COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..83969 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(235..966) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927735.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene trmB CDS complement(963..1748) product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704885.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene djlA tRNA complement(1822..1895) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 1990..3303 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810114.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS 3316..5364 product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957672.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(5375..6376) product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403858.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 6427..7188 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192921.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 7243..7725 product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814734.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene rnhA CDS 7725..8450 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444532.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene dnaQ CDS complement(8470..8769) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072939.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(8769..9335) product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192037.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 9484..10140 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532195.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 10155..10553 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265510.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(10563..10979) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393898.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 11061..12080 product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267458.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 12083..13741 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389348.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(13801..15504) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707434.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(15608..18289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(18361..21243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 21302..21529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS 21560..24865 product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224369.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 24873..25649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(25720..27363) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974597.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 27528..29477 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337373.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 29499..30293 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566968.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS 30290..31291 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719438.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 31291..32718 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120704930.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 32723..33799 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719437.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 33872..35176 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337371.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 35258..37087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 37087..38439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 38449..39657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 39847..40191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 40188..41330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 41347..42162 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719435.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 42170..43417 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818460.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 43446..44231 product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337545.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(44566..47022) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533447.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 47101..48363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(48377..49945) product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844661.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 50078..51352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 51528..51959 product YHS domain-containing (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878533.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 51988..52461 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037970.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 52484..54148 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389348.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 54203..55516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 55591..56277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 56285..57061 product ectoine utilization protein EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530330.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene eutA CDS complement(57086..58750) product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018013007.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(58807..59124) product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261442.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene bolA CDS complement(59225..60307) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533462.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(60304..60972) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(60976..61770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(61770..63764) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532890.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(63764..64819) product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532889.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(64906..65889) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532888.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(65981..67003) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532888.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 67188..67943 product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723682.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 67943..68275 product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723680.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 68275..68622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 68622..70361 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339081.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 70358..71284 product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339080.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 71281..71949 product fumarate hydratase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339079.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 72014..72658 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530075.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(72655..73854) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038295.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(73875..74876) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809444.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene gap CDS complement(74940..76937) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209965.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene tkt CDS complement(77085..79466) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229101.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(79463..80446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(80551..81999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(82002..82415) product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258723.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(82408..83880) product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728610.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 sequence002 source 1..71021 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2682 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036756.1:DNA gyrase subunit A locus_tag LOCUS_00710 CDS 2696..3781 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616461.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene pheA CDS 3781..4665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00730 note possible pseudo, frameshifted CDS 4665..5963 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036773.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene aroA CDS 5938..6681 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705689.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene cmk CDS 6808..8484 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367470.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene rpsA CDS 8494..8820 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037339.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 8817..9128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 9191..10384 product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957639.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene lapB CDS 10381..11712 product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036689.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 11709..12677 product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813350.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene rfaE1 CDS 12674..13687 product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687838.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene rfaD assembly_gap 13995..14094 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(14586..15203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(15216..18659) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113980.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene mfd CDS 18753..19484 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092359.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene ispD CDS 19481..19966 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098560.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene ispF CDS complement(19968..20330) product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461572.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene hinT CDS complement(20381..20971) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173537.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(20994..25820) product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947310.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 25946..28318 product DUF1989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067519.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 28498..29343 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837305.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 29353..30120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 30059..30760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 30764..31087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS 31151..32491 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532892.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(32581..32784) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421580.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 tmRNA complement(33022..33379) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(33483..33953) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948526.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene smpB CDS 34079..34780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 34957..35391 product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630220.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene dksA CDS complement(35388..37151) product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525974.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene aceK CDS complement(37196..38500) product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706620.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene aceA CDS 38643..40052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(40057..40506) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393181.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene dtd CDS complement(40503..41372) product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114180.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 41448..41819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 41816..42169 product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037282.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene sdhD CDS 42166..43977 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265974.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene sdhA CDS 44051..44749 product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596634.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 44771..45016 product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768810.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 44982..45440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(45454..47073) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186553.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene nadB CDS complement(47151..47600) product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088003.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(47551..49254) product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098180.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 49374..49880 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202045.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 49916..50440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 50415..50867 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098992.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene accB CDS 50860..52221 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814951.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene accC CDS 52218..53051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 53150..53404 product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687442.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 53440..55008 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105209.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene purH CDS 55011..56087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 56089..57438 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704786.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene purD CDS 57435..57953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 57950..59914 product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958281.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(59928..60824) product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851175.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(60893..65665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(65994..66500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(66649..67977) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074106.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(67978..68730) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947167.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 68812..69753 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975129.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 sequence003 source 1..56330 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 163..2181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 2178..3437 product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704239.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(3440..4663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 4754..6010 product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546117.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 5997..6458 product DUF4411 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544978.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 6464..9466 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 9544..11241 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502719.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene ilvD CDS 11273..12043 product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267567.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(12051..12500) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012534270.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 12590..13333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(13334..13624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(13621..14889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 14972..15913 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530247.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(15919..17028) product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096677.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 17109..17681 product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074301.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(17686..21054) product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064283.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(21054..23786) product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958090.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(23810..24109) product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528817.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(24149..24973) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094072.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 25046..26218 product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972186.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 26461..27720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 27812..28399 product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707597.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene petA CDS 28411..29661 product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215003.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 29658..30395 product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479715.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 30399..31049 product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162411.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene sspA CDS 31054..31521 product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420947.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene sspB CDS 31521..32066 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946377.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene hslV CDS 32063..33385 product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293343.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene hslU CDS 33398..34126 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027447.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 34313..35167 product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402233.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene rpoH CDS complement(35239..37587) product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266375.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 37654..38223 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806947.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 38251..39357 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403032.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene aroB CDS complement(39354..40250) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088085.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 40270..41073 product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036073.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 41114..42190 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098151.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene aroC CDS 42238..43635 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446523.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene leuC CDS 43635..44282 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222556.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene leuD CDS 44383..45003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 45074..46045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(46051..46893) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115801.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene trpA CDS complement(46890..48116) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265976.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene trpB CDS 48433..49617 product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113933.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(49637..50434) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene xth CDS 50473..51624 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164518318.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 51674..53059 product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421588.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 53110..53562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 53618..55435 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(55719..56099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 sequence004 source 1..47920 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..571 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005766020.1:recombination regulator RecX locus_tag LOCUS_01800 CDS 610..3288 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063947.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene alaS CDS 3317..4597 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085971.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 4775..5125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01830 tRNA 5140..5230 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA 5311..5387 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(5417..6073) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033459018.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene pyrE CDS 6153..7484 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261439.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(7485..8051) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084544.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(8051..8896) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114890.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene proC CDS complement(8913..9632) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194162.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 9729..10802 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269099.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene argC CDS 10805..13972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 14009..14299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 14296..14892 product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275445.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 14956..16179 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546283.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 16208..16873 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 16874..17785 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 17809..18840 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809683.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 18837..19580 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243767.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 19585..20433 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646064.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(20449..21351) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970855.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(21357..22130) product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191307.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(22163..24163) product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528247.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(24308..25165) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975811.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(25162..26031) product taurine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061776.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(26103..27116) product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276931.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(27313..29754) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112529352.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS 29818..30273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(30254..30925) product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705866.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(30938..31786) product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206428.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 tRNA complement(31809..31885) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(31894..32781) product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729118.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(32887..34500) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535409.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene gshA CDS 34707..35732 product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707399.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene dusA CDS 35729..37276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 37273..38109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 38106..38795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 38818..39735 product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057878.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(40125..40529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 40896..41678 product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003105.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 42096..43061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 43198..46677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 46825..47091 product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037637.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 47103..47756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 sequence005 source 1..46134 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 223..1701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(1863..2060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 1968..3260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 3283..6405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 6458..9493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 9494..12487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 12553..15234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 15378..18305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 18322..19116 product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 gene fabG CDS 19163..21748 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947476.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene clpB CDS complement(21755..22453) product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103309.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 22534..23238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(23235..24704) product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350322.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 24779..25039 product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193727.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 25065..25961 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109274.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(25945..26601) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813244.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene rpiA CDS complement(26603..27406) product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338148.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 27542..28831 product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932547.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 28845..31139 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932548.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 31142..31759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 31772..32686 product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940768.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 32797..35313 product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108570.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(35310..36104) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 36195..37361 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064838.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene argE CDS complement(37375..38625) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530448.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 38715..40043 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883395.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene folP CDS 40230..40709 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392242.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 40754..42610 product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 42635..43885 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941893.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 43944..44198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 44195..44497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 44497..44745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 44742..45812 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532083.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene moaA sequence006 source 1..42347 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(119..478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(609..1073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(1252..2562) product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003142418.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene guaD CDS 2561..3181 product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727574.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene uraD CDS 3178..3513 product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336831.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene uraH CDS 3516..4721 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947959.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(4779..4949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(4977..6260) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896012.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(6443..9940) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946697.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene dnaE CDS complement(9937..10515) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191384.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene rnhB CDS complement(10517..11674) product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113865.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene lpxB CDS complement(11691..12440) product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368155.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene lpxA CDS complement(12493..12945) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192266.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene fabZ CDS complement(12942..13997) product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098585.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene lpxD CDS complement(14044..14562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(14609..17065) product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245414.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene bamA CDS complement(17116..18435) product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098594.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene rseP CDS complement(18522..19697) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765988.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene ispC CDS complement(19694..20515) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092388.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene cdsA CDS complement(20512..21276) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420551.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(21276..21836) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947438.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene frr CDS complement(21906..26213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 26755..28344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(28445..28990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 tRNA complement(29005..29078) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(29112..29498) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005336286.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene rpsI CDS complement(29552..29980) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918559.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene rplM CDS complement(30080..30826) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106922.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene kdsB CDS complement(30811..31818) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706582.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene lpxK CDS complement(31818..33611) product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706583.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 gene msbA CDS 33738..35285 product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531176.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 35345..35887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(35884..37914) product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531166.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(37930..38835) product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066873494.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(38859..39791) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193173633.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(39825..40133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(40150..40767) product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395377.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(40785..41483) product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037386375.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 misc_feature complement(41686..>42347) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071102.1:phosphoribosyltransferase family protein locus_tag LOCUS_02920 sequence007 source 1..42044 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(401..1531) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250860.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 1679..3550 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 3547..4956 product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706705.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 5060..6202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 6256..6948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 7026..7748 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038353.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene rph CDS 7772..8374 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704791.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 8384..10012 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene gpmI CDS complement(10028..10294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 10405..11634 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 11639..12244 product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986868.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 12279..13514 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 13528..14643 product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815379.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(14634..15749) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389826.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene rnd CDS 15822..17183 product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073577.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene mpl CDS 17270..17869 product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403888.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(17874..18098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(18107..19897) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 19969..20811 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921532.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(20845..22719) product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103655.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(22719..22934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(23266..24795) product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200059.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(24792..25172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(25207..26259) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481684.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(26304..28301) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211829411.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene metG CDS 28422..29495 product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567450.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene apbC CDS 29528..30007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS 30259..30825 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808382.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene dcd CDS 30910..31488 product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919854.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 31472..32041 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036064.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene msrA CDS 32126..33010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 33014..33829 product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113213.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 33853..35181 product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114800.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(35192..35776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(35839..36192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(36222..36788) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112737.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(36788..37258) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186098.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene rlmH CDS complement(37301..37684) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100305.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene rsfS CDS complement(37681..38334) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210330.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene nadD CDS complement(38369..38854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 39050..40111 product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185886.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene nadA CDS complement(40153..40968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(41359..41880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03350 sequence008 source 1..41026 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..3294 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921648.1:YDG domain-containing protein locus_tag LOCUS_03360 CDS complement(3317..4030) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706567.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene lpxH CDS complement(4214..4429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 4335..11873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 12026..13399 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene cysS tRNA 13542..13618 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 13702..14241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 14238..15734 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037645.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene nusA CDS 15722..18115 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958223.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene infB CDS 18122..18499 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428234.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene rbfA CDS 18480..19397 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100522.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene truB assembly_gap 19475..19574 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA complement(19676..19751) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 19832..21856 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957630.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene uvrB CDS complement(21866..22453) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104746.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 tRNA complement(22475..22551) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS complement(22592..24052) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112870.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene gatB CDS complement(24049..25545) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091960758.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene gatA CDS complement(25557..25916) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106543.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene gatC CDS 26256..32993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 33118..34155 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189550.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 34233..35048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 35038..35538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 35538..37442 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399770.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene mrdA CDS 37459..38562 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261454.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene rodA CDS 38577..39575 product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132500.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene mltB CDS 39615..40430 product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929963.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 sequence009 source 1..39242 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 453..935 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 928..1968 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268330.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene nagZ CDS 1998..2717 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946684.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 2766..3869 product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892127.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 3927..4217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 4273..6060 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807038.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene aspS CDS 6122..6841 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947017.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 6841..7350 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003026245.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene ruvC CDS 7347..7946 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772102.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene ruvA CDS 7972..9027 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931466.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene ruvB assembly_gap 9426..9525 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 9600..10325 product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554655.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene tolQ CDS 10322..10735 product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126827401.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene tolR CDS 10732..11451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 11448..12743 product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038134.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene tolB CDS 12801..13361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 13397..14212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03740 tRNA 14220..14295 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(14323..15300) product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975103.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(15307..16200) product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932553.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 16298..17698 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215550.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene glmU CDS 17751..19580 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114654.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene glmS CDS 19577..20947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 21448..23106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 23103..23750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(23761..24321) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564662.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene efp CDS 24369..25049 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 25046..26866 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764425.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene uvrC CDS complement(26820..28163) product UDP-N-acetyl-D-glucosamine 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113429.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene wbpA CDS complement(28160..29143) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706039.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(29140..32304) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258550.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene ileS CDS complement(32301..32897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(33104..34513) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389475.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene gltA CDS 34714..35682 product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969676.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 35744..36823 product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331284.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 36820..38337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 38350..39111 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257492.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 sequence010 source 1..38419 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(58..507) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704179.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene dut CDS complement(557..1153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03950 assembly_gap 1240..1339 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2011..2637 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704181.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene radC CDS 2673..3218 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337767.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene cobO CDS 3301..4119 product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258927.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene yhdJ CDS 4109..4600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 4719..5963 product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148382.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 5982..6287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 6284..9334 product sarcosine oxidase subunit alpha family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202495.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 9327..9920 product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205601.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 9917..11218 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968391.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(11241..13694) product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204034.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(13801..15447) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094059.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene groL CDS complement(15511..15696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(15984..16430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(16427..17290) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886270.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 17480..19447 product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064751.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene dsbD CDS 19453..19959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(19978..20625) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252464.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(20691..21134) product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266803.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene moaE CDS complement(21147..21377) product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764130.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene moaD CDS 21470..21997 product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965931.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene moaB CDS 22089..24332 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095687.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene parC CDS 24335..25228 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809513.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 25228..26121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(26118..26927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(26924..27814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 27828..28787 product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038203.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene rluD CDS complement(28806..29663) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104915.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene nadC CDS 29741..31312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 31332..32723 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390981.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene thrC CDS 32720..33646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04250 assembly_gap 33726..33825 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 34038..34265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 34275..34496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(34683..35930) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337052.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(36039..37139) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480736.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(37202..38305) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722797.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 sequence011 source 1..35476 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 660..1916 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927715.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene hemA CDS 1924..3009 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706935.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene prfA CDS 3006..3839 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114694.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene prmC CDS complement(3885..5090) product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063044.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 assembly_gap 4362..4461 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(5116..6204) product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233234.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene serC CDS complement(6259..7221) product hydroxypyruvate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081620.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(7232..8179) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188178.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene asd assembly_gap 8238..8337 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 8670..8939 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114951.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene rpsO CDS 8966..11092 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369529.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene pnp CDS complement(11119..12549) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085916.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(12546..13256) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 13298..13921 product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084189.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(13925..16522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(16735..19623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 assembly_gap 19729..19828 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(20574..21683) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764114.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(21680..22876) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419738.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(23020..24120) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722552.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(24386..26524) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530885.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(26558..27445) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811978.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(27445..28380) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530883.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(28568..30268) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532331.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 30416..31066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 31063..32133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 32197..34656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04540 sequence012 source 1..33908 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..3212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(3314..3991) product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106037.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(3999..4439) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877160.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 4528..5841 product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532906.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene glnT CDS 5862..6455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 6496..7050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(7064..8308) product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337262.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(8358..11507) product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038915.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene putA CDS 11758..13536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 13567..13914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 13914..14510 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036206.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene recR CDS 14579..16144 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421494.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 16163..17140 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490818.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 17137..18048 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455202.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 18055..19011 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937477.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 19017..20042 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937476.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 20047..20838 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216995.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene truA CDS 20879..21547 product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104200.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 21544..22446 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104199.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene accD CDS 22443..23831 product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811819.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene folC CDS 23828..24355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 24436..24930 product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113932.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 24930..26462 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091383.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene purF assembly_gap 26630..26729 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 26796..28151 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038949.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 assembly_gap 27992..28091 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 28106..28252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(28269..28553) product DUF2160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312913.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(28563..29369) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376266.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(29369..30235) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530331.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(30232..31317) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531811.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(31310..32380) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973409.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 misc_feature complement(32382..>33908) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003098460.1:glycerol-3-phosphate dehydrogenase locus_tag LOCUS_04850 sequence013 source 1..33008 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 2007..2106 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2805..3263 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769445.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene mraZ CDS 3275..4216 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110151.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene rsmH CDS 4324..4560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 4560..6236 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042597405.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 6233..7795 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095570.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene murE CDS 7795..9213 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957393.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 9207..10289 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene mraY CDS 10292..11629 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766566.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene murD CDS 11626..12816 product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039094.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene ftsW CDS 12813..13913 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194182.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene murG CDS 13906..15339 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268845.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene murC CDS 15336..16238 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357031.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene murB CDS 16235..17065 product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948311.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 17059..18276 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364017.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene ftsA CDS 18345..19610 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420911.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene ftsZ CDS 19879..20793 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene lpxC CDS complement(20810..21124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 21181..23895 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220108.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene secA CDS 23921..25156 product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388153.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene argJ CDS 25137..25556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(25617..26264) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194322.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene coaE CDS 26416..27921 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772922.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene sufB assembly_gap 27926..28025 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 28030..28584 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066380.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 28677..29447 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene sufC CDS 29444..30760 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928762.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene sufD assembly_gap 30917..31016 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 31316..31636 product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037899.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 31636..32943 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094332.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene murA sequence014 source 1..32398 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3960..4748) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192025.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS complement(4763..5932) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039871.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene holB CDS complement(5929..6648) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091125.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene tmk CDS complement(6645..7913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(7977..9197) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193086.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene fabF CDS complement(9287..9526) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002814322.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene acpP CDS complement(9661..10401) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091137.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene fabG CDS complement(10478..11446) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(11443..12633) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947122.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene plsX CDS complement(12648..12815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 13031..14131 product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813056.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene aroG CDS 14128..15336 product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene sat CDS 15350..16330 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941156.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene trxB CDS 16320..16922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 16938..17261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 17351..18049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 18114..18713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(18737..19822) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974519.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(19819..20631) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640674.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(20618..21547) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265910.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 assembly_gap 21732..21831 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(21847..23004) product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920973.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 assembly_gap 23210..23309 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 23332..24564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(24585..24905) product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186955.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene grxD CDS complement(24971..25249) product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815785.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(25252..25548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(25545..26216) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946580.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(26213..26677) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815777.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 gene mlaD CDS complement(26677..27468) product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001887761.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene mlaE CDS complement(27465..28286) product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073693.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene mlaF CDS complement(28495..29235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 29347..30087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(30145..31140) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530045.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 misc_feature complement(31175..>32398) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530046.1:mandelate racemase/muconate lactonizing enzyme family protein locus_tag LOCUS_05450 sequence015 source 1..30416 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(44..1198) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038918.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 1288..2493 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071526.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene tyrS CDS 2503..3333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 3340..4620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 4632..6845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 6848..8857 product PEGA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008292761.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 8906..9064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 9066..9857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 9857..10918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 10909..11919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 rRNA 12225..13766 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 CDS 13944..14165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(14192..15118) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395802.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 15567..15878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 15875..19510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 19609..20589 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113326.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 tRNA 20868..20944 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 21002..21208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05610 tRNA 21231..21306 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 rRNA 21661..24561 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 rRNA 24679..24787 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 CDS complement(24851..26242) product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946411.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(26272..26604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(26612..27052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(27069..27668) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894276.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(27827..28033) product DUF6494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526979.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 28194..29012 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118351.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene fdhD CDS complement(29467..29841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05680 sequence016 source 1..29539 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 196..1215 product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087143.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 1329..1832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 1832..3334 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459464.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 3350..5095 product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972394.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 5136..6383 product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085940.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene frc CDS 6383..7309 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene fmt CDS 7306..8289 product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088878.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(8337..8618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(8668..10140) product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971781.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene sthA CDS 10332..11828 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403903.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 11894..13273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(13266..13778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 13838..14266 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037987.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(14278..14856) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042064868.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(14853..16022) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089466.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 16258..17649 product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162600451.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 17646..18341 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085122.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene rpe CDS 18354..19868 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402019.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene trpE CDS 19868..20464 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 assembly_gap 20506..20605 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 20616..21407 product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437196.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 gene trpC CDS 21404..21826 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401427.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 21901..22980 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 22977..23282 product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064795.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 23321..23668 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132650.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene arsC CDS 23677..24273 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528294.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(24302..26716) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220005.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene gyrB assembly_gap 26896..26995 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(27055..28170) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035260.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene dnaN misc_feature complement(28433..>29539) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010945763.1:chromosomal replication initiator protein DnaA locus_tag LOCUS_05960 sequence017 source 1..25760 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1422..2588) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704903.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene metK CDS 2726..3655 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096572.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene argB CDS 3655..5514 product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038070.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene recQ CDS 5631..6386 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887476.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(6387..7592) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070947.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 7844..9484 product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074085.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(9524..10459) product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693754.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene rluC CDS complement(10459..11751) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525489.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 11751..11966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 11920..13272 product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037489.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 13265..14377 product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726684.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 assembly_gap 14382..14481 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 14490..15821 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973446.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 15924..16994 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528515.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 17055..18152 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528516.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 18149..19027 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528517.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 19031..19873 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528518.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(19915..20967) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329344.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene ugpC CDS complement(20971..21816) product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811259.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene ugpE CDS complement(21816..22697) product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969345.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene ugpA CDS complement(22755..24068) product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083853.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene ugpB sequence018 source 1..25348 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 329..1528 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 1537..2232 product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228074.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 2454..2663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 2667..4493 product VC_2705 family sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259231.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 note possible pseudo, internal stop codon CDS 4567..4923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(4932..5864) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192300.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene miaA CDS 5958..6785 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074016730.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(6815..8656) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105240.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene mutL CDS complement(8643..9833) product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene amiB CDS complement(9827..10339) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106408.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene tsaE CDS complement(10326..11822) product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704859.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(11841..12653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 12776..13843 product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110324.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene queG CDS complement(13851..14183) product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(14205..14507) product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932538.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene tusB CDS complement(14507..14932) product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932537.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene tusC CDS complement(14932..15321) product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932536.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene tusD CDS complement(15346..15906) product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209143.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene orn CDS complement(15962..17239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 17543..18334 product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506490.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene fabI CDS complement(18335..20161) product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 20334..22316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06380 assembly_gap 22180..22279 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 22316..22978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 sequence019 source 1..25020 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 127..798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 841..1815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 1892..2383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 2494..4530 product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 4587..4925 product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970914.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 4922..5389 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970913.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 5407..6765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS complement(6776..6961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(6958..8223) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958118.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(8220..8591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(8634..9773) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625896.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 9872..10651 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071160.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene panB CDS complement(10645..11904) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391471.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 11967..12710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(12752..14401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(14551..14937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(14930..15178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(15186..15431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(15624..16784) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933793.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(17026..18192) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391469.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(18189..19187) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241956.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(19230..20741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(20930..21130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(21127..23037) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061526.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(23034..24974) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061525.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 sequence020 source 1..24971 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1004..2452) product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090469.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(2445..7040) product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066927.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene gltB CDS complement(7186..7767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040721.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(7764..8516) product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197992.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 8488..8700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(8770..9636) product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038909.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(9659..10222) product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482726.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(10239..10430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(10358..11941) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083723.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene ctaD CDS complement(11958..12179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(12176..12418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(12461..13603) product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101203.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene coxB CDS complement(13715..15928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(16204..17109) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768584.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene cyoE CDS complement(17109..17582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 17473..18612 product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089449.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 misc_feature complement(18628..>24971) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_211921382.1:putative Ig domain-containing protein locus_tag LOCUS_06810 sequence021 source 1..23071 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1900 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776172.1:Ig-like domain-containing protein locus_tag LOCUS_06820 CDS complement(1917..2642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 assembly_gap 2662..2761 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3028..4332 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705373.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 4329..5939 product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730646.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 6039..8015 product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730645.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 8031..8636 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268298.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 8633..8956 product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708200.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 8956..10914 product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530253.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 11225..15847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 15844..20565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(20602..21999) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114627.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(22442..22990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 sequence022 source 1..22288 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1..1533) product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(1526..3724) product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337301.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene scpA CDS complement(3786..4334) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943393.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 4451..5701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 5713..6387 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457207.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(6392..7285) product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258927.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene yhdJ CDS complement(7288..8283) product acryloyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233163.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(8301..8888) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037574.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(8911..9426) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707093.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(9407..9832) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707095.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene nusB CDS complement(9832..10284) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093311.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene ribE CDS complement(10277..11461) product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039073.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene ribBA CDS complement(11458..12093) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(12097..13245) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704561.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 gene ribD CDS complement(13249..13752) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771735.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene nrdR CDS complement(13758..14783) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486403.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene secF CDS complement(14783..16666) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482962.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene secD CDS complement(16792..17868) product alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533458.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(17897..22084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07120 sequence023 source 1..22261 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(79..152) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA complement(178..262) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(867..1532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(1532..2311) product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189091.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(2308..3078) product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815379.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene birA CDS 3175..3828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 3833..4978 product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118672.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene ispG CDS 4975..5688 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327506.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 5724..6197 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792822.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene msrB CDS 6194..6991 product DUF1223 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195184.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 7081..7494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 7586..8092 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969379.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene moaC CDS 8099..9367 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812683.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 9361..10017 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106022.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(10022..10366) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918409.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(10388..11761) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163308.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(11864..12079) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082372.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(12280..13929) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102377.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 14124..15125 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338924.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(15091..16170) product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112603.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene ltaE CDS complement(16178..17131) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313706.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 repeat_region 17237..17471 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggggtggacatgcactcaaaaccaaatgctttcccacc CDS complement(17477..18652) product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029732907.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 18808..20016 product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336960.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 20058..21545 product sodium/proton antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113594.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene nhaB CDS 21546..21863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07350 sequence024 source 1..22171 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 217..702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 678..926 product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816027.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene yidD CDS 938..2626 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105595.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene yidC CDS 2658..4124 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175133.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene mnmE assembly_gap 3989..4088 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4248..6134 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965608.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene mnmG CDS complement(6150..7496) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160795.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene gorA CDS 7580..8197 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390884.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 8198..8758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 8758..10104 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene pepP CDS 10101..11318 product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111165.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene ubiH CDS 11322..12539 product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266320.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 12564..12983 product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194273.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene fur CDS 13015..13953 product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 tRNA complement(13965..14040) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 14167..14985 product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727532.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 14996..16990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(17053..20472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727531.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(20483..21355) product DUF4007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727530.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(21408..21656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07530 sequence025 source 1..21076 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1169 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203976.1:FtsH protease activity modulator HflK locus_tag LOCUS_07540 CDS 1170..2048 product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106429.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene hflC CDS 2110..3399 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095642.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 3436..4929 product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368063.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene gabD CDS 5158..5622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS complement(5782..6693) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937425.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene hisG CDS 6811..7386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(7405..8808) product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169667.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene pntB CDS complement(8805..10346) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302608.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene pntA CDS 10456..12648 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112282.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene rnr CDS 12681..14501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 14503..15285 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620859.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene rlmB CDS complement(15270..16460) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262910.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene msrB CDS 16550..17296 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101974.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene pdxJ CDS complement(17286..17666) product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198835.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 17773..19083 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109642.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 19134..20873 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene recJ sequence026 source 1..20994 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(197..799) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096904.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene nth CDS complement(820..1482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 1547..3187 product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089209.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(3181..4236) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092092.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS complement(4236..5897) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388526.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(5894..6943) product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974534.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 7180..8895 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958595.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene argS CDS 8895..9458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 9463..10413 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099264.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene hemC CDS 10394..11203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 11235..12410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 12407..13645 product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096390.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 13719..14504 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614886.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(14501..15037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(15024..16088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(16180..17073) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206994.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene argF CDS 17161..18396 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 18403..19131 product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118717.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 19136..19801 product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029005.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 19798..20757 product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114803.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 sequence027 source 1..20500 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1302..1913) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958433.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene yihA CDS 1994..2587 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(2604..3521) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338398.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene folD CDS 3587..4540 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245314.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene fabD CDS complement(4537..5601) product betaine--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240571.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene bmt CDS 5747..6877 product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390215.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(6887..7357) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530371.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 7468..7917 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945508.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 7923..8744 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727762.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 8755..9894 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081326.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene leuB CDS 9904..11343 product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459012.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(11340..12470) product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969965.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(12554..13729) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224609.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(13726..14481) product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291204.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene rluB CDS complement(14478..15098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(15101..15943) product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396554.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(15950..17164) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191887.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(17161..17781) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091486.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(17827..19149) product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095142.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 tRNA 19219..19291 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 19390..19950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 sequence028 source 1..19747 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1168..2358) product 2-phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350737.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(2409..3671) product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704054.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS complement(3717..5882) product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038548.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(5956..8583) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310719.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(8622..9092) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061534.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 9157..10614 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812368.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene guaB CDS 10672..12249 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037329.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene guaA CDS 12240..12698 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810985.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene tadA CDS 12791..13603 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024325363.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 13761..14858 product spermidine-binding protein SpuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084301.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene spuE CDS 14870..16033 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530249.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 16033..17058 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388771.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 17055..17885 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388770.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(17925..19094) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920958.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 misc_feature complement(19176..>19747) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267129.1:lipid A biosynthesis lauroyl acyltransferase locus_tag LOCUS_08250 sequence029 source 1..19622 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2197 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003095847.1:primosomal protein N' locus_tag LOCUS_08260 CDS 2204..3247 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene pyrC CDS complement(3253..5193) product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098131.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 tRNA complement(5259..5336) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA complement(5342..5417) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(5464..5754) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357604.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(5991..8435) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071918.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene lon CDS complement(8578..9891) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087924.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene clpX CDS complement(9935..10558) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418252.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene clpP CDS complement(10555..11898) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267215.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene tig tRNA complement(11920..12004) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA complement(12021..12097) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA complement(12131..12206) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA complement(12748..12825) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 12925..14970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08340 assembly_gap 15138..15237 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 15381..17054 product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026051156.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene htpG CDS 17093..17545 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243288.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 17578..18813 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105667.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 sequence030 source 1..19432 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(114..1922) product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113630057.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(2041..3303) product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528423.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(3296..4801) product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000463030.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(4817..5515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(5561..6592) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818532.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 6707..8221 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458967.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 8208..9755 product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393478.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(9764..10993) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532282.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(11045..11335) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771921.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(11325..13763) product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317954.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene clpA CDS complement(13779..14102) product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640501.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene clpS CDS complement(14103..14474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 misc_feature complement(14546..>19432) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941413.1:fibronectin type III domain-containing protein locus_tag LOCUS_08500 sequence031 source 1..19298 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(440..1273) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089546.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(1275..2930) product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399307.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 3084..4304 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 4313..4735 product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(4732..5655) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556463.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(5784..6092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 6196..7035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 7098..7973 product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436920.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(7970..9214) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401363.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(9211..9591) product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009455671.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(9642..10430) product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070532.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 10512..11741 product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073991.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 11872..12765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 12785..13477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 13474..14301 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407632.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 14430..15692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 15751..17151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 17316..19007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 sequence032 source 1..19254 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1..1704) product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085104.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(1795..3567) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968009.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(3602..4492) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113950.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(4525..5007) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688476.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene greA CDS complement(5004..8297) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095207.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene carB CDS complement(8290..9513) product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037011.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene carA CDS 9616..11040 product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103740.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 11114..12337 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172709.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 12432..13364 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 13361..14320 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 14317..15057 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083886.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 15068..15772 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(15782..16594) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400159.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene dapB CDS 16799..18481 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092366.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 sequence033 source 1..18918 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 802..3066 product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039135.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 3063..4355 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444876.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 4368..4616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 4620..6428 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193305.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene lepA CDS 6428..7228 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065098.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene lepB CDS 7230..7925 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172746.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene rnc CDS 7925..8821 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036468.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene era CDS 8824..9576 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772032.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene recO CDS 9601..12531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(13100..14527) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086503.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene lpdA CDS complement(14543..16198) product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063727.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene aceF CDS complement(16199..18871) product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114556.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene aceE sequence034 source 1..18810 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 281..1180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 note possible pseudo, frameshifted CDS 1281..2069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 2297..2863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 2863..3093 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095634.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene rpsR CDS 3105..3683 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480442.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene rplI CDS 3789..5177 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192724.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 5208..6332 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112284.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 gene alr CDS 6325..7695 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555235.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene radA CDS complement(7747..7926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 7963..8298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 8724..9344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(9354..10265) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061850.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(10265..11107) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186650.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene dapD CDS 11303..12274 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455166.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 12178..12627 product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859143.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 12648..13205 product Panacea domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703843.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 13261..13602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(13627..14439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(14436..14897) product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705303.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(14894..15427) product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039916.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(15424..17385) product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114291.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(17407..17844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(17844..17978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(17989..18753) product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420296.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 sequence035 source 1..18282 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 127..1179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 1176..2297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 2282..3634 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092364.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene eno CDS 3631..3915 product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420699.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene ftsB CDS complement(3928..6069) product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022388.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(6186..6560) product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943630.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(6557..7558) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925680.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene hemH CDS complement(7546..8745) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531195.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(8773..10887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(10890..11978) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225667.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene ychF CDS complement(11978..12598) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221185.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene pth CDS complement(12625..13317) product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770208.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS complement(13336..14286) product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931310.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 tRNA complement(14320..14396) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 14545..15510 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525503.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene speB CDS complement(15515..15874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09330 assembly_gap 15922..16021 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(16529..17173) product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365627.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene lolB misc_feature complement(17173..>18282) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103429.1:tetratricopeptide repeat protein locus_tag LOCUS_09350 sequence036 source 1..18064 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 269..850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(838..1113) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414772.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene yccX CDS complement(1110..2171) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(2251..3480) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704436.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene hemL assembly_gap 3502..3601 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3838..5103) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096334.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene rho CDS complement(5350..5688) product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene trxA CDS 5856..7256 product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704129.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene rhlB CDS complement(7253..8131) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092629.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene xerD CDS complement(8124..9884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(9958..10308) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005313505.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene rplS CDS complement(10305..11054) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469802.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene trmD CDS complement(11081..11659) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703198.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene rimM CDS complement(11622..12083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(12213..12677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 12765..14057 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705853.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene xseA CDS complement(14086..15447) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192452.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene der CDS complement(15483..16688) product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771013.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene bamB CDS complement(16688..17410) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770804.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 misc_feature complement(17417..>18064) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023995843.1:histidine--tRNA ligase locus_tag LOCUS_09540 sequence037 source 1..17520 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(234..1046) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039216.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene mutM CDS 1045..2109 product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 2106..2711 product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381567.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene wrbA CDS complement(2695..3369) product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958403.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene hda CDS complement(3366..3932) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532444.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(3965..4666) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640231.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 4870..5892 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194386.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene purM CDS 5883..6527 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112584.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene purN CDS 6524..7216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS 7242..7670 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283762.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 7690..8610 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666552.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 8607..9380 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304632.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS complement(9385..11115) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816751.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene ptsP CDS complement(11118..11420) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468661.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(11417..12280) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369491.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene rapZ CDS complement(12277..12801) product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222750.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene ptsN CDS complement(12798..13091) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815178.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene raiA CDS complement(13174..13938) product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942533.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene lptB CDS complement(13922..14443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(14440..14862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(14886..15875) product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037924.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 16020..16331 product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970194.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(16383..16643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(16655..16909) product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022122.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(16906..17094) product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022121.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 sequence038 source 1..17467 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(147..362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 392..640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(598..1446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(1434..2333) product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875830.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(2419..3963) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731465.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 4248..4910 product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384632.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 4941..6131 product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243520.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 6161..7384 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190136.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(7407..7592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(7608..7871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 8002..9501 product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973074.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 9514..11511 product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204428.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 11508..12380 product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267708.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 12384..12965 product DUF2889 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391492.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 assembly_gap 12973..13072 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(13213..13668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09940 misc_feature complement(13768..>17467) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921648.1:YDG domain-containing protein locus_tag LOCUS_09950 sequence039 source 1..17253 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(344..1759) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026051153.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene gltX tRNA complement(1801..1877) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(1925..2290) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090655.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(2298..2651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(2866..5283) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103972.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene pheT CDS complement(5296..6327) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114409.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene pheS CDS complement(6329..6691) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099086.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene rplT CDS complement(6748..6945) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942164.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene rpmI CDS complement(7064..7636) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106936.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene infC CDS complement(7696..9609) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211836.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene thrS tRNA complement(9621..9697) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 10356..12467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(12495..13301) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947138.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(13298..14311) product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943275.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(14331..17090) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene fdhF sequence040 source 1..16383 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 5026..5125 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5300..6577 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038356.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene hemW assembly_gap 6718..6817 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(7113..8501) product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037734.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene pmbA CDS complement(8515..9981) product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194084.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene tldD CDS complement(10004..10891) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194407.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 tRNA complement(10041..10124) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(11080..11874) product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388401.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene pgeF tRNA 11948..12035 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS complement(12171..13103) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318785.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene ispH CDS complement(13111..13635) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112823.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene lspA CDS complement(13632..14582) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535897.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(14622..16154) product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704641.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene murJ sequence041 source 1..16149 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..561 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532060.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(545..1063) product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193471.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(1056..2042) product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553942.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene alc CDS complement(2054..2962) product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920459.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene puuE CDS complement(2959..4152) product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083321.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(4156..5160) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388524.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(5234..6322) product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389655.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(6386..7306) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389656.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(7329..8405) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389657.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(8407..9891) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389658.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 10039..11406 product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112635.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 11436..13004 product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242244.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene xdhA CDS 13047..15407 product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114679.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene xdhB sequence042 source 1..16101 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(983..1058) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(1118..1393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(1491..1868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(1959..2873) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390154.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(2984..3601) product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707565.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene ampD CDS complement(3598..4854) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228155.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(4851..6413) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 6540..8714 product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943936.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene ppk1 misc_feature complement(8742..>16101) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257272.1:Calx-beta domain-containing protein locus_tag LOCUS_10380 assembly_gap 11268..11367 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence043 source 1..15583 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 81..156 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 224..520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 526..1113 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317113.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene nusG CDS 1123..1596 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690112.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene rplK CDS 1593..2288 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185135.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene rplA CDS 2303..2857 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806888.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene rplJ CDS 2919..3299 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038645.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene rplL CDS 3408..7547 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946073.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene rpoB CDS 7547..12226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 12507..12881 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399892.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene rpsL CDS 12916..13368 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093742.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene rpsG CDS 13406..15499 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957451.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene fusA sequence044 source 1..15517 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(554..1855) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268988.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(1912..2937) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114330.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene holA CDS complement(2937..3452) product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947077.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene lptE CDS complement(3456..5969) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957661.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene leuS CDS 6044..7912 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918829.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene dnaG CDS 8081..10000 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453778.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene rpoD CDS complement(10044..10622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 10753..11646 product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091343.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 11643..13466 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879555.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene recN CDS 13463..13963 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686683.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 13960..14307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(14333..14827) product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189237.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 sequence045 source 1..14486 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 736..1275 product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087475.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene fabA CDS 1283..2530 product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene fabB CDS 2527..3606 product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087731.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(3584..4234) product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064484.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene coq7 CDS 4278..5747 product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268365.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene glcD CDS 5747..6826 product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114371.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene glcE CDS 6826..8031 product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114370.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene glcF CDS 8055..8369 product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 8379..9569 product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404120.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 9573..10394 product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206650.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 tRNA 10444..10530 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(10509..11072) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211023.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene ogt CDS complement(11080..12354) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967039.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(12398..13480) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073009.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene tgt misc_feature complement(13470..>14486) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930156.1:tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA locus_tag LOCUS_10750 sequence046 source 1..14075 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(20..1165) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555464.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene rpoA CDS complement(1204..1827) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417269.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene rpsD CDS complement(1840..2235) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216249.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene rpsK CDS complement(2248..2604) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213346.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene rpsM CDS complement(2761..4098) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806926.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene secY assembly_gap 4196..4295 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4469..4882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(4839..5033) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215447.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene rpmD CDS complement(5041..5550) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197945.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene rpsE CDS complement(5634..5990) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197946.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene rplR CDS complement(5995..6558) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093699.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene rplF CDS complement(6584..6979) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555475.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene rpsH CDS complement(7029..7334) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118926.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene rpsN CDS complement(7334..7873) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768935.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene rplE CDS complement(7877..8221) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008571669.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene rplX CDS complement(8218..8586) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307975.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene rplN CDS complement(8598..8891) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417239.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene rpsQ CDS complement(8888..9130) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771530.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene rpmC CDS complement(9133..9546) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199857.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene rplP CDS complement(9554..10327) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221644.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene rpsC CDS complement(10334..10714) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083595.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene rplV CDS complement(10717..10989) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138119.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene rpsS CDS complement(10989..11813) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070620.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene rplB CDS complement(11832..12227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(12224..13780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10990 assembly_gap 12900..12999 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence047 source 1..13147 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..744 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013099255.1:DNA helicase II locus_tag LOCUS_11000 CDS 808..1503 product proteobacterial dedicated sortase system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072225.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene pdsR CDS 1508..3673 product proteobacterial dedicated sortase system histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072224.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene pdsS CDS complement(3691..4011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 4090..6825 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250006.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene polA CDS 6932..8017 product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444610.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene cfa CDS complement(8041..9687) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974601.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(9677..10549) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182307726.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(10546..11502) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974599.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 sequence048 source 1..13025 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..911 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530888.1:FAD-dependent oxidoreductase locus_tag LOCUS_11090 CDS 912..1622 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407919.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(1619..2362) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970620.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene hisA CDS complement(2442..3698) product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531197.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 assembly_gap 3719..3818 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4117..7149) product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975932.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(7321..8214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(8207..8365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(8362..8967) product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810383.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene ccoO CDS complement(8964..10445) product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072351.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene ccoN CDS complement(10445..11065) product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082455.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(11091..12197) product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524994.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene nirK sequence049 source 1..13001 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1853..2404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11200 assembly_gap 2554..2653 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3309..5600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(5603..6394) product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(6524..6985) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978225.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(6993..7805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(7805..8854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(8859..9044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 9296..9748 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086091.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 9834..10778 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528466.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 11038..11715 product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114053.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 sequence050 source 1..12956 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(177..896) product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263187.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(899..1099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(1260..1985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(1982..3625) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948668.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene atpA CDS complement(3687..4244) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097135.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(4244..4747) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024691.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(4753..4986) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307205.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene atpE CDS complement(5020..5913) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100237.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene atpB CDS complement(5978..6373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(6388..6987) product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388415.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(7004..7888) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(7888..8652) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958543.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(8694..9329) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039110.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene rsmG CDS 9452..10222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(10223..11848) product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361659.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene pckA sequence051 source 1..12930 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(728..2059) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114643.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene rsmB CDS complement(2056..3012) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114642.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene fmt CDS complement(3029..3604) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525852.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene def assembly_gap 4263..4362 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4534..5022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(5041..6960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 7278..8510 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090554.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 8536..9264 product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531897.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 9257..10138 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene pssA CDS 10377..11924 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522419.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 11967..12692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11540 note possible pseudo, internal stop codon, frameshifted sequence052 source 1..12842 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1412 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194180.1:adenylosuccinate lyase locus_tag LOCUS_11550 CDS 1412..2497 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036961.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 2494..3918 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114030.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene argH CDS 4044..5300 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384387.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene lysA CDS complement(5309..6211) product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958093.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS complement(6208..7062) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194401.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene aroE CDS complement(7059..7700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 7805..9061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 9058..12192 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 misc_feature complement(12182..>12842) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011817330.1:taurine dioxygenase locus_tag LOCUS_11640 sequence053 source 1..12834 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(224..820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 1081..1347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 1369..2298 product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488700.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 gene ispA CDS 2417..4321 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813105.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene dxs CDS 4353..5225 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529690.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 5222..6352 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545276.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 6418..7239 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208959.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene tpiA CDS 7273..7626 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040273.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene secG tRNA 7643..7729 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(7751..8953) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528000.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 9139..10062 product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532649.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 10062..11300 product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811711.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 sequence054 source 1..12791 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(455..991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(981..2213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 2364..4613 product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968325.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(4622..6244) product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061789.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(6300..7346) product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061793.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 7464..8666 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(8663..10111) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337852.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(10108..11121) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337851.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(11122..11826) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(11823..12686) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384138.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 sequence055 source 1..11995 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 1319..1418 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1654..2757 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766543.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 gene zapE CDS 2925..3365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(3423..4493) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083076.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(4495..5337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384461.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(5374..6183) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262664.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(6232..7416) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064710.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 7478..8269 product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 8284..9519 product L-methionine/branched-chain amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368666.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene yjeH CDS 9555..10220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 10231..11526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(11563..11811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11960 sequence056 source 1..11973 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..582 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002216784.1:imidazoleglycerol-phosphate dehydratase HisB locus_tag LOCUS_11970 CDS 595..1296 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931644.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene hisH CDS 1298..2053 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106336.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene hisA CDS 2089..2856 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene hisF CDS 2853..3257 product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095888.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene hisI CDS 3301..3543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 3574..4074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 4267..5022 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073887.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene tatC CDS 5015..6631 product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211555.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(6655..7365) product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814165.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(7371..8252) product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938894.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene aat CDS 8236..9258 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369630.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene tsaD CDS complement(9290..9913) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522633.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene plsY assembly_gap 10329..10428 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10458..10694 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186391.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 gene rpmB CDS 10719..10874 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689824.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene rpmG sequence057 source 1..11937 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(746..4204) product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104408.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(4624..5343) product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937792.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene fetB CDS complement(5343..6413) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391184.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(6410..7180) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947446.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene map CDS 7407..8624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 8638..9513 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947440.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene tsf CDS 9841..10431 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174153.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(10428..11798) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930606.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 sequence058 source 1..11890 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(394..810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(876..1793) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114345.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene xerC assembly_gap 2473..2572 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2761..3066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(3072..4379) product proteolytic complex protein CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene cptA assembly_gap 5210..5309 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 5326..5748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 5768..6298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 6328..8121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 8118..9788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12270 sequence059 source 1..11772 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(76..1458) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919970.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene fumC CDS 1481..2740 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529614.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 2786..4576 product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099039.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene kefB CDS complement(4587..4973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 5319..5969 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880077.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(5935..9651) product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930621.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(9648..11660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12340 sequence060 source 1..11748 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(4626..7661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(7827..10889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 misc_feature complement(10922..>11748) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070585.1:tandem-95 repeat protein locus_tag LOCUS_12370 sequence061 source 1..11672 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(170..2989) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946456.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(2991..3428) product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100593.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene holC CDS complement(3460..4962) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092867.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 5139..6221 product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071578.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene lptF CDS 6218..7285 product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461103.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene lptG CDS 7319..8203 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028000663.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(8208..8651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(8575..9846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12450 assembly_gap 8864..8963 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(9851..10270) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195832.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 misc_feature complement(10277..>11672) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002219871.1:F0F1 ATP synthase subunit beta locus_tag LOCUS_12470 sequence062 source 1..11559 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(271..4224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12480 assembly_gap 1188..1287 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4249..5130) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086270.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene dapA CDS 5256..5990 product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947958.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 6020..6613 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229232.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(6618..7274) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207207.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 7351..8142 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080010657.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(8149..9219) product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975839.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 9341..9757 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425978.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 assembly_gap 9761..9860 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 10592..11395 product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707445.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 gene znuB sequence063 source 1..11426 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..660 product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769059.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 657..962 product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene nuoK CDS 959..2929 product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930037.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene nuoL CDS 2926..4404 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813918.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 4413..5876 product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224835.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene nuoN CDS 5873..6991 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096588.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene ddlA CDS 6988..7923 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390587.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 7920..9302 product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147522.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 9311..11380 product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967138.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 sequence064 source 1..10527 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1252..3654 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895627.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene ftsK assembly_gap 3692..3791 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3796..5106 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186129.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene serS CDS 5165..5761 product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037878.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 5754..6215 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706917.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene ruvX CDS 6208..6699 product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084574.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene pyrR CDS 6696..7664 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 7661..8968 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186353.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 8993..10468 product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565602.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 assembly_gap 9059..9158 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence065 source 1..10223 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1004..1735) product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337268.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(1732..2754) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(2831..3925) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811203.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(3954..4547) product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(4574..5947) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(6021..6434) product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(6614..7096) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477269.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 7166..8305 product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064424.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 tRNA 8119..8205 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(8294..9199) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194144.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene pyrF CDS 9198..10025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12830 sequence066 source 1..10210 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1728..2813 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405433.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 2810..3619 product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405435.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(3598..4521) product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192829.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(4502..6376) product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene btuB CDS 6750..8141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 8149..8559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 8614..10005 product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113366.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene cysG sequence067 source 1..9210 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(420..2360) product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113911.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene acs CDS complement(2454..3422) product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081163160.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(3445..4605) product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 4719..6020 product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084053.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 6017..6850 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084052.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 assembly_gap 6853..6952 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 7022..8365 product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268564.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(8433..8903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12970 sequence068 source 1..8916 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 414..1424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 1603..2202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 2199..3737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 3737..4333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(4352..5341) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886970.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(5370..8105) product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818886.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene acnB assembly_gap 5406..5505 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(8105..8707) product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909445.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 sequence069 source 1..8705 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(7..1038) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(1048..1548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(1568..2227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 assembly_gap 2332..2431 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2597..4372) product sulfoacetaldehyde acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945362.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene xsc CDS complement(4459..5577) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391433.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene ald CDS 5605..6171 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095369.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 6313..6771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705863.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 6743..7105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(7294..8391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13130 sequence070 source 1..8397 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 253..1026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 1124..2251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(2223..2939) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191981.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 3008..4225 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423059.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 4222..4863 product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095202.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene rlmE CDS 4951..6891 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809623.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene ftsH CDS 6906..8249 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071137.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene glmM tRNA complement(8270..8356) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 sequence071 source 1..8327 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1162 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114538.1:lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase locus_tag LOCUS_13210 CDS complement(1174..3804) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940973.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene pepN CDS complement(3851..4174) product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771072.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(4292..5311) product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207944.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(5308..6678) product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869179.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 assembly_gap 6896..6995 estimated_length known gap_type within scaffold linkage_evidence paired-ends misc_feature complement(7047..>8327) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113873.1:DNA mismatch repair protein MutS locus_tag LOCUS_13260 sequence072 source 1..7895 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 7..2532 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971758.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 2544..3653 product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194248.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene hrcA CDS 3658..4227 product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338669.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(4236..5021) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336750.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 5107..6705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13310 assembly_gap 5754..5853 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(6808..7893) product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090622.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 sequence073 source 1..7735 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2591..4078) product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088347.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(4139..5128) product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(5205..5978) product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705989.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene mtgA CDS complement(5986..7623) product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095724.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 sequence074 source 1..7697 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(66..1508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(1534..2022) product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186558.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene nuoI CDS complement(2036..3082) product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769061.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene nuoH CDS complement(3079..5610) product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813928.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 gene nuoG CDS complement(5645..6949) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443944.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene nuoF CDS 6921..7211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13420 sequence075 source 1..7571 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 114..189 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA 198..274 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS 327..3209 product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894214.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 3209..3727 product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194139.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 3756..4718 product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109333.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene accA CDS 4720..6096 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176586.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene tilS CDS 6130..6651 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704271.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene purE CDS 6648..7217 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769752.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 sequence076 source 1..7499 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(588..1238) product esterase TesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114753.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene tesA CDS 1253..1939 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928863.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 1936..4308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 assembly_gap 3039..3138 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4311..6200 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529979.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 6254..7051 product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705561.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene ppk2 sequence077 source 1..7221 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1345..2997) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338426.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(2994..4052) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087942.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(4045..5160) product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171436.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(5178..7172) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084241.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 assembly_gap 5261..5360 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence078 source 1..7163 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2889..3263) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001355634.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene gcvH CDS complement(3300..4415) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162129718.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene gcvT assembly_gap 4417..4516 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4543..5454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(5487..7019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13610 sequence079 source 1..6997 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1810..2289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(2340..2885) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098317.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene gmk CDS complement(2896..3693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528661.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(3678..4841) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192390.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(5029..6777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13660 sequence080 source 1..6893 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 493..1506 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037866.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 tRNA 1519..1595 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS 1614..2714 product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775991.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(2743..3519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(4464..5999) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 misc_feature complement(6045..>6893) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393208.1:cysteine synthase A locus_tag LOCUS_13710 sequence081 source 1..6837 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1111 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140889.1:arsenosugar biosynthesis radical SAM protein ArsS locus_tag LOCUS_13720 CDS 1108..2085 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895813.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene speB CDS 2091..2621 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975614.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 2644..4494 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 misc_feature complement(4525..>6837) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030909.1:glycoside hydrolase family 92 protein locus_tag LOCUS_13760 sequence082 source 1..6783 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(426..986) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091896.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene folE CDS 1070..2563 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(2560..2820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(2856..3728) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388967.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene sucD CDS complement(3728..4909) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388966.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene sucC CDS 4973..5716 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908611.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(5732..6487) product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940021.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene trmJ sequence083 source 1..6652 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2493..4499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(4493..6352) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038259.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 sequence084 source 1..6527 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 55..765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(762..3368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(3371..4303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(4381..5505) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(5645..5824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13900 misc_feature complement(5824..>6527) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927567.1:flap endonuclease Xni locus_tag LOCUS_13910 sequence085 source 1..6498 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 832..3699 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357696.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene uvrA CDS 3751..4569 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261996.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 4566..5267 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419416.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 5264..5992 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074307.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 sequence086 source 1..6454 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(664..1599) product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090860.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene rodZ CDS complement(1596..2705) product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444483.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(2702..3133) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810689.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene ndk CDS complement(3206..4603) product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388937.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene mtaB CDS complement(4578..4907) product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028953.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene iscA sequence087 source 1..6448 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..855 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003102073.1:arginine--pyruvate transaminase AruH locus_tag LOCUS_14010 CDS 861..3485 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969999.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 assembly_gap 3281..3380 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3419..4153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 4179..5522 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810594.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 5538..6446 product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812150.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 sequence088 source 1..6403 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1089..1871) product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141949.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(1868..2116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 2259..2927 product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522277.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 2941..4248 product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735329.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene tolC CDS complement(4245..5696) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070440.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 misc_feature complement(5700..>6403) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005461427.1:Trk system potassium transporter TrkA locus_tag LOCUS_14110 sequence089 source 1..6338 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..786 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331275.1:phosphate acetyltransferase locus_tag LOCUS_14120 CDS 783..1841 product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123092.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 1831..2859 product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121962.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 2869..3714 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391324.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 3778..6234 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969822.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 sequence090 source 1..6325 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 4..1305 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728086.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene hisD CDS 1302..2093 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 2146..3336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14190 assembly_gap 3132..3231 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(3371..4480) product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396744.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(4483..5424) product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582557.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(5512..6237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14220 sequence091 source 1..6280 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 444..1364 product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095783.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene ilvE CDS 1379..1606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 1663..2688 product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958358.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 gene waaF CDS 2916..5099 product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895708.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 5132..5881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096987.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 sequence092 source 1..6152 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1063..1281 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081934.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene infA CDS complement(1278..2111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14290 note possible pseudo, frameshifted CDS 2016..2285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 assembly_gap 2618..2717 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2751..2942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 2978..3466 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704185.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene coaD CDS 3479..3730 product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016533.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(3735..4823) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199913.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene hisC CDS complement(4820..6115) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268859.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene hisD sequence093 source 1..6151 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 25..1374 product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968347.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 1386..3089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 assembly_gap 1805..1904 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 3089..3382 product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821030.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 sequence094 source 1..6123 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 185..496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 481..1314 product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065267398.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 1353..2462 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene dprA CDS 2501..2974 product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166401.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 3018..5498 product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038837.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(5495..5956) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094122848.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 sequence095 source 1..5856 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1320..2441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 misc_feature complement(2446..>5856) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114676.1:chromosome segregation protein SMC locus_tag LOCUS_14460 sequence096 source 1..5567 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..3030 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257272.1:Calx-beta domain-containing protein locus_tag LOCUS_14470 CDS 3083..5383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14480 sequence097 source 1..5527 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1805..2716) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070431.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene glyQ CDS complement(2732..4351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(4348..5373) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544967.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene galE tRNA 5450..5526 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 sequence098 source 1..5523 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1107 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000132407.1:succinyl-diaminopimelate desuccinylase locus_tag LOCUS_14520 CDS 1135..2826 product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943977.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 2848..3867 product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925731.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 gene sohB CDS 3880..4395 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524734.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(4424..5422) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531149.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 sequence099 source 1..5465 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(4222..>5465) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921648.1:YDG domain-containing protein locus_tag LOCUS_14570 sequence100 source 1..5374 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(745..2040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 assembly_gap 1201..1300 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(2041..3291) product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267377.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene odhB misc_feature complement(3281..>5374) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005769626.1:2-oxoglutarate dehydrogenase E1 component locus_tag LOCUS_14600 sequence101 source 1..5301 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1315..1623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 1679..2479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 2547..2846 product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582865.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 2840..4012 product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460953.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 assembly_gap 4014..4113 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 4190..5281 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082910123.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 sequence102 source 1..5139 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1101..2009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(2006..2839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(2861..3355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 3440..4111 product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114590.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 misc_feature complement(4069..>5139) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876803.1:metallophosphoesterase locus_tag LOCUS_14700 sequence103 source 1..5122 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2045 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387813.1:acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha locus_tag LOCUS_14710 CDS 2032..3015 product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390231.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene meaB CDS 3012..3416 product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389447.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene mce CDS 3426..4151 product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019609.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene cmoA sequence104 source 1..4924 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(590..1099) product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(1121..1477) product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813943.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS 1576..2547 product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920875.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 assembly_gap 3279..3378 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS complement(4058..4618) product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522791.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene gmhB sequence105 source 1..4913 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 108..1628 product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398560.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene pyk CDS complement(1625..2899) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947133.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 3069..3668 product glutaredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261874.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(3674..4285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14820 misc_feature complement(4282..>4913) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015940983.1:site-specific DNA-methyltransferase locus_tag LOCUS_14830 sequence106 source 1..4911 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(127..813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(810..1409) product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693414.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene ccmA CDS 1485..2651 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119785.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene dinB CDS complement(2596..3441) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336964.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene panC CDS complement(3536..4228) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957521.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene gph misc_feature complement(4225..>4911) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005766737.1:bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase locus_tag LOCUS_14890 sequence107 source 1..4877 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1186..1962) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815367.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 2076..3992 product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388801.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 sequence108 source 1..4861 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(318..1472) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070680.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 1746..1937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 1973..2206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 2245..2427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 2752..3528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 3585..4817 product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310733.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 sequence109 source 1..4815 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 150..3851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 3889..4437 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092665.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 sequence110 source 1..4770 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence111 source 1..4759 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..543 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531177.1:4Fe-4S dicluster domain-containing protein locus_tag LOCUS_15000 CDS complement(540..2036) product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021841.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene glsA CDS 1992..4217 product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968324.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 assembly_gap 2064..2163 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence112 source 1..4071 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence113 source 1..4056 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(57..956) product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532814.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 1338..2228 product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189368.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(2270..2704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(2701..3954) product fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708487.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene cca sequence114 source 1..4044 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence115 source 1..3985 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(395..>3985) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921648.1:YDG domain-containing protein locus_tag LOCUS_15070 sequence116 source 1..3972 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1210 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880235.1:pyridoxal phosphate-dependent aminotransferase locus_tag LOCUS_15080 CDS 1295..1495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 1507..1839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 2190..2792 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096321.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS 2792..3250 product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958244.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 3331..3969 product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477215.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 gene ppiA sequence117 source 1..3932 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(577..1221) product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186002.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 1255..2202 product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072295.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(2526..3419) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871202.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 sequence118 source 1..3899 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(100..1179) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131114.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 gene mnmA CDS complement(2118..2381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(2473..2739) product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(2736..3791) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707498.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene mutY sequence119 source 1..3893 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..589 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003083872.1:triclosan efflux RND transporter adaptor protein TriB locus_tag LOCUS_15210 sequence120 source 1..3793 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence121 source 1..3782 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence122 source 1..3710 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 15..1868 product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185769.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 assembly_gap 1754..1853 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 1909..2232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 2237..2734 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814006.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene ilvN sequence123 source 1..3679 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 887..2578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15250 sequence124 source 1..3616 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1613..2080) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390521.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(2077..3315) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531195.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 sequence125 source 1..3584 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(193..1047) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455228.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene ubiA CDS complement(1054..3084) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096624.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene recG CDS complement(3144..3542) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687566.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 sequence126 source 1..3571 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence127 source 1..3397 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(24..746) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942828.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 806..1105 product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(1119..1637) product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070956.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene thpR CDS 1693..2427 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330118.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 2508..3260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 sequence128 source 1..3363 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 150..815 product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098558.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 897..1475 product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349540.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 1481..2320 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766016.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 sequence129 source 1..3301 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..809 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_116269310.1:tetratricopeptide repeat protein locus_tag LOCUS_15390 CDS 872..1774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(1782..2912) product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942826.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 sequence130 source 1..3227 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1307..1591) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036893.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene hfq CDS complement(1699..2418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 sequence131 source 1..3223 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1587..1874 product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 1902..2468 product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207954.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 sequence132 source 1..3221 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence133 source 1..3159 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 368..1174 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706862.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 sequence134 source 1..3112 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2525..2821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15470 sequence135 source 1..3051 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 108..521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 518..2266 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389659.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(2274..3050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15500 sequence136 source 1..3015 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(22..1566) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089648.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene lnt CDS complement(1583..2047) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037474.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene ybeY misc_feature complement(2044..>3015) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005763270.1:PhoH family protein locus_tag LOCUS_15530 sequence137 source 1..2977 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(22..1617) product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948590.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene ubiB CDS complement(1632..2285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 misc_feature complement(2285..>2977) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103462.1:bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE locus_tag LOCUS_15560 sequence138 source 1..2941 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 83..340 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383095.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene rpmA CDS 419..1441 product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551973.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene cgtA CDS 1405..2541 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094756.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene proB CDS complement(2547..2810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15600 sequence139 source 1..2916 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 211..2805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15610 sequence140 source 1..2890 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..951 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070585.1:tandem-95 repeat protein locus_tag LOCUS_15620 CDS complement(1324..1869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15630 sequence141 source 1..2890 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1889..>2890) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000973081.1:acyl-CoA dehydrogenase FadE locus_tag LOCUS_15640 sequence142 source 1..2874 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(73..1221) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947527.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene recA CDS complement(1317..1814) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532447.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS 1940..2731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15670 sequence143 source 1..2849 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(34..654) product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046849124.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene cysC tRNA complement(678..752) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS complement(809..2692) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102062.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene parE sequence144 source 1..2841 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..810 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003316297.1:anthranilate phosphoribosyltransferase locus_tag LOCUS_15700 CDS complement(865..1899) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958277.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(1905..2417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(2417..2824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15730 sequence145 source 1..2770 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence146 source 1..2720 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence147 source 1..2657 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence148 source 1..2581 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence149 source 1..2564 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(222..>2564) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964263.1:DEAD/DEAH box helicase family protein locus_tag LOCUS_15740