>Feature sequence001 1031 747 gene locus_tag LOCUS_0010 1031 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0010 1305 1793 gene locus_tag LOCUS_0020 1305 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0020 2551 2973 gene locus_tag LOCUS_0030 2551 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0030 2949 3488 gene locus_tag LOCUS_0040 2949 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0040 3454 3891 gene locus_tag LOCUS_0050 3454 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0050 4038 4217 gene locus_tag LOCUS_0060 4038 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0060 4214 5833 gene locus_tag LOCUS_0070 4214 5833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0070 5897 6376 gene locus_tag LOCUS_0080 5897 6376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0080 6394 7110 gene locus_tag LOCUS_0090 6394 7110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0090 7152 7583 gene locus_tag LOCUS_0100 7152 7583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0100 7604 10567 gene locus_tag LOCUS_0110 7604 10567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0110 10589 10915 gene locus_tag LOCUS_0120 10589 10915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0120 10912 11358 gene locus_tag LOCUS_0130 10912 11358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087299.1 protein_id gnl|my_center|LOCUS_0130 11351 11623 gene locus_tag LOCUS_0140 11351 11623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0140 11623 11901 gene locus_tag LOCUS_0150 11623 11901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0150 11894 12064 gene locus_tag LOCUS_0160 11894 12064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0160 12064 12336 gene locus_tag LOCUS_0170 12064 12336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0170 12348 12524 gene locus_tag LOCUS_0180 12348 12524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0180 12581 13675 gene locus_tag LOCUS_0190 12581 13675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0190 14394 13993 gene locus_tag LOCUS_0200 14394 13993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0200 14726 14391 gene locus_tag LOCUS_0210 14726 14391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0210 17538 14728 gene locus_tag LOCUS_0220 17538 14728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0220 18521 17538 gene locus_tag LOCUS_0230 18521 17538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0230 19760 18543 gene locus_tag LOCUS_0240 19760 18543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0240 20216 19791 gene locus_tag LOCUS_0250 20216 19791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0250 21642 20209 gene locus_tag LOCUS_0260 21642 20209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0260 21833 21651 gene locus_tag LOCUS_0270 21833 21651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0270 23989 21830 gene locus_tag LOCUS_0280 23989 21830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0280 25328 24024 gene locus_tag LOCUS_0290 25328 24024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0290 25532 25329 gene locus_tag LOCUS_0300 25532 25329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0300 25961 25560 gene locus_tag LOCUS_0310 25961 25560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0310 26685 25966 gene locus_tag LOCUS_0320 26685 25966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0320 28298 26706 gene locus_tag LOCUS_0330 28298 26706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0330 28487 28320 gene locus_tag LOCUS_0340 28487 28320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0340 29466 28567 gene locus_tag LOCUS_0350 29466 28567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0350 30059 29505 gene locus_tag LOCUS_0360 30059 29505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0360 30808 30080 gene locus_tag LOCUS_0370 30808 30080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0370 31696 30851 gene locus_tag LOCUS_0380 31696 30851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0380 32038 31700 gene locus_tag LOCUS_0390 32038 31700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0390 32301 32065 gene locus_tag LOCUS_0400 32301 32065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0400 34408 32291 gene locus_tag LOCUS_0410 34408 32291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0410 34754 34410 gene locus_tag LOCUS_0420 34754 34410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0420 36404 34797 gene locus_tag LOCUS_0430 36404 34797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0430 36564 36406 gene locus_tag LOCUS_0440 36564 36406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0440 37512 36955 gene locus_tag LOCUS_0450 37512 36955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0450 >Feature sequence002 1541 48 gene locus_tag LOCUS_0460 1541 48 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104588.1 protein_id gnl|my_center|LOCUS_0460 3386 1602 gene locus_tag LOCUS_0470 3386 1602 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390492.1 protein_id gnl|my_center|LOCUS_0470 3643 3915 gene locus_tag LOCUS_0480 3643 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0480 4725 3928 gene locus_tag LOCUS_0490 4725 3928 CDS product TIGR02186 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968644.1 protein_id gnl|my_center|LOCUS_0490 5648 4722 gene locus_tag LOCUS_0500 5648 4722 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389853.1 protein_id gnl|my_center|LOCUS_0500 6060 7850 gene locus_tag LOCUS_0510 6060 7850 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083977.1 protein_id gnl|my_center|LOCUS_0510 7861 9066 gene locus_tag LOCUS_0520 7861 9066 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917966.1 protein_id gnl|my_center|LOCUS_0520 9083 11239 gene locus_tag LOCUS_0530 9083 11239 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639873.1 protein_id gnl|my_center|LOCUS_0530 11359 11952 gene locus_tag LOCUS_0540 11359 11952 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268811.1 protein_id gnl|my_center|LOCUS_0540 11982 12962 gene locus_tag LOCUS_0550 11982 12962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0550 14260 13007 gene locus_tag LOCUS_0560 14260 13007 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478185.1 protein_id gnl|my_center|LOCUS_0560 >Feature sequence003 273 896 gene locus_tag LOCUS_0570 273 896 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992415.1 protein_id gnl|my_center|LOCUS_0570 974 1969 gene locus_tag LOCUS_0580 974 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_0580 1969 2355 gene locus_tag LOCUS_0590 1969 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_0590 2352 3608 gene locus_tag LOCUS_0600 2352 3608 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390982.1 protein_id gnl|my_center|LOCUS_0600 4238 3618 gene locus_tag LOCUS_0610 4238 3618 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036621.1 protein_id gnl|my_center|LOCUS_0610 5366 4239 gene locus_tag LOCUS_0620 gene mutY 5366 4239 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486227.1 protein_id gnl|my_center|LOCUS_0620 5506 6060 gene locus_tag LOCUS_0630 5506 6060 CDS product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390998.1 protein_id gnl|my_center|LOCUS_0630 6152 6958 gene locus_tag LOCUS_0640 6152 6958 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532754.1 protein_id gnl|my_center|LOCUS_0640 6980 10465 gene locus_tag LOCUS_0650 gene smc 6980 10465 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532753.1 protein_id gnl|my_center|LOCUS_0650 10693 11028 gene locus_tag LOCUS_0660 10693 11028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0660 11045 11230 gene locus_tag LOCUS_0670 11045 11230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0670 >Feature sequence004 1094 24 gene locus_tag LOCUS_0680 gene pseC 1094 24 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867760.1 protein_id gnl|my_center|LOCUS_0680 1355 1200 gene locus_tag LOCUS_0690 1355 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0690 2348 1362 gene locus_tag LOCUS_0700 2348 1362 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105102.1 protein_id gnl|my_center|LOCUS_0700 4763 2361 gene locus_tag LOCUS_0710 4763 2361 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889490.1 protein_id gnl|my_center|LOCUS_0710 5397 4765 gene locus_tag LOCUS_0720 5397 4765 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189588467.1 protein_id gnl|my_center|LOCUS_0720 5605 6318 gene locus_tag LOCUS_0730 5605 6318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0730 6315 6740 gene locus_tag LOCUS_0740 6315 6740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0740 6835 7407 gene locus_tag LOCUS_0750 6835 7407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0750 7400 8131 gene locus_tag LOCUS_0760 7400 8131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0760 8177 9079 gene locus_tag LOCUS_0770 8177 9079 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275180.1 protein_id gnl|my_center|LOCUS_0770 9891 9082 gene locus_tag LOCUS_0780 9891 9082 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071506.1 protein_id gnl|my_center|LOCUS_0780 10461 9904 gene locus_tag LOCUS_0790 10461 9904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0790 >Feature sequence005 177 515 gene locus_tag LOCUS_0800 177 515 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389838.1 protein_id gnl|my_center|LOCUS_0800 563 1972 gene locus_tag LOCUS_0810 gene glnA 563 1972 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328343.1 protein_id gnl|my_center|LOCUS_0810 2129 2677 gene locus_tag LOCUS_0820 2129 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387973.1 protein_id gnl|my_center|LOCUS_0820 2982 4043 gene locus_tag LOCUS_0830 2982 4043 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262581.1 protein_id gnl|my_center|LOCUS_0830 4077 7238 gene locus_tag LOCUS_0840 gene vexF 4077 7238 CDS product multidrug efflux RND transporter permease subunit VexF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494544.1 protein_id gnl|my_center|LOCUS_0840 7995 7240 gene locus_tag LOCUS_0850 gene pssA 7995 7240 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391331.1 protein_id gnl|my_center|LOCUS_0850 8715 8020 gene locus_tag LOCUS_0860 8715 8020 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338435.1 protein_id gnl|my_center|LOCUS_0860 <9762 8784 gene locus_tag LOCUS_0870 <9762 8784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002214723.1:ABC transporter transmembrane domain-containing protein >Feature sequence006 1247 1879 gene locus_tag LOCUS_0880 1247 1879 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390941.1 protein_id gnl|my_center|LOCUS_0880 2590 1892 gene locus_tag LOCUS_0890 2590 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0890 2800 4110 gene locus_tag LOCUS_0900 2800 4110 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038890.1 protein_id gnl|my_center|LOCUS_0900 4146 5447 gene locus_tag LOCUS_0910 4146 5447 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861814.1 protein_id gnl|my_center|LOCUS_0910 7073 5499 gene locus_tag LOCUS_0920 7073 5499 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640267.1 protein_id gnl|my_center|LOCUS_0920 9372 7216 gene locus_tag LOCUS_0930 9372 7216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0930 >Feature sequence007 2693 1491 gene locus_tag LOCUS_0940 gene recF 2693 1491 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527878.1 protein_id gnl|my_center|LOCUS_0940 3827 2706 gene locus_tag LOCUS_0950 gene dnaN 3827 2706 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387763.1 protein_id gnl|my_center|LOCUS_0950 5454 4021 gene locus_tag LOCUS_0960 gene dnaA 5454 4021 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387762.1 protein_id gnl|my_center|LOCUS_0960 5877 5458 gene locus_tag LOCUS_0970 5877 5458 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892192.1 protein_id gnl|my_center|LOCUS_0970 6591 6328 gene locus_tag LOCUS_0980 gene rpsT 6591 6328 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385126.1 protein_id gnl|my_center|LOCUS_0980 7564 6788 gene locus_tag LOCUS_0990 7564 6788 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391548.1 protein_id gnl|my_center|LOCUS_0990 8016 7597 gene locus_tag LOCUS_1000 8016 7597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1000 8900 8046 gene locus_tag LOCUS_1010 gene mutM 8900 8046 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385127.1 protein_id gnl|my_center|LOCUS_1010 >Feature sequence008 <1 773 gene locus_tag LOCUS_1020 <1 773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037381.1:CocE/NonD family hydrolase 3279 997 gene locus_tag LOCUS_1030 gene katG 3279 997 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945955.1 protein_id gnl|my_center|LOCUS_1030 3481 3305 gene locus_tag LOCUS_1040 3481 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1040 4273 3485 gene locus_tag LOCUS_1050 4273 3485 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388250.1 protein_id gnl|my_center|LOCUS_1050 5271 4270 gene locus_tag LOCUS_1060 5271 4270 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388249.1 protein_id gnl|my_center|LOCUS_1060 6166 5255 gene locus_tag LOCUS_1070 6166 5255 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919074.1 protein_id gnl|my_center|LOCUS_1070 8019 6166 gene locus_tag LOCUS_1080 8019 6166 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919618.1 protein_id gnl|my_center|LOCUS_1080 >Feature sequence009 1494 238 gene locus_tag LOCUS_1090 1494 238 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214468507.1 protein_id gnl|my_center|LOCUS_1090 1857 1504 gene locus_tag LOCUS_1100 1857 1504 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089353.1 protein_id gnl|my_center|LOCUS_1100 2065 3528 gene locus_tag LOCUS_1110 2065 3528 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262614.1 protein_id gnl|my_center|LOCUS_1110 4368 3676 gene locus_tag LOCUS_1120 4368 3676 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 protein_id gnl|my_center|LOCUS_1120 4676 4365 gene locus_tag LOCUS_1130 4676 4365 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196156.1 protein_id gnl|my_center|LOCUS_1130 4842 6827 gene locus_tag LOCUS_1140 4842 6827 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113842.1 protein_id gnl|my_center|LOCUS_1140 6849 8156 gene locus_tag LOCUS_1150 6849 8156 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112975.1 protein_id gnl|my_center|LOCUS_1150 >Feature sequence010 1711 1037 gene locus_tag LOCUS_1160 1711 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292634.1 protein_id gnl|my_center|LOCUS_1160 2504 1779 gene locus_tag LOCUS_1170 2504 1779 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084210.1 protein_id gnl|my_center|LOCUS_1170 3101 2529 gene locus_tag LOCUS_1180 3101 2529 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329550.1 protein_id gnl|my_center|LOCUS_1180 3990 3109 gene locus_tag LOCUS_1190 3990 3109 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391003.1 protein_id gnl|my_center|LOCUS_1190 4700 3987 gene locus_tag LOCUS_1200 gene ftsE 4700 3987 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626546.1 protein_id gnl|my_center|LOCUS_1200 4996 5757 gene locus_tag LOCUS_1210 4996 5757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1210 5827 6201 gene locus_tag LOCUS_1220 5827 6201 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084205.1 protein_id gnl|my_center|LOCUS_1220 7987 6227 gene locus_tag LOCUS_1230 7987 6227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1230 >Feature sequence011 107 1204 gene locus_tag LOCUS_1240 gene hisC 107 1204 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970110.1 protein_id gnl|my_center|LOCUS_1240 1876 1217 gene locus_tag LOCUS_1250 1876 1217 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582959.1 protein_id gnl|my_center|LOCUS_1250 3671 2094 gene locus_tag LOCUS_1260 3671 2094 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083952.1 protein_id gnl|my_center|LOCUS_1260 3846 6587 gene locus_tag LOCUS_1270 3846 6587 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390784.1 protein_id gnl|my_center|LOCUS_1270 6716 7822 gene locus_tag LOCUS_1280 6716 7822 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144408.1 protein_id gnl|my_center|LOCUS_1280 >Feature sequence012 <1 1135 gene locus_tag LOCUS_1290 <1 1135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269222.1:glycine-betaine demethylase subunit GbcA 1132 2190 gene locus_tag LOCUS_1300 1132 2190 CDS product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329412.1 protein_id gnl|my_center|LOCUS_1300 2204 3526 gene locus_tag LOCUS_1310 2204 3526 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104356.1 protein_id gnl|my_center|LOCUS_1310 3523 4449 gene locus_tag LOCUS_1320 3523 4449 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303519.1 protein_id gnl|my_center|LOCUS_1320 4446 5705 gene locus_tag LOCUS_1330 4446 5705 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531143.1 protein_id gnl|my_center|LOCUS_1330 5714 5989 gene locus_tag LOCUS_1340 5714 5989 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531142.1 protein_id gnl|my_center|LOCUS_1340 >Feature sequence013 303 1718 gene locus_tag LOCUS_1350 gene leuC 303 1718 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529677.1 protein_id gnl|my_center|LOCUS_1350 1711 2322 gene locus_tag LOCUS_1360 gene leuD 1711 2322 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067236.1 protein_id gnl|my_center|LOCUS_1360 2349 3446 gene locus_tag LOCUS_1370 gene leuB 2349 3446 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388946.1 protein_id gnl|my_center|LOCUS_1370 3464 4504 gene locus_tag LOCUS_1380 3464 4504 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528795.1 protein_id gnl|my_center|LOCUS_1380 5392 4610 gene locus_tag LOCUS_1390 5392 4610 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528877.1 protein_id gnl|my_center|LOCUS_1390 7244 5409 gene locus_tag LOCUS_1400 gene sdhA 7244 5409 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083345.1 protein_id gnl|my_center|LOCUS_1400 7569 7195 gene locus_tag LOCUS_1410 gene sdhD 7569 7195 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026615499.1 protein_id gnl|my_center|LOCUS_1410 >Feature sequence014 128 355 gene locus_tag LOCUS_1420 128 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1420 432 1097 gene locus_tag LOCUS_1430 gene ccmA 432 1097 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387801.1 protein_id gnl|my_center|LOCUS_1430 1097 1765 gene locus_tag LOCUS_1440 gene ccmB 1097 1765 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387800.1 protein_id gnl|my_center|LOCUS_1440 2018 1788 gene locus_tag LOCUS_1450 2018 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1450 2213 2944 gene locus_tag LOCUS_1460 2213 2944 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387799.1 protein_id gnl|my_center|LOCUS_1460 2937 3092 gene locus_tag LOCUS_1470 2937 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1470 3094 3576 gene locus_tag LOCUS_1480 gene ccmE 3094 3576 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107323.1 protein_id gnl|my_center|LOCUS_1480 3573 5558 gene locus_tag LOCUS_1490 3573 5558 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391272.1 protein_id gnl|my_center|LOCUS_1490 5545 6072 gene locus_tag LOCUS_1500 5545 6072 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528832.1 protein_id gnl|my_center|LOCUS_1500 6069 6536 gene locus_tag LOCUS_1510 6069 6536 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241025.1 protein_id gnl|my_center|LOCUS_1510 6533 7663 gene locus_tag LOCUS_1520 gene ccmI 6533 7663 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532636.1 protein_id gnl|my_center|LOCUS_1520 >Feature sequence015 <1 1658 gene locus_tag LOCUS_1530 <1 1658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140378.1:amidohydrolase 2998 1718 gene locus_tag LOCUS_1540 2998 1718 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218080540.1 protein_id gnl|my_center|LOCUS_1540 3093 4469 gene locus_tag LOCUS_1550 3093 4469 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405481.1 protein_id gnl|my_center|LOCUS_1550 5443 4466 gene locus_tag LOCUS_1560 5443 4466 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223629.1 protein_id gnl|my_center|LOCUS_1560 >Feature sequence016 1084 377 gene locus_tag LOCUS_1570 1084 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1570 1412 1269 gene locus_tag LOCUS_1580 1412 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_1580 2782 1412 gene locus_tag LOCUS_1590 gene trpE 2782 1412 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389644.1 protein_id gnl|my_center|LOCUS_1590 4668 2785 gene locus_tag LOCUS_1600 gene ppiD 4668 2785 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969436.1 protein_id gnl|my_center|LOCUS_1600 4934 5698 gene locus_tag LOCUS_1610 gene tpiA 4934 5698 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389642.1 protein_id gnl|my_center|LOCUS_1610 5805 6125 gene locus_tag LOCUS_1620 5805 6125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1620 >Feature sequence017 <1 1879 gene locus_tag LOCUS_1630 <1 1879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390501.1:elongation factor G 1964 3157 gene locus_tag LOCUS_1640 gene tuf 1964 3157 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943488.1 protein_id gnl|my_center|LOCUS_1640 3204 3521 gene locus_tag LOCUS_1650 gene rpsJ 3204 3521 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390499.1 protein_id gnl|my_center|LOCUS_1650 3527 4273 gene locus_tag LOCUS_1660 gene rplC 3527 4273 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563652.1 protein_id gnl|my_center|LOCUS_1660 4278 4898 gene locus_tag LOCUS_1670 gene rplD 4278 4898 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088150.1 protein_id gnl|my_center|LOCUS_1670 4895 5188 gene locus_tag LOCUS_1680 4895 5188 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440457.1 protein_id gnl|my_center|LOCUS_1680 5194 6030 gene locus_tag LOCUS_1690 gene rplB 5194 6030 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507771.1 protein_id gnl|my_center|LOCUS_1690 6042 6320 gene locus_tag LOCUS_1700 gene rpsS 6042 6320 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596203.1 protein_id gnl|my_center|LOCUS_1700 6323 6703 gene locus_tag LOCUS_1710 gene rplV 6323 6703 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538011.1 protein_id gnl|my_center|LOCUS_1710 6703 7437 gene locus_tag LOCUS_1720 gene rpsC 6703 7437 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531426.1 protein_id gnl|my_center|LOCUS_1720 >Feature sequence018 2 394 gene locus_tag LOCUS_1730 2 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1730 478 3414 gene locus_tag LOCUS_1740 478 3414 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970380.1 protein_id gnl|my_center|LOCUS_1740 3443 4696 gene locus_tag LOCUS_1750 gene odhB 3443 4696 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538105.1 protein_id gnl|my_center|LOCUS_1750 4720 6126 gene locus_tag LOCUS_1760 gene lpdA 4720 6126 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388970.1 protein_id gnl|my_center|LOCUS_1760 <7565 6203 gene locus_tag LOCUS_1770 <7565 6203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928859.1:MBL fold metallo-hydrolase >Feature sequence019 376 95 gene locus_tag LOCUS_1780 gene ihfB 376 95 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388045.1 protein_id gnl|my_center|LOCUS_1780 2572 680 gene locus_tag LOCUS_1790 gene rpsA 2572 680 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528183.1 protein_id gnl|my_center|LOCUS_1790 3389 2727 gene locus_tag LOCUS_1800 gene cmk 3389 2727 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388047.1 protein_id gnl|my_center|LOCUS_1800 4711 3380 gene locus_tag LOCUS_1810 gene aroA 4711 3380 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057817833.1 protein_id gnl|my_center|LOCUS_1810 4969 5343 gene locus_tag LOCUS_1820 4969 5343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1820 5536 5772 gene locus_tag LOCUS_1830 5536 5772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1830 5879 5954 gene locus_tag LOCUS_t0010 5879 5954 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7341 6001 gene locus_tag LOCUS_1840 7341 6001 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948998.1 protein_id gnl|my_center|LOCUS_1840 >Feature sequence020 819 373 gene locus_tag LOCUS_1850 gene mlaD 819 373 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720339.1 protein_id gnl|my_center|LOCUS_1850 1116 877 gene locus_tag LOCUS_1860 1116 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1860 1687 5340 gene locus_tag LOCUS_1870 1687 5340 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390194.1 protein_id gnl|my_center|LOCUS_1870 5485 7041 gene locus_tag LOCUS_1880 5485 7041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_1880 7038 7274 gene locus_tag LOCUS_1890 7038 7274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_1890 >Feature sequence021 1228 629 gene locus_tag LOCUS_1900 gene rimM 1228 629 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388941.1 protein_id gnl|my_center|LOCUS_1900 1747 1232 gene locus_tag LOCUS_1910 1747 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1910 3163 1814 gene locus_tag LOCUS_1920 gene ffh 3163 1814 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067302.1 protein_id gnl|my_center|LOCUS_1920 3342 3148 gene locus_tag LOCUS_1930 3342 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1930 3405 4118 gene locus_tag LOCUS_1940 3405 4118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1940 4169 5614 gene locus_tag LOCUS_1950 4169 5614 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 protein_id gnl|my_center|LOCUS_1950 5777 7060 gene locus_tag LOCUS_1960 gene mtaB 5777 7060 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886290.1 protein_id gnl|my_center|LOCUS_1960 >Feature sequence022 673 1827 gene locus_tag LOCUS_1970 673 1827 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390053.1 protein_id gnl|my_center|LOCUS_1970 2611 1829 gene locus_tag LOCUS_1980 gene blaOXA 2611 1829 CDS product oxacillin-hydrolyzing class D beta-lactamase OXA-50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099707.1 protein_id gnl|my_center|LOCUS_1980 4779 2641 gene locus_tag LOCUS_1990 gene scpA 4779 2641 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337301.1 protein_id gnl|my_center|LOCUS_1990 <7363 4882 gene locus_tag LOCUS_2000 <7363 4882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036697.1:methionine synthase >Feature sequence023 2 604 gene locus_tag LOCUS_2010 2 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2010 992 1068 gene locus_tag LOCUS_t0020 992 1068 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2068 1112 gene locus_tag LOCUS_2020 2068 1112 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086181.1 protein_id gnl|my_center|LOCUS_2020 2908 2087 gene locus_tag LOCUS_2030 2908 2087 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812150.1 protein_id gnl|my_center|LOCUS_2030 2944 3768 gene locus_tag LOCUS_2040 2944 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2040 3784 5295 gene locus_tag LOCUS_2050 3784 5295 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310888.1 protein_id gnl|my_center|LOCUS_2050 6510 5311 gene locus_tag LOCUS_2060 6510 5311 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423059.1 protein_id gnl|my_center|LOCUS_2060 7263 6712 gene locus_tag LOCUS_2070 7263 6712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2070 >Feature sequence024 192 782 gene locus_tag LOCUS_2080 192 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_2080 897 2258 gene locus_tag LOCUS_2090 897 2258 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038494.1 protein_id gnl|my_center|LOCUS_2090 3694 2312 gene locus_tag LOCUS_2100 3694 2312 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_2100 3865 4974 gene locus_tag LOCUS_2110 3865 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2110 4971 5564 gene locus_tag LOCUS_2120 4971 5564 CDS product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064232.1 protein_id gnl|my_center|LOCUS_2120 <6971 5632 gene locus_tag LOCUS_2130 <6971 5632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015923258.1:aminomethyl-transferring glycine dehydrogenase subunit GcvPB >Feature sequence025 1155 775 gene locus_tag LOCUS_2140 1155 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2140 2607 1162 gene locus_tag LOCUS_2150 gene hpaB 2607 1162 CDS product 4-hydroxyphenylacetate 3-monooxygenase, oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228328.1 protein_id gnl|my_center|LOCUS_2150 3505 2675 gene locus_tag LOCUS_2160 3505 2675 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065256.1 protein_id gnl|my_center|LOCUS_2160 3641 5263 gene locus_tag LOCUS_2170 3641 5263 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085749.1 protein_id gnl|my_center|LOCUS_2170 6648 5290 gene locus_tag LOCUS_2180 6648 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2180 >Feature sequence026 1901 657 gene locus_tag LOCUS_2190 1901 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2190 2623 1898 gene locus_tag LOCUS_2200 2623 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2200 3534 2620 gene locus_tag LOCUS_2210 gene hemC 3534 2620 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383712.1 protein_id gnl|my_center|LOCUS_2210 3671 4750 gene locus_tag LOCUS_2220 gene tsaD 3671 4750 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393860.1 protein_id gnl|my_center|LOCUS_2220 4751 5761 gene locus_tag LOCUS_2230 4751 5761 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391318.1 protein_id gnl|my_center|LOCUS_2230 5770 6057 gene locus_tag LOCUS_2240 5770 6057 CDS product YciI-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330126.1 protein_id gnl|my_center|LOCUS_2240 6061 6432 gene locus_tag LOCUS_2250 6061 6432 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237140.1 protein_id gnl|my_center|LOCUS_2250 >Feature sequence027 2479 1712 gene locus_tag LOCUS_2260 gene hutG 2479 1712 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524693.1 protein_id gnl|my_center|LOCUS_2260 4008 2476 gene locus_tag LOCUS_2270 gene hutH 4008 2476 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704356.1 protein_id gnl|my_center|LOCUS_2270 5680 4010 gene locus_tag LOCUS_2280 5680 4010 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975685.1 protein_id gnl|my_center|LOCUS_2280 <6401 5754 gene locus_tag LOCUS_2290 <6401 5754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002211280.1:histidine utilization repressor >Feature sequence028 1570 440 gene locus_tag LOCUS_2300 gene dapE 1570 440 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391801.1 protein_id gnl|my_center|LOCUS_2300 2447 1575 gene locus_tag LOCUS_2310 gene dapD 2447 1575 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391226.1 protein_id gnl|my_center|LOCUS_2310 3174 2488 gene locus_tag LOCUS_2320 3174 2488 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090825.1 protein_id gnl|my_center|LOCUS_2320 3290 4225 gene locus_tag LOCUS_2330 3290 4225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2330 4335 4985 gene locus_tag LOCUS_2340 4335 4985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2340 5012 6268 gene locus_tag LOCUS_2350 5012 6268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2350 >Feature sequence029 3282 622 gene locus_tag LOCUS_2360 3282 622 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918977.1 protein_id gnl|my_center|LOCUS_2360 4323 3736 gene locus_tag LOCUS_2370 4323 3736 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084308.1 protein_id gnl|my_center|LOCUS_2370 4591 5514 gene locus_tag LOCUS_2380 4591 5514 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066920.1 protein_id gnl|my_center|LOCUS_2380 5516 5959 gene locus_tag LOCUS_2390 5516 5959 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066921.1 protein_id gnl|my_center|LOCUS_2390 >Feature sequence030 280 468 gene locus_tag LOCUS_2400 280 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2400 1425 565 gene locus_tag LOCUS_2410 1425 565 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082145856.1 protein_id gnl|my_center|LOCUS_2410 1880 1554 gene locus_tag LOCUS_2420 1880 1554 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 protein_id gnl|my_center|LOCUS_2420 2444 1881 gene locus_tag LOCUS_2430 2444 1881 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_2430 2989 2444 gene locus_tag LOCUS_2440 2989 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2440 3101 3625 gene locus_tag LOCUS_2450 3101 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_2450 3622 4500 gene locus_tag LOCUS_2460 3622 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_2460 4497 5720 gene locus_tag LOCUS_2470 4497 5720 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275272.1 protein_id gnl|my_center|LOCUS_2470 >Feature sequence031 3059 5119 gene locus_tag LOCUS_2480 3059 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2480 5238 6005 gene locus_tag LOCUS_2490 5238 6005 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391810.1 protein_id gnl|my_center|LOCUS_2490 >Feature sequence032 3919 2006 gene locus_tag LOCUS_2500 gene dnaG 3919 2006 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090085.1 protein_id gnl|my_center|LOCUS_2500 4466 4011 gene locus_tag LOCUS_2510 4466 4011 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532937.1 protein_id gnl|my_center|LOCUS_2510 4758 5930 gene locus_tag LOCUS_2520 gene carA 4758 5930 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390635.1 protein_id gnl|my_center|LOCUS_2520 >Feature sequence033 549 4649 gene locus_tag LOCUS_2530 gene rpoB 549 4649 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088159.1 protein_id gnl|my_center|LOCUS_2530 >Feature sequence034 884 1633 gene locus_tag LOCUS_2540 884 1633 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982194.1 protein_id gnl|my_center|LOCUS_2540 1633 2565 gene locus_tag LOCUS_2550 1633 2565 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 protein_id gnl|my_center|LOCUS_2550 2605 3477 gene locus_tag LOCUS_2560 2605 3477 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084197.1 protein_id gnl|my_center|LOCUS_2560 3505 4011 gene locus_tag LOCUS_2570 3505 4011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2570 6003 4033 gene locus_tag LOCUS_2580 6003 4033 CDS product M13 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073607.1 protein_id gnl|my_center|LOCUS_2580 >Feature sequence035 1613 45 gene locus_tag LOCUS_2590 1613 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2590 2212 1637 gene locus_tag LOCUS_2600 2212 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2600 3108 2209 gene locus_tag LOCUS_2610 3108 2209 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 protein_id gnl|my_center|LOCUS_2610 3229 4266 gene locus_tag LOCUS_2620 3229 4266 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478452.1 protein_id gnl|my_center|LOCUS_2620 5496 4297 gene locus_tag LOCUS_2630 5496 4297 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626653.1 protein_id gnl|my_center|LOCUS_2630 >Feature sequence036 <1 673 gene locus_tag LOCUS_2640 <1 673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083050.1:peptide chain release factor 1 654 1535 gene locus_tag LOCUS_2650 gene prmC 654 1535 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384459.1 protein_id gnl|my_center|LOCUS_2650 1869 2450 gene locus_tag LOCUS_2660 1869 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2660 2672 5254 gene locus_tag LOCUS_2670 gene clpB 2672 5254 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529464.1 protein_id gnl|my_center|LOCUS_2670 >Feature sequence037 2301 2669 gene locus_tag LOCUS_2680 2301 2669 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640021.1 protein_id gnl|my_center|LOCUS_2680 2666 3646 gene locus_tag LOCUS_2690 2666 3646 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918510.1 protein_id gnl|my_center|LOCUS_2690 5318 3744 gene locus_tag LOCUS_2700 5318 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2700 >Feature sequence038 2180 1107 gene locus_tag LOCUS_2710 2180 1107 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971276.1 protein_id gnl|my_center|LOCUS_2710 2311 2736 gene locus_tag LOCUS_2720 2311 2736 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528746.1 protein_id gnl|my_center|LOCUS_2720 3816 2887 gene locus_tag LOCUS_2730 gene holA 3816 2887 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391376.1 protein_id gnl|my_center|LOCUS_2730 4370 3813 gene locus_tag LOCUS_2740 4370 3813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2740 <5800 4391 gene locus_tag LOCUS_2750 <5800 4391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391378.1:leucine--tRNA ligase >Feature sequence039 1611 328 gene locus_tag LOCUS_2760 gene pyrC 1611 328 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390939.1 protein_id gnl|my_center|LOCUS_2760 2579 1608 gene locus_tag LOCUS_2770 2579 1608 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383396.1 protein_id gnl|my_center|LOCUS_2770 3130 2660 gene locus_tag LOCUS_2780 gene ruvX 3130 2660 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384481.1 protein_id gnl|my_center|LOCUS_2780 3402 5237 gene locus_tag LOCUS_2790 gene thiC 3402 5237 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976311.1 protein_id gnl|my_center|LOCUS_2790 5253 5378 gene locus_tag LOCUS_2800 5253 5378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2800 >Feature sequence040 780 1226 gene locus_tag LOCUS_2810 780 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2810 1882 1229 gene locus_tag LOCUS_2820 gene rluA 1882 1229 CDS product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002888348.1 protein_id gnl|my_center|LOCUS_2820 1980 3173 gene locus_tag LOCUS_2830 1980 3173 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003117687.1 protein_id gnl|my_center|LOCUS_2830 3200 3967 gene locus_tag LOCUS_2840 3200 3967 CDS product dimethylarginine dimethylaminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086612.1 protein_id gnl|my_center|LOCUS_2840 >Feature sequence041 2234 561 gene locus_tag LOCUS_2850 gene recN 2234 561 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089333.1 protein_id gnl|my_center|LOCUS_2850 3033 2251 gene locus_tag LOCUS_2860 3033 2251 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388696.1 protein_id gnl|my_center|LOCUS_2860 3248 4225 gene locus_tag LOCUS_2870 gene znuA 3248 4225 CDS product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971688.1 protein_id gnl|my_center|LOCUS_2870 4670 4203 gene locus_tag LOCUS_2880 4670 4203 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103096.1 protein_id gnl|my_center|LOCUS_2880 >Feature sequence042 666 1043 gene locus_tag LOCUS_2890 666 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2890 1142 2725 gene locus_tag LOCUS_2900 1142 2725 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390250.1 protein_id gnl|my_center|LOCUS_2900 2779 3147 gene locus_tag LOCUS_2910 2779 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2910 3919 3221 gene locus_tag LOCUS_2920 3919 3221 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328127.1 protein_id gnl|my_center|LOCUS_2920 4560 3961 gene locus_tag LOCUS_2930 4560 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2930 4703 4777 gene locus_tag LOCUS_t0030 4703 4777 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence043 1460 1311 gene locus_tag LOCUS_2940 1460 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2940 3057 1576 gene locus_tag LOCUS_2950 3057 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2950 >Feature sequence044 871 20 gene locus_tag LOCUS_2960 871 20 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119048.1 protein_id gnl|my_center|LOCUS_2960 1329 1018 gene locus_tag LOCUS_2970 1329 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2970 2286 1351 gene locus_tag LOCUS_2980 2286 1351 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206906.1 protein_id gnl|my_center|LOCUS_2980 2929 2315 gene locus_tag LOCUS_2990 2929 2315 CDS product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395868.1 protein_id gnl|my_center|LOCUS_2990 3582 2932 gene locus_tag LOCUS_3000 3582 2932 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727135.1 protein_id gnl|my_center|LOCUS_3000 4612 3599 gene locus_tag LOCUS_3010 4612 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3010 5156 4737 gene locus_tag LOCUS_3020 gene bpsR 5156 4737 CDS product MarR family transcriptional regulator BpsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926293.1 protein_id gnl|my_center|LOCUS_3020 >Feature sequence045 <1 1653 gene locus_tag LOCUS_3030 <1 1653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003106692.1:arylsulfatase AtsA 1657 3324 gene locus_tag LOCUS_3040 1657 3324 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966695.1 protein_id gnl|my_center|LOCUS_3040 3300 4757 gene locus_tag LOCUS_3050 3300 4757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3050 >Feature sequence046 <1 754 gene locus_tag LOCUS_3060 <1 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090363.1:sugar phosphate isomerase/epimerase 805 1767 gene locus_tag LOCUS_3070 805 1767 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973448.1 protein_id gnl|my_center|LOCUS_3070 2401 1856 gene locus_tag LOCUS_3080 2401 1856 CDS product HutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973439.1 protein_id gnl|my_center|LOCUS_3080 3637 2417 gene locus_tag LOCUS_3090 3637 2417 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972893.1 protein_id gnl|my_center|LOCUS_3090 4870 3653 gene locus_tag LOCUS_3100 gene dgaE 4870 3653 CDS product D-glucosaminate-6-phosphate ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188469.1 protein_id gnl|my_center|LOCUS_3100 >Feature sequence047 76 1050 gene locus_tag LOCUS_3110 76 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3110 1679 1047 gene locus_tag LOCUS_3120 1679 1047 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266003.1 protein_id gnl|my_center|LOCUS_3120 1709 2371 gene locus_tag LOCUS_3130 1709 2371 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626629.1 protein_id gnl|my_center|LOCUS_3130 2827 2465 gene locus_tag LOCUS_3140 2827 2465 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207360.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_3140 4312 2897 gene locus_tag LOCUS_3150 4312 2897 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_3150 >Feature sequence048 306 1235 gene locus_tag LOCUS_3160 306 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3160 1238 1903 gene locus_tag LOCUS_3170 1238 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3170 1948 2634 gene locus_tag LOCUS_3180 1948 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3180 3577 2693 gene locus_tag LOCUS_3190 3577 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3190 4733 3711 gene locus_tag LOCUS_3200 4733 3711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3200 >Feature sequence049 1893 52 gene locus_tag LOCUS_3210 gene glmS 1893 52 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390777.1 protein_id gnl|my_center|LOCUS_3210 3203 1905 gene locus_tag LOCUS_3220 gene glmU 3203 1905 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626497.1 protein_id gnl|my_center|LOCUS_3220 3433 4134 gene locus_tag LOCUS_3230 3433 4134 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971741.1 protein_id gnl|my_center|LOCUS_3230 <4998 4118 gene locus_tag LOCUS_3240 <4998 4118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390849.1:nucleotidyltransferase family protein >Feature sequence050 1 657 gene locus_tag LOCUS_3250 1 657 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258992.1 protein_id gnl|my_center|LOCUS_3250 2974 680 gene locus_tag LOCUS_3260 2974 680 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972026.1 protein_id gnl|my_center|LOCUS_3260 4838 3054 gene locus_tag LOCUS_3270 4838 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3270 >Feature sequence051 <1 1069 gene locus_tag LOCUS_3280 <1 1069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188359.1:diaminopimelate decarboxylase 2947 1121 gene locus_tag LOCUS_3290 2947 1121 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071046.1 protein_id gnl|my_center|LOCUS_3290 3178 3011 gene locus_tag LOCUS_3300 3178 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3300 3775 3293 gene locus_tag LOCUS_3310 3775 3293 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265572.1 protein_id gnl|my_center|LOCUS_3310 >Feature sequence052 2678 1875 gene locus_tag LOCUS_3320 2678 1875 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815499.1 protein_id gnl|my_center|LOCUS_3320 3662 2682 gene locus_tag LOCUS_3330 3662 2682 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035835.1 protein_id gnl|my_center|LOCUS_3330 4210 3665 gene locus_tag LOCUS_3340 4210 3665 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119119.1 protein_id gnl|my_center|LOCUS_3340 <4788 4210 gene locus_tag LOCUS_3350 <4788 4210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529387.1:histidinol-phosphate transaminase >Feature sequence053 1243 107 gene locus_tag LOCUS_3360 1243 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3360 1448 1233 gene locus_tag LOCUS_3370 1448 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3370 3976 2576 gene locus_tag LOCUS_3380 3976 2576 CDS product phage/plasmid primase, P4 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903975.1 protein_id gnl|my_center|LOCUS_3380 >Feature sequence054 4259 1746 gene locus_tag LOCUS_3390 gene hrpB 4259 1746 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405451.1 protein_id gnl|my_center|LOCUS_3390 >Feature sequence055 2050 815 gene locus_tag LOCUS_3400 gene ftsA 2050 815 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530962.1 protein_id gnl|my_center|LOCUS_3400 2417 2052 gene locus_tag LOCUS_3410 2417 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_3410 2951 2457 gene locus_tag LOCUS_3420 2951 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3420 3850 2939 gene locus_tag LOCUS_3430 3850 2939 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337244.1 protein_id gnl|my_center|LOCUS_3430 <4740 3847 gene locus_tag LOCUS_3440 <4740 3847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388703.1:UDP-N-acetylmuramate dehydrogenase >Feature sequence056 625 314 gene locus_tag LOCUS_3450 625 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_3450 1257 631 gene locus_tag LOCUS_3460 1257 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_3460 3167 1320 gene locus_tag LOCUS_3470 gene sppA 3167 1320 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072397.1 protein_id gnl|my_center|LOCUS_3470 3560 4681 gene locus_tag LOCUS_3480 gene gcvT 3560 4681 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478448.1 protein_id gnl|my_center|LOCUS_3480 >Feature sequence057 850 419 gene locus_tag LOCUS_3490 850 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3490 2580 952 gene locus_tag LOCUS_3500 gene lnt 2580 952 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391521.1 protein_id gnl|my_center|LOCUS_3500 3489 2614 gene locus_tag LOCUS_3510 3489 2614 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391520.1 protein_id gnl|my_center|LOCUS_3510 4072 3539 gene locus_tag LOCUS_3520 gene ybeY 4072 3539 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391519.1 protein_id gnl|my_center|LOCUS_3520 <4680 4069 gene locus_tag LOCUS_3530 <4680 4069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391518.1:PhoH family protein >Feature sequence058 49 486 gene locus_tag LOCUS_3540 gene cpdR1 49 486 CDS product response regulator CpdR1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709376.1 protein_id gnl|my_center|LOCUS_3540 581 1714 gene locus_tag LOCUS_3550 581 1714 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615452.1 protein_id gnl|my_center|LOCUS_3550 2013 4625 gene locus_tag LOCUS_3560 gene pepN 2013 4625 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_3560 >Feature sequence059 2942 1782 gene locus_tag LOCUS_3570 gene argE 2942 1782 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106035.1 protein_id gnl|my_center|LOCUS_3570 4414 2966 gene locus_tag LOCUS_3580 4414 2966 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933527.1 protein_id gnl|my_center|LOCUS_3580 >Feature sequence060 <1 530 gene locus_tag LOCUS_3590 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097085.1:cupin domain-containing protein 2359 527 gene locus_tag LOCUS_3600 gene cobT 2359 527 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083010.1 protein_id gnl|my_center|LOCUS_3600 3382 2384 gene locus_tag LOCUS_3610 gene cobS 3382 2384 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175820.1 protein_id gnl|my_center|LOCUS_3610 3933 3391 gene locus_tag LOCUS_3620 3933 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3620 4018 4284 gene locus_tag LOCUS_3630 4018 4284 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083017.1 protein_id gnl|my_center|LOCUS_3630 >Feature sequence061 1571 1029 gene locus_tag LOCUS_3640 1571 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3640 2588 1725 gene locus_tag LOCUS_3650 2588 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3650 3813 2794 gene locus_tag LOCUS_3660 3813 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3660 4535 3879 gene locus_tag LOCUS_3670 4535 3879 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222950.1 protein_id gnl|my_center|LOCUS_3670 >Feature sequence062 <1 802 gene locus_tag LOCUS_3680 <1 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037978.1:L-serine ammonia-lyase 932 4126 gene locus_tag LOCUS_3690 gene putA 932 4126 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038915.1 protein_id gnl|my_center|LOCUS_3690 >Feature sequence063 <1 778 gene locus_tag LOCUS_3700 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391347.1:ATP-dependent protease ATPase subunit HslU 833 1702 gene locus_tag LOCUS_3710 833 1702 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266170.1 protein_id gnl|my_center|LOCUS_3710 1940 1797 gene locus_tag LOCUS_3720 1940 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3720 2332 2541 gene locus_tag LOCUS_3730 2332 2541 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720550.1 protein_id gnl|my_center|LOCUS_3730 3191 2745 gene locus_tag LOCUS_3740 3191 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3740 3446 3279 gene locus_tag LOCUS_3750 3446 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3750 3907 3569 gene locus_tag LOCUS_3760 3907 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3760 >Feature sequence064 1683 451 gene locus_tag LOCUS_3770 1683 451 CDS product bifunctional alpha/beta hydrolase/OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118826550.1 protein_id gnl|my_center|LOCUS_3770 >Feature sequence065 1665 811 gene locus_tag LOCUS_3780 1665 811 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085321.1 protein_id gnl|my_center|LOCUS_3780 2360 1677 gene locus_tag LOCUS_3790 2360 1677 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390702.1 protein_id gnl|my_center|LOCUS_3790 2662 2435 gene locus_tag LOCUS_3800 2662 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3800 2791 3813 gene locus_tag LOCUS_3810 2791 3813 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390700.1 protein_id gnl|my_center|LOCUS_3810 >Feature sequence066 1596 1144 gene locus_tag LOCUS_3820 1596 1144 CDS product GcrA family cell cycle regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389346.1 protein_id gnl|my_center|LOCUS_3820 1795 2610 gene locus_tag LOCUS_3830 1795 2610 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388398.1 protein_id gnl|my_center|LOCUS_3830 2704 3936 gene locus_tag LOCUS_3840 2704 3936 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533643.1 protein_id gnl|my_center|LOCUS_3840 >Feature sequence067 2313 754 gene locus_tag LOCUS_3850 gene metG 2313 754 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389391.1 protein_id gnl|my_center|LOCUS_3850 3457 2336 gene locus_tag LOCUS_3860 3457 2336 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389392.1 protein_id gnl|my_center|LOCUS_3860 3972 3553 gene locus_tag LOCUS_3870 3972 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3870 4439 3969 gene locus_tag LOCUS_3880 4439 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3880 >Feature sequence068 27 623 gene locus_tag LOCUS_3890 27 623 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023187660.1 protein_id gnl|my_center|LOCUS_3890 857 1417 gene locus_tag LOCUS_3900 857 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3900 2264 1473 gene locus_tag LOCUS_3910 2264 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3910 3084 2296 gene locus_tag LOCUS_3920 3084 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3920 <4504 3197 gene locus_tag LOCUS_3930 <4504 3197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482406.1:SulP family inorganic anion transporter >Feature sequence069 453 319 gene locus_tag LOCUS_3940 453 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3940 684 1379 gene locus_tag LOCUS_3950 684 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_3950 1376 2791 gene locus_tag LOCUS_3960 1376 2791 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338686.1 protein_id gnl|my_center|LOCUS_3960 2796 4229 gene locus_tag LOCUS_3970 2796 4229 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175987.1 protein_id gnl|my_center|LOCUS_3970 >Feature sequence070 97 471 gene locus_tag LOCUS_3980 97 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3980 547 828 gene locus_tag LOCUS_3990 547 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_3990 1242 1694 gene locus_tag LOCUS_4000 1242 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4000 2069 1716 gene locus_tag LOCUS_4010 2069 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4010 2997 2497 gene locus_tag LOCUS_4020 2997 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_4020 3670 2909 gene locus_tag LOCUS_4030 3670 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_4030 >Feature sequence071 1361 546 gene locus_tag LOCUS_4040 1361 546 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391374.1 protein_id gnl|my_center|LOCUS_4040 2009 1398 gene locus_tag LOCUS_4050 gene rsmG 2009 1398 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391373.1 protein_id gnl|my_center|LOCUS_4050 3910 2018 gene locus_tag LOCUS_4060 gene mnmG 3910 2018 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266007.1 protein_id gnl|my_center|LOCUS_4060 >Feature sequence072 1110 49 gene locus_tag LOCUS_4070 1110 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4070 1406 1128 gene locus_tag LOCUS_4080 1406 1128 CDS product DUF2160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719814.1 protein_id gnl|my_center|LOCUS_4080 2222 1419 gene locus_tag LOCUS_4090 2222 1419 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337643.1 protein_id gnl|my_center|LOCUS_4090 3094 2219 gene locus_tag LOCUS_4100 3094 2219 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719816.1 protein_id gnl|my_center|LOCUS_4100 4149 3091 gene locus_tag LOCUS_4110 4149 3091 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337644.1 protein_id gnl|my_center|LOCUS_4110 >Feature sequence073 698 2131 gene locus_tag LOCUS_4120 698 2131 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867411.1 protein_id gnl|my_center|LOCUS_4120 2282 2569 gene locus_tag LOCUS_4130 gene groES 2282 2569 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388344.1 protein_id gnl|my_center|LOCUS_4130 2631 4283 gene locus_tag LOCUS_4140 gene groL 2631 4283 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388345.1 protein_id gnl|my_center|LOCUS_4140 >Feature sequence074 290 490 gene locus_tag LOCUS_4150 290 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4150 599 3787 gene locus_tag LOCUS_4160 599 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_4160 <4406 3860 gene locus_tag LOCUS_4170 <4406 3860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012639997.1:gamma-glutamyltransferase >Feature sequence075 429 1490 gene locus_tag LOCUS_4180 429 1490 CDS product maleylacetate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085467.1 protein_id gnl|my_center|LOCUS_4180 1958 1494 gene locus_tag LOCUS_4190 1958 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4190 >Feature sequence076 535 1308 gene locus_tag LOCUS_4200 535 1308 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625959.1 protein_id gnl|my_center|LOCUS_4200 2078 1320 gene locus_tag LOCUS_4210 2078 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4210 2993 2280 gene locus_tag LOCUS_4220 2993 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4220 4177 3053 gene locus_tag LOCUS_4230 4177 3053 CDS product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391111.1 protein_id gnl|my_center|LOCUS_4230 >Feature sequence077 <1 2069 gene locus_tag LOCUS_4240 <1 2069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003535989.1:transketolase 2090 3097 gene locus_tag LOCUS_4250 gene gap 2090 3097 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084339.1 protein_id gnl|my_center|LOCUS_4250 3097 4308 gene locus_tag LOCUS_4260 3097 4308 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529247.1 protein_id gnl|my_center|LOCUS_4260 >Feature sequence078 <1 828 gene locus_tag LOCUS_4270 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330113.1:CRTAC1 family protein 831 2711 gene locus_tag LOCUS_4280 831 2711 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084127.1 protein_id gnl|my_center|LOCUS_4280 3450 2719 gene locus_tag LOCUS_4290 3450 2719 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265727.1 protein_id gnl|my_center|LOCUS_4290 4216 3530 gene locus_tag LOCUS_4300 4216 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4300 >Feature sequence079 <1 652 gene locus_tag LOCUS_4310 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388232.1:penicillin-binding protein 2 652 1800 gene locus_tag LOCUS_4320 gene rodA 652 1800 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597348.1 protein_id gnl|my_center|LOCUS_4320 2369 1803 gene locus_tag LOCUS_4330 2369 1803 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338458.1 protein_id gnl|my_center|LOCUS_4330 3192 2362 gene locus_tag LOCUS_4340 3192 2362 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390690.1 protein_id gnl|my_center|LOCUS_4340 <4362 3221 gene locus_tag LOCUS_4350 <4362 3221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880493.1:mechanosensitive ion channel family protein >Feature sequence080 251 526 gene locus_tag LOCUS_4360 251 526 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 protein_id gnl|my_center|LOCUS_4360 1139 771 gene locus_tag LOCUS_4370 1139 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_4370 1754 1266 gene locus_tag LOCUS_4380 1754 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_4380 2484 1765 gene locus_tag LOCUS_4390 2484 1765 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267485.1 protein_id gnl|my_center|LOCUS_4390 2649 4148 gene locus_tag LOCUS_4400 2649 4148 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261752.1 protein_id gnl|my_center|LOCUS_4400 >Feature sequence081 2 1021 gene locus_tag LOCUS_4410 2 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4410 1018 1668 gene locus_tag LOCUS_4420 1018 1668 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336954.1 protein_id gnl|my_center|LOCUS_4420 1826 2194 gene locus_tag LOCUS_4430 gene rpsM 1826 2194 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390416.1 protein_id gnl|my_center|LOCUS_4430 2207 2593 gene locus_tag LOCUS_4440 gene rpsK 2207 2593 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919150.1 protein_id gnl|my_center|LOCUS_4440 2669 3691 gene locus_tag LOCUS_4450 2669 3691 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626433.1 protein_id gnl|my_center|LOCUS_4450 3744 4178 gene locus_tag LOCUS_4460 gene rplQ 3744 4178 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088131.1 protein_id gnl|my_center|LOCUS_4460 >Feature sequence082 479 309 gene locus_tag LOCUS_4470 479 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_4470 2218 509 gene locus_tag LOCUS_4480 gene acs 2218 509 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_4480 <4304 2365 gene locus_tag LOCUS_4490 <4304 2365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766195.1:glucosamine-6-phosphate deaminase >Feature sequence083 615 1517 gene locus_tag LOCUS_4500 gene cysD 615 1517 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417374.1 protein_id gnl|my_center|LOCUS_4500 1520 3367 gene locus_tag LOCUS_4510 gene cysN 1520 3367 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503688.1 protein_id gnl|my_center|LOCUS_4510 4174 3422 gene locus_tag LOCUS_4520 4174 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4520 >Feature sequence084 877 1641 gene locus_tag LOCUS_4530 877 1641 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388186.1 protein_id gnl|my_center|LOCUS_4530 2634 1654 gene locus_tag LOCUS_4540 2634 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4540 3081 2644 gene locus_tag LOCUS_4550 3081 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_4550 3899 3078 gene locus_tag LOCUS_4560 3899 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_4560 >Feature sequence085 237 1361 gene locus_tag LOCUS_4570 237 1361 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174849007.1 protein_id gnl|my_center|LOCUS_4570 1741 1424 gene locus_tag LOCUS_4580 gene trxA 1741 1424 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921368.1 protein_id gnl|my_center|LOCUS_4580 <4191 1819 gene locus_tag LOCUS_4590 <4191 1819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391181.1:double-strand break repair helicase AddA >Feature sequence086 142 1071 gene locus_tag LOCUS_4600 gene hemB 142 1071 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966342.1 protein_id gnl|my_center|LOCUS_4600 1557 1081 gene locus_tag LOCUS_4610 1557 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_4610 1957 1607 gene locus_tag LOCUS_4620 1957 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_4620 2147 3379 gene locus_tag LOCUS_4630 2147 3379 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921462.1 protein_id gnl|my_center|LOCUS_4630 >Feature sequence087 699 1850 gene locus_tag LOCUS_4640 699 1850 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390032.1 protein_id gnl|my_center|LOCUS_4640 1852 2205 gene locus_tag LOCUS_4650 1852 2205 CDS product proton-translocating transhydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066973.1 protein_id gnl|my_center|LOCUS_4650 2209 3627 gene locus_tag LOCUS_4660 2209 3627 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921135.1 protein_id gnl|my_center|LOCUS_4660 <4173 3645 gene locus_tag LOCUS_4670 <4173 3645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005416813.1:YigZ family protein >Feature sequence088 <1 2566 gene locus_tag LOCUS_4680 <1 2566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919340.1:regulatory protein FlaEY 2638 3072 gene locus_tag LOCUS_4690 2638 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4690 <4139 3085 gene locus_tag LOCUS_4700 <4139 3085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037398238.1:DNA polymerase I >Feature sequence089 3 1325 gene locus_tag LOCUS_4710 3 1325 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729117.1 protein_id gnl|my_center|LOCUS_4710 2145 1372 gene locus_tag LOCUS_4720 2145 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4720 2698 2923 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gaatgatccattgttgaatggtccatag <4106 3398 gene locus_tag LOCUS_4730 <4106 3398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265648.1:copper resistance system multicopper oxidase note possible pseudo, internal stop codon, frameshifted >Feature sequence090 2 127 gene locus_tag LOCUS_4740 2 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4740 124 1272 gene locus_tag LOCUS_4750 gene tgt 124 1272 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337793.1 protein_id gnl|my_center|LOCUS_4750 1348 1423 gene locus_tag LOCUS_t0040 1348 1423 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1562 2866 gene locus_tag LOCUS_4760 gene phoA 1562 2866 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368025.1 protein_id gnl|my_center|LOCUS_4760 >Feature sequence091 95 355 gene locus_tag LOCUS_4770 95 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947964.1 protein_id gnl|my_center|LOCUS_4770 443 1297 gene locus_tag LOCUS_4780 443 1297 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444160.1 protein_id gnl|my_center|LOCUS_4780 1278 2087 gene locus_tag LOCUS_4790 1278 2087 CDS product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947962.1 protein_id gnl|my_center|LOCUS_4790 2522 2070 gene locus_tag LOCUS_4800 2522 2070 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946342.1 protein_id gnl|my_center|LOCUS_4800 >Feature sequence092 2051 1062 gene locus_tag LOCUS_4810 2051 1062 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390713.1 protein_id gnl|my_center|LOCUS_4810 2325 2711 gene locus_tag LOCUS_4820 2325 2711 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008567674.1 protein_id gnl|my_center|LOCUS_4820 2711 3370 gene locus_tag LOCUS_4830 2711 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4830 <4029 3403 gene locus_tag LOCUS_4840 <4029 3403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918596.1:EAL domain-containing protein >Feature sequence093 3655 968 gene locus_tag LOCUS_4850 gene mutS 3655 968 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391288.1 protein_id gnl|my_center|LOCUS_4850 >Feature sequence094 591 1403 gene locus_tag LOCUS_4860 591 1403 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087855.1 protein_id gnl|my_center|LOCUS_4860 1423 2337 gene locus_tag LOCUS_4870 1423 2337 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087855.1 protein_id gnl|my_center|LOCUS_4870 3091 2402 gene locus_tag LOCUS_4880 gene phoU 3091 2402 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388360.1 protein_id gnl|my_center|LOCUS_4880 3869 3123 gene locus_tag LOCUS_4890 gene pstB 3869 3123 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081467712.1 protein_id gnl|my_center|LOCUS_4890 >Feature sequence095 691 605 gene locus_tag LOCUS_t0050 691 605 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1029 781 gene locus_tag LOCUS_4900 1029 781 CDS product FliM/FliN family flagellar motor switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390918.1 protein_id gnl|my_center|LOCUS_4900 1135 1782 gene locus_tag LOCUS_4910 gene lipB 1135 1782 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640426.1 protein_id gnl|my_center|LOCUS_4910 2103 1786 gene locus_tag LOCUS_4920 2103 1786 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390404.1 protein_id gnl|my_center|LOCUS_4920 <4011 2109 gene locus_tag LOCUS_4930 <4011 2109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037392124.1:acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha >Feature sequence096 <1 1199 gene locus_tag LOCUS_4940 <1 1199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003809055.1:type I secretion system permease/ATPase 1204 2487 gene locus_tag LOCUS_4950 1204 2487 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040402.1 protein_id gnl|my_center|LOCUS_4950 2563 3636 gene locus_tag LOCUS_4960 2563 3636 CDS product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141839.1 protein_id gnl|my_center|LOCUS_4960 >Feature sequence097 92 595 gene locus_tag LOCUS_4970 92 595 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388110.1 protein_id gnl|my_center|LOCUS_4970 739 1953 gene locus_tag LOCUS_4980 739 1953 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388109.1 protein_id gnl|my_center|LOCUS_4980 3202 2009 gene locus_tag LOCUS_4990 3202 2009 CDS product cyclic nucleotide-gated ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967190.1 protein_id gnl|my_center|LOCUS_4990 <3995 3215 gene locus_tag LOCUS_5000 <3995 3215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390445.1:alanine--tRNA ligase >Feature sequence098 <1 962 gene locus_tag LOCUS_5010 <1 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261388.1:30S ribosomal protein S6--L-glutamate ligase 969 2000 gene locus_tag LOCUS_5020 969 2000 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261387.1 protein_id gnl|my_center|LOCUS_5020 3376 1997 gene locus_tag LOCUS_5030 gene rimK 3376 1997 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962905.1 protein_id gnl|my_center|LOCUS_5030 <3953 3441 gene locus_tag LOCUS_5040 <3953 3441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024232.1:methyltransferase domain-containing protein >Feature sequence099 1835 690 gene locus_tag LOCUS_5050 1835 690 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391095.1 protein_id gnl|my_center|LOCUS_5050 1919 2437 gene locus_tag LOCUS_5060 gene def 1919 2437 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378195.1 protein_id gnl|my_center|LOCUS_5060 2449 3357 gene locus_tag LOCUS_5070 gene fmt 2449 3357 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383426.1 protein_id gnl|my_center|LOCUS_5070 >Feature sequence100 1 852 gene locus_tag LOCUS_5080 1 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5080 1205 849 gene locus_tag LOCUS_5090 1205 849 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528719.1 protein_id gnl|my_center|LOCUS_5090 1765 1202 gene locus_tag LOCUS_5100 1765 1202 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970599.1 protein_id gnl|my_center|LOCUS_5100 2991 1747 gene locus_tag LOCUS_5110 2991 1747 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947710.1 protein_id gnl|my_center|LOCUS_5110 3705 2995 gene locus_tag LOCUS_5120 3705 2995 CDS product Tim44/TimA family putative adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528722.1 protein_id gnl|my_center|LOCUS_5120 >Feature sequence101 <1 1392 gene locus_tag LOCUS_5130 <1 1392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275523.1:serine hydrolase 2022 1393 gene locus_tag LOCUS_5140 2022 1393 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063692.1 protein_id gnl|my_center|LOCUS_5140 <3932 2036 gene locus_tag LOCUS_5150 <3932 2036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004529751.1:penicillin acylase family protein >Feature sequence102 1109 1651 gene locus_tag LOCUS_5160 1109 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5160 3353 1689 gene locus_tag LOCUS_5170 3353 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5170 >Feature sequence103 525 1292 gene locus_tag LOCUS_5180 525 1292 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527978.1 protein_id gnl|my_center|LOCUS_5180 1298 2107 gene locus_tag LOCUS_5190 1298 2107 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527980.1 protein_id gnl|my_center|LOCUS_5190 2107 3285 gene locus_tag LOCUS_5200 2107 3285 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064927.1 protein_id gnl|my_center|LOCUS_5200 3315 3707 gene locus_tag LOCUS_5210 3315 3707 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527982.1 protein_id gnl|my_center|LOCUS_5210 3738 3914 gene locus_tag LOCUS_5220 3738 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5220 >Feature sequence104 <1 525 gene locus_tag LOCUS_5230 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201418056.1:dienelactone hydrolase family protein 655 1821 gene locus_tag LOCUS_5240 gene metK 655 1821 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391523.1 protein_id gnl|my_center|LOCUS_5240 1996 2628 gene locus_tag LOCUS_5250 gene trmB 1996 2628 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391524.1 protein_id gnl|my_center|LOCUS_5250 2788 3294 gene locus_tag LOCUS_5260 gene rimP 2788 3294 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538041.1 protein_id gnl|my_center|LOCUS_5260 >Feature sequence105 445 1155 gene locus_tag LOCUS_5270 445 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5270 2181 1159 gene locus_tag LOCUS_5280 2181 1159 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838141.1 protein_id gnl|my_center|LOCUS_5280 <3919 2178 gene locus_tag LOCUS_5290 <3919 2178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222472.1:2-oxoacid:acceptor oxidoreductase subunit alpha >Feature sequence106 <1 1491 gene locus_tag LOCUS_5300 <1 1491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038616.1:pitrilysin family protein 1464 2684 gene locus_tag LOCUS_5310 1464 2684 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857806.1 protein_id gnl|my_center|LOCUS_5310 2700 3755 gene locus_tag LOCUS_5320 gene pyrC 2700 3755 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073490.1 protein_id gnl|my_center|LOCUS_5320 >Feature sequence107 1872 64 gene locus_tag LOCUS_5330 gene recJ 1872 64 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390161.1 protein_id gnl|my_center|LOCUS_5330 2853 1882 gene locus_tag LOCUS_5340 gene glpX 2853 1882 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531987.1 protein_id gnl|my_center|LOCUS_5340 <3915 2901 gene locus_tag LOCUS_5350 <3915 2901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390163.1:homoserine dehydrogenase >Feature sequence108 1108 149 gene locus_tag LOCUS_5360 1108 149 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818717.1 protein_id gnl|my_center|LOCUS_5360 2433 1117 gene locus_tag LOCUS_5370 2433 1117 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389530.1 protein_id gnl|my_center|LOCUS_5370 3662 2463 gene locus_tag LOCUS_5380 3662 2463 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969644.1 protein_id gnl|my_center|LOCUS_5380 >Feature sequence109 130 954 gene locus_tag LOCUS_5390 130 954 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639851.1 protein_id gnl|my_center|LOCUS_5390 951 1808 gene locus_tag LOCUS_5400 951 1808 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391360.1 protein_id gnl|my_center|LOCUS_5400 1808 2398 gene locus_tag LOCUS_5410 gene coaE 1808 2398 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639852.1 protein_id gnl|my_center|LOCUS_5410 2399 3085 gene locus_tag LOCUS_5420 gene dnaQ 2399 3085 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391358.1 protein_id gnl|my_center|LOCUS_5420 3651 3130 gene locus_tag LOCUS_5430 gene secB 3651 3130 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968288.1 protein_id gnl|my_center|LOCUS_5430 >Feature sequence110 839 3415 gene locus_tag LOCUS_5440 839 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5440 >Feature sequence111 1130 2644 gene locus_tag LOCUS_5450 1130 2644 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460243.1 protein_id gnl|my_center|LOCUS_5450 3696 2641 gene locus_tag LOCUS_5460 3696 2641 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639906.1 protein_id gnl|my_center|LOCUS_5460 >Feature sequence112 8 940 gene locus_tag LOCUS_5470 gene dusB 8 940 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014411626.1 protein_id gnl|my_center|LOCUS_5470 944 2083 gene locus_tag LOCUS_5480 944 2083 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087259.1 protein_id gnl|my_center|LOCUS_5480 2080 3531 gene locus_tag LOCUS_5490 gene ntrC 2080 3531 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535443.1 protein_id gnl|my_center|LOCUS_5490 >Feature sequence113 735 58 gene locus_tag LOCUS_5500 735 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5500 1898 771 gene locus_tag LOCUS_5510 1898 771 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020134.1 protein_id gnl|my_center|LOCUS_5510 2142 2651 gene locus_tag LOCUS_5520 2142 2651 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071597.1 protein_id gnl|my_center|LOCUS_5520 3224 2751 gene locus_tag LOCUS_5530 3224 2751 CDS product RT0821/Lpp0805 family surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596824.1 protein_id gnl|my_center|LOCUS_5530 >Feature sequence114 346 1425 gene locus_tag LOCUS_5540 gene obgE 346 1425 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185662252.1 protein_id gnl|my_center|LOCUS_5540 1435 2565 gene locus_tag LOCUS_5550 gene proB 1435 2565 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972562.1 protein_id gnl|my_center|LOCUS_5550 >Feature sequence115 <1 794 gene locus_tag LOCUS_5560 <1 794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003233301.1:Na+/H+ antiporter NhaC 2974 791 gene locus_tag LOCUS_5570 2974 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5570 >Feature sequence116 2 325 gene locus_tag LOCUS_5580 2 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5580 418 2049 gene locus_tag LOCUS_5590 418 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5590 3334 2054 gene locus_tag LOCUS_5600 gene radA 3334 2054 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962283.1 protein_id gnl|my_center|LOCUS_5600 >Feature sequence117 634 470 gene locus_tag LOCUS_5610 634 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5610 1058 642 gene locus_tag LOCUS_5620 1058 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5620 2714 1167 gene locus_tag LOCUS_5630 gene guaA 2714 1167 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397349.1 protein_id gnl|my_center|LOCUS_5630 <3745 2748 gene locus_tag LOCUS_5640 <3745 2748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387996.1:RsmB/NOP family class I SAM-dependent RNA methyltransferase >Feature sequence118 1400 255 gene locus_tag LOCUS_5650 1400 255 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164548906.1 protein_id gnl|my_center|LOCUS_5650 2823 1507 gene locus_tag LOCUS_5660 2823 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5660 3283 2846 gene locus_tag LOCUS_5670 3283 2846 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530850.1 protein_id gnl|my_center|LOCUS_5670 >Feature sequence119 607 5 gene locus_tag LOCUS_5680 607 5 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970963.1 protein_id gnl|my_center|LOCUS_5680 847 629 gene locus_tag LOCUS_5690 gene infA 847 629 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327290.1 protein_id gnl|my_center|LOCUS_5690 1451 933 gene locus_tag LOCUS_5700 1451 933 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920202.1 protein_id gnl|my_center|LOCUS_5700 1949 1458 gene locus_tag LOCUS_5710 1949 1458 CDS product UPF0262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312939.1 protein_id gnl|my_center|LOCUS_5710 3248 1950 gene locus_tag LOCUS_5720 gene hisD 3248 1950 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530199.1 protein_id gnl|my_center|LOCUS_5720 <3740 3232 gene locus_tag LOCUS_5730 <3740 3232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390582.1:ATP phosphoribosyltransferase >Feature sequence120 1097 1519 gene locus_tag LOCUS_5740 1097 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5740 1616 1870 gene locus_tag LOCUS_5750 gene grxC 1616 1870 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173827777.1 protein_id gnl|my_center|LOCUS_5750 1867 2715 gene locus_tag LOCUS_5760 1867 2715 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083043.1 protein_id gnl|my_center|LOCUS_5760 2744 3271 gene locus_tag LOCUS_5770 2744 3271 CDS product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394735.1 protein_id gnl|my_center|LOCUS_5770 >Feature sequence121 1780 194 gene locus_tag LOCUS_5780 1780 194 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918975.1 protein_id gnl|my_center|LOCUS_5780 2041 3117 gene locus_tag LOCUS_5790 2041 3117 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064449.1 protein_id gnl|my_center|LOCUS_5790 >Feature sequence122 483 4 gene locus_tag LOCUS_5800 483 4 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087466.1 protein_id gnl|my_center|LOCUS_5800 597 3506 gene locus_tag LOCUS_5810 gene uvrA 597 3506 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389505.1 protein_id gnl|my_center|LOCUS_5810 >Feature sequence123 <1 1933 gene locus_tag LOCUS_5820 <1 1933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039380.1:acyl-CoA dehydrogenase 2199 2972 gene locus_tag LOCUS_5830 2199 2972 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 protein_id gnl|my_center|LOCUS_5830 <3702 2969 gene locus_tag LOCUS_5840 <3702 2969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004597728.1:IscS subfamily cysteine desulfurase >Feature sequence124 395 1654 gene locus_tag LOCUS_5850 395 1654 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967232.1 protein_id gnl|my_center|LOCUS_5850 1716 2444 gene locus_tag LOCUS_5860 1716 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5860 2958 2449 gene locus_tag LOCUS_5870 gene dfrA 2958 2449 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637198.1 protein_id gnl|my_center|LOCUS_5870 <3698 2955 gene locus_tag LOCUS_5880 <3698 2955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089252.1:thymidylate synthase >Feature sequence125 1825 872 gene locus_tag LOCUS_5890 1825 872 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030497.1 protein_id gnl|my_center|LOCUS_5890 2692 1931 gene locus_tag LOCUS_5900 2692 1931 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225772.1 protein_id gnl|my_center|LOCUS_5900 >Feature sequence126 1972 1478 gene locus_tag LOCUS_5910 1972 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5910 3616 2021 gene locus_tag LOCUS_5920 3616 2021 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918975.1 protein_id gnl|my_center|LOCUS_5920 >Feature sequence127 1244 645 gene locus_tag LOCUS_5930 gene ruvA 1244 645 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393643.1 protein_id gnl|my_center|LOCUS_5930 1813 1241 gene locus_tag LOCUS_5940 gene ruvC 1813 1241 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388842.1 protein_id gnl|my_center|LOCUS_5940 2193 1810 gene locus_tag LOCUS_5950 2193 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_5950 2559 2302 gene locus_tag LOCUS_5960 2559 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_5960 3476 2658 gene locus_tag LOCUS_5970 3476 2658 CDS product YmdB family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921077.1 protein_id gnl|my_center|LOCUS_5970 >Feature sequence128 2 163 gene locus_tag LOCUS_5980 2 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5980 723 193 gene locus_tag LOCUS_5990 723 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5990 1747 752 gene locus_tag LOCUS_6000 gene thiL 1747 752 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389573.1 protein_id gnl|my_center|LOCUS_6000 2214 1756 gene locus_tag LOCUS_6010 gene nusB 2214 1756 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707539.1 protein_id gnl|my_center|LOCUS_6010 2645 2211 gene locus_tag LOCUS_6020 gene ribH 2645 2211 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975017.1 protein_id gnl|my_center|LOCUS_6020 3166 2651 gene locus_tag LOCUS_6030 3166 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_6030 >Feature sequence129 1246 1695 gene locus_tag LOCUS_6040 1246 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6040 >Feature sequence130 1296 322 gene locus_tag LOCUS_6050 gene moaA 1296 322 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168084.1 protein_id gnl|my_center|LOCUS_6050 1906 1520 gene locus_tag LOCUS_6060 1906 1520 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530041.1 protein_id gnl|my_center|LOCUS_6060 2514 1906 gene locus_tag LOCUS_6070 gene recR 2514 1906 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527928.1 protein_id gnl|my_center|LOCUS_6070 2852 2529 gene locus_tag LOCUS_6080 2852 2529 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391219.1 protein_id gnl|my_center|LOCUS_6080 <3621 2900 gene locus_tag LOCUS_6090 <3621 2900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013527932.1:DNA polymerase III subunit gamma/tau >Feature sequence131 1454 699 gene locus_tag LOCUS_6100 gene sufC 1454 699 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240388.1 protein_id gnl|my_center|LOCUS_6100 2935 1481 gene locus_tag LOCUS_6110 gene sufB 2935 1481 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390323.1 protein_id gnl|my_center|LOCUS_6110 3438 2941 gene locus_tag LOCUS_6120 3438 2941 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390324.1 protein_id gnl|my_center|LOCUS_6120 >Feature sequence132 172 678 gene locus_tag LOCUS_6130 gene hpaR 172 678 CDS product homoprotocatechuate degradation operon regulator HpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085755.1 protein_id gnl|my_center|LOCUS_6130 912 1058 gene locus_tag LOCUS_6140 912 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6140 1243 1716 gene locus_tag LOCUS_6150 1243 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6150 2618 1713 gene locus_tag LOCUS_6160 2618 1713 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533671.1 protein_id gnl|my_center|LOCUS_6160 3353 2622 gene locus_tag LOCUS_6170 3353 2622 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533670.1 protein_id gnl|my_center|LOCUS_6170 >Feature sequence133 660 112 gene locus_tag LOCUS_6180 gene ppa 660 112 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528997.1 protein_id gnl|my_center|LOCUS_6180 2897 798 gene locus_tag LOCUS_6190 2897 798 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389571.1 protein_id gnl|my_center|LOCUS_6190 >Feature sequence134 679 272 gene locus_tag LOCUS_6200 gene apaG 679 272 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533640.1 protein_id gnl|my_center|LOCUS_6200 1918 701 gene locus_tag LOCUS_6210 1918 701 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310686.1 protein_id gnl|my_center|LOCUS_6210 2941 2003 gene locus_tag LOCUS_6220 2941 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6220 3009 3380 gene locus_tag LOCUS_6230 3009 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6230 >Feature sequence135 1945 1247 gene locus_tag LOCUS_6240 gene pgl 1945 1247 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 protein_id gnl|my_center|LOCUS_6240 <3550 1964 gene locus_tag LOCUS_6250 <3550 1964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003527054.1:glucose-6-phosphate dehydrogenase >Feature sequence136 30 491 gene locus_tag LOCUS_6260 30 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6260 2086 488 gene locus_tag LOCUS_6270 2086 488 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966695.1 protein_id gnl|my_center|LOCUS_6270 2609 2130 gene locus_tag LOCUS_6280 2609 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6280 <3544 2542 gene locus_tag LOCUS_6290 <3544 2542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013527965.1:indolepyruvate oxidoreductase subunit beta family protein >Feature sequence137 <1 678 gene locus_tag LOCUS_6300 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928760.1:transferrin receptor-like dimerization domain-containing protein 1567 740 gene locus_tag LOCUS_6310 1567 740 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384626.1 protein_id gnl|my_center|LOCUS_6310 2036 1635 gene locus_tag LOCUS_6320 2036 1635 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974817.1 protein_id gnl|my_center|LOCUS_6320 2310 2023 gene locus_tag LOCUS_6330 2310 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6330 2398 3117 gene locus_tag LOCUS_6340 2398 3117 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162304053.1 protein_id gnl|my_center|LOCUS_6340 >Feature sequence138 8 871 gene locus_tag LOCUS_6350 8 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6350 846 2147 gene locus_tag LOCUS_6360 gene murD 846 2147 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037868.1 protein_id gnl|my_center|LOCUS_6360 3297 2140 gene locus_tag LOCUS_6370 3297 2140 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388874.1 protein_id gnl|my_center|LOCUS_6370 >Feature sequence139 2065 1091 gene locus_tag LOCUS_6380 2065 1091 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806971.1 protein_id gnl|my_center|LOCUS_6380 2635 2111 gene locus_tag LOCUS_6390 2635 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6390 <3497 2628 gene locus_tag LOCUS_6400 <3497 2628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531141.1:sarcosine oxidase subunit alpha >Feature sequence140 >Feature sequence141 1169 402 gene locus_tag LOCUS_6410 1169 402 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405392.1 protein_id gnl|my_center|LOCUS_6410 1500 2624 gene locus_tag LOCUS_6420 1500 2624 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121670.1 protein_id gnl|my_center|LOCUS_6420 2782 3309 gene locus_tag LOCUS_6430 2782 3309 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_6430 >Feature sequence142 634 131 gene locus_tag LOCUS_6440 634 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6440 1404 712 gene locus_tag LOCUS_6450 1404 712 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721035.1 protein_id gnl|my_center|LOCUS_6450 1626 2633 gene locus_tag LOCUS_6460 gene ribA 1626 2633 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391384.1 protein_id gnl|my_center|LOCUS_6460 >Feature sequence143 <1 980 gene locus_tag LOCUS_6470 <1 980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002657823.1:aminopeptidase 1007 2440 gene locus_tag LOCUS_6480 gene pyk 1007 2440 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529204.1 protein_id gnl|my_center|LOCUS_6480 2692 2567 gene locus_tag LOCUS_6490 gene ykgO 2692 2567 CDS product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722020.1 protein_id gnl|my_center|LOCUS_6490 >Feature sequence144 202 1497 gene locus_tag LOCUS_6500 202 1497 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114549.1 protein_id gnl|my_center|LOCUS_6500 2652 1492 gene locus_tag LOCUS_6510 2652 1492 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931942.1 protein_id gnl|my_center|LOCUS_6510 <3461 2680 gene locus_tag LOCUS_6520 <3461 2680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705753.1:phage shock protein operon transcriptional activator >Feature sequence145 190 819 gene locus_tag LOCUS_6530 190 819 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530072.1 protein_id gnl|my_center|LOCUS_6530 835 2031 gene locus_tag LOCUS_6540 835 2031 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483272.1 protein_id gnl|my_center|LOCUS_6540 2094 2897 gene locus_tag LOCUS_6550 gene dapF 2094 2897 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388938.1 protein_id gnl|my_center|LOCUS_6550 >Feature sequence146 344 1087 gene locus_tag LOCUS_6560 344 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6560 1361 1960 gene locus_tag LOCUS_6570 1361 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6570 1978 2772 gene locus_tag LOCUS_6580 1978 2772 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529670.1 protein_id gnl|my_center|LOCUS_6580 <3441 2773 gene locus_tag LOCUS_6590 <3441 2773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918305.1:SDR family oxidoreductase >Feature sequence147 574 1545 gene locus_tag LOCUS_6600 574 1545 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625895.1 protein_id gnl|my_center|LOCUS_6600 3392 1638 gene locus_tag LOCUS_6610 3392 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6610 >Feature sequence148 197 1015 gene locus_tag LOCUS_6620 gene fabI 197 1015 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532347.1 protein_id gnl|my_center|LOCUS_6620 1022 2092 gene locus_tag LOCUS_6630 gene aroC 1022 2092 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085417.1 protein_id gnl|my_center|LOCUS_6630 2561 2178 gene locus_tag LOCUS_6640 2561 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6640 <3431 2854 gene locus_tag LOCUS_6650 <3431 2854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385454.1:class I SAM-dependent RNA methyltransferase >Feature sequence149 887 189 gene locus_tag LOCUS_6660 gene tsaB 887 189 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917948.1 protein_id gnl|my_center|LOCUS_6660 1031 2068 gene locus_tag LOCUS_6670 1031 2068 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_6670 2637 2089 gene locus_tag LOCUS_6680 2637 2089 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378149.1 protein_id gnl|my_center|LOCUS_6680 3202 2729 gene locus_tag LOCUS_6690 3202 2729 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528063.1 protein_id gnl|my_center|LOCUS_6690 >Feature sequence150 1267 227 gene locus_tag LOCUS_6700 1267 227 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529256.1 protein_id gnl|my_center|LOCUS_6700 1266 1628 gene locus_tag LOCUS_6710 1266 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6710 1975 1631 gene locus_tag LOCUS_6720 1975 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6720 2053 2676 gene locus_tag LOCUS_6730 2053 2676 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258926.1 protein_id gnl|my_center|LOCUS_6730 <3425 2673 gene locus_tag LOCUS_6740 <3425 2673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388204.1:3'(2'),5'-bisphosphate nucleotidase CysQ >Feature sequence151 214 1533 gene locus_tag LOCUS_6750 214 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6750 1666 3072 gene locus_tag LOCUS_6760 gene nhaC 1666 3072 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017141.1 protein_id gnl|my_center|LOCUS_6760 >Feature sequence152 86 661 gene locus_tag LOCUS_6770 gene pdxH 86 661 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390377.1 protein_id gnl|my_center|LOCUS_6770 674 1573 gene locus_tag LOCUS_6780 674 1573 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074103.1 protein_id gnl|my_center|LOCUS_6780 2572 1670 gene locus_tag LOCUS_6790 2572 1670 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070732.1 protein_id gnl|my_center|LOCUS_6790 2693 3124 gene locus_tag LOCUS_6800 2693 3124 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820995.1 protein_id gnl|my_center|LOCUS_6800 >Feature sequence153 >Feature sequence154 1520 936 gene locus_tag LOCUS_6810 1520 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_6810 2333 1551 gene locus_tag LOCUS_6820 gene lptB 2333 1551 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385411.1 protein_id gnl|my_center|LOCUS_6820 2964 2431 gene locus_tag LOCUS_6830 2964 2431 CDS product LptA/OstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974232.1 protein_id gnl|my_center|LOCUS_6830 >Feature sequence155 1398 739 gene locus_tag LOCUS_6840 1398 739 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966008.1 protein_id gnl|my_center|LOCUS_6840 1523 2986 gene locus_tag LOCUS_6850 gene hydA 1523 2986 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086117.1 protein_id gnl|my_center|LOCUS_6850 >Feature sequence156 996 133 gene locus_tag LOCUS_6860 gene coxB 996 133 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083989.1 protein_id gnl|my_center|LOCUS_6860 1429 2787 gene locus_tag LOCUS_6870 gene tldD 1429 2787 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968899.1 protein_id gnl|my_center|LOCUS_6870 >Feature sequence157 1514 2470 gene locus_tag LOCUS_6880 gene msrP 1514 2470 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920589.1 protein_id gnl|my_center|LOCUS_6880 2563 3105 gene locus_tag LOCUS_6890 gene msrQ 2563 3105 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036769.1 protein_id gnl|my_center|LOCUS_6890 >Feature sequence158 762 160 gene locus_tag LOCUS_6900 762 160 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389577.1 protein_id gnl|my_center|LOCUS_6900 1897 770 gene locus_tag LOCUS_6910 gene ribD 1897 770 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389578.1 protein_id gnl|my_center|LOCUS_6910 2345 1884 gene locus_tag LOCUS_6920 gene nrdR 2345 1884 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003512508.1 protein_id gnl|my_center|LOCUS_6920 <3306 2364 gene locus_tag LOCUS_6930 <3306 2364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389580.1:serine hydroxymethyltransferase >Feature sequence159 1049 465 gene locus_tag LOCUS_6940 1049 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6940 1524 3005 gene locus_tag LOCUS_6950 1524 3005 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966309.1 protein_id gnl|my_center|LOCUS_6950 >Feature sequence160 113 1546 gene locus_tag LOCUS_6960 gene xseA 113 1546 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383570.1 protein_id gnl|my_center|LOCUS_6960 1543 2364 gene locus_tag LOCUS_6970 1543 2364 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275350.1 protein_id gnl|my_center|LOCUS_6970 2378 3082 gene locus_tag LOCUS_6980 2378 3082 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073341.1 protein_id gnl|my_center|LOCUS_6980 >Feature sequence161 <1 679 gene locus_tag LOCUS_6990 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390844.1:glycosyltransferase family 4 protein 905 1387 gene locus_tag LOCUS_7000 905 1387 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975385.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_7000 1567 1860 gene locus_tag LOCUS_7010 1567 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7010 1862 2467 gene locus_tag LOCUS_7020 1862 2467 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530355.1 protein_id gnl|my_center|LOCUS_7020 2618 2542 gene locus_tag LOCUS_t0060 2618 2542 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3180 2689 gene locus_tag LOCUS_7030 3180 2689 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087183.1 protein_id gnl|my_center|LOCUS_7030 >Feature sequence162 957 145 gene locus_tag LOCUS_7040 957 145 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388454.1 protein_id gnl|my_center|LOCUS_7040 2315 963 gene locus_tag LOCUS_7050 gene cysS 2315 963 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388447.1 protein_id gnl|my_center|LOCUS_7050 <3236 2312 gene locus_tag LOCUS_7060 <3236 2312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388446.1:glutamate--tRNA ligase >Feature sequence163 369 1106 gene locus_tag LOCUS_7070 369 1106 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067191.1 protein_id gnl|my_center|LOCUS_7070 1132 2367 gene locus_tag LOCUS_7080 1132 2367 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067192.1 protein_id gnl|my_center|LOCUS_7080 3228 2371 gene locus_tag LOCUS_7090 3228 2371 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529823.1 protein_id gnl|my_center|LOCUS_7090 >Feature sequence164 579 253 gene locus_tag LOCUS_7100 579 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7100 982 527 gene locus_tag LOCUS_7110 gene dut 982 527 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970813.1 protein_id gnl|my_center|LOCUS_7110 2203 992 gene locus_tag LOCUS_7120 gene coaBC 2203 992 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923348.1 protein_id gnl|my_center|LOCUS_7120 <3228 2288 gene locus_tag LOCUS_7130 <3228 2288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970817.1:2-polyprenylphenol 6-hydroxylase >Feature sequence165 3204 2578 gene locus_tag LOCUS_7140 3204 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7140 >Feature sequence166 22 2400 gene locus_tag LOCUS_7150 22 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7150 3170 2487 gene locus_tag LOCUS_7160 3170 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7160 >Feature sequence167 338 994 gene locus_tag LOCUS_7170 338 994 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390408.1 protein_id gnl|my_center|LOCUS_7170 995 1687 gene locus_tag LOCUS_7180 995 1687 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390406.1 protein_id gnl|my_center|LOCUS_7180 >Feature sequence168 903 1688 gene locus_tag LOCUS_7190 903 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7190 1733 2521 gene locus_tag LOCUS_7200 1733 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7200 >Feature sequence169 3107 120 gene locus_tag LOCUS_7210 3107 120 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441479.1 protein_id gnl|my_center|LOCUS_7210 >Feature sequence170 <1 723 gene locus_tag LOCUS_7220 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404763.1:S9 family peptidase 1997 720 gene locus_tag LOCUS_7230 1997 720 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972400.1 protein_id gnl|my_center|LOCUS_7230 2065 2706 gene locus_tag LOCUS_7240 2065 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_7240 2732 3010 gene locus_tag LOCUS_7250 2732 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_7250 >Feature sequence171 991 80 gene locus_tag LOCUS_7260 gene era 991 80 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844236.1 protein_id gnl|my_center|LOCUS_7260 1694 1005 gene locus_tag LOCUS_7270 gene rnc 1694 1005 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389605.1 protein_id gnl|my_center|LOCUS_7270 2128 1715 gene locus_tag LOCUS_7280 2128 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_7280 2508 2152 gene locus_tag LOCUS_7290 2508 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_7290 3039 2632 gene locus_tag LOCUS_7300 gene acpS 3039 2632 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707403.1 protein_id gnl|my_center|LOCUS_7300 3169 3044 gene locus_tag LOCUS_7310 3169 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7310 >Feature sequence172 714 1952 gene locus_tag LOCUS_7320 714 1952 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070677.1 protein_id gnl|my_center|LOCUS_7320 2411 2719 gene locus_tag LOCUS_7330 2411 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7330 >Feature sequence173 653 2353 gene locus_tag LOCUS_7340 653 2353 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973790.1 protein_id gnl|my_center|LOCUS_7340 2359 2952 gene locus_tag LOCUS_7350 gene lacC 2359 2952 CDS product lactose 3-dehydrogenase subunit gamma LacC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919508.1 protein_id gnl|my_center|LOCUS_7350 >Feature sequence174 <1 879 gene locus_tag LOCUS_7360 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764544.1:peptide MFS transporter 901 1899 gene locus_tag LOCUS_7370 901 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_7370 1927 2439 gene locus_tag LOCUS_7380 1927 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_7380 2996 2481 gene locus_tag LOCUS_7390 2996 2481 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089838.1 protein_id gnl|my_center|LOCUS_7390 >Feature sequence175 275 1618 gene locus_tag LOCUS_7400 275 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7400 2603 1620 gene locus_tag LOCUS_7410 2603 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_7410 >Feature sequence176 740 504 gene locus_tag LOCUS_7420 740 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7420 1252 785 gene locus_tag LOCUS_7430 gene lspA 1252 785 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704644.1 protein_id gnl|my_center|LOCUS_7430 3100 1253 gene locus_tag LOCUS_7440 3100 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7440 >Feature sequence177 2684 615 gene locus_tag LOCUS_7450 2684 615 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695098.1 protein_id gnl|my_center|LOCUS_7450 >Feature sequence178 480 1346 gene locus_tag LOCUS_7460 gene gluQRS 480 1346 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391481.1 protein_id gnl|my_center|LOCUS_7460 1851 1348 gene locus_tag LOCUS_7470 1851 1348 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962259.1 protein_id gnl|my_center|LOCUS_7470 2583 1870 gene locus_tag LOCUS_7480 2583 1870 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337268.1 protein_id gnl|my_center|LOCUS_7480 >Feature sequence179 1386 172 gene locus_tag LOCUS_7490 gene trpB 1386 172 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391174.1 protein_id gnl|my_center|LOCUS_7490 2041 1379 gene locus_tag LOCUS_7500 2041 1379 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339435.1 protein_id gnl|my_center|LOCUS_7500 2760 2038 gene locus_tag LOCUS_7510 gene pyrF 2760 2038 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391171.1 protein_id gnl|my_center|LOCUS_7510 >Feature sequence180 2096 567 gene locus_tag LOCUS_7520 gene atpA 2096 567 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310773.1 protein_id gnl|my_center|LOCUS_7520 2680 2096 gene locus_tag LOCUS_7530 2680 2096 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388978.1 protein_id gnl|my_center|LOCUS_7530 >Feature sequence181 155 1570 gene locus_tag LOCUS_7540 155 1570 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545413.1 protein_id gnl|my_center|LOCUS_7540 1722 1976 gene locus_tag LOCUS_7550 gene hfq 1722 1976 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007591126.1 protein_id gnl|my_center|LOCUS_7550 >Feature sequence182 1352 1738 gene locus_tag LOCUS_7560 1352 1738 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434074.1 protein_id gnl|my_center|LOCUS_7560 1872 2582 gene locus_tag LOCUS_7570 1872 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7570 2624 2845 gene locus_tag LOCUS_7580 2624 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7580 >Feature sequence183 1161 106 gene locus_tag LOCUS_7590 1161 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_7590 2072 1158 gene locus_tag LOCUS_7600 gene metF 2072 1158 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389283.1 protein_id gnl|my_center|LOCUS_7600 <3012 2121 gene locus_tag LOCUS_7610 <3012 2121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389282.1:metalloregulator ArsR/SmtB family transcription factor >Feature sequence184 1074 538 gene locus_tag LOCUS_7620 1074 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7620 2258 1077 gene locus_tag LOCUS_7630 2258 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7630 >Feature sequence185 174 362 gene locus_tag LOCUS_7640 174 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7640 364 927 gene locus_tag LOCUS_7650 364 927 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973170.1 protein_id gnl|my_center|LOCUS_7650 1600 929 gene locus_tag LOCUS_7660 gene csiR 1600 929 CDS product DNA-binding transcriptional regulator CsiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126152.1 protein_id gnl|my_center|LOCUS_7660 1702 2883 gene locus_tag LOCUS_7670 1702 2883 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389758.1 protein_id gnl|my_center|LOCUS_7670 >Feature sequence186 145 1323 gene locus_tag LOCUS_7680 145 1323 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389347.1 protein_id gnl|my_center|LOCUS_7680 1382 1870 gene locus_tag LOCUS_7690 1382 1870 CDS product EF-hand domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970853.1 protein_id gnl|my_center|LOCUS_7690 2064 2945 gene locus_tag LOCUS_7700 gene dapA 2064 2945 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171604.1 protein_id gnl|my_center|LOCUS_7700 >Feature sequence187 308 958 gene locus_tag LOCUS_7710 308 958 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206933.1 protein_id gnl|my_center|LOCUS_7710 973 2280 gene locus_tag LOCUS_7720 973 2280 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394859.1 protein_id gnl|my_center|LOCUS_7720 >Feature sequence188 622 320 gene locus_tag LOCUS_7730 622 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7730 2746 695 gene locus_tag LOCUS_7740 2746 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7740 >Feature sequence189 491 1006 gene locus_tag LOCUS_7750 gene ilvN 491 1006 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388227.1 protein_id gnl|my_center|LOCUS_7750 1044 2060 gene locus_tag LOCUS_7760 gene ilvC 1044 2060 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388228.1 protein_id gnl|my_center|LOCUS_7760 <2955 2160 gene locus_tag LOCUS_7770 <2955 2160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006310684.1:Hsp33 family molecular chaperone >Feature sequence190 739 1479 gene locus_tag LOCUS_7780 739 1479 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889327.1 protein_id gnl|my_center|LOCUS_7780 1499 2143 gene locus_tag LOCUS_7790 1499 2143 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089829.1 protein_id gnl|my_center|LOCUS_7790 >Feature sequence191 <1 696 gene locus_tag LOCUS_7800 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006312430.1:carbohydrate ABC transporter permease 735 2231 gene locus_tag LOCUS_7810 gene argH 735 2231 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257217.1 protein_id gnl|my_center|LOCUS_7810 >Feature sequence192 117 509 gene locus_tag LOCUS_7820 117 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7820 726 1514 gene locus_tag LOCUS_7830 726 1514 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 protein_id gnl|my_center|LOCUS_7830 2011 2286 gene locus_tag LOCUS_7840 2011 2286 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 protein_id gnl|my_center|LOCUS_7840 >Feature sequence193 <1 654 gene locus_tag LOCUS_7850 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528519.1:gamma-glutamyltransferase 1895 657 gene locus_tag LOCUS_7860 1895 657 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257181.1 protein_id gnl|my_center|LOCUS_7860 2854 2036 gene locus_tag LOCUS_7870 2854 2036 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551552.1 protein_id gnl|my_center|LOCUS_7870 >Feature sequence194 255 1538 gene locus_tag LOCUS_7880 255 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440088.1 protein_id gnl|my_center|LOCUS_7880 1538 2635 gene locus_tag LOCUS_7890 1538 2635 CDS product peptidoglycan -binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388828.1 protein_id gnl|my_center|LOCUS_7890 >Feature sequence195 <1 1110 gene locus_tag LOCUS_7900 <1 1110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839396.1:P1 family peptidase >Feature sequence196 723 1115 gene locus_tag LOCUS_7910 723 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7910 1544 2110 gene locus_tag LOCUS_7920 1544 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7920 2107 2667 gene locus_tag LOCUS_7930 2107 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7930 >Feature sequence197 1551 94 gene locus_tag LOCUS_7940 1551 94 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140892.1 protein_id gnl|my_center|LOCUS_7940 2683 1748 gene locus_tag LOCUS_7950 2683 1748 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242008.1 protein_id gnl|my_center|LOCUS_7950 >Feature sequence198 <1 1004 gene locus_tag LOCUS_7960 <1 1004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919161.1:DegQ family serine endoprotease 1001 2311 gene locus_tag LOCUS_7970 1001 2311 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 protein_id gnl|my_center|LOCUS_7970 <2893 2313 gene locus_tag LOCUS_7980 <2893 2313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389663.1:cyclopropane-fatty-acyl-phospholipid synthase family protein >Feature sequence199 <1 530 gene locus_tag LOCUS_7990 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705541.1:glycerol-3-phosphate transporter 542 2107 gene locus_tag LOCUS_8000 542 2107 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928742.1 protein_id gnl|my_center|LOCUS_8000 2346 2116 gene locus_tag LOCUS_8010 2346 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8010 2534 2334 gene locus_tag LOCUS_8020 2534 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8020 >Feature sequence200 1566 1009 gene locus_tag LOCUS_8030 1566 1009 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088861.1 protein_id gnl|my_center|LOCUS_8030 2848 1553 gene locus_tag LOCUS_8040 gene soxC 2848 1553 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088862.1 protein_id gnl|my_center|LOCUS_8040 >Feature sequence201 <1 1050 gene locus_tag LOCUS_8050 <1 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037381.1:CocE/NonD family hydrolase 1075 1239 gene locus_tag LOCUS_8060 1075 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8060 2780 1443 gene locus_tag LOCUS_8070 2780 1443 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764891.1 protein_id gnl|my_center|LOCUS_8070 >Feature sequence202 484 1833 gene locus_tag LOCUS_8080 gene glmM 484 1833 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918006.1 protein_id gnl|my_center|LOCUS_8080 1846 2439 gene locus_tag LOCUS_8090 1846 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_8090 2488 2640 gene locus_tag LOCUS_8100 2488 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8100 >Feature sequence203 1192 530 gene locus_tag LOCUS_8110 1192 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8110 1479 2339 gene locus_tag LOCUS_8120 1479 2339 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084238.1 protein_id gnl|my_center|LOCUS_8120 2766 2341 gene locus_tag LOCUS_8130 2766 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8130 >Feature sequence204 873 238 gene locus_tag LOCUS_8140 873 238 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 protein_id gnl|my_center|LOCUS_8140 1551 883 gene locus_tag LOCUS_8150 gene thiE 1551 883 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388835.1 protein_id gnl|my_center|LOCUS_8150 <2860 1591 gene locus_tag LOCUS_8160 <2860 1591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338601.1:folylpolyglutamate synthase/dihydrofolate synthase family protein >Feature sequence205 2667 541 gene locus_tag LOCUS_8170 gene pnp 2667 541 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527890.1 protein_id gnl|my_center|LOCUS_8170 >Feature sequence206 163 660 gene locus_tag LOCUS_8180 163 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8180 763 1533 gene locus_tag LOCUS_8190 763 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8190 2561 1596 gene locus_tag LOCUS_8200 gene prfB 2561 1596 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113519808.1 protein_id gnl|my_center|LOCUS_8200 >Feature sequence207 81 878 gene locus_tag LOCUS_8210 81 878 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390704.1 protein_id gnl|my_center|LOCUS_8210 >Feature sequence208 495 130 gene locus_tag LOCUS_8220 495 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_8220 1035 505 gene locus_tag LOCUS_8230 1035 505 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534501.1 protein_id gnl|my_center|LOCUS_8230 1907 1035 gene locus_tag LOCUS_8240 1907 1035 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337020.1 protein_id gnl|my_center|LOCUS_8240 <2834 1998 gene locus_tag LOCUS_8250 <2834 1998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010969491.1:cytochrome c1 >Feature sequence209 32 397 gene locus_tag LOCUS_8260 32 397 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389430.1 protein_id gnl|my_center|LOCUS_8260 388 951 gene locus_tag LOCUS_8270 388 951 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640371.1 protein_id gnl|my_center|LOCUS_8270 964 1584 gene locus_tag LOCUS_8280 964 1584 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389432.1 protein_id gnl|my_center|LOCUS_8280 1588 2766 gene locus_tag LOCUS_8290 1588 2766 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389433.1 protein_id gnl|my_center|LOCUS_8290 >Feature sequence210 <1 2658 gene locus_tag LOCUS_8300 <1 2658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947310.1:NAD-glutamate dehydrogenase >Feature sequence211 <2818 239 gene locus_tag LOCUS_8310 <2818 239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390504.1:DNA-directed RNA polymerase subunit beta' >Feature sequence212 468 1124 gene locus_tag LOCUS_8320 468 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8320 1277 2479 gene locus_tag LOCUS_8330 1277 2479 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980220.1 protein_id gnl|my_center|LOCUS_8330 >Feature sequence213 343 1119 gene locus_tag LOCUS_8340 343 1119 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 protein_id gnl|my_center|LOCUS_8340 1119 2495 gene locus_tag LOCUS_8350 gene radA 1119 2495 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388165.1 protein_id gnl|my_center|LOCUS_8350 >Feature sequence214 <1 550 gene locus_tag LOCUS_8360 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_036892595.1:sodium:alanine symporter family protein 571 1926 gene locus_tag LOCUS_8370 571 1926 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762587.1 protein_id gnl|my_center|LOCUS_8370 >Feature sequence215 2285 51 gene locus_tag LOCUS_8380 gene rnr 2285 51 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971530.1 protein_id gnl|my_center|LOCUS_8380 <2801 2294 gene locus_tag LOCUS_8390 <2801 2294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002719330.1:type I DNA topoisomerase >Feature sequence216 3 2549 gene locus_tag LOCUS_8400 gene ppdK 3 2549 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532744.1 protein_id gnl|my_center|LOCUS_8400 >Feature sequence217 1279 14 gene locus_tag LOCUS_8410 1279 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8410 1815 1288 gene locus_tag LOCUS_8420 gene petA 1815 1288 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639988.1 protein_id gnl|my_center|LOCUS_8420 >Feature sequence218 <1 1180 gene locus_tag LOCUS_8430 <1 1180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000732723.1:outer membrane protein assembly factor BamB 1262 2674 gene locus_tag LOCUS_8440 gene der 1262 2674 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975953.1 protein_id gnl|my_center|LOCUS_8440 >Feature sequence219 1116 526 gene locus_tag LOCUS_8450 1116 526 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528820.1 protein_id gnl|my_center|LOCUS_8450 1244 1954 gene locus_tag LOCUS_8460 1244 1954 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470636.1 protein_id gnl|my_center|LOCUS_8460 >Feature sequence220 2321 1014 gene locus_tag LOCUS_8470 gene serA 2321 1014 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090136.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_8470 2578 2366 gene locus_tag LOCUS_8480 2578 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_8480 >Feature sequence221 74 1039 gene locus_tag LOCUS_8490 gene mdh 74 1039 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067155.1 protein_id gnl|my_center|LOCUS_8490 1132 2301 gene locus_tag LOCUS_8500 gene sucC 1132 2301 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388966.1 protein_id gnl|my_center|LOCUS_8500 2301 2540 gene locus_tag LOCUS_8510 2301 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_8510 >Feature sequence222 <1 2465 gene locus_tag LOCUS_8520 <1 2465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013527894.1:translation initiation factor IF-2 >Feature sequence223 <1 950 gene locus_tag LOCUS_8530 <1 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919797.1:proline--tRNA ligase 954 2210 gene locus_tag LOCUS_8540 954 2210 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087643.1 protein_id gnl|my_center|LOCUS_8540 >Feature sequence224 <2766 455 gene locus_tag LOCUS_8550 <2766 455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120545.1:M1 family metallopeptidase >Feature sequence225 631 80 gene locus_tag LOCUS_8560 631 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8560 1552 653 gene locus_tag LOCUS_8570 1552 653 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392779.1 protein_id gnl|my_center|LOCUS_8570 <2760 1645 gene locus_tag LOCUS_8580 <2760 1645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007246323.1:pyoverdine-tailoring dipeptidase-like protein PvdM >Feature sequence226 1299 385 gene locus_tag LOCUS_8590 1299 385 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389819.1 protein_id gnl|my_center|LOCUS_8590 2281 1358 gene locus_tag LOCUS_8600 2281 1358 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434787.1 protein_id gnl|my_center|LOCUS_8600 >Feature sequence227 240 1775 gene locus_tag LOCUS_8610 240 1775 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090948.1 protein_id gnl|my_center|LOCUS_8610 <2754 1978 gene locus_tag LOCUS_8620 <2754 1978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073218.1:ferrochelatase >Feature sequence228 <1 767 gene locus_tag LOCUS_8630 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067283.1:Bax inhibitor-1/YccA family protein 998 2230 gene locus_tag LOCUS_8640 gene soxC 998 2230 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088862.1 protein_id gnl|my_center|LOCUS_8640 >Feature sequence229 2574 340 gene locus_tag LOCUS_8650 2574 340 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171192.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_8650 >Feature sequence230 2 199 gene locus_tag LOCUS_8660 2 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8660 219 806 gene locus_tag LOCUS_8670 219 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_8670 728 1693 gene locus_tag LOCUS_8680 728 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_8680 1709 2266 gene locus_tag LOCUS_8690 1709 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_8690 2227 2745 gene locus_tag LOCUS_8700 2227 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_8700 >Feature sequence231 1112 663 gene locus_tag LOCUS_8710 1112 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8710 1726 1247 gene locus_tag LOCUS_8720 1726 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8720 <2744 1881 gene locus_tag LOCUS_8730 <2744 1881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920963.1:TonB-dependent receptor >Feature sequence232 659 213 gene locus_tag LOCUS_8740 659 213 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721618.1 protein_id gnl|my_center|LOCUS_8740 1230 652 gene locus_tag LOCUS_8750 1230 652 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107442.1 protein_id gnl|my_center|LOCUS_8750 2393 1233 gene locus_tag LOCUS_8760 gene argJ 2393 1233 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388153.1 protein_id gnl|my_center|LOCUS_8760 >Feature sequence233 846 1034 gene locus_tag LOCUS_8770 846 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8770 1714 2532 gene locus_tag LOCUS_8780 1714 2532 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_8780 >Feature sequence234 852 1202 gene locus_tag LOCUS_8790 852 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8790 2012 1215 gene locus_tag LOCUS_8800 gene thiS 2012 1215 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390185.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_8800 2234 2031 gene locus_tag LOCUS_8810 2234 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_8810 >Feature sequence235 928 44 gene locus_tag LOCUS_8820 928 44 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440473.1 protein_id gnl|my_center|LOCUS_8820 1919 975 gene locus_tag LOCUS_8830 gene trxB 1919 975 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265863.1 protein_id gnl|my_center|LOCUS_8830 <2730 2017 gene locus_tag LOCUS_8840 <2730 2017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958530.1:DsbA family protein >Feature sequence236 143 57 gene locus_tag LOCUS_t0070 143 57 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1001 249 gene locus_tag LOCUS_8850 1001 249 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920524.1 protein_id gnl|my_center|LOCUS_8850 1068 1778 gene locus_tag LOCUS_8860 gene sfsA 1068 1778 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388493.1 protein_id gnl|my_center|LOCUS_8860 1778 2599 gene locus_tag LOCUS_8870 gene map 1778 2599 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388491.1 protein_id gnl|my_center|LOCUS_8870 >Feature sequence237 483 1052 gene locus_tag LOCUS_8880 483 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8880 1049 1669 gene locus_tag LOCUS_8890 1049 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8890 1671 2087 gene locus_tag LOCUS_8900 1671 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8900 2185 2412 gene locus_tag LOCUS_8910 2185 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8910 2436 2666 gene locus_tag LOCUS_8920 2436 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8920 >Feature sequence238 529 2103 gene locus_tag LOCUS_8930 529 2103 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966434.1 protein_id gnl|my_center|LOCUS_8930 <2709 2104 gene locus_tag LOCUS_8940 <2709 2104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920959.1:TetR family transcriptional regulator C-terminal domain-containing protein >Feature sequence239 2245 503 gene locus_tag LOCUS_8950 gene yidC 2245 503 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391086.1 protein_id gnl|my_center|LOCUS_8950 2564 2235 gene locus_tag LOCUS_8960 2564 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8960 >Feature sequence240 <1 575 gene locus_tag LOCUS_8970 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038738.1:kynureninase 596 1417 gene locus_tag LOCUS_8980 596 1417 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086179.1 protein_id gnl|my_center|LOCUS_8980 >Feature sequence241 804 1301 gene locus_tag LOCUS_8990 804 1301 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974619.1 protein_id gnl|my_center|LOCUS_8990 1322 2620 gene locus_tag LOCUS_9000 1322 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_9000 >Feature sequence242 <1 826 gene locus_tag LOCUS_9010 <1 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014328227.1:twin-arginine translocase subunit TatC 819 2093 gene locus_tag LOCUS_9020 gene serS 819 2093 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393416.1 protein_id gnl|my_center|LOCUS_9020 >Feature sequence243 2 211 gene locus_tag LOCUS_9030 gene rpsU 2 211 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533884.1 protein_id gnl|my_center|LOCUS_9030 305 940 gene locus_tag LOCUS_9040 305 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_9040 1098 919 gene locus_tag LOCUS_9050 1098 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_9050 2623 1991 gene locus_tag LOCUS_9060 2623 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_9060 >Feature sequence244 2582 855 gene locus_tag LOCUS_9070 2582 855 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230581.1 protein_id gnl|my_center|LOCUS_9070 >Feature sequence245 59 220 gene locus_tag LOCUS_9080 59 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_9080 1984 269 gene locus_tag LOCUS_9090 1984 269 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531269.1 protein_id gnl|my_center|LOCUS_9090 2337 2104 gene locus_tag LOCUS_9100 2337 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_9100 >Feature sequence246 97 1452 gene locus_tag LOCUS_9110 97 1452 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174621.1 protein_id gnl|my_center|LOCUS_9110 1616 2107 gene locus_tag LOCUS_9120 1616 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_9120 >Feature sequence247 201 953 gene locus_tag LOCUS_9130 201 953 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_9130 <2630 996 gene locus_tag LOCUS_9140 <2630 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005462598.1:alkaline phosphatase D family protein >Feature sequence248 1980 1003 gene locus_tag LOCUS_9150 1980 1003 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275390.1 protein_id gnl|my_center|LOCUS_9150 2265 2092 gene locus_tag LOCUS_9160 2265 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_9160 >Feature sequence249 866 345 gene locus_tag LOCUS_9170 gene infC 866 345 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_9170 <2613 989 gene locus_tag LOCUS_9180 <2613 989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391234.1:threonine--tRNA ligase >Feature sequence250 487 621 gene locus_tag LOCUS_9190 487 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_9190 652 1356 gene locus_tag LOCUS_9200 652 1356 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391169.1 protein_id gnl|my_center|LOCUS_9200 >Feature sequence251 <1 1100 gene locus_tag LOCUS_9210 <1 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015444445.1:S9 family peptidase 1137 2447 gene locus_tag LOCUS_9220 1137 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_9220 >Feature sequence252 1050 157 gene locus_tag LOCUS_9230 1050 157 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974047.1 protein_id gnl|my_center|LOCUS_9230 2249 1047 gene locus_tag LOCUS_9240 2249 1047 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974048.1 protein_id gnl|my_center|LOCUS_9240 >Feature sequence253 <1 1001 gene locus_tag LOCUS_9250 <1 1001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263815.1:SIS domain-containing protein 1006 1917 gene locus_tag LOCUS_9260 gene nagK 1006 1917 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170645.1 protein_id gnl|my_center|LOCUS_9260 >Feature sequence254 2102 54 gene locus_tag LOCUS_9270 2102 54 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063035.1 protein_id gnl|my_center|LOCUS_9270 >Feature sequence255 3 1241 gene locus_tag LOCUS_9280 gene ppx 3 1241 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086895.1 protein_id gnl|my_center|LOCUS_9280 2410 1262 gene locus_tag LOCUS_9290 gene rnd 2410 1262 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389826.1 protein_id gnl|my_center|LOCUS_9290 >Feature sequence256 2576 870 gene locus_tag LOCUS_9300 2576 870 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919006.1 protein_id gnl|my_center|LOCUS_9300 >Feature sequence257 1107 229 gene locus_tag LOCUS_9310 1107 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_9310 1390 2193 gene locus_tag LOCUS_9320 1390 2193 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067189.1 protein_id gnl|my_center|LOCUS_9320 >Feature sequence258 137 1750 gene locus_tag LOCUS_9330 gene secD 137 1750 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087503.1 protein_id gnl|my_center|LOCUS_9330 >Feature sequence259 <1 915 gene locus_tag LOCUS_9340 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085924.1:PAS domain-containing sensor histidine kinase 2309 1023 gene locus_tag LOCUS_9350 2309 1023 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969134.1 protein_id gnl|my_center|LOCUS_9350 >Feature sequence260 2232 166 gene locus_tag LOCUS_9360 2232 166 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265515.1 protein_id gnl|my_center|LOCUS_9360 >Feature sequence261 1774 2496 gene locus_tag LOCUS_9370 1774 2496 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388716.1 protein_id gnl|my_center|LOCUS_9370 >Feature sequence262 >Feature sequence263 <1 942 gene locus_tag LOCUS_9380 <1 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339635.1:aspartate aminotransferase family protein 950 1831 gene locus_tag LOCUS_9390 950 1831 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088206.1 protein_id gnl|my_center|LOCUS_9390 <2518 1840 gene locus_tag LOCUS_9400 <2518 1840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206030.1:IclR family transcriptional regulator >Feature sequence264 1368 25 gene locus_tag LOCUS_9410 gene xylA 1368 25 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039169.1 protein_id gnl|my_center|LOCUS_9410 <2509 1380 gene locus_tag LOCUS_9420 <2509 1380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036931.1:xylulokinase