 protein_id gnl|my_center|LOCUS_23700 9416 6111 gene locus_tag LOCUS_23710 gene recC 9416 6111 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877040.1 protein_id gnl|my_center|LOCUS_23710 9492 10739 gene locus_tag LOCUS_23720 9492 10739 CDS product bifunctional alpha/beta hydrolase/OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085686.1 protein_id gnl|my_center|LOCUS_23720 12081 10750 gene locus_tag LOCUS_23730 gene mak 12081 10750 CDS product maltokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899824.1 protein_id gnl|my_center|LOCUS_23730 13829 12078 gene locus_tag LOCUS_23740 gene treS 13829 12078 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400893.1 protein_id gnl|my_center|LOCUS_23740 14805 13885 gene locus_tag LOCUS_23750 14805 13885 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416403.1 protein_id gnl|my_center|LOCUS_23750 15290 14721 gene locus_tag LOCUS_23760 15290 14721 CDS product GreA/GreB family elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230484.1 protein_id gnl|my_center|LOCUS_23760 15383 16180 gene locus_tag LOCUS_23770 15383 16180 CDS product DUF2470 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731334.1 protein_id gnl|my_center|LOCUS_23770 17042 16161 gene locus_tag LOCUS_23780 17042 16161 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206791.1 protein_id gnl|my_center|LOCUS_23780 >Feature sequence080 329 1828 gene locus_tag LOCUS_23790 gene dnaA 329 1828 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950320.1 protein_id gnl|my_center|LOCUS_23790 2454 2221 gene locus_tag LOCUS_23800 2454 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 2408 3484 gene locus_tag LOCUS_23810 gene dnaN 2408 3484 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726602.1 protein_id gnl|my_center|LOCUS_23810 3515 4408 gene locus_tag LOCUS_23820 gene gnd 3515 4408 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891330.1 protein_id gnl|my_center|LOCUS_23820 4412 5587 gene locus_tag LOCUS_23830 gene recF 4412 5587 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726603.1 protein_id gnl|my_center|LOCUS_23830 5584 6141 gene locus_tag LOCUS_23840 5584 6141 CDS product DUF721 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087667.1 protein_id gnl|my_center|LOCUS_23840 6687 6166 gene locus_tag LOCUS_23850 6687 6166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 6878 8908 gene locus_tag LOCUS_23860 gene gyrB 6878 8908 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917863.1 protein_id gnl|my_center|LOCUS_23860 8968 11463 gene locus_tag LOCUS_23870 gene gyrA 8968 11463 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891334.1 protein_id gnl|my_center|LOCUS_23870 11522 12325 gene locus_tag LOCUS_23880 11522 12325 CDS product DUF3566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726605.1 protein_id gnl|my_center|LOCUS_23880 12394 12468 gene locus_tag LOCUS_t00300 12394 12468 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 12604 12677 gene locus_tag LOCUS_t00310 12604 12677 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 12770 13300 gene locus_tag LOCUS_23890 12770 13300 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891350.1 protein_id gnl|my_center|LOCUS_23890 13747 13328 gene locus_tag LOCUS_23900 13747 13328 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899772.1 protein_id gnl|my_center|LOCUS_23900 14084 13803 gene locus_tag LOCUS_23910 gene crgA 14084 13803 CDS product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891352.1 protein_id gnl|my_center|LOCUS_23910 14225 14899 gene locus_tag LOCUS_23920 14225 14899 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891354.1 protein_id gnl|my_center|LOCUS_23920 16751 14877 gene locus_tag LOCUS_23930 gene pknB 16751 14877 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400356.1 protein_id gnl|my_center|LOCUS_23930 >Feature sequence081 627 2987 gene locus_tag LOCUS_23940 627 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 3002 3358 gene locus_tag LOCUS_23950 3002 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 3386 3877 gene locus_tag LOCUS_23960 3386 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 3882 4238 gene locus_tag LOCUS_23970 3882 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 4266 6218 gene locus_tag LOCUS_23980 4266 6218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 6239 6577 gene locus_tag LOCUS_23990 6239 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 6584 7243 gene locus_tag LOCUS_24000 6584 7243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 7619 7278 gene locus_tag LOCUS_24010 7619 7278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 8017 7619 gene locus_tag LOCUS_24020 8017 7619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 9194 8097 gene locus_tag LOCUS_24030 9194 8097 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977058.1 protein_id gnl|my_center|LOCUS_24030 10280 9261 gene locus_tag LOCUS_24040 10280 9261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 10897 10277 gene locus_tag LOCUS_24050 10897 10277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 11082 10894 gene locus_tag LOCUS_24060 11082 10894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 12167 11097 gene locus_tag LOCUS_24070 12167 11097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 12624 12382 gene locus_tag LOCUS_24080 12624 12382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 12743 13135 gene locus_tag LOCUS_24090 12743 13135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 13638 15038 gene locus_tag LOCUS_24100 13638 15038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 16359 15136 gene locus_tag LOCUS_24110 16359 15136 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728185.1 protein_id gnl|my_center|LOCUS_24110 >Feature sequence082 162 1034 gene locus_tag LOCUS_24120 162 1034 CDS product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878294.1 protein_id gnl|my_center|LOCUS_24120 2838 1105 gene locus_tag LOCUS_24130 2838 1105 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727265.1 protein_id gnl|my_center|LOCUS_24130 2873 3397 gene locus_tag LOCUS_24140 2873 3397 CDS product mycothiol transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892314.1 protein_id gnl|my_center|LOCUS_24140 3436 3969 gene locus_tag LOCUS_24150 3436 3969 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727268.1 protein_id gnl|my_center|LOCUS_24150 4002 4841 gene locus_tag LOCUS_24160 4002 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727270.1 protein_id gnl|my_center|LOCUS_24160 6830 4809 gene locus_tag LOCUS_24170 6830 4809 CDS product prolyl oligopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402292.1 protein_id gnl|my_center|LOCUS_24170 6896 8419 gene locus_tag LOCUS_24180 6896 8419 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727276.1 protein_id gnl|my_center|LOCUS_24180 8459 8893 gene locus_tag LOCUS_24190 8459 8893 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727277.1 protein_id gnl|my_center|LOCUS_24190 8956 9231 gene locus_tag LOCUS_24200 8956 9231 CDS product putative holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094873.1 protein_id gnl|my_center|LOCUS_24200 9228 10061 gene locus_tag LOCUS_24210 9228 10061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 10066 11466 gene locus_tag LOCUS_24220 gene lpdA 10066 11466 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892330.1 protein_id gnl|my_center|LOCUS_24220 11477 11746 gene locus_tag LOCUS_24230 11477 11746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727279.1 protein_id gnl|my_center|LOCUS_24230 11851 12135 gene locus_tag LOCUS_24240 11851 12135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 12704 12162 gene locus_tag LOCUS_24250 12704 12162 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892332.1 protein_id gnl|my_center|LOCUS_24250 14119 12701 gene locus_tag LOCUS_24260 gene ramB 14119 12701 CDS product acetate metabolism transcriptional regulator RamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296731.1 protein_id gnl|my_center|LOCUS_24260 14191 15012 gene locus_tag LOCUS_24270 14191 15012 CDS product acyl-[acyl-carrier-protein] thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727282.1 protein_id gnl|my_center|LOCUS_24270 15271 16569 gene locus_tag LOCUS_24280 gene aceA 15271 16569 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892337.1 protein_id gnl|my_center|LOCUS_24280 >Feature sequence083 195 782 gene locus_tag LOCUS_24290 195 782 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878471.1 protein_id gnl|my_center|LOCUS_24290 785 1771 gene locus_tag LOCUS_24300 785 1771 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899238.1 protein_id gnl|my_center|LOCUS_24300 2496 1768 gene locus_tag LOCUS_24310 2496 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 2522 3940 gene locus_tag LOCUS_24320 gene purB 2522 3940 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878470.1 protein_id gnl|my_center|LOCUS_24320 4613 3987 gene locus_tag LOCUS_24330 4613 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730838.1 protein_id gnl|my_center|LOCUS_24330 4664 5569 gene locus_tag LOCUS_24340 4664 5569 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897243.1 protein_id gnl|my_center|LOCUS_24340 5566 7680 gene locus_tag LOCUS_24350 5566 7680 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898586.1 protein_id gnl|my_center|LOCUS_24350 7748 8452 gene locus_tag LOCUS_24360 7748 8452 CDS product DUF2334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730833.1 protein_id gnl|my_center|LOCUS_24360 9267 8467 gene locus_tag LOCUS_24370 9267 8467 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225418.1 protein_id gnl|my_center|LOCUS_24370 9907 9269 gene locus_tag LOCUS_24380 9907 9269 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897237.1 protein_id gnl|my_center|LOCUS_24380 9941 10597 gene locus_tag LOCUS_24390 9941 10597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24390 10648 10887 gene locus_tag LOCUS_24400 gene purS 10648 10887 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403993.1 protein_id gnl|my_center|LOCUS_24400 10884 11558 gene locus_tag LOCUS_24410 gene purQ 10884 11558 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730830.1 protein_id gnl|my_center|LOCUS_24410 11560 12846 gene locus_tag LOCUS_24420 11560 12846 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730828.1 protein_id gnl|my_center|LOCUS_24420 12860 13213 gene locus_tag LOCUS_24430 12860 13213 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730827.1 protein_id gnl|my_center|LOCUS_24430 13233 15515 gene locus_tag LOCUS_24440 gene purL 13233 15515 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730824.1 protein_id gnl|my_center|LOCUS_24440 >Feature sequence084 78 530 gene locus_tag LOCUS_24450 78 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 1556 711 gene locus_tag LOCUS_24460 1556 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 1826 2245 gene locus_tag LOCUS_24470 1826 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 2242 2868 gene locus_tag LOCUS_24480 2242 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 2865 3332 gene locus_tag LOCUS_24490 2865 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 3332 5062 gene locus_tag LOCUS_24500 3332 5062 CDS product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284849.1 protein_id gnl|my_center|LOCUS_24500 5928 5206 gene locus_tag LOCUS_24510 5928 5206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 6167 6397 gene locus_tag LOCUS_24520 6167 6397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 6390 6755 gene locus_tag LOCUS_24530 6390 6755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 6767 7654 gene locus_tag LOCUS_24540 6767 7654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 7651 10656 gene locus_tag LOCUS_24550 7651 10656 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201843320.1 protein_id gnl|my_center|LOCUS_24550 10759 11616 gene locus_tag LOCUS_24560 10759 11616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 11654 12391 gene locus_tag LOCUS_24570 11654 12391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 12497 13390 gene locus_tag LOCUS_24580 12497 13390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 13395 13712 gene locus_tag LOCUS_24590 13395 13712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 13712 14176 gene locus_tag LOCUS_24600 13712 14176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 14199 14405 gene locus_tag LOCUS_24610 14199 14405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 14482 15348 gene locus_tag LOCUS_24620 14482 15348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 15345 15728 gene locus_tag LOCUS_24630 15345 15728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 >Feature sequence085 1972 764 gene locus_tag LOCUS_24640 1972 764 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408560.1 protein_id gnl|my_center|LOCUS_24640 3897 1972 gene locus_tag LOCUS_24650 3897 1972 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550348.1 protein_id gnl|my_center|LOCUS_24650 4030 4488 gene locus_tag LOCUS_24660 4030 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104572.1 protein_id gnl|my_center|LOCUS_24660 5332 4490 gene locus_tag LOCUS_24670 5332 4490 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495744.1 protein_id gnl|my_center|LOCUS_24670 5679 6101 gene locus_tag LOCUS_24680 5679 6101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 6178 6813 gene locus_tag LOCUS_24690 6178 6813 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079740.1 protein_id gnl|my_center|LOCUS_24690 6828 7235 gene locus_tag LOCUS_24700 6828 7235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 7237 7728 gene locus_tag LOCUS_24710 7237 7728 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731373.1 protein_id gnl|my_center|LOCUS_24710 7737 8969 gene locus_tag LOCUS_24720 gene lipE 7737 8969 CDS product lipase LipE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420590.1 protein_id gnl|my_center|LOCUS_24720 9006 9143 gene locus_tag LOCUS_24730 9006 9143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 9448 9149 gene locus_tag LOCUS_24740 9448 9149 CDS product DUF2694 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400405.1 protein_id gnl|my_center|LOCUS_24740 9762 9445 gene locus_tag LOCUS_24750 9762 9445 CDS product ESX-1 secretion-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400401.1 protein_id gnl|my_center|LOCUS_24750 11254 9776 gene locus_tag LOCUS_24760 11254 9776 CDS product DUF4226 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015287743.1 protein_id gnl|my_center|LOCUS_24760 11681 11325 gene locus_tag LOCUS_24770 11681 11325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 12543 11743 gene locus_tag LOCUS_24780 12543 11743 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400393.1 protein_id gnl|my_center|LOCUS_24780 13280 12540 gene locus_tag LOCUS_24790 13280 12540 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400391.1 protein_id gnl|my_center|LOCUS_24790 13409 13834 gene locus_tag LOCUS_24800 gene whiB5 13409 13834 CDS product transcriptional regulator WhiB5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400388.1 protein_id gnl|my_center|LOCUS_24800 13888 14181 gene locus_tag LOCUS_24810 13888 14181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 15257 14184 gene locus_tag LOCUS_24820 15257 14184 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895326.1 protein_id gnl|my_center|LOCUS_24820 15620 15318 gene locus_tag LOCUS_24830 15620 15318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 <16235 15639 gene locus_tag LOCUS_24840 <16235 15639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727721.1:cutinase family protein >Feature sequence086 30 923 gene locus_tag LOCUS_24850 30 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 1213 2061 gene locus_tag LOCUS_24860 1213 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 2091 2828 gene locus_tag LOCUS_24870 2091 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 3195 2809 gene locus_tag LOCUS_24880 3195 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 3387 4196 gene locus_tag LOCUS_24890 3387 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 4440 4703 gene locus_tag LOCUS_24900 4440 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 4922 5791 gene locus_tag LOCUS_24910 4922 5791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 6736 5843 gene locus_tag LOCUS_24920 6736 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 7742 7942 gene locus_tag LOCUS_24930 7742 7942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 8076 9182 gene locus_tag LOCUS_24940 8076 9182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 9387 10295 gene locus_tag LOCUS_24950 9387 10295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 10292 12118 gene locus_tag LOCUS_24960 10292 12118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 12518 12919 gene locus_tag LOCUS_24970 12518 12919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 13026 13619 gene locus_tag LOCUS_24980 13026 13619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728866.1 protein_id gnl|my_center|LOCUS_24980 14195 13875 gene locus_tag LOCUS_24990 14195 13875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 14524 14862 gene locus_tag LOCUS_25000 14524 14862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 15014 15181 gene locus_tag LOCUS_25010 15014 15181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 15199 15786 gene locus_tag LOCUS_25020 15199 15786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 >Feature sequence087 87 329 gene locus_tag LOCUS_25030 87 329 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218045626.1 protein_id gnl|my_center|LOCUS_25030 329 856 gene locus_tag LOCUS_25040 gene rimM 329 856 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111677.1 protein_id gnl|my_center|LOCUS_25040 856 1554 gene locus_tag LOCUS_25050 gene trmD 856 1554 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893804.1 protein_id gnl|my_center|LOCUS_25050 2441 1551 gene locus_tag LOCUS_25060 2441 1551 CDS product LppW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731560.1 protein_id gnl|my_center|LOCUS_25060 2716 3057 gene locus_tag LOCUS_25070 gene rplS 2716 3057 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893806.1 protein_id gnl|my_center|LOCUS_25070 3127 3942 gene locus_tag LOCUS_25080 gene lepB 3127 3942 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728343.1 protein_id gnl|my_center|LOCUS_25080 3944 4672 gene locus_tag LOCUS_25090 3944 4672 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414713.1 protein_id gnl|my_center|LOCUS_25090 4731 5036 gene locus_tag LOCUS_25100 4731 5036 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414710.1 protein_id gnl|my_center|LOCUS_25100 5149 5514 gene locus_tag LOCUS_25110 5149 5514 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877409.1 protein_id gnl|my_center|LOCUS_25110 5514 7025 gene locus_tag LOCUS_25120 5514 7025 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414700.1 protein_id gnl|my_center|LOCUS_25120 7022 8155 gene locus_tag LOCUS_25130 gene dprA 7022 8155 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414694.1 protein_id gnl|my_center|LOCUS_25130 11175 8173 gene locus_tag LOCUS_25140 11175 8173 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114814.1 protein_id gnl|my_center|LOCUS_25140 11603 11172 gene locus_tag LOCUS_25150 11603 11172 CDS product MmpS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877720.1 protein_id gnl|my_center|LOCUS_25150 11808 12098 gene locus_tag LOCUS_25160 11808 12098 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878317.1 protein_id gnl|my_center|LOCUS_25160 12370 12780 gene locus_tag LOCUS_25170 12370 12780 CDS product DUF5078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877718.1 protein_id gnl|my_center|LOCUS_25170 12808 13767 gene locus_tag LOCUS_25180 12808 13767 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414689.1 protein_id gnl|my_center|LOCUS_25180 13970 13770 gene locus_tag LOCUS_25190 13970 13770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 14028 15500 gene locus_tag LOCUS_25200 14028 15500 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903979.1 protein_id gnl|my_center|LOCUS_25200 15497 15850 gene locus_tag LOCUS_25210 15497 15850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 >Feature sequence088 1234 740 gene locus_tag LOCUS_25220 1234 740 CDS product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414654.1 protein_id gnl|my_center|LOCUS_25220 1872 1288 gene locus_tag LOCUS_25230 1872 1288 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049747928.1 protein_id gnl|my_center|LOCUS_25230 2115 2540 gene locus_tag LOCUS_25240 2115 2540 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876808.1 protein_id gnl|my_center|LOCUS_25240 2598 3089 gene locus_tag LOCUS_25250 2598 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 3111 3842 gene locus_tag LOCUS_25260 gene modA 3111 3842 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728090.1 protein_id gnl|my_center|LOCUS_25260 3932 4612 gene locus_tag LOCUS_25270 gene yaaA 3932 4612 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083089.1 protein_id gnl|my_center|LOCUS_25270 4651 5250 gene locus_tag LOCUS_25280 4651 5250 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777112.1 protein_id gnl|my_center|LOCUS_25280 5247 6359 gene locus_tag LOCUS_25290 5247 6359 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112106.1 protein_id gnl|my_center|LOCUS_25290 6402 7460 gene locus_tag LOCUS_25300 gene speB 6402 7460 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894987.1 protein_id gnl|my_center|LOCUS_25300 8258 7623 gene locus_tag LOCUS_25310 8258 7623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 9609 8368 gene locus_tag LOCUS_25320 9609 8368 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104544.1 protein_id gnl|my_center|LOCUS_25320 10907 9663 gene locus_tag LOCUS_25330 10907 9663 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731551.1 protein_id gnl|my_center|LOCUS_25330 11576 10917 gene locus_tag LOCUS_25340 11576 10917 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878688.1 protein_id gnl|my_center|LOCUS_25340 11866 12774 gene locus_tag LOCUS_25350 11866 12774 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731346.1 protein_id gnl|my_center|LOCUS_25350 12771 13586 gene locus_tag LOCUS_25360 12771 13586 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110992.1 protein_id gnl|my_center|LOCUS_25360 14409 13663 gene locus_tag LOCUS_25370 14409 13663 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729123.1 protein_id gnl|my_center|LOCUS_25370 14469 15539 gene locus_tag LOCUS_25380 14469 15539 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730637.1 protein_id gnl|my_center|LOCUS_25380 >Feature sequence089 829 404 gene locus_tag LOCUS_25390 829 404 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730722.1 protein_id gnl|my_center|LOCUS_25390 1302 826 gene locus_tag LOCUS_25400 1302 826 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404549.1 protein_id gnl|my_center|LOCUS_25400 1799 1299 gene locus_tag LOCUS_25410 gene moaC 1799 1299 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404544.1 protein_id gnl|my_center|LOCUS_25410 1999 1802 gene locus_tag LOCUS_25420 1999 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911329.1 protein_id gnl|my_center|LOCUS_25420 2056 4329 gene locus_tag LOCUS_25430 2056 4329 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404512.1 protein_id gnl|my_center|LOCUS_25430 4337 5986 gene locus_tag LOCUS_25440 4337 5986 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897120.1 protein_id gnl|my_center|LOCUS_25440 6133 7593 gene locus_tag LOCUS_25450 6133 7593 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408473.1 protein_id gnl|my_center|LOCUS_25450 7603 8820 gene locus_tag LOCUS_25460 7603 8820 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408476.1 protein_id gnl|my_center|LOCUS_25460 9790 8801 gene locus_tag LOCUS_25470 9790 8801 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897127.1 protein_id gnl|my_center|LOCUS_25470 10608 9817 gene locus_tag LOCUS_25480 10608 9817 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400678.1 protein_id gnl|my_center|LOCUS_25480 12769 10634 gene locus_tag LOCUS_25490 gene fadB 12769 10634 CDS product fatty oxidation protein FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404426.1 protein_id gnl|my_center|LOCUS_25490 14013 12802 gene locus_tag LOCUS_25500 14013 12802 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404423.1 protein_id gnl|my_center|LOCUS_25500 14172 15371 gene locus_tag LOCUS_25510 14172 15371 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730742.1 protein_id gnl|my_center|LOCUS_25510 >Feature sequence090 <1 924 gene locus_tag LOCUS_25520 <1 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729920.1:translation elongation factor 4 1069 1677 gene locus_tag LOCUS_25530 1069 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 3700 1682 gene locus_tag LOCUS_25540 3700 1682 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729900.1 protein_id gnl|my_center|LOCUS_25540 3787 3981 gene locus_tag LOCUS_25550 3787 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197492460.1 protein_id gnl|my_center|LOCUS_25550 4279 5313 gene locus_tag LOCUS_25560 4279 5313 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895899.1 protein_id gnl|my_center|LOCUS_25560 5310 6149 gene locus_tag LOCUS_25570 gene cysT 5310 6149 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895898.1 protein_id gnl|my_center|LOCUS_25570 6146 6949 gene locus_tag LOCUS_25580 gene cysW 6146 6949 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895897.1 protein_id gnl|my_center|LOCUS_25580 6963 7997 gene locus_tag LOCUS_25590 6963 7997 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729898.1 protein_id gnl|my_center|LOCUS_25590 7994 8341 gene locus_tag LOCUS_25600 7994 8341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 9780 8359 gene locus_tag LOCUS_25610 9780 8359 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104282.1 protein_id gnl|my_center|LOCUS_25610 10580 9873 gene locus_tag LOCUS_25620 10580 9873 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878057.1 protein_id gnl|my_center|LOCUS_25620 11356 10577 gene locus_tag LOCUS_25630 11356 10577 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729897.1 protein_id gnl|my_center|LOCUS_25630 13011 11353 gene locus_tag LOCUS_25640 13011 11353 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729896.1 protein_id gnl|my_center|LOCUS_25640 13315 14487 gene locus_tag LOCUS_25650 gene hemW 13315 14487 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729894.1 protein_id gnl|my_center|LOCUS_25650 14820 14572 gene locus_tag LOCUS_25660 14820 14572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 15287 15057 gene locus_tag LOCUS_25670 15287 15057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 >Feature sequence091 2376 901 gene locus_tag LOCUS_25680 gene pbpA 2376 901 CDS product D,D-transpeptidase PbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899775.1 protein_id gnl|my_center|LOCUS_25680 3770 2373 gene locus_tag LOCUS_25690 gene rodA 3770 2373 CDS product cell shape-determining peptidoglycan glycosyltransferase RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400364.1 protein_id gnl|my_center|LOCUS_25690 5349 3871 gene locus_tag LOCUS_25700 5349 3871 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726619.1 protein_id gnl|my_center|LOCUS_25700 5813 5346 gene locus_tag LOCUS_25710 5813 5346 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726620.1 protein_id gnl|my_center|LOCUS_25710 7458 5950 gene locus_tag LOCUS_25720 7458 5950 CDS product DUF3662 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876644.1 protein_id gnl|my_center|LOCUS_25720 7580 7663 gene locus_tag LOCUS_t00320 7580 7663 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8375 7983 gene locus_tag LOCUS_25730 8375 7983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 8532 11612 gene locus_tag LOCUS_25740 8532 11612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 13223 11922 gene locus_tag LOCUS_25750 13223 11922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 13315 13743 gene locus_tag LOCUS_25760 13315 13743 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144317.1 protein_id gnl|my_center|LOCUS_25760 13740 13985 gene locus_tag LOCUS_25770 13740 13985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 15260 13989 gene locus_tag LOCUS_25780 15260 13989 CDS product IS256-like element ISRba9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120088.1 protein_id gnl|my_center|LOCUS_25780 >Feature sequence092 871 245 gene locus_tag LOCUS_25790 871 245 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412790.1 protein_id gnl|my_center|LOCUS_25790 959 2521 gene locus_tag LOCUS_25800 959 2521 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730034.1 protein_id gnl|my_center|LOCUS_25800 2528 4522 gene locus_tag LOCUS_25810 2528 4522 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878115.1 protein_id gnl|my_center|LOCUS_25810 4515 5678 gene locus_tag LOCUS_25820 4515 5678 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896109.1 protein_id gnl|my_center|LOCUS_25820 7669 5741 gene locus_tag LOCUS_25830 7669 5741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 8525 7773 gene locus_tag LOCUS_25840 8525 7773 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730027.1 protein_id gnl|my_center|LOCUS_25840 10690 8549 gene locus_tag LOCUS_25850 10690 8549 CDS product SGNH hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624217.1 protein_id gnl|my_center|LOCUS_25850 10993 10790 gene locus_tag LOCUS_25860 10993 10790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 11796 11107 gene locus_tag LOCUS_25870 11796 11107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 12544 12368 gene locus_tag LOCUS_25880 12544 12368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 >Feature sequence093 260 2650 gene locus_tag LOCUS_25890 260 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 3346 3050 gene locus_tag LOCUS_25900 3346 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 3306 4772 gene locus_tag LOCUS_25910 3306 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 4810 6042 gene locus_tag LOCUS_25920 4810 6042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 6115 6561 gene locus_tag LOCUS_25930 6115 6561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 6604 7194 gene locus_tag LOCUS_25940 6604 7194 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142113.1 protein_id gnl|my_center|LOCUS_25940 7398 8162 gene locus_tag LOCUS_25950 7398 8162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 8638 8288 gene locus_tag LOCUS_25960 8638 8288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 9034 9435 gene locus_tag LOCUS_25970 9034 9435 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467875.1 protein_id gnl|my_center|LOCUS_25970 11123 9468 gene locus_tag LOCUS_25980 11123 9468 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113016.1 protein_id gnl|my_center|LOCUS_25980 12036 11128 gene locus_tag LOCUS_25990 12036 11128 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113015.1 protein_id gnl|my_center|LOCUS_25990 12952 12029 gene locus_tag LOCUS_26000 12952 12029 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113014.1 protein_id gnl|my_center|LOCUS_26000 14660 12957 gene locus_tag LOCUS_26010 14660 12957 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086928.1 protein_id gnl|my_center|LOCUS_26010 >Feature sequence094 <1 3937 gene locus_tag LOCUS_26020 <1 3937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730064.1:type I polyketide synthase 3947 4339 gene locus_tag LOCUS_26030 3947 4339 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412952.1 protein_id gnl|my_center|LOCUS_26030 4425 5768 gene locus_tag LOCUS_26040 4425 5768 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878135.1 protein_id gnl|my_center|LOCUS_26040 6334 5756 gene locus_tag LOCUS_26050 6334 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 6922 6449 gene locus_tag LOCUS_26060 gene bcp 6922 6449 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730061.1 protein_id gnl|my_center|LOCUS_26060 7036 7260 gene locus_tag LOCUS_26070 7036 7260 CDS product DUF3618 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896152.1 protein_id gnl|my_center|LOCUS_26070 7705 7630 gene locus_tag LOCUS_t00330 7705 7630 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 7813 9021 gene locus_tag LOCUS_26080 7813 9021 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496011.1 protein_id gnl|my_center|LOCUS_26080 9138 10217 gene locus_tag LOCUS_26090 9138 10217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 10339 10265 gene locus_tag LOCUS_t00340 10339 10265 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 10982 10368 gene locus_tag LOCUS_26100 gene orn 10982 10368 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899361.1 protein_id gnl|my_center|LOCUS_26100 11091 12680 gene locus_tag LOCUS_26110 11091 12680 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730039.1 protein_id gnl|my_center|LOCUS_26110 12769 13491 gene locus_tag LOCUS_26120 12769 13491 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877731.1 protein_id gnl|my_center|LOCUS_26120 13488 14177 gene locus_tag LOCUS_26130 13488 14177 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894979.1 protein_id gnl|my_center|LOCUS_26130 14848 14174 gene locus_tag LOCUS_26140 gene cmrA 14848 14174 CDS product mycolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730038.1 protein_id gnl|my_center|LOCUS_26140 >Feature sequence095 346 1350 gene locus_tag LOCUS_26150 346 1350 CDS product phosphotriesterase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900835.1 protein_id gnl|my_center|LOCUS_26150 4190 1386 gene locus_tag LOCUS_26160 4190 1386 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228256.1 protein_id gnl|my_center|LOCUS_26160 6646 4394 gene locus_tag LOCUS_26170 6646 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 6555 6878 gene locus_tag LOCUS_26180 6555 6878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 7059 7283 gene locus_tag LOCUS_26190 7059 7283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 7301 8680 gene locus_tag LOCUS_26200 7301 8680 CDS product ISL3-like element ISAar39 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141270575.1 protein_id gnl|my_center|LOCUS_26200 9544 8981 gene locus_tag LOCUS_26210 9544 8981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 <14576 9790 gene locus_tag LOCUS_26220 <14576 9790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729242.1:LysM peptidoglycan-binding domain-containing protein >Feature sequence096 1203 244 gene locus_tag LOCUS_26230 gene ala 1203 244 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061064.1 protein_id gnl|my_center|LOCUS_26230 1256 2785 gene locus_tag LOCUS_26240 1256 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 2782 3798 gene locus_tag LOCUS_26250 2782 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 3886 4302 gene locus_tag LOCUS_26260 3886 4302 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895688.1 protein_id gnl|my_center|LOCUS_26260 4671 4309 gene locus_tag LOCUS_26270 4671 4309 CDS product Rv2640c family ArsR-like transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727473.1 protein_id gnl|my_center|LOCUS_26270 4773 5168 gene locus_tag LOCUS_26280 4773 5168 CDS product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727472.1 protein_id gnl|my_center|LOCUS_26280 5318 7105 gene locus_tag LOCUS_26290 5318 7105 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114561.1 protein_id gnl|my_center|LOCUS_26290 8600 7113 gene locus_tag LOCUS_26300 8600 7113 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877831.1 protein_id gnl|my_center|LOCUS_26300 8762 10285 gene locus_tag LOCUS_26310 8762 10285 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728275.1 protein_id gnl|my_center|LOCUS_26310 11504 10290 gene locus_tag LOCUS_26320 11504 10290 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891438.1 protein_id gnl|my_center|LOCUS_26320 12161 11508 gene locus_tag LOCUS_26330 12161 11508 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726671.1 protein_id gnl|my_center|LOCUS_26330 12343 12945 gene locus_tag LOCUS_26340 12343 12945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 12989 13324 gene locus_tag LOCUS_26350 12989 13324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 13798 13370 gene locus_tag LOCUS_26360 13798 13370 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401566.1 protein_id gnl|my_center|LOCUS_26360 14010 13789 gene locus_tag LOCUS_26370 gene vapB2 14010 13789 CDS product type II toxin-antitoxin system antitoxin VapB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401563.1 protein_id gnl|my_center|LOCUS_26370 >Feature sequence097 2034 187 gene locus_tag LOCUS_26380 2034 187 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156206934.1 protein_id gnl|my_center|LOCUS_26380 2317 2072 gene locus_tag LOCUS_26390 2317 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 2300 2485 gene locus_tag LOCUS_26400 2300 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 2502 3044 gene locus_tag LOCUS_26410 2502 3044 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894176.1 protein_id gnl|my_center|LOCUS_26410 4127 3051 gene locus_tag LOCUS_26420 gene zapE 4127 3051 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899426.1 protein_id gnl|my_center|LOCUS_26420 4126 4953 gene locus_tag LOCUS_26430 gene ribD 4126 4953 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413854.1 protein_id gnl|my_center|LOCUS_26430 5007 6575 gene locus_tag LOCUS_26440 5007 6575 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139536.1 protein_id gnl|my_center|LOCUS_26440 6596 7915 gene locus_tag LOCUS_26450 gene aftC 6596 7915 CDS product arabinofuranan 3-O-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728581.1 protein_id gnl|my_center|LOCUS_26450 7912 8331 gene locus_tag LOCUS_26460 gene msrB 7912 8331 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894168.1 protein_id gnl|my_center|LOCUS_26460 10467 8314 gene locus_tag LOCUS_26470 10467 8314 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190878.1 protein_id gnl|my_center|LOCUS_26470 10351 10668 gene locus_tag LOCUS_26480 10351 10668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 11360 10665 gene locus_tag LOCUS_26490 11360 10665 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894166.1 protein_id gnl|my_center|LOCUS_26490 13662 11374 gene locus_tag LOCUS_26500 13662 11374 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190878.1 protein_id gnl|my_center|LOCUS_26500 >Feature sequence098 <1 511 gene locus_tag LOCUS_26510 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727309.1:glutamyl-tRNA reductase 508 1446 gene locus_tag LOCUS_26520 gene hemC 508 1446 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727310.1 protein_id gnl|my_center|LOCUS_26520 1472 3112 gene locus_tag LOCUS_26530 1472 3112 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624021.1 protein_id gnl|my_center|LOCUS_26530 3126 4106 gene locus_tag LOCUS_26540 gene hemB 3126 4106 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898491.1 protein_id gnl|my_center|LOCUS_26540 4103 4525 gene locus_tag LOCUS_26550 4103 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727314.1 protein_id gnl|my_center|LOCUS_26550 4543 4971 gene locus_tag LOCUS_26560 4543 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 4964 5488 gene locus_tag LOCUS_26570 4964 5488 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727315.1 protein_id gnl|my_center|LOCUS_26570 5497 5736 gene locus_tag LOCUS_26580 5497 5736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 5753 7852 gene locus_tag LOCUS_26590 5753 7852 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112129.1 protein_id gnl|my_center|LOCUS_26590 7959 8840 gene locus_tag LOCUS_26600 7959 8840 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079707.1 protein_id gnl|my_center|LOCUS_26600 8833 9435 gene locus_tag LOCUS_26610 8833 9435 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892386.1 protein_id gnl|my_center|LOCUS_26610 9603 10685 gene locus_tag LOCUS_26620 9603 10685 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462438.1 protein_id gnl|my_center|LOCUS_26620 10781 12100 gene locus_tag LOCUS_26630 gene hemL 10781 12100 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892395.1 protein_id gnl|my_center|LOCUS_26630 12097 12711 gene locus_tag LOCUS_26640 12097 12711 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462582.1 protein_id gnl|my_center|LOCUS_26640 12708 13301 gene locus_tag LOCUS_26650 12708 13301 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727323.1 protein_id gnl|my_center|LOCUS_26650 >Feature sequence099 69 1667 gene locus_tag LOCUS_26660 69 1667 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496094.1 protein_id gnl|my_center|LOCUS_26660 1664 2644 gene locus_tag LOCUS_26670 gene ccsB 1664 2644 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892400.1 protein_id gnl|my_center|LOCUS_26670 2824 2660 gene locus_tag LOCUS_26680 2824 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727327.1 protein_id gnl|my_center|LOCUS_26680 2875 3183 gene locus_tag LOCUS_26690 2875 3183 CDS product DUF4229 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908877.1 protein_id gnl|my_center|LOCUS_26690 4158 3286 gene locus_tag LOCUS_26700 4158 3286 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727336.1 protein_id gnl|my_center|LOCUS_26700 4804 4181 gene locus_tag LOCUS_26710 4804 4181 CDS product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079604.1 protein_id gnl|my_center|LOCUS_26710 4840 5616 gene locus_tag LOCUS_26720 4840 5616 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727338.1 protein_id gnl|my_center|LOCUS_26720 5649 6782 gene locus_tag LOCUS_26730 5649 6782 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892418.1 protein_id gnl|my_center|LOCUS_26730 7825 6794 gene locus_tag LOCUS_26740 7825 6794 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727340.1 protein_id gnl|my_center|LOCUS_26740 8516 7806 gene locus_tag LOCUS_26750 8516 7806 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727341.1 protein_id gnl|my_center|LOCUS_26750 9656 8559 gene locus_tag LOCUS_26760 gene menE 9656 8559 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402892.1 protein_id gnl|my_center|LOCUS_26760 10027 9725 gene locus_tag LOCUS_26770 10027 9725 CDS product DUF3349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402896.1 protein_id gnl|my_center|LOCUS_26770 10272 11546 gene locus_tag LOCUS_26780 10272 11546 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727384.1 protein_id gnl|my_center|LOCUS_26780 11562 11846 gene locus_tag LOCUS_26790 11562 11846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077815.1 protein_id gnl|my_center|LOCUS_26790 11854 12168 gene locus_tag LOCUS_26800 11854 12168 CDS product DUF3349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727386.1 protein_id gnl|my_center|LOCUS_26800 12548 12165 gene locus_tag LOCUS_26810 12548 12165 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727387.1 protein_id gnl|my_center|LOCUS_26810 13424 12564 gene locus_tag LOCUS_26820 13424 12564 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402909.1 protein_id gnl|my_center|LOCUS_26820 >Feature sequence100 1627 1067 gene locus_tag LOCUS_26830 1627 1067 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893048.1 protein_id gnl|my_center|LOCUS_26830 1651 1980 gene locus_tag LOCUS_26840 1651 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 2235 4733 gene locus_tag LOCUS_26850 2235 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 4892 5152 gene locus_tag LOCUS_26860 4892 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413177.1 protein_id gnl|my_center|LOCUS_26860 5167 5625 gene locus_tag LOCUS_26870 5167 5625 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727792.1 protein_id gnl|my_center|LOCUS_26870 6268 5627 gene locus_tag LOCUS_26880 6268 5627 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727791.1 protein_id gnl|my_center|LOCUS_26880 9458 6285 gene locus_tag LOCUS_26890 gene dnaE2 9458 6285 CDS product error-prone DNA polymerase DnaE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417885.1 protein_id gnl|my_center|LOCUS_26890 9637 10350 gene locus_tag LOCUS_26900 9637 10350 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893323.1 protein_id gnl|my_center|LOCUS_26900 11224 10355 gene locus_tag LOCUS_26910 gene htdY 11224 10355 CDS product 3-hydroxyacyl-thioester dehydratase HtdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417929.1 protein_id gnl|my_center|LOCUS_26910 11383 12051 gene locus_tag LOCUS_26920 11383 12051 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417932.1 protein_id gnl|my_center|LOCUS_26920 12048 12455 gene locus_tag LOCUS_26930 12048 12455 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226776.1 protein_id gnl|my_center|LOCUS_26930 <13878 12446 gene locus_tag LOCUS_26940 <13878 12446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727778.1:DNA polymerase Y family protein >Feature sequence101 945 367 gene locus_tag LOCUS_26950 945 367 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727765.1 protein_id gnl|my_center|LOCUS_26950 1843 1037 gene locus_tag LOCUS_26960 1843 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162618307.1 protein_id gnl|my_center|LOCUS_26960 2128 2421 gene locus_tag LOCUS_26970 2128 2421 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893002.1 protein_id gnl|my_center|LOCUS_26970 2779 2426 gene locus_tag LOCUS_26980 2779 2426 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084922.1 protein_id gnl|my_center|LOCUS_26980 3111 2824 gene locus_tag LOCUS_26990 3111 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 3850 3179 gene locus_tag LOCUS_27000 3850 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408495.1 protein_id gnl|my_center|LOCUS_27000 4124 3918 gene locus_tag LOCUS_27010 4124 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 4182 4373 gene locus_tag LOCUS_27020 4182 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 5980 4361 gene locus_tag LOCUS_27030 gene groL 5980 4361 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727753.1 protein_id gnl|my_center|LOCUS_27030 6408 6094 gene locus_tag LOCUS_27040 gene groES 6408 6094 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892970.1 protein_id gnl|my_center|LOCUS_27040 7104 6601 gene locus_tag LOCUS_27050 7104 6601 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080606.1 protein_id gnl|my_center|LOCUS_27050 8126 7101 gene locus_tag LOCUS_27060 gene tsaD 8126 7101 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727752.1 protein_id gnl|my_center|LOCUS_27060 8590 8123 gene locus_tag LOCUS_27070 gene rimI 8590 8123 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727751.1 protein_id gnl|my_center|LOCUS_27070 9228 8587 gene locus_tag LOCUS_27080 gene tsaB 9228 8587 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727750.1 protein_id gnl|my_center|LOCUS_27080 9695 9225 gene locus_tag LOCUS_27090 gene tsaE 9695 9225 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080598.1 protein_id gnl|my_center|LOCUS_27090 10818 9688 gene locus_tag LOCUS_27100 10818 9688 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250368.1 protein_id gnl|my_center|LOCUS_27100 11986 10808 gene locus_tag LOCUS_27110 gene alr 11986 10808 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023637501.1 protein_id gnl|my_center|LOCUS_27110 13450 12059 gene locus_tag LOCUS_27120 13450 12059 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727746.1 protein_id gnl|my_center|LOCUS_27120 >Feature sequence102 <1 696 gene locus_tag LOCUS_27130 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003402217.1:molybdopterin molybdotransferase MoeA 722 1426 gene locus_tag LOCUS_27140 722 1426 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727246.1 protein_id gnl|my_center|LOCUS_27140 1423 2289 gene locus_tag LOCUS_27150 gene pssA 1423 2289 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064848.1 protein_id gnl|my_center|LOCUS_27150 2286 4454 gene locus_tag LOCUS_27160 2286 4454 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727245.1 protein_id gnl|my_center|LOCUS_27160 5103 4462 gene locus_tag LOCUS_27170 5103 4462 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402203.1 protein_id gnl|my_center|LOCUS_27170 5439 5110 gene locus_tag LOCUS_27180 5439 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 6572 5448 gene locus_tag LOCUS_27190 6572 5448 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892265.1 protein_id gnl|my_center|LOCUS_27190 7281 6553 gene locus_tag LOCUS_27200 7281 6553 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727227.1 protein_id gnl|my_center|LOCUS_27200 7738 7292 gene locus_tag LOCUS_27210 7738 7292 CDS product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898448.1 protein_id gnl|my_center|LOCUS_27210 8070 7762 gene locus_tag LOCUS_27220 8070 7762 CDS product DUF3263 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892262.1 protein_id gnl|my_center|LOCUS_27220 8199 8792 gene locus_tag LOCUS_27230 8199 8792 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727226.1 protein_id gnl|my_center|LOCUS_27230 8798 9616 gene locus_tag LOCUS_27240 8798 9616 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727225.1 protein_id gnl|my_center|LOCUS_27240 9814 10956 gene locus_tag LOCUS_27250 9814 10956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 12346 11297 gene locus_tag LOCUS_27260 12346 11297 CDS product DEDDh family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420320.1 protein_id gnl|my_center|LOCUS_27260 >Feature sequence103 1480 20 gene locus_tag LOCUS_27270 1480 20 CDS product glycine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171512914.1 protein_id gnl|my_center|LOCUS_27270 2757 1537 gene locus_tag LOCUS_27280 2757 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104479.1 protein_id gnl|my_center|LOCUS_27280 2788 3726 gene locus_tag LOCUS_27290 gene coaA 2788 3726 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405790.1 protein_id gnl|my_center|LOCUS_27290 4575 3778 gene locus_tag LOCUS_27300 4575 3778 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896657.1 protein_id gnl|my_center|LOCUS_27300 4647 5396 gene locus_tag LOCUS_27310 4647 5396 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730422.1 protein_id gnl|my_center|LOCUS_27310 5787 5416 gene locus_tag LOCUS_27320 5787 5416 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730423.1 protein_id gnl|my_center|LOCUS_27320 7807 5798 gene locus_tag LOCUS_27330 7807 5798 CDS product DUF255 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405750.1 protein_id gnl|my_center|LOCUS_27330 8063 7791 gene locus_tag LOCUS_27340 8063 7791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896661.1 protein_id gnl|my_center|LOCUS_27340 8932 8060 gene locus_tag LOCUS_27350 gene mca 8932 8060 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896662.1 protein_id gnl|my_center|LOCUS_27350 9120 9503 gene locus_tag LOCUS_27360 9120 9503 CDS product DUF4307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405744.1 protein_id gnl|my_center|LOCUS_27360 9735 10226 gene locus_tag LOCUS_27370 gene greA 9735 10226 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896664.1 protein_id gnl|my_center|LOCUS_27370 10258 10917 gene locus_tag LOCUS_27380 10258 10917 CDS product GPP34 family phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730425.1 protein_id gnl|my_center|LOCUS_27380 12084 10927 gene locus_tag LOCUS_27390 12084 10927 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730426.1 protein_id gnl|my_center|LOCUS_27390 12792 12085 gene locus_tag LOCUS_27400 12792 12085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27400 >Feature sequence104 427 122 gene locus_tag LOCUS_27410 gene clpS 427 122 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406906.1 protein_id gnl|my_center|LOCUS_27410 493 1803 gene locus_tag LOCUS_27420 493 1803 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730184.1 protein_id gnl|my_center|LOCUS_27420 1800 3806 gene locus_tag LOCUS_27430 gene dinG 1800 3806 CDS product ATP-dependent helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898827.1 protein_id gnl|my_center|LOCUS_27430 3845 5281 gene locus_tag LOCUS_27440 gene lpqM 3845 5281 CDS product zinc metallopeptidase LpqM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730186.1 protein_id gnl|my_center|LOCUS_27440 6057 5290 gene locus_tag LOCUS_27450 6057 5290 CDS product MspA family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076063.1 protein_id gnl|my_center|LOCUS_27450 8726 6087 gene locus_tag LOCUS_27460 8726 6087 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730188.1 protein_id gnl|my_center|LOCUS_27460 8843 10927 gene locus_tag LOCUS_27470 8843 10927 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896313.1 protein_id gnl|my_center|LOCUS_27470 >Feature sequence105 600 103 gene locus_tag LOCUS_27480 600 103 CDS product Low molecular weight antigen MTB12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412264.1 protein_id gnl|my_center|LOCUS_27480 746 2563 gene locus_tag LOCUS_27490 gene arc 746 2563 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895355.1 protein_id gnl|my_center|LOCUS_27490 3197 2586 gene locus_tag LOCUS_27500 3197 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411033.1 protein_id gnl|my_center|LOCUS_27500 3324 4835 gene locus_tag LOCUS_27510 3324 4835 CDS product IS1634-like element IS1549 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726646.1 protein_id gnl|my_center|LOCUS_27510 5095 4832 gene locus_tag LOCUS_27520 5095 4832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 5019 6515 gene locus_tag LOCUS_27530 gene dop 5019 6515 CDS product pup deamidase/depupylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895348.1 protein_id gnl|my_center|LOCUS_27530 6612 6806 gene locus_tag LOCUS_27540 6612 6806 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411026.1 protein_id gnl|my_center|LOCUS_27540 6803 7735 gene locus_tag LOCUS_27550 gene prcB 6803 7735 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877854.1 protein_id gnl|my_center|LOCUS_27550 7749 8534 gene locus_tag LOCUS_27560 gene prcA 7749 8534 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895345.1 protein_id gnl|my_center|LOCUS_27560 8798 8541 gene locus_tag LOCUS_27570 8798 8541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 9004 10347 gene locus_tag LOCUS_27580 gene pafA 9004 10347 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729397.1 protein_id gnl|my_center|LOCUS_27580 10389 11384 gene locus_tag LOCUS_27590 10389 11384 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410775.1 protein_id gnl|my_center|LOCUS_27590 11381 12358 gene locus_tag LOCUS_27600 11381 12358 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950657.1 protein_id gnl|my_center|LOCUS_27600 >Feature sequence106 1389 550 gene locus_tag LOCUS_27610 1389 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 1948 1655 gene locus_tag LOCUS_27620 1948 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 2297 1989 gene locus_tag LOCUS_27630 2297 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 3759 2410 gene locus_tag LOCUS_27640 3759 2410 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036463052.1 protein_id gnl|my_center|LOCUS_27640 4062 3865 gene locus_tag LOCUS_27650 4062 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 4001 4210 gene locus_tag LOCUS_27660 4001 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 8494 4304 gene locus_tag LOCUS_27670 8494 4304 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055990.1 protein_id gnl|my_center|LOCUS_27670 10081 8495 gene locus_tag LOCUS_27680 gene eccB 10081 8495 CDS product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892036.1 protein_id gnl|my_center|LOCUS_27680 11924 10074 gene locus_tag LOCUS_27690 gene eccA1 11924 10074 CDS product type VII secretion system ESX-1 AAA family ATPase EccA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891386.1 protein_id gnl|my_center|LOCUS_27690 >Feature sequence107 124 1059 gene locus_tag LOCUS_27700 gene tatC 124 1059 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410764.1 protein_id gnl|my_center|LOCUS_27700 1043 3856 gene locus_tag LOCUS_27710 1043 3856 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729394.1 protein_id gnl|my_center|LOCUS_27710 3926 4699 gene locus_tag LOCUS_27720 3926 4699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 4808 5101 gene locus_tag LOCUS_27730 4808 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 5101 6993 gene locus_tag LOCUS_27740 5101 6993 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208177.1 protein_id gnl|my_center|LOCUS_27740 6998 7504 gene locus_tag LOCUS_27750 6998 7504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 8464 7508 gene locus_tag LOCUS_27760 8464 7508 CDS product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886139.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27760 8487 9614 gene locus_tag LOCUS_27770 8487 9614 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729390.1 protein_id gnl|my_center|LOCUS_27770 10044 9628 gene locus_tag LOCUS_27780 10044 9628 CDS product F420-dependent biliverdin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899157.1 protein_id gnl|my_center|LOCUS_27780 10080 10847 gene locus_tag LOCUS_27790 10080 10847 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900457.1 protein_id gnl|my_center|LOCUS_27790 10879 12054 gene locus_tag LOCUS_27800 10879 12054 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729388.1 protein_id gnl|my_center|LOCUS_27800 >Feature sequence108 <1 1399 gene locus_tag LOCUS_27810 <1 1399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262166.1:glycosyl hydrolase family 18 protein 1556 1732 gene locus_tag LOCUS_27820 1556 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 1792 3009 gene locus_tag LOCUS_27830 1792 3009 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401015.1 protein_id gnl|my_center|LOCUS_27830 3006 3812 gene locus_tag LOCUS_27840 3006 3812 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726668.1 protein_id gnl|my_center|LOCUS_27840 4345 3809 gene locus_tag LOCUS_27850 4345 3809 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726666.1 protein_id gnl|my_center|LOCUS_27850 5250 4390 gene locus_tag LOCUS_27860 5250 4390 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876665.1 protein_id gnl|my_center|LOCUS_27860 5355 6275 gene locus_tag LOCUS_27870 gene bla 5355 6275 CDS product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728509.1 protein_id gnl|my_center|LOCUS_27870 7204 6266 gene locus_tag LOCUS_27880 7204 6266 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726662.1 protein_id gnl|my_center|LOCUS_27880 7801 7259 gene locus_tag LOCUS_27890 7801 7259 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726661.1 protein_id gnl|my_center|LOCUS_27890 9423 8023 gene locus_tag LOCUS_27900 9423 8023 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400974.1 protein_id gnl|my_center|LOCUS_27900 9551 10117 gene locus_tag LOCUS_27910 9551 10117 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876664.1 protein_id gnl|my_center|LOCUS_27910 >Feature sequence109 1438 563 gene locus_tag LOCUS_27920 1438 563 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411201.1 protein_id gnl|my_center|LOCUS_27920 1911 2885 gene locus_tag LOCUS_27930 1911 2885 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727602.1 protein_id gnl|my_center|LOCUS_27930 2934 3287 gene locus_tag LOCUS_27940 2934 3287 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028983.1 protein_id gnl|my_center|LOCUS_27940 3480 3704 gene locus_tag LOCUS_27950 3480 3704 CDS product antitoxin MazE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729843.1 protein_id gnl|my_center|LOCUS_27950 3704 4033 gene locus_tag LOCUS_27960 3704 4033 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895797.1 protein_id gnl|my_center|LOCUS_27960 4367 5659 gene locus_tag LOCUS_27970 4367 5659 CDS product NADH:flavin oxidoreductase/NADH oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528855.1 protein_id gnl|my_center|LOCUS_27970 5954 6121 gene locus_tag LOCUS_27980 5954 6121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 6140 7237 gene locus_tag LOCUS_27990 6140 7237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 7666 7310 gene locus_tag LOCUS_28000 7666 7310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 8493 7756 gene locus_tag LOCUS_28010 8493 7756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 9648 9899 gene locus_tag LOCUS_28020 9648 9899 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409899.1 protein_id gnl|my_center|LOCUS_28020 9896 10192 gene locus_tag LOCUS_28030 9896 10192 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409896.1 protein_id gnl|my_center|LOCUS_28030 10817 10497 gene locus_tag LOCUS_28040 10817 10497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28040 11757 10999 gene locus_tag LOCUS_28050 11757 10999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 12000 11806 gene locus_tag LOCUS_28060 12000 11806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 >Feature sequence110 190 1575 gene locus_tag LOCUS_28070 190 1575 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150981032.1 protein_id gnl|my_center|LOCUS_28070 1590 2729 gene locus_tag LOCUS_28080 1590 2729 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878348.1 protein_id gnl|my_center|LOCUS_28080 3368 2760 gene locus_tag LOCUS_28090 3368 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731393.1 protein_id gnl|my_center|LOCUS_28090 4594 3449 gene locus_tag LOCUS_28100 gene nagA 4594 3449 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728170.1 protein_id gnl|my_center|LOCUS_28100 5380 4595 gene locus_tag LOCUS_28110 gene nagB 5380 4595 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728169.1 protein_id gnl|my_center|LOCUS_28110 5857 5387 gene locus_tag LOCUS_28120 5857 5387 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728168.1 protein_id gnl|my_center|LOCUS_28120 6014 7579 gene locus_tag LOCUS_28130 6014 7579 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728167.1 protein_id gnl|my_center|LOCUS_28130 7745 9358 gene locus_tag LOCUS_28140 7745 9358 CDS product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727775.1 protein_id gnl|my_center|LOCUS_28140 9355 10092 gene locus_tag LOCUS_28150 9355 10092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 10254 10096 gene locus_tag LOCUS_28160 10254 10096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 11951 10278 gene locus_tag LOCUS_28170 11951 10278 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878652.1 protein_id gnl|my_center|LOCUS_28170 >Feature sequence111 1969 203 gene locus_tag LOCUS_28180 1969 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 2075 3703 gene locus_tag LOCUS_28190 2075 3703 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727643.1 protein_id gnl|my_center|LOCUS_28190 3798 4703 gene locus_tag LOCUS_28200 3798 4703 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403426.1 protein_id gnl|my_center|LOCUS_28200 4706 5422 gene locus_tag LOCUS_28210 4706 5422 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104527.1 protein_id gnl|my_center|LOCUS_28210 5419 6177 gene locus_tag LOCUS_28220 5419 6177 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727645.1 protein_id gnl|my_center|LOCUS_28220 6679 6308 gene locus_tag LOCUS_28230 6679 6308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 6758 7387 gene locus_tag LOCUS_28240 6758 7387 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892785.1 protein_id gnl|my_center|LOCUS_28240 7636 8010 gene locus_tag LOCUS_28250 gene rpsL 7636 8010 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007167812.1 protein_id gnl|my_center|LOCUS_28250 8010 8480 gene locus_tag LOCUS_28260 gene rpsG 8010 8480 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055588.1 protein_id gnl|my_center|LOCUS_28260 8567 10669 gene locus_tag LOCUS_28270 gene fusA 8567 10669 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908589.1 protein_id gnl|my_center|LOCUS_28270 10767 11957 gene locus_tag LOCUS_28280 gene tuf 10767 11957 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892789.1 protein_id gnl|my_center|LOCUS_28280 >Feature sequence112 2003 1473 gene locus_tag LOCUS_28290 2003 1473 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896473.1 protein_id gnl|my_center|LOCUS_28290 3256 2000 gene locus_tag LOCUS_28300 3256 2000 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896472.1 protein_id gnl|my_center|LOCUS_28300 3324 4280 gene locus_tag LOCUS_28310 3324 4280 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730292.1 protein_id gnl|my_center|LOCUS_28310 4924 4283 gene locus_tag LOCUS_28320 4924 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 4923 5453 gene locus_tag LOCUS_28330 4923 5453 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406290.1 protein_id gnl|my_center|LOCUS_28330 5610 6968 gene locus_tag LOCUS_28340 5610 6968 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730290.1 protein_id gnl|my_center|LOCUS_28340 6965 7864 gene locus_tag LOCUS_28350 6965 7864 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896467.1 protein_id gnl|my_center|LOCUS_28350 7866 8687 gene locus_tag LOCUS_28360 gene sugB 7866 8687 CDS product trehalose ABC transporter permease SugB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900298.1 protein_id gnl|my_center|LOCUS_28360 8701 9861 gene locus_tag LOCUS_28370 gene ugpC 8701 9861 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730288.1 protein_id gnl|my_center|LOCUS_28370 9858 10466 gene locus_tag LOCUS_28380 9858 10466 CDS product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730287.1 protein_id gnl|my_center|LOCUS_28380 11786 10500 gene locus_tag LOCUS_28390 11786 10500 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729712.1 protein_id gnl|my_center|LOCUS_28390 >Feature sequence113 1248 472 gene locus_tag LOCUS_28400 gene pstB 1248 472 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730783.1 protein_id gnl|my_center|LOCUS_28400 2171 1266 gene locus_tag LOCUS_28410 gene pstA 2171 1266 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112722.1 protein_id gnl|my_center|LOCUS_28410 3205 2168 gene locus_tag LOCUS_28420 gene pstC 3205 2168 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112723.1 protein_id gnl|my_center|LOCUS_28420 4336 3224 gene locus_tag LOCUS_28430 gene pstS 4336 3224 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112724.1 protein_id gnl|my_center|LOCUS_28430 5317 4442 gene locus_tag LOCUS_28440 gene mshD 5317 4442 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404307.1 protein_id gnl|my_center|LOCUS_28440 6078 5314 gene locus_tag LOCUS_28450 6078 5314 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897204.1 protein_id gnl|my_center|LOCUS_28450 6170 6967 gene locus_tag LOCUS_28460 gene lmeA 6170 6967 CDS product mannan chain length control protein LmeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730787.1 protein_id gnl|my_center|LOCUS_28460 6964 7383 gene locus_tag LOCUS_28470 6964 7383 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730788.1 protein_id gnl|my_center|LOCUS_28470 7600 8088 gene locus_tag LOCUS_28480 7600 8088 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897207.1 protein_id gnl|my_center|LOCUS_28480 8091 8405 gene locus_tag LOCUS_28490 8091 8405 CDS product DUF1416 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878457.1 protein_id gnl|my_center|LOCUS_28490 8527 9171 gene locus_tag LOCUS_28500 8527 9171 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730793.1 protein_id gnl|my_center|LOCUS_28500 9483 10871 gene locus_tag LOCUS_28510 9483 10871 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113119.1 protein_id gnl|my_center|LOCUS_28510 >Feature sequence114 789 103 gene locus_tag LOCUS_28520 789 103 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402936.1 protein_id gnl|my_center|LOCUS_28520 967 803 gene locus_tag LOCUS_28530 967 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 1636 1118 gene locus_tag LOCUS_28540 1636 1118 CDS product DUF3592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402929.1 protein_id gnl|my_center|LOCUS_28540 3303 1633 gene locus_tag LOCUS_28550 gene menD 3303 1633 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402927.1 protein_id gnl|my_center|LOCUS_28550 4113 3325 gene locus_tag LOCUS_28560 4113 3325 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402925.1 protein_id gnl|my_center|LOCUS_28560 4624 4118 gene locus_tag LOCUS_28570 gene tpx 4624 4118 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059496.1 protein_id gnl|my_center|LOCUS_28570 5585 4638 gene locus_tag LOCUS_28580 5585 4638 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727412.1 protein_id gnl|my_center|LOCUS_28580 7159 5591 gene locus_tag LOCUS_28590 7159 5591 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223393.1 protein_id gnl|my_center|LOCUS_28590 7338 7595 gene locus_tag LOCUS_28600 7338 7595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 9113 7566 gene locus_tag LOCUS_28610 9113 7566 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977257.1 protein_id gnl|my_center|LOCUS_28610 9144 10748 gene locus_tag LOCUS_28620 gene fadD8 9144 10748 CDS product fatty-acid--CoA ligase FadD8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727407.1 protein_id gnl|my_center|LOCUS_28620 >Feature sequence115 518 75 gene locus_tag LOCUS_28630 gene rplO 518 75 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727689.1 protein_id gnl|my_center|LOCUS_28630 718 515 gene locus_tag LOCUS_28640 gene rpmD 718 515 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727688.1 protein_id gnl|my_center|LOCUS_28640 1437 721 gene locus_tag LOCUS_28650 1437 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 1882 1481 gene locus_tag LOCUS_28660 gene rplR 1882 1481 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080509.1 protein_id gnl|my_center|LOCUS_28660 2424 1885 gene locus_tag LOCUS_28670 gene rplF 2424 1885 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892857.1 protein_id gnl|my_center|LOCUS_28670 2845 2447 gene locus_tag LOCUS_28680 gene rpsH 2845 2447 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892856.1 protein_id gnl|my_center|LOCUS_28680 3128 2943 gene locus_tag LOCUS_28690 3128 2943 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892855.1 protein_id gnl|my_center|LOCUS_28690 3695 3132 gene locus_tag LOCUS_28700 gene rplE 3695 3132 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892854.1 protein_id gnl|my_center|LOCUS_28700 4015 3692 gene locus_tag LOCUS_28710 gene rplX 4015 3692 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055682.1 protein_id gnl|my_center|LOCUS_28710 4384 4016 gene locus_tag LOCUS_28720 gene rplN 4384 4016 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403649.1 protein_id gnl|my_center|LOCUS_28720 5514 4636 gene locus_tag LOCUS_28730 5514 4636 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403610.1 protein_id gnl|my_center|LOCUS_28730 7950 5599 gene locus_tag LOCUS_28740 7950 5599 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727677.1 protein_id gnl|my_center|LOCUS_28740 8046 8516 gene locus_tag LOCUS_28750 gene mpt63 8046 8516 CDS product immunoprotective protein Mpt63 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409684.1 protein_id gnl|my_center|LOCUS_28750 10316 8523 gene locus_tag LOCUS_28760 10316 8523 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013411.1 protein_id gnl|my_center|LOCUS_28760 10198 10785 gene locus_tag LOCUS_28770 10198 10785 CDS product heme NO-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920829.1 protein_id gnl|my_center|LOCUS_28770 >Feature sequence116 1315 497 gene locus_tag LOCUS_28780 1315 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 1405 2133 gene locus_tag LOCUS_28790 1405 2133 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014848103.1 protein_id gnl|my_center|LOCUS_28790 4525 2195 gene locus_tag LOCUS_28800 4525 2195 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730364.1 protein_id gnl|my_center|LOCUS_28800 5937 4516 gene locus_tag LOCUS_28810 5937 4516 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946887.1 protein_id gnl|my_center|LOCUS_28810 6060 8573 gene locus_tag LOCUS_28820 6060 8573 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110390.1 protein_id gnl|my_center|LOCUS_28820 >Feature sequence117 1498 383 gene locus_tag LOCUS_28830 gene ald 1498 383 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894041.1 protein_id gnl|my_center|LOCUS_28830 1603 2118 gene locus_tag LOCUS_28840 1603 2118 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899476.1 protein_id gnl|my_center|LOCUS_28840 2156 2890 gene locus_tag LOCUS_28850 gene dapB 2156 2890 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414099.1 protein_id gnl|my_center|LOCUS_28850 2887 3339 gene locus_tag LOCUS_28860 2887 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728513.1 protein_id gnl|my_center|LOCUS_28860 3336 3794 gene locus_tag LOCUS_28870 3336 3794 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069385.1 protein_id gnl|my_center|LOCUS_28870 3824 4285 gene locus_tag LOCUS_28880 3824 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728515.1 protein_id gnl|my_center|LOCUS_28880 5014 4274 gene locus_tag LOCUS_28890 5014 4274 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728517.1 protein_id gnl|my_center|LOCUS_28890 4953 5858 gene locus_tag LOCUS_28900 4953 5858 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728518.1 protein_id gnl|my_center|LOCUS_28900 5869 6351 gene locus_tag LOCUS_28910 gene dfrA 5869 6351 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414073.1 protein_id gnl|my_center|LOCUS_28910 6348 7559 gene locus_tag LOCUS_28920 6348 7559 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728523.1 protein_id gnl|my_center|LOCUS_28920 8324 10084 gene locus_tag LOCUS_28930 gene ltrA 8324 10084 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097733.1 protein_id gnl|my_center|LOCUS_28930 >Feature sequence118 3446 4237 gene locus_tag LOCUS_28940 3446 4237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 4365 5069 gene locus_tag LOCUS_28950 4365 5069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 5374 5090 gene locus_tag LOCUS_28960 5374 5090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235623958.1 protein_id gnl|my_center|LOCUS_28960 5439 6350 gene locus_tag LOCUS_28970 5439 6350 CDS product TIGR03564 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230804.1 protein_id gnl|my_center|LOCUS_28970 6464 7072 gene locus_tag LOCUS_28980 gene pnuC 6464 7072 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766257.1 protein_id gnl|my_center|LOCUS_28980 7065 7598 gene locus_tag LOCUS_28990 7065 7598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 7648 8427 gene locus_tag LOCUS_29000 7648 8427 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057728.1 protein_id gnl|my_center|LOCUS_29000 >Feature sequence119 85 840 gene locus_tag LOCUS_29010 gene ttfA 85 840 CDS product trehalose monomycolate transport factor TtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892156.1 protein_id gnl|my_center|LOCUS_29010 861 1637 gene locus_tag LOCUS_29020 861 1637 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727156.1 protein_id gnl|my_center|LOCUS_29020 1624 2184 gene locus_tag LOCUS_29030 gene pyrE 1624 2184 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085722.1 protein_id gnl|my_center|LOCUS_29030 2177 2926 gene locus_tag LOCUS_29040 2177 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 2923 3570 gene locus_tag LOCUS_29050 2923 3570 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323891.1 protein_id gnl|my_center|LOCUS_29050 3587 4675 gene locus_tag LOCUS_29060 3587 4675 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727158.1 protein_id gnl|my_center|LOCUS_29060 4723 5640 gene locus_tag LOCUS_29070 4723 5640 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776432.1 protein_id gnl|my_center|LOCUS_29070 5737 6408 gene locus_tag LOCUS_29080 5737 6408 CDS product LpqN/LpqT family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730547.1 protein_id gnl|my_center|LOCUS_29080 6441 6743 gene locus_tag LOCUS_29090 6441 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 7410 6754 gene locus_tag LOCUS_29100 7410 6754 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401857.1 protein_id gnl|my_center|LOCUS_29100 7483 8520 gene locus_tag LOCUS_29110 gene fbaA 7483 8520 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892176.1 protein_id gnl|my_center|LOCUS_29110 9354 8539 gene locus_tag LOCUS_29120 9354 8539 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401853.1 protein_id gnl|my_center|LOCUS_29120 9486 9902 gene locus_tag LOCUS_29130 9486 9902 CDS product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892178.1 protein_id gnl|my_center|LOCUS_29130 >Feature sequence120 2168 1527 gene locus_tag LOCUS_29140 2168 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 2427 2630 gene locus_tag LOCUS_29150 2427 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 3455 2673 gene locus_tag LOCUS_29160 3455 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 4936 4559 gene locus_tag LOCUS_29170 4936 4559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 5976 5710 gene locus_tag LOCUS_29180 5976 5710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 6881 6255 gene locus_tag LOCUS_29190 6881 6255 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531693.1 protein_id gnl|my_center|LOCUS_29190 9888 7054 gene locus_tag LOCUS_29200 9888 7054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 >Feature sequence121 <1 996 gene locus_tag LOCUS_29210 <1 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003416815.1:AarF/ABC1/UbiB kinase family protein 1059 1289 gene locus_tag LOCUS_29220 1059 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 1280 1690 gene locus_tag LOCUS_29230 1280 1690 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401566.1 protein_id gnl|my_center|LOCUS_29230 1944 1717 gene locus_tag LOCUS_29240 1944 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 5047 2084 gene locus_tag LOCUS_29250 5047 2084 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407779.1 protein_id gnl|my_center|LOCUS_29250 5484 5044 gene locus_tag LOCUS_29260 5484 5044 CDS product MmpS family transport accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903500.1 protein_id gnl|my_center|LOCUS_29260 6085 5522 gene locus_tag LOCUS_29270 6085 5522 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407773.1 protein_id gnl|my_center|LOCUS_29270 6271 6879 gene locus_tag LOCUS_29280 6271 6879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 7282 6881 gene locus_tag LOCUS_29290 7282 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 7352 7891 gene locus_tag LOCUS_29300 7352 7891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 <9823 7888 gene locus_tag LOCUS_29310 <9823 7888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_036462428.1:ATP-dependent DNA helicase UvrD2 >Feature sequence122 225 782 gene locus_tag LOCUS_29320 225 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 1226 900 gene locus_tag LOCUS_29330 1226 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 2015 1317 gene locus_tag LOCUS_29340 2015 1317 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854724.1 protein_id gnl|my_center|LOCUS_29340 2425 2012 gene locus_tag LOCUS_29350 2425 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 2634 3542 gene locus_tag LOCUS_29360 2634 3542 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296515.1 protein_id gnl|my_center|LOCUS_29360 4127 3642 gene locus_tag LOCUS_29370 4127 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 4381 4124 gene locus_tag LOCUS_29380 4381 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 5358 4399 gene locus_tag LOCUS_29390 5358 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 7002 5515 gene locus_tag LOCUS_29400 7002 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 7325 6999 gene locus_tag LOCUS_29410 gene tnpA 7325 6999 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979974.1 protein_id gnl|my_center|LOCUS_29410 7741 7514 gene locus_tag LOCUS_29420 7741 7514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 8025 7738 gene locus_tag LOCUS_29430 8025 7738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 8428 8054 gene locus_tag LOCUS_29440 8428 8054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 9016 8498 gene locus_tag LOCUS_29450 9016 8498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 >Feature sequence123 <1 509 gene locus_tag LOCUS_29460 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_070939476.1:pyridoxal 5'-phosphate synthase lyase subunit PdxS 522 1355 gene locus_tag LOCUS_29470 gene tesB 522 1355 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894316.1 protein_id gnl|my_center|LOCUS_29470 1352 1948 gene locus_tag LOCUS_29480 gene pdxT 1352 1948 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413465.1 protein_id gnl|my_center|LOCUS_29480 2027 2782 gene locus_tag LOCUS_29490 2027 2782 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894318.1 protein_id gnl|my_center|LOCUS_29490 2865 3419 gene locus_tag LOCUS_29500 gene ruvC 2865 3419 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894321.1 protein_id gnl|my_center|LOCUS_29500 3416 4009 gene locus_tag LOCUS_29510 gene ruvA 3416 4009 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728708.1 protein_id gnl|my_center|LOCUS_29510 4039 5100 gene locus_tag LOCUS_29520 gene ruvB 4039 5100 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728709.1 protein_id gnl|my_center|LOCUS_29520 5137 5520 gene locus_tag LOCUS_29530 5137 5520 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728710.1 protein_id gnl|my_center|LOCUS_29530 6887 5541 gene locus_tag LOCUS_29540 6887 5541 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897865.1 protein_id gnl|my_center|LOCUS_29540 8294 6930 gene locus_tag LOCUS_29550 gene gabT 8294 6930 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907749.1 protein_id gnl|my_center|LOCUS_29550 8634 9080 gene locus_tag LOCUS_29560 8634 9080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 >Feature sequence124 724 128 gene locus_tag LOCUS_29570 724 128 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894458.1 protein_id gnl|my_center|LOCUS_29570 1252 755 gene locus_tag LOCUS_29580 1252 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 1355 2020 gene locus_tag LOCUS_29590 gene lprG 1355 2020 CDS product lipoarabinomannan carrier protein LprG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407315.1 protein_id gnl|my_center|LOCUS_29590 2020 3570 gene locus_tag LOCUS_29600 2020 3570 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462758.1 protein_id gnl|my_center|LOCUS_29600 3641 4678 gene locus_tag LOCUS_29610 3641 4678 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413230.1 protein_id gnl|my_center|LOCUS_29610 4682 5677 gene locus_tag LOCUS_29620 4682 5677 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899801.1 protein_id gnl|my_center|LOCUS_29620 6705 5686 gene locus_tag LOCUS_29630 gene ribD 6705 5686 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104448.1 protein_id gnl|my_center|LOCUS_29630 7367 6702 gene locus_tag LOCUS_29640 gene rpe 7367 6702 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894453.1 protein_id gnl|my_center|LOCUS_29640 8753 7413 gene locus_tag LOCUS_29650 8753 7413 CDS product 16S rRNA m5C967 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728793.1 protein_id gnl|my_center|LOCUS_29650 <9654 8813 gene locus_tag LOCUS_29660 <9654 8813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728792.1:methionyl-tRNA formyltransferase >Feature sequence125 1681 2964 gene locus_tag LOCUS_29670 1681 2964 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727602.1 protein_id gnl|my_center|LOCUS_29670 3058 4512 gene locus_tag LOCUS_29680 3058 4512 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690336.1 protein_id gnl|my_center|LOCUS_29680 4536 5459 gene locus_tag LOCUS_29690 4536 5459 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411849.1 protein_id gnl|my_center|LOCUS_29690 5899 5462 gene locus_tag LOCUS_29700 5899 5462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 6364 5954 gene locus_tag LOCUS_29710 6364 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141564470.1 protein_id gnl|my_center|LOCUS_29710 6583 6419 gene locus_tag LOCUS_29720 gene rpmG 6583 6419 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003889348.1 protein_id gnl|my_center|LOCUS_29720 6819 6583 gene locus_tag LOCUS_29730 gene rpmB 6819 6583 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410631.1 protein_id gnl|my_center|LOCUS_29730 6926 8134 gene locus_tag LOCUS_29740 6926 8134 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400804.1 protein_id gnl|my_center|LOCUS_29740 8131 8394 gene locus_tag LOCUS_29750 8131 8394 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897470.1 protein_id gnl|my_center|LOCUS_29750 8410 8673 gene locus_tag LOCUS_29760 8410 8673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 9545 8853 gene locus_tag LOCUS_29770 9545 8853 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403259.1 protein_id gnl|my_center|LOCUS_29770 >Feature sequence126 1769 717 gene locus_tag LOCUS_29780 1769 717 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405716.1 protein_id gnl|my_center|LOCUS_29780 1955 2800 gene locus_tag LOCUS_29790 1955 2800 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405719.1 protein_id gnl|my_center|LOCUS_29790 2971 3825 gene locus_tag LOCUS_29800 2971 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727189.1 protein_id gnl|my_center|LOCUS_29800 5141 3921 gene locus_tag LOCUS_29810 5141 3921 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730434.1 protein_id gnl|my_center|LOCUS_29810 6115 5180 gene locus_tag LOCUS_29820 6115 5180 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730433.1 protein_id gnl|my_center|LOCUS_29820 6328 7359 gene locus_tag LOCUS_29830 6328 7359 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049769636.1 protein_id gnl|my_center|LOCUS_29830 7394 8788 gene locus_tag LOCUS_29840 7394 8788 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084259.1 protein_id gnl|my_center|LOCUS_29840 8830 9381 gene locus_tag LOCUS_29850 8830 9381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 >Feature sequence127 1698 70 gene locus_tag LOCUS_29860 1698 70 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405625.1 protein_id gnl|my_center|LOCUS_29860 1872 2189 gene locus_tag LOCUS_29870 1872 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104483.1 protein_id gnl|my_center|LOCUS_29870 3276 2215 gene locus_tag LOCUS_29880 3276 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730461.1 protein_id gnl|my_center|LOCUS_29880 4662 3658 gene locus_tag LOCUS_29890 4662 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 4823 5413 gene locus_tag LOCUS_29900 4823 5413 CDS product DUF3060 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401619.1 protein_id gnl|my_center|LOCUS_29900 6883 5420 gene locus_tag LOCUS_29910 6883 5420 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803738.1 protein_id gnl|my_center|LOCUS_29910 7176 6913 gene locus_tag LOCUS_29920 7176 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 7533 7264 gene locus_tag LOCUS_29930 7533 7264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 9054 7609 gene locus_tag LOCUS_29940 9054 7609 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411955.1 protein_id gnl|my_center|LOCUS_29940 9484 9170 gene locus_tag LOCUS_29950 9484 9170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 >Feature sequence128 1664 36 gene locus_tag LOCUS_29960 1664 36 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730355.1 protein_id gnl|my_center|LOCUS_29960 2011 1661 gene locus_tag LOCUS_29970 2011 1661 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049745379.1 protein_id gnl|my_center|LOCUS_29970 3871 2141 gene locus_tag LOCUS_29980 3871 2141 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730352.1 protein_id gnl|my_center|LOCUS_29980 4236 3868 gene locus_tag LOCUS_29990 4236 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104514.1 protein_id gnl|my_center|LOCUS_29990 5078 4281 gene locus_tag LOCUS_30000 5078 4281 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896559.1 protein_id gnl|my_center|LOCUS_30000 6284 5103 gene locus_tag LOCUS_30010 6284 5103 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896558.1 protein_id gnl|my_center|LOCUS_30010 6567 7142 gene locus_tag LOCUS_30020 6567 7142 CDS product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896556.1 protein_id gnl|my_center|LOCUS_30020 7171 7317 gene locus_tag LOCUS_30030 7171 7317 CDS product DUF1059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896554.1 protein_id gnl|my_center|LOCUS_30030 8747 7311 gene locus_tag LOCUS_30040 8747 7311 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420440.1 protein_id gnl|my_center|LOCUS_30040 8862 9335 gene locus_tag LOCUS_30050 8862 9335 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085194.1 protein_id gnl|my_center|LOCUS_30050 >Feature sequence129 399 1247 gene locus_tag LOCUS_30060 399 1247 CDS product Rv0687 family mycofactocin-dependent SDR oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403468.1 protein_id gnl|my_center|LOCUS_30060 4041 1312 gene locus_tag LOCUS_30070 4041 1312 CDS product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965961.1 protein_id gnl|my_center|LOCUS_30070 4945 4064 gene locus_tag LOCUS_30080 4945 4064 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727652.1 protein_id gnl|my_center|LOCUS_30080 6399 4942 gene locus_tag LOCUS_30090 6399 4942 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411955.1 protein_id gnl|my_center|LOCUS_30090 6483 7664 gene locus_tag LOCUS_30100 6483 7664 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901000.1 protein_id gnl|my_center|LOCUS_30100 8338 7745 gene locus_tag LOCUS_30110 gene mftR 8338 7745 CDS product mycofactocin system transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403482.1 protein_id gnl|my_center|LOCUS_30110 8503 8778 gene locus_tag LOCUS_30120 gene mftB 8503 8778 CDS product mycofactocin biosynthesis chaperone MftB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892808.1 protein_id gnl|my_center|LOCUS_30120 >Feature sequence130 616 1623 gene locus_tag LOCUS_30130 616 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 1710 2072 gene locus_tag LOCUS_30140 1710 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 2098 2733 gene locus_tag LOCUS_30150 2098 2733 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480040.1 protein_id gnl|my_center|LOCUS_30150 2730 3560 gene locus_tag LOCUS_30160 2730 3560 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894238.1 protein_id gnl|my_center|LOCUS_30160 3564 4340 gene locus_tag LOCUS_30170 3564 4340 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729123.1 protein_id gnl|my_center|LOCUS_30170 4337 6592 gene locus_tag LOCUS_30180 4337 6592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 6589 9000 gene locus_tag LOCUS_30190 6589 9000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 >Feature sequence131 988 170 gene locus_tag LOCUS_30200 988 170 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082640.1 protein_id gnl|my_center|LOCUS_30200 1261 1518 gene locus_tag LOCUS_30210 1261 1518 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407272.1 protein_id gnl|my_center|LOCUS_30210 1500 1904 gene locus_tag LOCUS_30220 1500 1904 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407268.1 protein_id gnl|my_center|LOCUS_30220 2082 1864 gene locus_tag LOCUS_30230 2082 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 2433 2176 gene locus_tag LOCUS_30240 2433 2176 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417760.1 protein_id gnl|my_center|LOCUS_30240 2714 2430 gene locus_tag LOCUS_30250 gene relJ 2714 2430 CDS product type II toxin-antitoxin system antitoxin RelJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417757.1 protein_id gnl|my_center|LOCUS_30250 2842 3087 gene locus_tag LOCUS_30260 2842 3087 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413429.1 protein_id gnl|my_center|LOCUS_30260 3084 3488 gene locus_tag LOCUS_30270 3084 3488 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413432.1 protein_id gnl|my_center|LOCUS_30270 3762 4859 gene locus_tag LOCUS_30280 3762 4859 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408248.1 protein_id gnl|my_center|LOCUS_30280 4856 5380 gene locus_tag LOCUS_30290 4856 5380 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031817.1 protein_id gnl|my_center|LOCUS_30290 5377 6390 gene locus_tag LOCUS_30300 5377 6390 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727207.1 protein_id gnl|my_center|LOCUS_30300 7654 6491 gene locus_tag LOCUS_30310 7654 6491 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230171.1 protein_id gnl|my_center|LOCUS_30310 8923 7727 gene locus_tag LOCUS_30320 8923 7727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 >Feature sequence132 382 675 gene locus_tag LOCUS_30330 382 675 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075541644.1 protein_id gnl|my_center|LOCUS_30330 1556 672 gene locus_tag LOCUS_30340 1556 672 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080122.1 protein_id gnl|my_center|LOCUS_30340 1963 1622 gene locus_tag LOCUS_30350 1963 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 2231 1926 gene locus_tag LOCUS_30360 2231 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 2853 2269 gene locus_tag LOCUS_30370 2853 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085620.1 protein_id gnl|my_center|LOCUS_30370 3419 2928 gene locus_tag LOCUS_30380 3419 2928 CDS product DUF4126 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895565.1 protein_id gnl|my_center|LOCUS_30380 4296 3430 gene locus_tag LOCUS_30390 gene hisG 4296 3430 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877960.1 protein_id gnl|my_center|LOCUS_30390 4585 4304 gene locus_tag LOCUS_30400 4585 4304 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899180.1 protein_id gnl|my_center|LOCUS_30400 5241 4627 gene locus_tag LOCUS_30410 5241 4627 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726661.1 protein_id gnl|my_center|LOCUS_30410 6768 5329 gene locus_tag LOCUS_30420 6768 5329 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877961.1 protein_id gnl|my_center|LOCUS_30420 7562 6882 gene locus_tag LOCUS_30430 7562 6882 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729623.1 protein_id gnl|my_center|LOCUS_30430 9081 7639 gene locus_tag LOCUS_30440 9081 7639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 >Feature sequence133 103 417 gene locus_tag LOCUS_30450 103 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 1385 414 gene locus_tag LOCUS_30460 1385 414 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878272.1 protein_id gnl|my_center|LOCUS_30460 1473 2063 gene locus_tag LOCUS_30470 1473 2063 CDS product lipid droplet-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898730.1 protein_id gnl|my_center|LOCUS_30470 2060 3313 gene locus_tag LOCUS_30480 gene xseA 2060 3313 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405846.1 protein_id gnl|my_center|LOCUS_30480 3310 3543 gene locus_tag LOCUS_30490 3310 3543 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405844.1 protein_id gnl|my_center|LOCUS_30490 3604 3981 gene locus_tag LOCUS_30500 3604 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 4275 5051 gene locus_tag LOCUS_30510 4275 5051 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730402.1 protein_id gnl|my_center|LOCUS_30510 5056 6255 gene locus_tag LOCUS_30520 5056 6255 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898727.1 protein_id gnl|my_center|LOCUS_30520 7039 6236 gene locus_tag LOCUS_30530 7039 6236 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730405.1 protein_id gnl|my_center|LOCUS_30530 7683 7048 gene locus_tag LOCUS_30540 7683 7048 CDS product DUF4245 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405815.1 protein_id gnl|my_center|LOCUS_30540 7580 8770 gene locus_tag LOCUS_30550 gene glpX 7580 8770 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730407.1 protein_id gnl|my_center|LOCUS_30550 >Feature sequence134 <1 770 gene locus_tag LOCUS_30560 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003400411.1:DUF5631 domain-containing protein 767 1792 gene locus_tag LOCUS_30570 767 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 1920 3089 gene locus_tag LOCUS_30580 1920 3089 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898396.1 protein_id gnl|my_center|LOCUS_30580 4004 3093 gene locus_tag LOCUS_30590 4004 3093 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104249.1 protein_id gnl|my_center|LOCUS_30590 4086 4706 gene locus_tag LOCUS_30600 4086 4706 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902925.1 protein_id gnl|my_center|LOCUS_30600 4841 7054 gene locus_tag LOCUS_30610 4841 7054 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727059.1 protein_id gnl|my_center|LOCUS_30610 8824 7145 gene locus_tag LOCUS_30620 gene fadD2 8824 7145 CDS product long-chain-fatty-acid--CoA ligase FadD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876813.1 protein_id gnl|my_center|LOCUS_30620 >Feature sequence135 2880 4745 gene locus_tag LOCUS_30630 2880 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 4811 5128 gene locus_tag LOCUS_30640 4811 5128 CDS product DUF3349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415968.1 protein_id gnl|my_center|LOCUS_30640 6202 5132 gene locus_tag LOCUS_30650 6202 5132 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727367.1 protein_id gnl|my_center|LOCUS_30650 7110 6739 gene locus_tag LOCUS_30660 7110 6739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 7174 7527 gene locus_tag LOCUS_30670 7174 7527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 7541 8377 gene locus_tag LOCUS_30680 7541 8377 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266249.1 protein_id gnl|my_center|LOCUS_30680 <8922 8394 gene locus_tag LOCUS_30690 <8922 8394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727368.1:ABC transporter substrate-binding protein >Feature sequence136 190 711 gene locus_tag LOCUS_30700 190 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 1088 735 gene locus_tag LOCUS_30710 1088 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 1564 1085 gene locus_tag LOCUS_30720 1564 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 1923 1657 gene locus_tag LOCUS_30730 1923 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 2130 2909 gene locus_tag LOCUS_30740 2130 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 3012 3206 gene locus_tag LOCUS_30750 3012 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 3264 5852 gene locus_tag LOCUS_30760 3264 5852 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900188.1 protein_id gnl|my_center|LOCUS_30760 6445 6056 gene locus_tag LOCUS_30770 6445 6056 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227971.1 protein_id gnl|my_center|LOCUS_30770 6714 6442 gene locus_tag LOCUS_30780 6714 6442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 7933 6932 gene locus_tag LOCUS_30790 7933 6932 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730353.1 protein_id gnl|my_center|LOCUS_30790 >Feature sequence137 163 744 gene locus_tag LOCUS_30800 163 744 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223649.1 protein_id gnl|my_center|LOCUS_30800 769 2076 gene locus_tag LOCUS_30810 gene lipE 769 2076 CDS product lipase LipE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420590.1 protein_id gnl|my_center|LOCUS_30810 2553 2266 gene locus_tag LOCUS_30820 2553 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 3137 2550 gene locus_tag LOCUS_30830 3137 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 3503 3258 gene locus_tag LOCUS_30840 3503 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 3900 3496 gene locus_tag LOCUS_30850 3900 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 4387 4127 gene locus_tag LOCUS_30860 4387 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 5088 4384 gene locus_tag LOCUS_30870 5088 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 5398 5234 gene locus_tag LOCUS_30880 5398 5234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 6138 5425 gene locus_tag LOCUS_30890 6138 5425 CDS product phthiotriol/phenolphthiotriol dimycocerosates methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414900.1 protein_id gnl|my_center|LOCUS_30890 >Feature sequence138 432 346 gene locus_tag LOCUS_t00350 432 346 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 545 1741 gene locus_tag LOCUS_30900 545 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 1827 2213 gene locus_tag LOCUS_30910 1827 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898833.1 protein_id gnl|my_center|LOCUS_30910 2210 2554 gene locus_tag LOCUS_30920 2210 2554 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730175.1 protein_id gnl|my_center|LOCUS_30920 3152 2544 gene locus_tag LOCUS_30930 gene rdgB 3152 2544 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730176.1 protein_id gnl|my_center|LOCUS_30930 3934 3155 gene locus_tag LOCUS_30940 gene rph 3934 3155 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730177.1 protein_id gnl|my_center|LOCUS_30940 4368 3970 gene locus_tag LOCUS_30950 4368 3970 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403246.1 protein_id gnl|my_center|LOCUS_30950 4625 4365 gene locus_tag LOCUS_30960 4625 4365 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403244.1 protein_id gnl|my_center|LOCUS_30960 5440 4661 gene locus_tag LOCUS_30970 5440 4661 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730178.1 protein_id gnl|my_center|LOCUS_30970 6300 5491 gene locus_tag LOCUS_30980 gene murI 6300 5491 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406919.1 protein_id gnl|my_center|LOCUS_30980 6950 6297 gene locus_tag LOCUS_30990 6950 6297 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730180.1 protein_id gnl|my_center|LOCUS_30990 8086 7037 gene locus_tag LOCUS_31000 8086 7037 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730182.1 protein_id gnl|my_center|LOCUS_31000 8661 8083 gene locus_tag LOCUS_31010 8661 8083 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730183.1 protein_id gnl|my_center|LOCUS_31010 >Feature sequence139 2984 1821 gene locus_tag LOCUS_31020 2984 1821 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083125798.1 protein_id gnl|my_center|LOCUS_31020 3186 3112 gene locus_tag LOCUS_t00360 3186 3112 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3441 4589 gene locus_tag LOCUS_31030 3441 4589 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412725.1 protein_id gnl|my_center|LOCUS_31030 4749 6266 gene locus_tag LOCUS_31040 4749 6266 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412717.1 protein_id gnl|my_center|LOCUS_31040 6263 7957 gene locus_tag LOCUS_31050 6263 7957 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412713.1 protein_id gnl|my_center|LOCUS_31050 >Feature sequence140 246 479 gene locus_tag LOCUS_31060 246 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 469 780 gene locus_tag LOCUS_31070 469 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 994 1200 gene locus_tag LOCUS_31080 994 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 2234 1455 gene locus_tag LOCUS_31090 2234 1455 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014152.1 protein_id gnl|my_center|LOCUS_31090 2325 4091 gene locus_tag LOCUS_31100 2325 4091 CDS product peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014153.1 protein_id gnl|my_center|LOCUS_31100 5041 4238 gene locus_tag LOCUS_31110 5041 4238 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407737.1 protein_id gnl|my_center|LOCUS_31110 5307 5552 gene locus_tag LOCUS_31120 5307 5552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 5576 5959 gene locus_tag LOCUS_31130 5576 5959 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403137.1 protein_id gnl|my_center|LOCUS_31130 7631 5973 gene locus_tag LOCUS_31140 7631 5973 CDS product IS200/IS605 family element transposase accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028271.1 protein_id gnl|my_center|LOCUS_31140 8032 7628 gene locus_tag LOCUS_31150 8032 7628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 <8667 8025 gene locus_tag LOCUS_31160 <8667 8025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003404760.1:IS607-like element IS1535 family transposase >Feature sequence141 525 1814 gene locus_tag LOCUS_31170 525 1814 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408476.1 protein_id gnl|my_center|LOCUS_31170 3302 1833 gene locus_tag LOCUS_31180 3302 1833 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950580.1 protein_id gnl|my_center|LOCUS_31180 3418 5370 gene locus_tag LOCUS_31190 3418 5370 CDS product primary-amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729366.1 protein_id gnl|my_center|LOCUS_31190 6906 5380 gene locus_tag LOCUS_31200 6906 5380 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727782.1 protein_id gnl|my_center|LOCUS_31200 7021 7929 gene locus_tag LOCUS_31210 7021 7929 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227300.1 protein_id gnl|my_center|LOCUS_31210 <8663 7941 gene locus_tag LOCUS_31220 <8663 7941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728734.1:peptidylprolyl isomerase >Feature sequence142 975 4 gene locus_tag LOCUS_31230 975 4 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412235.1 protein_id gnl|my_center|LOCUS_31230 1846 1082 gene locus_tag LOCUS_31240 1846 1082 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900509.1 protein_id gnl|my_center|LOCUS_31240 3009 1867 gene locus_tag LOCUS_31250 gene dnaJ 3009 1867 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729880.1 protein_id gnl|my_center|LOCUS_31250 4202 3048 gene locus_tag LOCUS_31260 gene hrcA 4202 3048 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412252.1 protein_id gnl|my_center|LOCUS_31260 5693 4239 gene locus_tag LOCUS_31270 5693 4239 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405324.1 protein_id gnl|my_center|LOCUS_31270 6445 5690 gene locus_tag LOCUS_31280 gene trcR 6445 5690 CDS product two-component system response regulator TrcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405328.1 protein_id gnl|my_center|LOCUS_31280 6895 8634 gene locus_tag LOCUS_31290 6895 8634 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908805.1 protein_id gnl|my_center|LOCUS_31290 >Feature sequence143 658 1068 gene locus_tag LOCUS_31300 658 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 2280 1306 gene locus_tag LOCUS_31310 gene nrdF 2280 1306 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893682.1 protein_id gnl|my_center|LOCUS_31310 3145 2399 gene locus_tag LOCUS_31320 3145 2399 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415979.1 protein_id gnl|my_center|LOCUS_31320 3235 4419 gene locus_tag LOCUS_31330 3235 4419 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893677.1 protein_id gnl|my_center|LOCUS_31330 4416 5162 gene locus_tag LOCUS_31340 4416 5162 CDS product YqjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409685.1 protein_id gnl|my_center|LOCUS_31340 5913 5200 gene locus_tag LOCUS_31350 5913 5200 CDS product LysR family substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111803.1 protein_id gnl|my_center|LOCUS_31350 5955 6332 gene locus_tag LOCUS_31360 5955 6332 CDS product DUF5997 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090410.1 protein_id gnl|my_center|LOCUS_31360 7215 6394 gene locus_tag LOCUS_31370 gene zupT 7215 6394 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861091.1 protein_id gnl|my_center|LOCUS_31370 <8624 7299 gene locus_tag LOCUS_31380 <8624 7299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003914457.1:class 1b ribonucleoside-diphosphate reductase subunit alpha >Feature sequence144 3 386 gene locus_tag LOCUS_31390 3 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 383 1051 gene locus_tag LOCUS_31400 gene pptT 383 1051 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414149.1 protein_id gnl|my_center|LOCUS_31400 1048 1974 gene locus_tag LOCUS_31410 gene truB 1048 1974 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728501.1 protein_id gnl|my_center|LOCUS_31410 2035 3495 gene locus_tag LOCUS_31420 2035 3495 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092091.1 protein_id gnl|my_center|LOCUS_31420 3531 4526 gene locus_tag LOCUS_31430 3531 4526 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728505.1 protein_id gnl|my_center|LOCUS_31430 4645 4914 gene locus_tag LOCUS_31440 gene rpsO 4645 4914 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894036.1 protein_id gnl|my_center|LOCUS_31440 5298 4963 gene locus_tag LOCUS_31450 5298 4963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 5219 7462 gene locus_tag LOCUS_31460 5219 7462 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728507.1 protein_id gnl|my_center|LOCUS_31460 >Feature sequence145 <1 1014 gene locus_tag LOCUS_31470 <1 1014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005080648.1:anti-sigma-D factor RsdA 1418 1011 gene locus_tag LOCUS_31480 1418 1011 CDS product DUF5319 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907700.1 protein_id gnl|my_center|LOCUS_31480 1481 3061 gene locus_tag LOCUS_31490 gene guaB 1481 3061 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727766.1 protein_id gnl|my_center|LOCUS_31490 3072 4220 gene locus_tag LOCUS_31500 3072 4220 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727767.1 protein_id gnl|my_center|LOCUS_31500 4247 5977 gene locus_tag LOCUS_31510 4247 5977 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893009.1 protein_id gnl|my_center|LOCUS_31510 5994 7547 gene locus_tag LOCUS_31520 gene guaA 5994 7547 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893015.1 protein_id gnl|my_center|LOCUS_31520 7656 8333 gene locus_tag LOCUS_31530 7656 8333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727777.1 protein_id gnl|my_center|LOCUS_31530 >Feature sequence146 672 1160 gene locus_tag LOCUS_31540 672 1160 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314356.1 protein_id gnl|my_center|LOCUS_31540 1924 1199 gene locus_tag LOCUS_31550 1924 1199 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_31550 2770 2051 gene locus_tag LOCUS_31560 2770 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898997.1 protein_id gnl|my_center|LOCUS_31560 3146 2856 gene locus_tag LOCUS_31570 3146 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 3389 4441 gene locus_tag LOCUS_31580 3389 4441 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941057.1 protein_id gnl|my_center|LOCUS_31580 4438 5082 gene locus_tag LOCUS_31590 4438 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 5132 5356 gene locus_tag LOCUS_31600 5132 5356 CDS product type II toxin-antitoxin system antitoxin MazE9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901465.1 protein_id gnl|my_center|LOCUS_31600 5343 5690 gene locus_tag LOCUS_31610 gene mazF9 5343 5690 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414166.1 protein_id gnl|my_center|LOCUS_31610 6506 5715 gene locus_tag LOCUS_31620 gene ppk2 6506 5715 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014894.1 protein_id gnl|my_center|LOCUS_31620 6660 7331 gene locus_tag LOCUS_31630 6660 7331 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064102.1 protein_id gnl|my_center|LOCUS_31630 7359 8384 gene locus_tag LOCUS_31640 7359 8384 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822893.1 protein_id gnl|my_center|LOCUS_31640 >Feature sequence147 2632 818 gene locus_tag LOCUS_31650 gene acsA 2632 818 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862102.1 protein_id gnl|my_center|LOCUS_31650 2900 2658 gene locus_tag LOCUS_31660 2900 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 3668 2994 gene locus_tag LOCUS_31670 3668 2994 CDS product GAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727149.1 protein_id gnl|my_center|LOCUS_31670 3978 3670 gene locus_tag LOCUS_31680 3978 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 5465 4080 gene locus_tag LOCUS_31690 5465 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 5816 8362 gene locus_tag LOCUS_31700 gene clpB 5816 8362 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727152.1 protein_id gnl|my_center|LOCUS_31700 >Feature sequence148 2 247 gene locus_tag LOCUS_31710 2 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 244 1224 gene locus_tag LOCUS_31720 244 1224 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943073.1 protein_id gnl|my_center|LOCUS_31720 1221 2453 gene locus_tag LOCUS_31730 1221 2453 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064873.1 protein_id gnl|my_center|LOCUS_31730 2466 2705 gene locus_tag LOCUS_31740 2466 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 3635 3537 gene locus_tag LOCUS_t00370 3635 3537 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 4097 3723 gene locus_tag LOCUS_31750 gene hspR 4097 3723 CDS product heat shock transcriptional regulator HspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401823.1 protein_id gnl|my_center|LOCUS_31750 5287 4094 gene locus_tag LOCUS_31760 gene dnaJ 5287 4094 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892137.1 protein_id gnl|my_center|LOCUS_31760 5985 5320 gene locus_tag LOCUS_31770 gene grpE 5985 5320 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401817.1 protein_id gnl|my_center|LOCUS_31770 7835 5982 gene locus_tag LOCUS_31780 gene dnaK 7835 5982 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892134.1 protein_id gnl|my_center|LOCUS_31780 >Feature sequence149 842 240 gene locus_tag LOCUS_31790 842 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 1507 4761 gene locus_tag LOCUS_31800 1507 4761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 4761 5477 gene locus_tag LOCUS_31810 4761 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 5470 6207 gene locus_tag LOCUS_31820 5470 6207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 6562 6843 gene locus_tag LOCUS_31830 6562 6843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 7381 6812 gene locus_tag LOCUS_31840 7381 6812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 8120 7470 gene locus_tag LOCUS_31850 8120 7470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 >Feature sequence150 177 617 gene locus_tag LOCUS_31860 177 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 735 650 gene locus_tag LOCUS_t00380 735 650 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 833 1324 gene locus_tag LOCUS_31870 833 1324 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727465.1 protein_id gnl|my_center|LOCUS_31870 1419 2933 gene locus_tag LOCUS_31880 1419 2933 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402981.1 protein_id gnl|my_center|LOCUS_31880 3044 4036 gene locus_tag LOCUS_31890 3044 4036 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727444.1 protein_id gnl|my_center|LOCUS_31890 4585 4043 gene locus_tag LOCUS_31900 4585 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 4748 5737 gene locus_tag LOCUS_31910 4748 5737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 6614 5751 gene locus_tag LOCUS_31920 gene htpX 6614 5751 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727439.1 protein_id gnl|my_center|LOCUS_31920 7673 6684 gene locus_tag LOCUS_31930 7673 6684 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519569.1 protein_id gnl|my_center|LOCUS_31930 >Feature sequence151 1997 1077 gene locus_tag LOCUS_31940 1997 1077 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964530.1 protein_id gnl|my_center|LOCUS_31940 2790 2149 gene locus_tag LOCUS_31950 2790 2149 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742110.1 protein_id gnl|my_center|LOCUS_31950 3648 2803 gene locus_tag LOCUS_31960 3648 2803 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730190.1 protein_id gnl|my_center|LOCUS_31960 4954 3773 gene locus_tag LOCUS_31970 4954 3773 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878184.1 protein_id gnl|my_center|LOCUS_31970 5036 5503 gene locus_tag LOCUS_31980 gene mce 5036 5503 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730193.1 protein_id gnl|my_center|LOCUS_31980 5770 5537 gene locus_tag LOCUS_31990 5770 5537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 6435 5770 gene locus_tag LOCUS_32000 gene nucS 6435 5770 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886111.1 protein_id gnl|my_center|LOCUS_32000 7373 7062 gene locus_tag LOCUS_32010 7373 7062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 7445 8116 gene locus_tag LOCUS_32020 7445 8116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32020 >Feature sequence152 1940 1572 gene locus_tag LOCUS_32030 1940 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 2111 3280 gene locus_tag LOCUS_32040 2111 3280 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728185.1 protein_id gnl|my_center|LOCUS_32040 3340 4566 gene locus_tag LOCUS_32050 3340 4566 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957570.1 protein_id gnl|my_center|LOCUS_32050 4671 5036 gene locus_tag LOCUS_32060 4671 5036 CDS product STAS/SEC14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081152.1 protein_id gnl|my_center|LOCUS_32060 5832 5080 gene locus_tag LOCUS_32070 5832 5080 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085165.1 protein_id gnl|my_center|LOCUS_32070 6492 6001 gene locus_tag LOCUS_32080 6492 6001 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467644.1 protein_id gnl|my_center|LOCUS_32080 7548 6502 gene locus_tag LOCUS_32090 7548 6502 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028994.1 protein_id gnl|my_center|LOCUS_32090 <8175 7545 gene locus_tag LOCUS_32100 <8175 7545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028995.1:ABC transporter permease subunit >Feature sequence153 <1 1022 gene locus_tag LOCUS_32110 <1 1022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124860.1:class I SAM-dependent DNA methyltransferase 1015 2265 gene locus_tag LOCUS_32120 1015 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 2265 3164 gene locus_tag LOCUS_32130 2265 3164 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838903.1 protein_id gnl|my_center|LOCUS_32130 3168 6290 gene locus_tag LOCUS_32140 3168 6290 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554541.1 protein_id gnl|my_center|LOCUS_32140 6332 6772 gene locus_tag LOCUS_32150 6332 6772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 6765 7565 gene locus_tag LOCUS_32160 6765 7565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 >Feature sequence154 1269 91 gene locus_tag LOCUS_32170 1269 91 CDS product FAD-binding domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898508.1 protein_id gnl|my_center|LOCUS_32170 2394 1321 gene locus_tag LOCUS_32180 2394 1321 CDS product ArsO family NAD(P)H-dependent flavin-containing monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043376805.1 protein_id gnl|my_center|LOCUS_32180 4177 2405 gene locus_tag LOCUS_32190 gene arsA 4177 2405 CDS product arsenite efflux transporter ATPase subunit ArsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817073.1 protein_id gnl|my_center|LOCUS_32190 4587 4192 gene locus_tag LOCUS_32200 gene arsD 4587 4192 CDS product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012540111.1 protein_id gnl|my_center|LOCUS_32200 5000 4587 gene locus_tag LOCUS_32210 5000 4587 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_32210 6091 5009 gene locus_tag LOCUS_32220 gene arsB 6091 5009 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112738.1 protein_id gnl|my_center|LOCUS_32220 6417 6088 gene locus_tag LOCUS_32230 6417 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 6665 7786 gene locus_tag LOCUS_32240 gene pstS 6665 7786 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112724.1 protein_id gnl|my_center|LOCUS_32240 >Feature sequence155 2511 229 gene locus_tag LOCUS_32250 gene ppsA 2511 229 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005629687.1 protein_id gnl|my_center|LOCUS_32250 4009 2531 gene locus_tag LOCUS_32260 4009 2531 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080367.1 protein_id gnl|my_center|LOCUS_32260 4135 5115 gene locus_tag LOCUS_32270 gene acg 4135 5115 CDS product FMN-binding protein Acg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410193.1 protein_id gnl|my_center|LOCUS_32270 5239 7236 gene locus_tag LOCUS_32280 5239 7236 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410178.1 protein_id gnl|my_center|LOCUS_32280 7242 7150 gene locus_tag LOCUS_t00390 7242 7150 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence156 778 1380 gene locus_tag LOCUS_32290 778 1380 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400935.1 protein_id gnl|my_center|LOCUS_32290 1494 2156 gene locus_tag LOCUS_32300 1494 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 2189 2512 gene locus_tag LOCUS_32310 2189 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 3026 2541 gene locus_tag LOCUS_32320 3026 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731319.1 protein_id gnl|my_center|LOCUS_32320 3096 4139 gene locus_tag LOCUS_32330 3096 4139 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730444.1 protein_id gnl|my_center|LOCUS_32330 4177 4905 gene locus_tag LOCUS_32340 4177 4905 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224546.1 protein_id gnl|my_center|LOCUS_32340 4905 5942 gene locus_tag LOCUS_32350 4905 5942 CDS product DUF4185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729758.1 protein_id gnl|my_center|LOCUS_32350 6620 6015 gene locus_tag LOCUS_32360 6620 6015 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400924.1 protein_id gnl|my_center|LOCUS_32360 7873 6644 gene locus_tag LOCUS_32370 7873 6644 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964004.1 protein_id gnl|my_center|LOCUS_32370 >Feature sequence157 1060 89 gene locus_tag LOCUS_32380 gene thrB 1060 89 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406654.1 protein_id gnl|my_center|LOCUS_32380 2181 1063 gene locus_tag LOCUS_32390 gene thrC 2181 1063 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730211.1 protein_id gnl|my_center|LOCUS_32390 3503 2178 gene locus_tag LOCUS_32400 3503 2178 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406648.1 protein_id gnl|my_center|LOCUS_32400 4918 3500 gene locus_tag LOCUS_32410 gene lysA 4918 3500 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730213.1 protein_id gnl|my_center|LOCUS_32410 6567 4915 gene locus_tag LOCUS_32420 gene argS 6567 4915 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730214.1 protein_id gnl|my_center|LOCUS_32420 6620 6694 gene locus_tag LOCUS_t00400 6620 6694 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7374 6697 gene locus_tag LOCUS_32430 7374 6697 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730225.1 protein_id gnl|my_center|LOCUS_32430 >Feature sequence158 1221 58 gene locus_tag LOCUS_32440 gene murG 1221 58 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729656.1 protein_id gnl|my_center|LOCUS_32440 2894 1218 gene locus_tag LOCUS_32450 gene ftsW 2894 1218 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049746059.1 protein_id gnl|my_center|LOCUS_32450 4398 2908 gene locus_tag LOCUS_32460 gene murD 4398 2908 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729658.1 protein_id gnl|my_center|LOCUS_32460 5461 4382 gene locus_tag LOCUS_32470 gene mraY 5461 4382 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411171.1 protein_id gnl|my_center|LOCUS_32470 6942 5458 gene locus_tag LOCUS_32480 6942 5458 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729659.1 protein_id gnl|my_center|LOCUS_32480 <7815 6939 gene locus_tag LOCUS_32490 <7815 6939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729660.1:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase >Feature sequence159 1745 1167 gene locus_tag LOCUS_32500 1745 1167 CDS product DUF4194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727561.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32500 3198 1756 gene locus_tag LOCUS_32510 3198 1756 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892661.1 protein_id gnl|my_center|LOCUS_32510 3699 3343 gene locus_tag LOCUS_32520 3699 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 3589 4266 gene locus_tag LOCUS_32530 3589 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 4263 4763 gene locus_tag LOCUS_32540 4263 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908994.1 protein_id gnl|my_center|LOCUS_32540 4891 4815 gene locus_tag LOCUS_t00410 4891 4815 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5010 5468 gene locus_tag LOCUS_32550 5010 5468 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013440.1 protein_id gnl|my_center|LOCUS_32550 5471 5818 gene locus_tag LOCUS_32560 5471 5818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857117.1 protein_id gnl|my_center|LOCUS_32560 6702 5911 gene locus_tag LOCUS_32570 6702 5911 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893143.1 protein_id gnl|my_center|LOCUS_32570 <7755 6722 gene locus_tag LOCUS_32580 <7755 6722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003414155.1:alpha/beta hydrolase family protein >Feature sequence160 1506 1006 gene locus_tag LOCUS_32590 gene nrdI 1506 1006 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415981.1 protein_id gnl|my_center|LOCUS_32590 1787 1533 gene locus_tag LOCUS_32600 1787 1533 CDS product redoxin NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056596.1 protein_id gnl|my_center|LOCUS_32600 1886 2197 gene locus_tag LOCUS_32610 1886 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 3056 2142 gene locus_tag LOCUS_32620 3056 2142 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415986.1 protein_id gnl|my_center|LOCUS_32620 3589 3014 gene locus_tag LOCUS_32630 3589 3014 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893657.1 protein_id gnl|my_center|LOCUS_32630 3772 5253 gene locus_tag LOCUS_32640 3772 5253 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893656.1 protein_id gnl|my_center|LOCUS_32640 5536 5267 gene locus_tag LOCUS_32650 5536 5267 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878317.1 protein_id gnl|my_center|LOCUS_32650 6406 5546 gene locus_tag LOCUS_32660 6406 5546 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730500.1 protein_id gnl|my_center|LOCUS_32660 6984 6406 gene locus_tag LOCUS_32670 6984 6406 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730499.1 protein_id gnl|my_center|LOCUS_32670 7132 7515 gene locus_tag LOCUS_32680 gene trxA 7132 7515 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861174.1 protein_id gnl|my_center|LOCUS_32680 >Feature sequence161 3223 683 gene locus_tag LOCUS_32690 3223 683 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104130.1 protein_id gnl|my_center|LOCUS_32690 3400 4293 gene locus_tag LOCUS_32700 3400 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 4677 4300 gene locus_tag LOCUS_32710 4677 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 5537 4674 gene locus_tag LOCUS_32720 gene mshB 5537 4674 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730335.1 protein_id gnl|my_center|LOCUS_32720 6486 5560 gene locus_tag LOCUS_32730 gene purU 6486 5560 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893574.1 protein_id gnl|my_center|LOCUS_32730 >Feature sequence162 1580 945 gene locus_tag LOCUS_32740 1580 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 1648 1881 gene locus_tag LOCUS_32750 1648 1881 CDS product antitoxin VapB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404898.1 protein_id gnl|my_center|LOCUS_32750 1878 2261 gene locus_tag LOCUS_32760 1878 2261 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404903.1 protein_id gnl|my_center|LOCUS_32760 2277 2492 gene locus_tag LOCUS_32770 2277 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 2599 3366 gene locus_tag LOCUS_32780 2599 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 3538 5715 gene locus_tag LOCUS_32790 3538 5715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 5746 5943 gene locus_tag LOCUS_32800 5746 5943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 6566 5940 gene locus_tag LOCUS_32810 6566 5940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 6814 6563 gene locus_tag LOCUS_32820 6814 6563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412936.1 protein_id gnl|my_center|LOCUS_32820 >Feature sequence163 174 989 gene locus_tag LOCUS_32830 174 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 989 2233 gene locus_tag LOCUS_32840 989 2233 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226953.1 protein_id gnl|my_center|LOCUS_32840 2687 2379 gene locus_tag LOCUS_32850 2687 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 3135 2830 gene locus_tag LOCUS_32860 3135 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 4158 3190 gene locus_tag LOCUS_32870 4158 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 4388 6829 gene locus_tag LOCUS_32880 gene atsD 4388 6829 CDS product arylsulfatase AtsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403397.1 protein_id gnl|my_center|LOCUS_32880 >Feature sequence164 1116 2651 gene locus_tag LOCUS_32890 1116 2651 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899485.1 protein_id gnl|my_center|LOCUS_32890 2923 2648 gene locus_tag LOCUS_32900 2923 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 3012 3779 gene locus_tag LOCUS_32910 3012 3779 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894024.1 protein_id gnl|my_center|LOCUS_32910 4860 3865 gene locus_tag LOCUS_32920 4860 3865 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728486.1 protein_id gnl|my_center|LOCUS_32920 5338 4835 gene locus_tag LOCUS_32930 gene rbfA 5338 4835 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728485.1 protein_id gnl|my_center|LOCUS_32930 7207 5375 gene locus_tag LOCUS_32940 7207 5375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 >Feature sequence165 1828 812 gene locus_tag LOCUS_32950 1828 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 1969 4704 gene locus_tag LOCUS_32960 1969 4704 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228256.1 protein_id gnl|my_center|LOCUS_32960 6448 4751 gene locus_tag LOCUS_32970 6448 4751 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056556.1 protein_id gnl|my_center|LOCUS_32970 6570 6755 gene locus_tag LOCUS_32980 6570 6755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 >Feature sequence166 1004 243 gene locus_tag LOCUS_32990 1004 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 1108 2022 gene locus_tag LOCUS_33000 1108 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 3130 2030 gene locus_tag LOCUS_33010 3130 2030 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015009.1 protein_id gnl|my_center|LOCUS_33010 3752 3132 gene locus_tag LOCUS_33020 3752 3132 CDS product dithiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250214.1 protein_id gnl|my_center|LOCUS_33020 6820 3827 gene locus_tag LOCUS_33030 6820 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 >Feature sequence167 222 1697 gene locus_tag LOCUS_33040 222 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731144.1 protein_id gnl|my_center|LOCUS_33040 2443 1724 gene locus_tag LOCUS_33050 2443 1724 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419812.1 protein_id gnl|my_center|LOCUS_33050 2829 2473 gene locus_tag LOCUS_33060 2829 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 2947 3234 gene locus_tag LOCUS_33070 2947 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 3463 4734 gene locus_tag LOCUS_33080 3463 4734 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022265.1 protein_id gnl|my_center|LOCUS_33080 6100 4958 gene locus_tag LOCUS_33090 6100 4958 CDS product DUF4185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197492484.1 protein_id gnl|my_center|LOCUS_33090 7146 6106 gene locus_tag LOCUS_33100 7146 6106 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731165.1 protein_id gnl|my_center|LOCUS_33100 >Feature sequence168 19 1248 gene locus_tag LOCUS_33110 gene tgt 19 1248 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897733.1 protein_id gnl|my_center|LOCUS_33110 2712 1381 gene locus_tag LOCUS_33120 2712 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 4798 2705 gene locus_tag LOCUS_33130 4798 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 4855 5601 gene locus_tag LOCUS_33140 4855 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 5625 6839 gene locus_tag LOCUS_33150 5625 6839 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104331.1 protein_id gnl|my_center|LOCUS_33150 >Feature sequence169 <1 1361 gene locus_tag LOCUS_33160 <1 1361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730437.1:alpha/beta-hydrolase family protein 1370 2746 gene locus_tag LOCUS_33170 1370 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 2801 3766 gene locus_tag LOCUS_33180 2801 3766 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519616.1 protein_id gnl|my_center|LOCUS_33180 4631 3693 gene locus_tag LOCUS_33190 4631 3693 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405636.1 protein_id gnl|my_center|LOCUS_33190 5107 4637 gene locus_tag LOCUS_33200 5107 4637 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405633.1 protein_id gnl|my_center|LOCUS_33200 6181 5117 gene locus_tag LOCUS_33210 6181 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405629.1 protein_id gnl|my_center|LOCUS_33210 >Feature sequence170 1183 611 gene locus_tag LOCUS_33220 1183 611 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401168.1 protein_id gnl|my_center|LOCUS_33220 1412 1215 gene locus_tag LOCUS_33230 1412 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 1529 1984 gene locus_tag LOCUS_33240 1529 1984 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070911733.1 protein_id gnl|my_center|LOCUS_33240 4320 1981 gene locus_tag LOCUS_33250 4320 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 4370 4831 gene locus_tag LOCUS_33260 4370 4831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 6285 4813 gene locus_tag LOCUS_33270 6285 4813 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891663.1 protein_id gnl|my_center|LOCUS_33270 <7081 6326 gene locus_tag LOCUS_33280 <7081 6326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003401240.1:class I SAM-dependent methyltransferase >Feature sequence171 <1 2662 gene locus_tag LOCUS_33290 <1 2662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921307.1:lipocalin family protein 3062 6559 gene locus_tag LOCUS_33300 3062 6559 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296696.1 protein_id gnl|my_center|LOCUS_33300 >Feature sequence172 167 2329 gene locus_tag LOCUS_33310 167 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 3278 2376 gene locus_tag LOCUS_33320 3278 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 3429 3343 gene locus_tag LOCUS_t00420 3429 3343 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3629 4927 gene locus_tag LOCUS_33330 3629 4927 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899653.1 protein_id gnl|my_center|LOCUS_33330 4937 6820 gene locus_tag LOCUS_33340 4937 6820 CDS product DNA polymerase III subunits gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731177.1 protein_id gnl|my_center|LOCUS_33340 >Feature sequence173 247 56 gene locus_tag LOCUS_33350 247 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 370 702 gene locus_tag LOCUS_33360 370 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 699 1010 gene locus_tag LOCUS_33370 699 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 1491 1048 gene locus_tag LOCUS_33380 1491 1048 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406060.1 protein_id gnl|my_center|LOCUS_33380 1533 2357 gene locus_tag LOCUS_33390 1533 2357 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731439.1 protein_id gnl|my_center|LOCUS_33390 2728 2360 gene locus_tag LOCUS_33400 2728 2360 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730360.1 protein_id gnl|my_center|LOCUS_33400 2740 3459 gene locus_tag LOCUS_33410 gene cobB 2740 3459 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406044.1 protein_id gnl|my_center|LOCUS_33410 4102 3470 gene locus_tag LOCUS_33420 4102 3470 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405982.1 protein_id gnl|my_center|LOCUS_33420 6363 4099 gene locus_tag LOCUS_33430 6363 4099 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405970.1 protein_id gnl|my_center|LOCUS_33430 6534 6665 gene locus_tag LOCUS_33440 6534 6665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730366.1 protein_id gnl|my_center|LOCUS_33440 >Feature sequence174 583 2586 gene locus_tag LOCUS_33450 583 2586 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181825004.1 protein_id gnl|my_center|LOCUS_33450 2583 3773 gene locus_tag LOCUS_33460 2583 3773 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900550.1 protein_id gnl|my_center|LOCUS_33460 3893 5212 gene locus_tag LOCUS_33470 gene nhaA 3893 5212 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081951.1 protein_id gnl|my_center|LOCUS_33470 >Feature sequence175 77 310 gene locus_tag LOCUS_33480 77 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894966.1 protein_id gnl|my_center|LOCUS_33480 1242 328 gene locus_tag LOCUS_33490 1242 328 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727159.1 protein_id gnl|my_center|LOCUS_33490 1335 2984 gene locus_tag LOCUS_33500 1335 2984 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729261.1 protein_id gnl|my_center|LOCUS_33500 4570 2942 gene locus_tag LOCUS_33510 4570 2942 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112854.1 protein_id gnl|my_center|LOCUS_33510 4637 6208 gene locus_tag LOCUS_33520 4637 6208 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_33520 6227 6619 gene locus_tag LOCUS_33530 6227 6619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408775.1 protein_id gnl|my_center|LOCUS_33530 >Feature sequence176 <1 1110 gene locus_tag LOCUS_33540 <1 1110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730394.1:redox-regulated ATPase YchF 1123 1809 gene locus_tag LOCUS_33550 1123 1809 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729362.1 protein_id gnl|my_center|LOCUS_33550 2725 1883 gene locus_tag LOCUS_33560 2725 1883 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730384.1 protein_id gnl|my_center|LOCUS_33560 2840 3427 gene locus_tag LOCUS_33570 2840 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726872.1 protein_id gnl|my_center|LOCUS_33570 3424 3915 gene locus_tag LOCUS_33580 3424 3915 CDS product Mce associated membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899110.1 protein_id gnl|my_center|LOCUS_33580 3942 4826 gene locus_tag LOCUS_33590 3942 4826 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405888.1 protein_id gnl|my_center|LOCUS_33590 5609 4833 gene locus_tag LOCUS_33600 5609 4833 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083383.1 protein_id gnl|my_center|LOCUS_33600 >Feature sequence177 <1 668 gene locus_tag LOCUS_33610 <1 668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003412957.1:DUF1906 domain-containing protein >Feature sequence178 1183 599 gene locus_tag LOCUS_33620 1183 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 1343 2578 gene locus_tag LOCUS_33630 1343 2578 CDS product mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217160422.1 protein_id gnl|my_center|LOCUS_33630 2807 2523 gene locus_tag LOCUS_33640 2807 2523 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730347.1 protein_id gnl|my_center|LOCUS_33640 2834 3235 gene locus_tag LOCUS_33650 2834 3235 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896546.1 protein_id gnl|my_center|LOCUS_33650 3279 5192 gene locus_tag LOCUS_33660 gene typA 3279 5192 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066672.1 protein_id gnl|my_center|LOCUS_33660 >Feature sequence179 <1 926 gene locus_tag LOCUS_33670 <1 926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224442.1:amidohydrolase 2316 940 gene locus_tag LOCUS_33680 2316 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 2482 4242 gene locus_tag LOCUS_33690 2482 4242 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898774.1 protein_id gnl|my_center|LOCUS_33690 4239 5759 gene locus_tag LOCUS_33700 4239 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 >Feature sequence180 2756 1848 gene locus_tag LOCUS_33710 2756 1848 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891444.1 protein_id gnl|my_center|LOCUS_33710 2658 2909 gene locus_tag LOCUS_33720 2658 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 3352 2906 gene locus_tag LOCUS_33730 3352 2906 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895256.1 protein_id gnl|my_center|LOCUS_33730 3768 3553 gene locus_tag LOCUS_33740 3768 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 3650 5098 gene locus_tag LOCUS_33750 3650 5098 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408080.1 protein_id gnl|my_center|LOCUS_33750 5974 5123 gene locus_tag LOCUS_33760 gene ldtMt3 5974 5123 CDS product L,D-transpeptidase LdtMt3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407384.1 protein_id gnl|my_center|LOCUS_33760 6286 6017 gene locus_tag LOCUS_33770 6286 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 >Feature sequence181 1 495 gene locus_tag LOCUS_33780 1 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 492 1205 gene locus_tag LOCUS_33790 492 1205 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731174.1 protein_id gnl|my_center|LOCUS_33790 1299 2291 gene locus_tag LOCUS_33800 1299 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 2899 2288 gene locus_tag LOCUS_33810 gene recR 2899 2288 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897699.1 protein_id gnl|my_center|LOCUS_33810 3289 2903 gene locus_tag LOCUS_33820 3289 2903 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104589.1 protein_id gnl|my_center|LOCUS_33820 3288 4154 gene locus_tag LOCUS_33830 3288 4154 CDS product Rv3717 family N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731175.1 protein_id gnl|my_center|LOCUS_33830 4606 4166 gene locus_tag LOCUS_33840 4606 4166 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899651.1 protein_id gnl|my_center|LOCUS_33840 4673 6037 gene locus_tag LOCUS_33850 4673 6037 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731176.1 protein_id gnl|my_center|LOCUS_33850 >Feature sequence182 354 617 gene locus_tag LOCUS_33860 354 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 614 997 gene locus_tag LOCUS_33870 614 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 1231 998 gene locus_tag LOCUS_33880 1231 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 1654 2499 gene locus_tag LOCUS_33890 1654 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 3242 2496 gene locus_tag LOCUS_33900 3242 2496 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091624.1 protein_id gnl|my_center|LOCUS_33900 3290 3862 gene locus_tag LOCUS_33910 3290 3862 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408030.1 protein_id gnl|my_center|LOCUS_33910 3947 4837 gene locus_tag LOCUS_33920 3947 4837 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894906.1 protein_id gnl|my_center|LOCUS_33920 <6225 4839 gene locus_tag LOCUS_33930 <6225 4839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004266392.1:lysozyme inhibitor LprI family protein >Feature sequence183 <1 1726 gene locus_tag LOCUS_33940 <1 1726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003900013.1:phosphatidylinositol-3-phosphatase 2534 1737 gene locus_tag LOCUS_33950 gene hdhA 2534 1737 CDS product 7-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483362.1 protein_id gnl|my_center|LOCUS_33950 3316 2546 gene locus_tag LOCUS_33960 gene hdhA 3316 2546 CDS product 7-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483362.1 protein_id gnl|my_center|LOCUS_33960 3397 4251 gene locus_tag LOCUS_33970 3397 4251 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729274.1 protein_id gnl|my_center|LOCUS_33970 4248 4706 gene locus_tag LOCUS_33980 4248 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 4760 5311 gene locus_tag LOCUS_33990 4760 5311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401751.1 protein_id gnl|my_center|LOCUS_33990 >Feature sequence184 353 1183 gene locus_tag LOCUS_34000 353 1183 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730414.1 protein_id gnl|my_center|LOCUS_34000 1270 2589 gene locus_tag LOCUS_34010 1270 2589 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730413.1 protein_id gnl|my_center|LOCUS_34010 2619 3470 gene locus_tag LOCUS_34020 2619 3470 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898725.1 protein_id gnl|my_center|LOCUS_34020 3482 4693 gene locus_tag LOCUS_34030 3482 4693 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705373.1 protein_id gnl|my_center|LOCUS_34030 <6071 4690 gene locus_tag LOCUS_34040 <6071 4690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730408.1:class II fumarate hydratase >Feature sequence185 <1 1525 gene locus_tag LOCUS_34050 <1 1525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230224.1:RICIN domain-containing protein 1552 1746 gene locus_tag LOCUS_34060 1552 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 2014 2460 gene locus_tag LOCUS_34070 2014 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 3150 2881 gene locus_tag LOCUS_34080 3150 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 3312 4622 gene locus_tag LOCUS_34090 3312 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 >Feature sequence186 1527 613 gene locus_tag LOCUS_34100 1527 613 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727248.1 protein_id gnl|my_center|LOCUS_34100 1542 2372 gene locus_tag LOCUS_34110 1542 2372 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892291.1 protein_id gnl|my_center|LOCUS_34110 4049 2361 gene locus_tag LOCUS_34120 4049 2361 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727251.1 protein_id gnl|my_center|LOCUS_34120 4196 5932 gene locus_tag LOCUS_34130 gene groL 4196 5932 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064866.1 protein_id gnl|my_center|LOCUS_34130 >Feature sequence187 937 617 gene locus_tag LOCUS_34140 937 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 1205 1020 gene locus_tag LOCUS_34150 1205 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 1461 1973 gene locus_tag LOCUS_34160 1461 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 3746 1977 gene locus_tag LOCUS_34170 3746 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419613.1 protein_id gnl|my_center|LOCUS_34170 4298 3960 gene locus_tag LOCUS_34180 4298 3960 CDS product DUF2304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419590.1 protein_id gnl|my_center|LOCUS_34180 4999 4295 gene locus_tag LOCUS_34190 4999 4295 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907598.1 protein_id gnl|my_center|LOCUS_34190 >Feature sequence188 <1 604 gene locus_tag LOCUS_34200 <1 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_167379699.1:haloalkane dehalogenase 817 1080 gene locus_tag LOCUS_34210 817 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 1083 1439 gene locus_tag LOCUS_34220 1083 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 2191 1475 gene locus_tag LOCUS_34230 2191 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 2661 2230 gene locus_tag LOCUS_34240 2661 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 2755 3429 gene locus_tag LOCUS_34250 2755 3429 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257831.1 protein_id gnl|my_center|LOCUS_34250 3898 3497 gene locus_tag LOCUS_34260 3898 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 4054 4437 gene locus_tag LOCUS_34270 4054 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 5153 4482 gene locus_tag LOCUS_34280 5153 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 <5841 5167 gene locus_tag LOCUS_34290 <5841 5167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028998.1:CDP-alcohol phosphatidyltransferase family protein >Feature sequence189 790 503 gene locus_tag LOCUS_34300 790 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 3257 903 gene locus_tag LOCUS_34310 3257 903 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052049378.1 protein_id gnl|my_center|LOCUS_34310 4705 3257 gene locus_tag LOCUS_34320 4705 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 5607 4702 gene locus_tag LOCUS_34330 5607 4702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 >Feature sequence190 160 471 gene locus_tag LOCUS_34340 160 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 692 405 gene locus_tag LOCUS_34350 692 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34350 1391 714 gene locus_tag LOCUS_34360 1391 714 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086746.1 protein_id gnl|my_center|LOCUS_34360 1761 1381 gene locus_tag LOCUS_34370 1761 1381 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112726.1 protein_id gnl|my_center|LOCUS_34370 2133 1879 gene locus_tag LOCUS_34380 2133 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 2909 2214 gene locus_tag LOCUS_34390 2909 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34390 3228 3611 gene locus_tag LOCUS_34400 3228 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 3695 5503 gene locus_tag LOCUS_34410 3695 5503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 >Feature sequence191 <1 1111 gene locus_tag LOCUS_34420 <1 1111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005112119.1:MinD/ParA family protein 1132 2682 gene locus_tag LOCUS_34430 gene eccD1 1132 2682 CDS product type VII secretion system ESX-1 subunit EccD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399976.1 protein_id gnl|my_center|LOCUS_34430 2679 4103 gene locus_tag LOCUS_34440 gene mycP1 2679 4103 CDS product type VII secretion system ESX-1 serine protease mycosin MycP1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726654.1 protein_id gnl|my_center|LOCUS_34440 >Feature sequence192 <1 3618 gene locus_tag LOCUS_34450 <1 3618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003403413.1:DNA-directed RNA polymerase subunit beta' 3758 4639 gene locus_tag LOCUS_34460 3758 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041179691.1 protein_id gnl|my_center|LOCUS_34460 4752 5501 gene locus_tag LOCUS_34470 4752 5501 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727639.1 protein_id gnl|my_center|LOCUS_34470 >Feature sequence193 <1 622 gene locus_tag LOCUS_34480 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003413352.1:membrane protein 1525 644 gene locus_tag LOCUS_34490 1525 644 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899384.1 protein_id gnl|my_center|LOCUS_34490 1707 3482 gene locus_tag LOCUS_34500 gene aspS 1707 3482 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899382.1 protein_id gnl|my_center|LOCUS_34500 3499 4851 gene locus_tag LOCUS_34510 3499 4851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730045.1 protein_id gnl|my_center|LOCUS_34510 5122 4862 gene locus_tag LOCUS_34520 5122 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 5561 5184 gene locus_tag LOCUS_34530 5561 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 5467 5661 gene locus_tag LOCUS_34540 5467 5661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 >Feature sequence194 101 961 gene locus_tag LOCUS_34550 101 961 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640484.1 protein_id gnl|my_center|LOCUS_34550 2407 983 gene locus_tag LOCUS_34560 2407 983 CDS product PE-PPE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115316754.1 protein_id gnl|my_center|LOCUS_34560 3235 2585 gene locus_tag LOCUS_34570 3235 2585 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060503.1 protein_id gnl|my_center|LOCUS_34570 3415 3810 gene locus_tag LOCUS_34580 3415 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 4450 3818 gene locus_tag LOCUS_34590 4450 3818 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920406.1 protein_id gnl|my_center|LOCUS_34590 4534 5313 gene locus_tag LOCUS_34600 4534 5313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 >Feature sequence195 3634 893 gene locus_tag LOCUS_34610 gene cphA 3634 893 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021315.1 protein_id gnl|my_center|LOCUS_34610 4943 3930 gene locus_tag LOCUS_34620 4943 3930 CDS product glycoside hydrolase family 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400562.1 protein_id gnl|my_center|LOCUS_34620 5637 5050 gene locus_tag LOCUS_34630 5637 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 >Feature sequence196 1917 49 gene locus_tag LOCUS_34640 1917 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 2336 2052 gene locus_tag LOCUS_34650 2336 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 3154 2333 gene locus_tag LOCUS_34660 3154 2333 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228058.1 protein_id gnl|my_center|LOCUS_34660 3576 3265 gene locus_tag LOCUS_34670 3576 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 3787 3563 gene locus_tag LOCUS_34680 3787 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 3855 4373 gene locus_tag LOCUS_34690 3855 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 >Feature sequence197 3145 2663 gene locus_tag LOCUS_34700 gene rraA 3145 2663 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399786.1 protein_id gnl|my_center|LOCUS_34700 3590 3150 gene locus_tag LOCUS_34710 3590 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 4173 3670 gene locus_tag LOCUS_34720 4173 3670 CDS product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897849.1 protein_id gnl|my_center|LOCUS_34720 4829 4173 gene locus_tag LOCUS_34730 4829 4173 CDS product DUF6474 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897846.1 protein_id gnl|my_center|LOCUS_34730 >Feature sequence198 1603 239 gene locus_tag LOCUS_34740 1603 239 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728041.1 protein_id gnl|my_center|LOCUS_34740 1637 2659 gene locus_tag LOCUS_34750 1637 2659 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893338.1 protein_id gnl|my_center|LOCUS_34750 >Feature sequence199 1060 1503 gene locus_tag LOCUS_34760 1060 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 1475 2347 gene locus_tag LOCUS_34770 1475 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 2347 2547 gene locus_tag LOCUS_34780 2347 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 2550 2870 gene locus_tag LOCUS_34790 2550 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 4215 2953 gene locus_tag LOCUS_34800 4215 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 4829 4338 gene locus_tag LOCUS_34810 4829 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 5390 4935 gene locus_tag LOCUS_34820 5390 4935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 >Feature sequence200 883 1914 gene locus_tag LOCUS_34830 883 1914 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031610.1 protein_id gnl|my_center|LOCUS_34830 1920 3215 gene locus_tag LOCUS_34840 1920 3215 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400917.1 protein_id gnl|my_center|LOCUS_34840 3613 3212 gene locus_tag LOCUS_34850 3613 3212 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409913.1 protein_id gnl|my_center|LOCUS_34850 3886 3617 gene locus_tag LOCUS_34860 3886 3617 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899100.1 protein_id gnl|my_center|LOCUS_34860 4747 3920 gene locus_tag LOCUS_34870 4747 3920 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728361.1 protein_id gnl|my_center|LOCUS_34870 <5385 4744 gene locus_tag LOCUS_34880 <5385 4744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728360.1:CoA transferase >Feature sequence201 9 3788 gene locus_tag LOCUS_34890 9 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 4107 4487 gene locus_tag LOCUS_34900 4107 4487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 4622 5242 gene locus_tag LOCUS_34910 4622 5242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 >Feature sequence202 1241 276 gene locus_tag LOCUS_34920 1241 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 1807 1238 gene locus_tag LOCUS_34930 1807 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 1806 2351 gene locus_tag LOCUS_34940 1806 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 2443 2706 gene locus_tag LOCUS_34950 2443 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 3565 2711 gene locus_tag LOCUS_34960 3565 2711 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411722.1 protein_id gnl|my_center|LOCUS_34960 4230 3562 gene locus_tag LOCUS_34970 4230 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 5013 4249 gene locus_tag LOCUS_34980 5013 4249 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104317.1 protein_id gnl|my_center|LOCUS_34980 >Feature sequence203 1468 425 gene locus_tag LOCUS_34990 1468 425 CDS product TIGR03857 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877342.1 protein_id gnl|my_center|LOCUS_34990 3654 1465 gene locus_tag LOCUS_35000 3654 1465 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039318110.1 protein_id gnl|my_center|LOCUS_35000 4847 3651 gene locus_tag LOCUS_35010 4847 3651 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728223.1 protein_id gnl|my_center|LOCUS_35010 >Feature sequence204 206 688 gene locus_tag LOCUS_35020 206 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 731 1699 gene locus_tag LOCUS_35030 731 1699 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730776.1 protein_id gnl|my_center|LOCUS_35030 1795 1720 gene locus_tag LOCUS_t00430 1795 1720 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1916 1989 gene locus_tag LOCUS_t00440 1916 1989 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2022 2096 gene locus_tag LOCUS_t00450 2022 2096 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2140 2216 gene locus_tag LOCUS_t00460 2140 2216 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3428 2256 gene locus_tag LOCUS_35040 3428 2256 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728221.1 protein_id gnl|my_center|LOCUS_35040 3480 4220 gene locus_tag LOCUS_35050 gene fabG 3480 4220 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051065148.1 protein_id gnl|my_center|LOCUS_35050 >Feature sequence205 439 1329 gene locus_tag LOCUS_35060 439 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 2086 1367 gene locus_tag LOCUS_35070 2086 1367 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919378.1 protein_id gnl|my_center|LOCUS_35070 2628 2212 gene locus_tag LOCUS_35080 2628 2212 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222283.1 protein_id gnl|my_center|LOCUS_35080 2986 2621 gene locus_tag LOCUS_35090 2986 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 4138 3527 gene locus_tag LOCUS_35100 4138 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 4429 4148 gene locus_tag LOCUS_35110 4429 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 4976 4536 gene locus_tag LOCUS_35120 4976 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 >Feature sequence206 182 1177 gene locus_tag LOCUS_35130 182 1177 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897193.1 protein_id gnl|my_center|LOCUS_35130 1267 2352 gene locus_tag LOCUS_35140 gene dusB 1267 2352 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104395.1 protein_id gnl|my_center|LOCUS_35140 2387 4489 gene locus_tag LOCUS_35150 2387 4489 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049744866.1 protein_id gnl|my_center|LOCUS_35150 >Feature sequence207 2670 1465 gene locus_tag LOCUS_35160 2670 1465 CDS product DUF3068 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891671.1 protein_id gnl|my_center|LOCUS_35160 2930 4123 gene locus_tag LOCUS_35170 2930 4123 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070945485.1 protein_id gnl|my_center|LOCUS_35170 <5088 4089 gene locus_tag LOCUS_35180 <5088 4089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003891673.1:AMP-binding protein >Feature sequence208 1046 2416 gene locus_tag LOCUS_35190 1046 2416 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903691.1 protein_id gnl|my_center|LOCUS_35190 3440 2421 gene locus_tag LOCUS_35200 3440 2421 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731304.1 protein_id gnl|my_center|LOCUS_35200 3943 3437 gene locus_tag LOCUS_35210 3943 3437 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897886.1 protein_id gnl|my_center|LOCUS_35210 >Feature sequence209 1726 953 gene locus_tag LOCUS_35220 1726 953 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727171.1 protein_id gnl|my_center|LOCUS_35220 1752 3113 gene locus_tag LOCUS_35230 1752 3113 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950925.1 protein_id gnl|my_center|LOCUS_35230 3759 3133 gene locus_tag LOCUS_35240 3759 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401831.1 protein_id gnl|my_center|LOCUS_35240 >Feature sequence210 306 1619 gene locus_tag LOCUS_35250 306 1619 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510669.1 protein_id gnl|my_center|LOCUS_35250 3133 1625 gene locus_tag LOCUS_35260 gene purF 3133 1625 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730800.1 protein_id gnl|my_center|LOCUS_35260 3611 3213 gene locus_tag LOCUS_35270 3611 3213 CDS product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404127.1 protein_id gnl|my_center|LOCUS_35270 4249 3608 gene locus_tag LOCUS_35280 4249 3608 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404117.1 protein_id gnl|my_center|LOCUS_35280 <5049 4246 gene locus_tag LOCUS_35290 <5049 4246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730823.1:alpha/beta hydrolase >Feature sequence211 88 1362 gene locus_tag LOCUS_35300 88 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 1426 1872 gene locus_tag LOCUS_35310 1426 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 1997 2458 gene locus_tag LOCUS_35320 1997 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 2780 4465 gene locus_tag LOCUS_35330 2780 4465 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074412.1 protein_id gnl|my_center|LOCUS_35330 4939 4547 gene locus_tag LOCUS_35340 4939 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 >Feature sequence212 <1 778 gene locus_tag LOCUS_35350 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729208.1:alanine and proline-rich secreted protein Apa 859 1191 gene locus_tag LOCUS_35360 859 1191 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895070.1 protein_id gnl|my_center|LOCUS_35360 1207 2208 gene locus_tag LOCUS_35370 1207 2208 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409345.1 protein_id gnl|my_center|LOCUS_35370 2977 2213 gene locus_tag LOCUS_35380 2977 2213 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877763.1 protein_id gnl|my_center|LOCUS_35380 >Feature sequence213 <1 554 gene locus_tag LOCUS_35390 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003895328.1:precorrin-4 C(11)-methyltransferase 554 1282 gene locus_tag LOCUS_35400 554 1282 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900455.1 protein_id gnl|my_center|LOCUS_35400 2733 1270 gene locus_tag LOCUS_35410 2733 1270 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895324.1 protein_id gnl|my_center|LOCUS_35410 3379 2744 gene locus_tag LOCUS_35420 3379 2744 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080079.1 protein_id gnl|my_center|LOCUS_35420 4497 3376 gene locus_tag LOCUS_35430 gene cobG 4497 3376 CDS product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729385.1 protein_id gnl|my_center|LOCUS_35430 >Feature sequence214 632 790 gene locus_tag LOCUS_35440 632 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 978 1601 gene locus_tag LOCUS_35450 978 1601 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731275.1 protein_id gnl|my_center|LOCUS_35450 1729 2325 gene locus_tag LOCUS_35460 1729 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899730.1 protein_id gnl|my_center|LOCUS_35460 2697 3095 gene locus_tag LOCUS_35470 2697 3095 CDS product secretion protein EspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897840.1 protein_id gnl|my_center|LOCUS_35470 4218 3100 gene locus_tag LOCUS_35480 4218 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104341.1 protein_id gnl|my_center|LOCUS_35480 4706 4215 gene locus_tag LOCUS_35490 4706 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878644.1 protein_id gnl|my_center|LOCUS_35490 >Feature sequence215 4443 2551 gene locus_tag LOCUS_35500 4443 2551 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727124.1 protein_id gnl|my_center|LOCUS_35500 >Feature sequence216 463 89 gene locus_tag LOCUS_35510 463 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 565 1392 gene locus_tag LOCUS_35520 565 1392 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730283.1 protein_id gnl|my_center|LOCUS_35520 2260 1418 gene locus_tag LOCUS_35530 2260 1418 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900301.1 protein_id gnl|my_center|LOCUS_35530 3444 2275 gene locus_tag LOCUS_35540 3444 2275 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878221.1 protein_id gnl|my_center|LOCUS_35540 3516 4619 gene locus_tag LOCUS_35550 gene corA 3516 4619 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730286.1 protein_id gnl|my_center|LOCUS_35550 4826 4626 gene locus_tag LOCUS_35560 4826 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 >Feature sequence217 1104 643 gene locus_tag LOCUS_35570 gene rplI 1104 643 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400543.1 protein_id gnl|my_center|LOCUS_35570 1397 1134 gene locus_tag LOCUS_35580 gene rpsR 1397 1134 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898319.1 protein_id gnl|my_center|LOCUS_35580 1963 1448 gene locus_tag LOCUS_35590 1963 1448 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400534.1 protein_id gnl|my_center|LOCUS_35590 2345 2055 gene locus_tag LOCUS_35600 gene rpsF 2345 2055 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898321.1 protein_id gnl|my_center|LOCUS_35600 3097 2459 gene locus_tag LOCUS_35610 3097 2459 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400517.1 protein_id gnl|my_center|LOCUS_35610 4661 3066 gene locus_tag LOCUS_35620 4661 3066 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400514.1 protein_id gnl|my_center|LOCUS_35620 >Feature sequence218 635 210 gene locus_tag LOCUS_35630 635 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 783 2048 gene locus_tag LOCUS_35640 783 2048 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892107.1 protein_id gnl|my_center|LOCUS_35640 2052 3308 gene locus_tag LOCUS_35650 2052 3308 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727121.1 protein_id gnl|my_center|LOCUS_35650 4125 3259 gene locus_tag LOCUS_35660 gene rfbA 4125 3259 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726901.1 protein_id gnl|my_center|LOCUS_35660 4509 4135 gene locus_tag LOCUS_35670 4509 4135 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401666.1 protein_id gnl|my_center|LOCUS_35670 >Feature sequence219 740 297 gene locus_tag LOCUS_35680 740 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401613.1 protein_id gnl|my_center|LOCUS_35680 2046 811 gene locus_tag LOCUS_35690 2046 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898398.1 protein_id gnl|my_center|LOCUS_35690 2087 2560 gene locus_tag LOCUS_35700 2087 2560 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727083.1 protein_id gnl|my_center|LOCUS_35700 3253 2561 gene locus_tag LOCUS_35710 3253 2561 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876820.1 protein_id gnl|my_center|LOCUS_35710 >Feature sequence220 328 119 gene locus_tag LOCUS_35720 328 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 1032 325 gene locus_tag LOCUS_35730 1032 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35730 1370 1029 gene locus_tag LOCUS_35740 1370 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 1712 2800 gene locus_tag LOCUS_35750 1712 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 4656 2797 gene locus_tag LOCUS_35760 4656 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 >Feature sequence221 <1 745 gene locus_tag LOCUS_35770 <1 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064987376.1:IS1380 family transposase 1094 1558 gene locus_tag LOCUS_35780 1094 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 1632 2822 gene locus_tag LOCUS_35790 1632 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 2819 4003 gene locus_tag LOCUS_35800 2819 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 4255 4602 gene locus_tag LOCUS_35810 4255 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 >Feature sequence222 313 1458 gene locus_tag LOCUS_35820 313 1458 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731141.1 protein_id gnl|my_center|LOCUS_35820 3136 1472 gene locus_tag LOCUS_35830 3136 1472 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082715.1 protein_id gnl|my_center|LOCUS_35830 3475 3173 gene locus_tag LOCUS_35840 3475 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 3702 3472 gene locus_tag LOCUS_35850 3702 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 3809 4249 gene locus_tag LOCUS_35860 3809 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408538.1 protein_id gnl|my_center|LOCUS_35860 >Feature sequence223 969 85 gene locus_tag LOCUS_35870 969 85 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404139.1 protein_id gnl|my_center|LOCUS_35870 1053 2084 gene locus_tag LOCUS_35880 1053 2084 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730797.1 protein_id gnl|my_center|LOCUS_35880 2249 2431 gene locus_tag LOCUS_35890 2249 2431 CDS product DUF3073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730798.1 protein_id gnl|my_center|LOCUS_35890 3554 2466 gene locus_tag LOCUS_35900 gene purM 3554 2466 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897216.1 protein_id gnl|my_center|LOCUS_35900 4314 3688 gene locus_tag LOCUS_35910 4314 3688 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224341.1 protein_id gnl|my_center|LOCUS_35910 >Feature sequence224 <1 568 gene locus_tag LOCUS_35920 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_203086395.1:FAD-dependent monooxygenase 1514 633 gene locus_tag LOCUS_35930 1514 633 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211155436.1 protein_id gnl|my_center|LOCUS_35930 1671 2396 gene locus_tag LOCUS_35940 1671 2396 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227486.1 protein_id gnl|my_center|LOCUS_35940 2774 3067 gene locus_tag LOCUS_35950 2774 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 3058 4170 gene locus_tag LOCUS_35960 3058 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 >Feature sequence225 334 789 gene locus_tag LOCUS_35970 334 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225797.1 protein_id gnl|my_center|LOCUS_35970 1633 1250 gene locus_tag LOCUS_35980 1633 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 1878 1633 gene locus_tag LOCUS_35990 1878 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 1979 2209 gene locus_tag LOCUS_36000 1979 2209 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529932.1 protein_id gnl|my_center|LOCUS_36000 2206 2595 gene locus_tag LOCUS_36010 2206 2595 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227971.1 protein_id gnl|my_center|LOCUS_36010 >Feature sequence226 1299 820 gene locus_tag LOCUS_36020 1299 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 3171 1486 gene locus_tag LOCUS_36030 3171 1486 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_36030 4184 4035 gene locus_tag LOCUS_36040 4184 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 >Feature sequence227 <1 980 gene locus_tag LOCUS_36050 <1 980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_187437126.1:IS256 family transposase 1232 1687 gene locus_tag LOCUS_36060 1232 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 1663 3915 gene locus_tag LOCUS_36070 1663 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 4148 3981 gene locus_tag LOCUS_36080 4148 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 >Feature sequence228 <1 1283 gene locus_tag LOCUS_36090 <1 1283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003413385.1:protein translocase subunit SecD 1287 2510 gene locus_tag LOCUS_36100 gene secF 1287 2510 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728724.1 protein_id gnl|my_center|LOCUS_36100 2518 4176 gene locus_tag LOCUS_36110 2518 4176 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728725.1 protein_id gnl|my_center|LOCUS_36110 >Feature sequence229 <1 919 gene locus_tag LOCUS_36120 <1 919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731304.1:NAD-dependent epimerase/dehydratase family protein 1459 1106 gene locus_tag LOCUS_36130 gene mazF7 1459 1106 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410654.1 protein_id gnl|my_center|LOCUS_36130 1652 1452 gene locus_tag LOCUS_36140 gene mazE7 1652 1452 CDS product type II toxin-antitoxin system antitoxin MazE7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410651.1 protein_id gnl|my_center|LOCUS_36140 2023 1715 gene locus_tag LOCUS_36150 2023 1715 CDS product toxin-antitoxin system toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401560.1 protein_id gnl|my_center|LOCUS_36150 2247 2020 gene locus_tag LOCUS_36160 2247 2020 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401555.1 protein_id gnl|my_center|LOCUS_36160 2374 3744 gene locus_tag LOCUS_36170 2374 3744 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878659.1 protein_id gnl|my_center|LOCUS_36170 >Feature sequence230 949 122 gene locus_tag LOCUS_36180 949 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 1628 1119 gene locus_tag LOCUS_36190 1628 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 1873 1631 gene locus_tag LOCUS_36200 1873 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 2526 1873 gene locus_tag LOCUS_36210 2526 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 2792 2523 gene locus_tag LOCUS_36220 2792 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 3268 2795 gene locus_tag LOCUS_36230 3268 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 4060 3572 gene locus_tag LOCUS_36240 4060 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 >Feature sequence231 464 1750 gene locus_tag LOCUS_36250 gene eno 464 1750 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896814.1 protein_id gnl|my_center|LOCUS_36250 1790 2476 gene locus_tag LOCUS_36260 1790 2476 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104417.1 protein_id gnl|my_center|LOCUS_36260 2469 2960 gene locus_tag LOCUS_36270 2469 2960 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907636.1 protein_id gnl|my_center|LOCUS_36270 2957 3907 gene locus_tag LOCUS_36280 2957 3907 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896811.1 protein_id gnl|my_center|LOCUS_36280 >Feature sequence232 <1 1159 gene locus_tag LOCUS_36290 <1 1159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008783747.1:IS30-like element ISBlo4 family transposase 1453 1169 gene locus_tag LOCUS_36300 1453 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 2203 1847 gene locus_tag LOCUS_36310 2203 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 2556 2215 gene locus_tag LOCUS_36320 2556 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 3323 2571 gene locus_tag LOCUS_36330 3323 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 3879 3487 gene locus_tag LOCUS_36340 3879 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 >Feature sequence233 377 619 gene locus_tag LOCUS_36350 377 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 619 1560 gene locus_tag LOCUS_36360 619 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 2589 1750 gene locus_tag LOCUS_36370 2589 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 3448 3059 gene locus_tag LOCUS_36380 3448 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36380 3481 3636 gene locus_tag LOCUS_36390 3481 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 >Feature sequence234 2057 327 gene locus_tag LOCUS_36400 2057 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 2183 2791 gene locus_tag LOCUS_36410 2183 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895343.1 protein_id gnl|my_center|LOCUS_36410 2788 3873 gene locus_tag LOCUS_36420 2788 3873 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895344.1 protein_id gnl|my_center|LOCUS_36420 >Feature sequence235 383 99 gene locus_tag LOCUS_36430 383 99 CDS product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167470730.1 protein_id gnl|my_center|LOCUS_36430 1592 408 gene locus_tag LOCUS_36440 1592 408 CDS product IS30-like element ISMsm8 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728521.1 protein_id gnl|my_center|LOCUS_36440 2524 1697 gene locus_tag LOCUS_36450 2524 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36450 2832 2521 gene locus_tag LOCUS_36460 2832 2521 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899493.1 protein_id gnl|my_center|LOCUS_36460 2864 3055 gene locus_tag LOCUS_36470 2864 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 >Feature sequence236 1324 65 gene locus_tag LOCUS_36480 1324 65 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728577.1 protein_id gnl|my_center|LOCUS_36480 1907 1326 gene locus_tag LOCUS_36490 1907 1326 CDS product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728578.1 protein_id gnl|my_center|LOCUS_36490 2001 3059 gene locus_tag LOCUS_36500 gene hemE 2001 3059 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728579.1 protein_id gnl|my_center|LOCUS_36500 >Feature sequence237 577 47 gene locus_tag LOCUS_36510 577 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 1141 725 gene locus_tag LOCUS_36520 1141 725 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414734.1 protein_id gnl|my_center|LOCUS_36520 1197 2084 gene locus_tag LOCUS_36530 gene dacB2 1197 2084 CDS product D-alanyl-D-alanine carboxypeptidase DacB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414736.1 protein_id gnl|my_center|LOCUS_36530 2783 2103 gene locus_tag LOCUS_36540 2783 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 2975 3805 gene locus_tag LOCUS_36550 2975 3805 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728339.1 protein_id gnl|my_center|LOCUS_36550 >Feature sequence238 1385 1185 gene locus_tag LOCUS_36560 1385 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36560 1651 1382 gene locus_tag LOCUS_36570 1651 1382 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975041.1 protein_id gnl|my_center|LOCUS_36570 3750 1924 gene locus_tag LOCUS_36580 gene ilvD 3750 1924 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900824.1 protein_id gnl|my_center|LOCUS_36580 >Feature sequence239 1480 89 gene locus_tag LOCUS_36590 1480 89 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014385.1 protein_id gnl|my_center|LOCUS_36590 2935 1538 gene locus_tag LOCUS_36600 2935 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 <3829 3077 gene locus_tag LOCUS_36610 <3829 3077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_125310973.1:glycoside hydrolase >Feature sequence240 908 108 gene locus_tag LOCUS_36620 908 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 2188 950 gene locus_tag LOCUS_36630 2188 950 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236074023.1 protein_id gnl|my_center|LOCUS_36630 2302 2460 gene locus_tag LOCUS_36640 2302 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 2553 2954 gene locus_tag LOCUS_36650 2553 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 >Feature sequence241 <1 820 gene locus_tag LOCUS_36660 <1 820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003902383.1:DAK2 domain-containing protein 823 3039 gene locus_tag LOCUS_36670 gene recG 823 3039 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877375.1 protein_id gnl|my_center|LOCUS_36670 3036 3737 gene locus_tag LOCUS_36680 3036 3737 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728321.1 protein_id gnl|my_center|LOCUS_36680 >Feature sequence242 980 444 gene locus_tag LOCUS_36690 980 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 1258 977 gene locus_tag LOCUS_36700 1258 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 1773 1333 gene locus_tag LOCUS_36710 1773 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 2381 1770 gene locus_tag LOCUS_36720 2381 1770 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142458.1 protein_id gnl|my_center|LOCUS_36720 2718 2954 gene locus_tag LOCUS_36730 2718 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 3019 3495 gene locus_tag LOCUS_36740 3019 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 >Feature sequence243 <1 2173 gene locus_tag LOCUS_36750 <1 2173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039730.1:helicase RepA family protein 2439 2948 gene locus_tag LOCUS_36760 2439 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 2932 3468 gene locus_tag LOCUS_36770 2932 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063611.1 protein_id gnl|my_center|LOCUS_36770 3465 3722 gene locus_tag LOCUS_36780 3465 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 >Feature sequence244 1791 2534 gene locus_tag LOCUS_36790 gene aqpZ 1791 2534 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731298.1 protein_id gnl|my_center|LOCUS_36790 3260 2643 gene locus_tag LOCUS_36800 3260 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 3664 3488 gene locus_tag LOCUS_36810 3664 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 >Feature sequence245 214 966 gene locus_tag LOCUS_36820 gene thyX 214 966 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899465.1 protein_id gnl|my_center|LOCUS_36820 992 1921 gene locus_tag LOCUS_36830 gene dapA 992 1921 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175048369.1 protein_id gnl|my_center|LOCUS_36830 1921 3600 gene locus_tag LOCUS_36840 gene rnj 1921 3600 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414049.1 protein_id gnl|my_center|LOCUS_36840 >Feature sequence246 <1 729 gene locus_tag LOCUS_36850 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005074730.1:glycoside hydrolase family 16 protein 768 926 gene locus_tag LOCUS_36860 768 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 926 1579 gene locus_tag LOCUS_36870 926 1579 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946157.1 protein_id gnl|my_center|LOCUS_36870 1658 1585 gene locus_tag LOCUS_t00470 1658 1585 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1753 2325 gene locus_tag LOCUS_36880 gene dcd 1753 2325 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898399.1 protein_id gnl|my_center|LOCUS_36880 >Feature sequence247 <1 3473 gene locus_tag LOCUS_36890 <1 3473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730279.1:multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit >Feature sequence248 1484 1879 gene locus_tag LOCUS_36900 1484 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 1928 3016 gene locus_tag LOCUS_36910 1928 3016 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389734.1 protein_id gnl|my_center|LOCUS_36910 <3610 3036 gene locus_tag LOCUS_36920 <3610 3036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003891984.1:DUF808 domain-containing protein >Feature sequence249 <1 1493 gene locus_tag LOCUS_36930 <1 1493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120136.1:DUF1592 domain-containing protein 1534 2832 gene locus_tag LOCUS_36940 1534 2832 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120135.1 protein_id gnl|my_center|LOCUS_36940 >Feature sequence250 250 930 gene locus_tag LOCUS_36950 250 930 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728701.1 protein_id gnl|my_center|LOCUS_36950 927 1838 gene locus_tag LOCUS_36960 927 1838 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728702.1 protein_id gnl|my_center|LOCUS_36960 1838 2962 gene locus_tag LOCUS_36970 gene pimA 1838 2962 CDS product phosphatidyl-myo-inositol alpha-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728703.1 protein_id gnl|my_center|LOCUS_36970 2973 3479 gene locus_tag LOCUS_36980 2973 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36980 >Feature sequence251 664 392 gene locus_tag LOCUS_36990 664 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 1458 787 gene locus_tag LOCUS_37000 1458 787 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089232.1 protein_id gnl|my_center|LOCUS_37000 2081 1476 gene locus_tag LOCUS_37010 2081 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 2311 2078 gene locus_tag LOCUS_37020 2311 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 2873 2226 gene locus_tag LOCUS_37030 2873 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 >Feature sequence252 709 1527 gene locus_tag LOCUS_37040 709 1527 CDS product bacteriorhodopsin-like inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140202.1 protein_id gnl|my_center|LOCUS_37040 1823 1623 gene locus_tag LOCUS_37050 1823 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 2236 1853 gene locus_tag LOCUS_37060 2236 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 2436 2236 gene locus_tag LOCUS_37070 2436 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 >Feature sequence253 473 2026 gene locus_tag LOCUS_37080 473 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 2137 3237 gene locus_tag LOCUS_37090 2137 3237 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112973.1 protein_id gnl|my_center|LOCUS_37090 >Feature sequence254 519 316 gene locus_tag LOCUS_37100 519 316 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891980.1 protein_id gnl|my_center|LOCUS_37100 988 2643 gene locus_tag LOCUS_37110 988 2643 CDS product ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727568.1 protein_id gnl|my_center|LOCUS_37110 2822 3298 gene locus_tag LOCUS_37120 2822 3298 CDS product DUF5994 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891979.1 protein_id gnl|my_center|LOCUS_37120 >Feature sequence255 469 927 gene locus_tag LOCUS_37130 469 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 980 2461 gene locus_tag LOCUS_37140 980 2461 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144956692.1 protein_id gnl|my_center|LOCUS_37140 2458 3273 gene locus_tag LOCUS_37150 2458 3273 CDS product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899491.1 protein_id gnl|my_center|LOCUS_37150 >Feature sequence256 806 72 gene locus_tag LOCUS_37160 806 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 1460 837 gene locus_tag LOCUS_37170 1460 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 1975 2457 gene locus_tag LOCUS_37180 1975 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 3182 2895 gene locus_tag LOCUS_37190 3182 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 >Feature sequence257 <1 712 gene locus_tag LOCUS_37200 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003892868.1:class I SAM-dependent methyltransferase 709 1617 gene locus_tag LOCUS_37210 709 1617 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892866.1 protein_id gnl|my_center|LOCUS_37210 <3442 1622 gene locus_tag LOCUS_37220 <3442 1622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727691.1:signal peptide peptidase SppA >Feature sequence258 1262 987 gene locus_tag LOCUS_37230 1262 987 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402695.1 protein_id gnl|my_center|LOCUS_37230 1301 2167 gene locus_tag LOCUS_37240 1301 2167 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892375.1 protein_id gnl|my_center|LOCUS_37240 3048 2260 gene locus_tag LOCUS_37250 3048 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 >Feature sequence259 219 1442 gene locus_tag LOCUS_37260 219 1442 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901321.1 protein_id gnl|my_center|LOCUS_37260 1499 1945 gene locus_tag LOCUS_37270 1499 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 2584 2784 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggcactggtcaagtcgccgcc >Feature sequence260 <1 568 gene locus_tag LOCUS_37280 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057728.1:SDR family oxidoreductase 1066 626 gene locus_tag LOCUS_37290 1066 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 1149 1715 gene locus_tag LOCUS_37300 1149 1715 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226688.1 protein_id gnl|my_center|LOCUS_37300 >Feature sequence261 173 1240 gene locus_tag LOCUS_37310 173 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 1307 1480 gene locus_tag LOCUS_37320 1307 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 1971 2246 gene locus_tag LOCUS_37330 1971 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 2399 2812 gene locus_tag LOCUS_37340 2399 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091317612.1 protein_id gnl|my_center|LOCUS_37340 >Feature sequence262 1192 98 gene locus_tag LOCUS_37350 1192 98 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411849.1 protein_id gnl|my_center|LOCUS_37350 2115 1189 gene locus_tag LOCUS_37360 2115 1189 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907972.1 protein_id gnl|my_center|LOCUS_37360 2899 2150 gene locus_tag LOCUS_37370 2899 2150 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103613.1 protein_id gnl|my_center|LOCUS_37370 >Feature sequence263 23 3103 gene locus_tag LOCUS_37380 23 3103 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878795.1 protein_id gnl|my_center|LOCUS_37380 >Feature sequence264 831 1016 gene locus_tag LOCUS_37390 831 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 1075 2106 gene locus_tag LOCUS_37400 1075 2106 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047532.1 protein_id gnl|my_center|LOCUS_37400 2121 2396 gene locus_tag LOCUS_37410 2121 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 3042 2674 gene locus_tag LOCUS_37420 3042 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 >Feature sequence265 1084 680 gene locus_tag LOCUS_37430 gene vapc11 1084 680 CDS product type II toxin-antitoxin system toxin ribonuclease VapC11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407786.1 protein_id gnl|my_center|LOCUS_37430 1293 1084 gene locus_tag LOCUS_37440 1293 1084 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407785.1 protein_id gnl|my_center|LOCUS_37440 1372 3015 gene locus_tag LOCUS_37450 1372 3015 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727596.1 protein_id gnl|my_center|LOCUS_37450 >Feature sequence266 492 1184 gene locus_tag LOCUS_37460 492 1184 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728735.1 protein_id gnl|my_center|LOCUS_37460 1181 2440 gene locus_tag LOCUS_37470 gene hisS 1181 2440 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413365.1 protein_id gnl|my_center|LOCUS_37470 2526 2993 gene locus_tag LOCUS_37480 2526 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 >Feature sequence267 1801 773 gene locus_tag LOCUS_37490 1801 773 CDS product (R)-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082714.1 protein_id gnl|my_center|LOCUS_37490 1933 2511 gene locus_tag LOCUS_37500 1933 2511 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227409.1 protein_id gnl|my_center|LOCUS_37500 >Feature sequence268 <1 575 gene locus_tag LOCUS_37510 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730845.1:alpha/beta hydrolase-fold protein 1370 588 gene locus_tag LOCUS_37520 1370 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 2635 1367 gene locus_tag LOCUS_37530 gene purD 2635 1367 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878472.1 protein_id gnl|my_center|LOCUS_37530 2705 2995 gene locus_tag LOCUS_37540 2705 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 >Feature sequence269 275 2083 gene locus_tag LOCUS_37550 275 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 >Feature sequence270 2431 1094 gene locus_tag LOCUS_37560 2431 1094 CDS product IS256-like element IS1554 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404757.1 protein_id gnl|my_center|LOCUS_37560 >Feature sequence271 1900 77 gene locus_tag LOCUS_37570 gene leuA 1900 77 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731169.1 protein_id gnl|my_center|LOCUS_37570 2065 2421 gene locus_tag LOCUS_37580 2065 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 >Feature sequence272 201 1040 gene locus_tag LOCUS_37590 201 1040 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729429.1 protein_id gnl|my_center|LOCUS_37590 1129 2169 gene locus_tag LOCUS_37600 1129 2169 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893734.1 protein_id gnl|my_center|LOCUS_37600 2183 2818 gene locus_tag LOCUS_37610 2183 2818 CDS product cutinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165447246.1 protein_id gnl|my_center|LOCUS_37610 >Feature sequence273 1373 363 gene locus_tag LOCUS_37620 1373 363 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403363.1 protein_id gnl|my_center|LOCUS_37620 1936 1550 gene locus_tag LOCUS_37630 gene rplL 1936 1550 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403353.1 protein_id gnl|my_center|LOCUS_37630 2628 1996 gene locus_tag LOCUS_37640 gene rplJ 2628 1996 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892752.1 protein_id gnl|my_center|LOCUS_37640 >Feature sequence274 1996 482 gene locus_tag LOCUS_37650 gene glpK 1996 482 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731139.1 protein_id gnl|my_center|LOCUS_37650 >Feature sequence275 901 122 gene locus_tag LOCUS_37660 gene istB 901 122 CDS product IS21-like element ISMt2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418125.1 protein_id gnl|my_center|LOCUS_37660 2523 964 gene locus_tag LOCUS_37670 2523 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 >Feature sequence276 >Feature sequence277 412 197 gene locus_tag LOCUS_37680 412 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 >Feature sequence278 2483 141 gene locus_tag LOCUS_37690 2483 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 >Feature sequence279 994 362 gene locus_tag LOCUS_37700 994 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 1882 1082 gene locus_tag LOCUS_37710 1882 1082 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115222831.1 protein_id gnl|my_center|LOCUS_37710 2377 1964 gene locus_tag LOCUS_37720 2377 1964 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410075.1 protein_id gnl|my_center|LOCUS_37720 2577 2374 gene locus_tag LOCUS_37730 2577 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 >Feature sequence280 211 747 gene locus_tag LOCUS_37740 gene rimP 211 747 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899507.1 protein_id gnl|my_center|LOCUS_37740 744 1790 gene locus_tag LOCUS_37750 gene nusA 744 1790 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414511.1 protein_id gnl|my_center|LOCUS_37750 1834 2157 gene locus_tag LOCUS_37760 1834 2157 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083453034.1 protein_id gnl|my_center|LOCUS_37760 >Feature sequence281 <1 587 gene locus_tag LOCUS_37770 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728570.1:potassium uptake protein TrkA 584 1249 gene locus_tag LOCUS_37780 584 1249 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899435.1 protein_id gnl|my_center|LOCUS_37780 1937 1269 gene locus_tag LOCUS_37790 1937 1269 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894153.1 protein_id gnl|my_center|LOCUS_37790 2295 1954 gene locus_tag LOCUS_37800 2295 1954 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901453.1 protein_id gnl|my_center|LOCUS_37800 >Feature sequence282 >Feature sequence283 <1 848 gene locus_tag LOCUS_37810 <1 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776228.1:phosphoketolase family protein 1430 1035 gene locus_tag LOCUS_37820 1430 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 >Feature sequence284 <1 583 gene locus_tag LOCUS_37830 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730375.1:crotonase/enoyl-CoA hydratase family protein 1614 706 gene locus_tag LOCUS_37840 1614 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 1535 1774 gene locus_tag LOCUS_37850 1535 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 1774 2280 gene locus_tag LOCUS_37860 1774 2280 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730372.1 protein_id gnl|my_center|LOCUS_37860 >Feature sequence285 329 405 gene locus_tag LOCUS_t00480 329 405 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2273 435 gene locus_tag LOCUS_37870 2273 435 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404749.1 protein_id gnl|my_center|LOCUS_37870