>Feature sequence001 966 235 gene locus_tag LOCUS_00010 gene trmB 966 235 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927735.1 protein_id gnl|my_center|LOCUS_00010 1748 963 gene locus_tag LOCUS_00020 gene djlA 1748 963 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704885.1 protein_id gnl|my_center|LOCUS_00020 1895 1822 gene locus_tag LOCUS_t00010 1895 1822 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1990 3303 gene locus_tag LOCUS_00030 1990 3303 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810114.1 protein_id gnl|my_center|LOCUS_00030 3316 5364 gene locus_tag LOCUS_00040 3316 5364 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957672.1 protein_id gnl|my_center|LOCUS_00040 6376 5375 gene locus_tag LOCUS_00050 6376 5375 CDS product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403858.1 protein_id gnl|my_center|LOCUS_00050 6427 7188 gene locus_tag LOCUS_00060 6427 7188 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192921.1 protein_id gnl|my_center|LOCUS_00060 7243 7725 gene locus_tag LOCUS_00070 gene rnhA 7243 7725 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814734.1 protein_id gnl|my_center|LOCUS_00070 7725 8450 gene locus_tag LOCUS_00080 gene dnaQ 7725 8450 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444532.1 protein_id gnl|my_center|LOCUS_00080 8769 8470 gene locus_tag LOCUS_00090 8769 8470 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072939.1 protein_id gnl|my_center|LOCUS_00090 9335 8769 gene locus_tag LOCUS_00100 9335 8769 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192037.1 protein_id gnl|my_center|LOCUS_00100 9484 10140 gene locus_tag LOCUS_00110 9484 10140 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532195.1 protein_id gnl|my_center|LOCUS_00110 10155 10553 gene locus_tag LOCUS_00120 10155 10553 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265510.1 protein_id gnl|my_center|LOCUS_00120 10979 10563 gene locus_tag LOCUS_00130 10979 10563 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393898.1 protein_id gnl|my_center|LOCUS_00130 11061 12080 gene locus_tag LOCUS_00140 11061 12080 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267458.1 protein_id gnl|my_center|LOCUS_00140 12083 13741 gene locus_tag LOCUS_00150 12083 13741 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389348.1 protein_id gnl|my_center|LOCUS_00150 15504 13801 gene locus_tag LOCUS_00160 15504 13801 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707434.1 protein_id gnl|my_center|LOCUS_00160 18289 15608 gene locus_tag LOCUS_00170 18289 15608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 21243 18361 gene locus_tag LOCUS_00180 21243 18361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 21302 21529 gene locus_tag LOCUS_00190 21302 21529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 21560 24865 gene locus_tag LOCUS_00200 21560 24865 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224369.1 protein_id gnl|my_center|LOCUS_00200 24873 25649 gene locus_tag LOCUS_00210 24873 25649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 27363 25720 gene locus_tag LOCUS_00220 27363 25720 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974597.1 protein_id gnl|my_center|LOCUS_00220 27528 29477 gene locus_tag LOCUS_00230 27528 29477 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337373.1 protein_id gnl|my_center|LOCUS_00230 29499 30293 gene locus_tag LOCUS_00240 29499 30293 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566968.1 protein_id gnl|my_center|LOCUS_00240 30290 31291 gene locus_tag LOCUS_00250 30290 31291 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719438.1 protein_id gnl|my_center|LOCUS_00250 31291 32718 gene locus_tag LOCUS_00260 31291 32718 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120704930.1 protein_id gnl|my_center|LOCUS_00260 32723 33799 gene locus_tag LOCUS_00270 32723 33799 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719437.1 protein_id gnl|my_center|LOCUS_00270 33872 35176 gene locus_tag LOCUS_00280 33872 35176 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337371.1 protein_id gnl|my_center|LOCUS_00280 35258 37087 gene locus_tag LOCUS_00290 35258 37087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 37087 38439 gene locus_tag LOCUS_00300 37087 38439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 38449 39657 gene locus_tag LOCUS_00310 38449 39657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 39847 40191 gene locus_tag LOCUS_00320 39847 40191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 40188 41330 gene locus_tag LOCUS_00330 40188 41330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 41347 42162 gene locus_tag LOCUS_00340 41347 42162 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719435.1 protein_id gnl|my_center|LOCUS_00340 42170 43417 gene locus_tag LOCUS_00350 42170 43417 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818460.1 protein_id gnl|my_center|LOCUS_00350 43446 44231 gene locus_tag LOCUS_00360 43446 44231 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337545.1 protein_id gnl|my_center|LOCUS_00360 47022 44566 gene locus_tag LOCUS_00370 47022 44566 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533447.1 protein_id gnl|my_center|LOCUS_00370 47101 48363 gene locus_tag LOCUS_00380 47101 48363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 49945 48377 gene locus_tag LOCUS_00390 49945 48377 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844661.1 protein_id gnl|my_center|LOCUS_00390 50078 51352 gene locus_tag LOCUS_00400 50078 51352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 51528 51959 gene locus_tag LOCUS_00410 51528 51959 CDS product YHS domain-containing (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878533.1 protein_id gnl|my_center|LOCUS_00410 51988 52461 gene locus_tag LOCUS_00420 51988 52461 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037970.1 protein_id gnl|my_center|LOCUS_00420 52484 54148 gene locus_tag LOCUS_00430 52484 54148 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389348.1 protein_id gnl|my_center|LOCUS_00430 54203 55516 gene locus_tag LOCUS_00440 54203 55516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 55591 56277 gene locus_tag LOCUS_00450 55591 56277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 56285 57061 gene locus_tag LOCUS_00460 gene eutA 56285 57061 CDS product ectoine utilization protein EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530330.1 protein_id gnl|my_center|LOCUS_00460 58750 57086 gene locus_tag LOCUS_00470 58750 57086 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018013007.1 protein_id gnl|my_center|LOCUS_00470 59124 58807 gene locus_tag LOCUS_00480 gene bolA 59124 58807 CDS product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261442.1 protein_id gnl|my_center|LOCUS_00480 60307 59225 gene locus_tag LOCUS_00490 60307 59225 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533462.1 protein_id gnl|my_center|LOCUS_00490 60972 60304 gene locus_tag LOCUS_00500 60972 60304 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_00500 61770 60976 gene locus_tag LOCUS_00510 61770 60976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 63764 61770 gene locus_tag LOCUS_00520 63764 61770 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532890.1 protein_id gnl|my_center|LOCUS_00520 64819 63764 gene locus_tag LOCUS_00530 64819 63764 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532889.1 protein_id gnl|my_center|LOCUS_00530 65889 64906 gene locus_tag LOCUS_00540 65889 64906 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532888.1 protein_id gnl|my_center|LOCUS_00540 67003 65981 gene locus_tag LOCUS_00550 67003 65981 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532888.1 protein_id gnl|my_center|LOCUS_00550 67188 67943 gene locus_tag LOCUS_00560 67188 67943 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723682.1 protein_id gnl|my_center|LOCUS_00560 67943 68275 gene locus_tag LOCUS_00570 67943 68275 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723680.1 protein_id gnl|my_center|LOCUS_00570 68275 68622 gene locus_tag LOCUS_00580 68275 68622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 68622 70361 gene locus_tag LOCUS_00590 68622 70361 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339081.1 protein_id gnl|my_center|LOCUS_00590 70358 71284 gene locus_tag LOCUS_00600 70358 71284 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339080.1 protein_id gnl|my_center|LOCUS_00600 71281 71949 gene locus_tag LOCUS_00610 71281 71949 CDS product fumarate hydratase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339079.1 protein_id gnl|my_center|LOCUS_00610 72014 72658 gene locus_tag LOCUS_00620 72014 72658 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530075.1 protein_id gnl|my_center|LOCUS_00620 73854 72655 gene locus_tag LOCUS_00630 73854 72655 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038295.1 protein_id gnl|my_center|LOCUS_00630 74876 73875 gene locus_tag LOCUS_00640 gene gap 74876 73875 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809444.1 protein_id gnl|my_center|LOCUS_00640 76937 74940 gene locus_tag LOCUS_00650 gene tkt 76937 74940 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209965.1 protein_id gnl|my_center|LOCUS_00650 79466 77085 gene locus_tag LOCUS_00660 79466 77085 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229101.1 protein_id gnl|my_center|LOCUS_00660 80446 79463 gene locus_tag LOCUS_00670 80446 79463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 81999 80551 gene locus_tag LOCUS_00680 81999 80551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 82415 82002 gene locus_tag LOCUS_00690 82415 82002 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258723.1 protein_id gnl|my_center|LOCUS_00690 83880 82408 gene locus_tag LOCUS_00700 83880 82408 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728610.1 protein_id gnl|my_center|LOCUS_00700 >Feature sequence002 <1 2682 gene locus_tag LOCUS_00710 <1 2682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036756.1:DNA gyrase subunit A 2696 3781 gene locus_tag LOCUS_00720 gene pheA 2696 3781 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616461.1 protein_id gnl|my_center|LOCUS_00720 3781 4665 gene locus_tag LOCUS_00730 3781 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00730 4665 5963 gene locus_tag LOCUS_00740 gene aroA 4665 5963 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036773.1 protein_id gnl|my_center|LOCUS_00740 5938 6681 gene locus_tag LOCUS_00750 gene cmk 5938 6681 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705689.1 protein_id gnl|my_center|LOCUS_00750 6808 8484 gene locus_tag LOCUS_00760 gene rpsA 6808 8484 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367470.1 protein_id gnl|my_center|LOCUS_00760 8494 8820 gene locus_tag LOCUS_00770 8494 8820 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037339.1 protein_id gnl|my_center|LOCUS_00770 8817 9128 gene locus_tag LOCUS_00780 8817 9128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 9191 10384 gene locus_tag LOCUS_00790 gene lapB 9191 10384 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957639.1 protein_id gnl|my_center|LOCUS_00790 10381 11712 gene locus_tag LOCUS_00800 10381 11712 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036689.1 protein_id gnl|my_center|LOCUS_00800 11709 12677 gene locus_tag LOCUS_00810 gene rfaE1 11709 12677 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813350.1 protein_id gnl|my_center|LOCUS_00810 12674 13687 gene locus_tag LOCUS_00820 gene rfaD 12674 13687 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687838.1 protein_id gnl|my_center|LOCUS_00820 13995 14094 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15203 14586 gene locus_tag LOCUS_00830 15203 14586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 18659 15216 gene locus_tag LOCUS_00840 gene mfd 18659 15216 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113980.1 protein_id gnl|my_center|LOCUS_00840 18753 19484 gene locus_tag LOCUS_00850 gene ispD 18753 19484 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092359.1 protein_id gnl|my_center|LOCUS_00850 19481 19966 gene locus_tag LOCUS_00860 gene ispF 19481 19966 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098560.1 protein_id gnl|my_center|LOCUS_00860 20330 19968 gene locus_tag LOCUS_00870 gene hinT 20330 19968 CDS product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461572.1 protein_id gnl|my_center|LOCUS_00870 20971 20381 gene locus_tag LOCUS_00880 20971 20381 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173537.1 protein_id gnl|my_center|LOCUS_00880 25820 20994 gene locus_tag LOCUS_00890 25820 20994 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947310.1 protein_id gnl|my_center|LOCUS_00890 25946 28318 gene locus_tag LOCUS_00900 25946 28318 CDS product DUF1989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067519.1 protein_id gnl|my_center|LOCUS_00900 28498 29343 gene locus_tag LOCUS_00910 28498 29343 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837305.1 protein_id gnl|my_center|LOCUS_00910 29353 30120 gene locus_tag LOCUS_00920 29353 30120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 30059 30760 gene locus_tag LOCUS_00930 30059 30760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 30764 31087 gene locus_tag LOCUS_00940 30764 31087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 31151 32491 gene locus_tag LOCUS_00950 31151 32491 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532892.1 protein_id gnl|my_center|LOCUS_00950 32784 32581 gene locus_tag LOCUS_00960 32784 32581 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421580.1 protein_id gnl|my_center|LOCUS_00960 33379 33022 gene locus_tag LOCUS_tm00010 33379 33022 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 33953 33483 gene locus_tag LOCUS_00970 gene smpB 33953 33483 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948526.1 protein_id gnl|my_center|LOCUS_00970 34079 34780 gene locus_tag LOCUS_00980 34079 34780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 34957 35391 gene locus_tag LOCUS_00990 gene dksA 34957 35391 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005630220.1 protein_id gnl|my_center|LOCUS_00990 37151 35388 gene locus_tag LOCUS_01000 gene aceK 37151 35388 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525974.1 protein_id gnl|my_center|LOCUS_01000 38500 37196 gene locus_tag LOCUS_01010 gene aceA 38500 37196 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706620.1 protein_id gnl|my_center|LOCUS_01010 38643 40052 gene locus_tag LOCUS_01020 38643 40052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 40506 40057 gene locus_tag LOCUS_01030 gene dtd 40506 40057 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393181.1 protein_id gnl|my_center|LOCUS_01030 41372 40503 gene locus_tag LOCUS_01040 41372 40503 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114180.1 protein_id gnl|my_center|LOCUS_01040 41448 41819 gene locus_tag LOCUS_01050 41448 41819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 41816 42169 gene locus_tag LOCUS_01060 gene sdhD 41816 42169 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037282.1 protein_id gnl|my_center|LOCUS_01060 42166 43977 gene locus_tag LOCUS_01070 gene sdhA 42166 43977 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265974.1 protein_id gnl|my_center|LOCUS_01070 44051 44749 gene locus_tag LOCUS_01080 44051 44749 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596634.1 protein_id gnl|my_center|LOCUS_01080 44771 45016 gene locus_tag LOCUS_01090 44771 45016 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768810.1 protein_id gnl|my_center|LOCUS_01090 44982 45440 gene locus_tag LOCUS_01100 44982 45440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 47073 45454 gene locus_tag LOCUS_01110 gene nadB 47073 45454 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186553.1 protein_id gnl|my_center|LOCUS_01110 47600 47151 gene locus_tag LOCUS_01120 47600 47151 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088003.1 protein_id gnl|my_center|LOCUS_01120 49254 47551 gene locus_tag LOCUS_01130 49254 47551 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098180.1 protein_id gnl|my_center|LOCUS_01130 49374 49880 gene locus_tag LOCUS_01140 49374 49880 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202045.1 protein_id gnl|my_center|LOCUS_01140 49916 50440 gene locus_tag LOCUS_01150 49916 50440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 50415 50867 gene locus_tag LOCUS_01160 gene accB 50415 50867 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098992.1 protein_id gnl|my_center|LOCUS_01160 50860 52221 gene locus_tag LOCUS_01170 gene accC 50860 52221 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814951.1 protein_id gnl|my_center|LOCUS_01170 52218 53051 gene locus_tag LOCUS_01180 52218 53051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 53150 53404 gene locus_tag LOCUS_01190 53150 53404 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687442.1 protein_id gnl|my_center|LOCUS_01190 53440 55008 gene locus_tag LOCUS_01200 gene purH 53440 55008 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105209.1 protein_id gnl|my_center|LOCUS_01200 55011 56087 gene locus_tag LOCUS_01210 55011 56087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 56089 57438 gene locus_tag LOCUS_01220 gene purD 56089 57438 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704786.1 protein_id gnl|my_center|LOCUS_01220 57435 57953 gene locus_tag LOCUS_01230 57435 57953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 57950 59914 gene locus_tag LOCUS_01240 57950 59914 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958281.1 protein_id gnl|my_center|LOCUS_01240 60824 59928 gene locus_tag LOCUS_01250 60824 59928 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851175.1 protein_id gnl|my_center|LOCUS_01250 65665 60893 gene locus_tag LOCUS_01260 65665 60893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 66500 65994 gene locus_tag LOCUS_01270 66500 65994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 67977 66649 gene locus_tag LOCUS_01280 67977 66649 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074106.1 protein_id gnl|my_center|LOCUS_01280 68730 67978 gene locus_tag LOCUS_01290 68730 67978 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947167.1 protein_id gnl|my_center|LOCUS_01290 68812 69753 gene locus_tag LOCUS_01300 68812 69753 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975129.1 protein_id gnl|my_center|LOCUS_01300 >Feature sequence003 163 2181 gene locus_tag LOCUS_01310 163 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 2178 3437 gene locus_tag LOCUS_01320 2178 3437 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704239.1 protein_id gnl|my_center|LOCUS_01320 4663 3440 gene locus_tag LOCUS_01330 4663 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 4754 6010 gene locus_tag LOCUS_01340 4754 6010 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546117.1 protein_id gnl|my_center|LOCUS_01340 5997 6458 gene locus_tag LOCUS_01350 5997 6458 CDS product DUF4411 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544978.1 protein_id gnl|my_center|LOCUS_01350 6464 9466 gene locus_tag LOCUS_01360 6464 9466 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_01360 9544 11241 gene locus_tag LOCUS_01370 gene ilvD 9544 11241 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502719.1 protein_id gnl|my_center|LOCUS_01370 11273 12043 gene locus_tag LOCUS_01380 11273 12043 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267567.1 protein_id gnl|my_center|LOCUS_01380 12500 12051 gene locus_tag LOCUS_01390 12500 12051 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012534270.1 protein_id gnl|my_center|LOCUS_01390 12590 13333 gene locus_tag LOCUS_01400 12590 13333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 13624 13334 gene locus_tag LOCUS_01410 13624 13334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 14889 13621 gene locus_tag LOCUS_01420 14889 13621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 14972 15913 gene locus_tag LOCUS_01430 14972 15913 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530247.1 protein_id gnl|my_center|LOCUS_01430 17028 15919 gene locus_tag LOCUS_01440 17028 15919 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096677.1 protein_id gnl|my_center|LOCUS_01440 17109 17681 gene locus_tag LOCUS_01450 17109 17681 CDS product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074301.1 protein_id gnl|my_center|LOCUS_01450 21054 17686 gene locus_tag LOCUS_01460 21054 17686 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064283.1 protein_id gnl|my_center|LOCUS_01460 23786 21054 gene locus_tag LOCUS_01470 23786 21054 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958090.1 protein_id gnl|my_center|LOCUS_01470 24109 23810 gene locus_tag LOCUS_01480 24109 23810 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528817.1 protein_id gnl|my_center|LOCUS_01480 24973 24149 gene locus_tag LOCUS_01490 24973 24149 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094072.1 protein_id gnl|my_center|LOCUS_01490 25046 26218 gene locus_tag LOCUS_01500 25046 26218 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972186.1 protein_id gnl|my_center|LOCUS_01500 26461 27720 gene locus_tag LOCUS_01510 26461 27720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 27812 28399 gene locus_tag LOCUS_01520 gene petA 27812 28399 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707597.1 protein_id gnl|my_center|LOCUS_01520 28411 29661 gene locus_tag LOCUS_01530 28411 29661 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215003.1 protein_id gnl|my_center|LOCUS_01530 29658 30395 gene locus_tag LOCUS_01540 29658 30395 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479715.1 protein_id gnl|my_center|LOCUS_01540 30399 31049 gene locus_tag LOCUS_01550 gene sspA 30399 31049 CDS product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162411.1 protein_id gnl|my_center|LOCUS_01550 31054 31521 gene locus_tag LOCUS_01560 gene sspB 31054 31521 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420947.1 protein_id gnl|my_center|LOCUS_01560 31521 32066 gene locus_tag LOCUS_01570 gene hslV 31521 32066 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946377.1 protein_id gnl|my_center|LOCUS_01570 32063 33385 gene locus_tag LOCUS_01580 gene hslU 32063 33385 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293343.1 protein_id gnl|my_center|LOCUS_01580 33398 34126 gene locus_tag LOCUS_01590 33398 34126 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027447.1 protein_id gnl|my_center|LOCUS_01590 34313 35167 gene locus_tag LOCUS_01600 gene rpoH 34313 35167 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402233.1 protein_id gnl|my_center|LOCUS_01600 37587 35239 gene locus_tag LOCUS_01610 37587 35239 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266375.1 protein_id gnl|my_center|LOCUS_01610 37654 38223 gene locus_tag LOCUS_01620 37654 38223 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806947.1 protein_id gnl|my_center|LOCUS_01620 38251 39357 gene locus_tag LOCUS_01630 gene aroB 38251 39357 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403032.1 protein_id gnl|my_center|LOCUS_01630 40250 39354 gene locus_tag LOCUS_01640 40250 39354 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088085.1 protein_id gnl|my_center|LOCUS_01640 40270 41073 gene locus_tag LOCUS_01650 40270 41073 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036073.1 protein_id gnl|my_center|LOCUS_01650 41114 42190 gene locus_tag LOCUS_01660 gene aroC 41114 42190 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098151.1 protein_id gnl|my_center|LOCUS_01660 42238 43635 gene locus_tag LOCUS_01670 gene leuC 42238 43635 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446523.1 protein_id gnl|my_center|LOCUS_01670 43635 44282 gene locus_tag LOCUS_01680 gene leuD 43635 44282 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222556.1 protein_id gnl|my_center|LOCUS_01680 44383 45003 gene locus_tag LOCUS_01690 44383 45003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 45074 46045 gene locus_tag LOCUS_01700 45074 46045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 46893 46051 gene locus_tag LOCUS_01710 gene trpA 46893 46051 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115801.1 protein_id gnl|my_center|LOCUS_01710 48116 46890 gene locus_tag LOCUS_01720 gene trpB 48116 46890 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265976.1 protein_id gnl|my_center|LOCUS_01720 48433 49617 gene locus_tag LOCUS_01730 48433 49617 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113933.1 protein_id gnl|my_center|LOCUS_01730 50434 49637 gene locus_tag LOCUS_01740 gene xth 50434 49637 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_01740 50473 51624 gene locus_tag LOCUS_01750 50473 51624 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164518318.1 protein_id gnl|my_center|LOCUS_01750 51674 53059 gene locus_tag LOCUS_01760 51674 53059 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421588.1 protein_id gnl|my_center|LOCUS_01760 53110 53562 gene locus_tag LOCUS_01770 53110 53562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 53618 55435 gene locus_tag LOCUS_01780 53618 55435 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 protein_id gnl|my_center|LOCUS_01780 56099 55719 gene locus_tag LOCUS_01790 56099 55719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 >Feature sequence004 <1 571 gene locus_tag LOCUS_01800 <1 571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005766020.1:recombination regulator RecX 610 3288 gene locus_tag LOCUS_01810 gene alaS 610 3288 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063947.1 protein_id gnl|my_center|LOCUS_01810 3317 4597 gene locus_tag LOCUS_01820 3317 4597 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085971.1 protein_id gnl|my_center|LOCUS_01820 4775 5125 gene locus_tag LOCUS_01830 4775 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 5140 5230 gene locus_tag LOCUS_t00020 5140 5230 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5311 5387 gene locus_tag LOCUS_t00030 5311 5387 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6073 5417 gene locus_tag LOCUS_01840 gene pyrE 6073 5417 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033459018.1 protein_id gnl|my_center|LOCUS_01840 6153 7484 gene locus_tag LOCUS_01850 6153 7484 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261439.1 protein_id gnl|my_center|LOCUS_01850 8051 7485 gene locus_tag LOCUS_01860 8051 7485 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084544.1 protein_id gnl|my_center|LOCUS_01860 8896 8051 gene locus_tag LOCUS_01870 gene proC 8896 8051 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114890.1 protein_id gnl|my_center|LOCUS_01870 9632 8913 gene locus_tag LOCUS_01880 9632 8913 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194162.1 protein_id gnl|my_center|LOCUS_01880 9729 10802 gene locus_tag LOCUS_01890 gene argC 9729 10802 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269099.1 protein_id gnl|my_center|LOCUS_01890 10805 13972 gene locus_tag LOCUS_01900 10805 13972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 14009 14299 gene locus_tag LOCUS_01910 14009 14299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 14296 14892 gene locus_tag LOCUS_01920 14296 14892 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275445.1 protein_id gnl|my_center|LOCUS_01920 14956 16179 gene locus_tag LOCUS_01930 14956 16179 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546283.1 protein_id gnl|my_center|LOCUS_01930 16208 16873 gene locus_tag LOCUS_01940 16208 16873 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_01940 16874 17785 gene locus_tag LOCUS_01950 16874 17785 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 protein_id gnl|my_center|LOCUS_01950 17809 18840 gene locus_tag LOCUS_01960 17809 18840 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809683.1 protein_id gnl|my_center|LOCUS_01960 18837 19580 gene locus_tag LOCUS_01970 18837 19580 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243767.1 protein_id gnl|my_center|LOCUS_01970 19585 20433 gene locus_tag LOCUS_01980 19585 20433 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646064.1 protein_id gnl|my_center|LOCUS_01980 21351 20449 gene locus_tag LOCUS_01990 21351 20449 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970855.1 protein_id gnl|my_center|LOCUS_01990 22130 21357 gene locus_tag LOCUS_02000 22130 21357 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191307.1 protein_id gnl|my_center|LOCUS_02000 24163 22163 gene locus_tag LOCUS_02010 24163 22163 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528247.1 protein_id gnl|my_center|LOCUS_02010 25165 24308 gene locus_tag LOCUS_02020 25165 24308 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975811.1 protein_id gnl|my_center|LOCUS_02020 26031 25162 gene locus_tag LOCUS_02030 26031 25162 CDS product taurine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061776.1 protein_id gnl|my_center|LOCUS_02030 27116 26103 gene locus_tag LOCUS_02040 27116 26103 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276931.1 protein_id gnl|my_center|LOCUS_02040 29754 27313 gene locus_tag LOCUS_02050 29754 27313 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112529352.1 protein_id gnl|my_center|LOCUS_02050 29818 30273 gene locus_tag LOCUS_02060 29818 30273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 30925 30254 gene locus_tag LOCUS_02070 30925 30254 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705866.1 protein_id gnl|my_center|LOCUS_02070 31786 30938 gene locus_tag LOCUS_02080 31786 30938 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206428.1 protein_id gnl|my_center|LOCUS_02080 31885 31809 gene locus_tag LOCUS_t00040 31885 31809 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 32781 31894 gene locus_tag LOCUS_02090 32781 31894 CDS product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729118.1 protein_id gnl|my_center|LOCUS_02090 34500 32887 gene locus_tag LOCUS_02100 gene gshA 34500 32887 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535409.1 protein_id gnl|my_center|LOCUS_02100 34707 35732 gene locus_tag LOCUS_02110 gene dusA 34707 35732 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707399.1 protein_id gnl|my_center|LOCUS_02110 35729 37276 gene locus_tag LOCUS_02120 35729 37276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 37273 38109 gene locus_tag LOCUS_02130 37273 38109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 38106 38795 gene locus_tag LOCUS_02140 38106 38795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 38818 39735 gene locus_tag LOCUS_02150 38818 39735 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057878.1 protein_id gnl|my_center|LOCUS_02150 40529 40125 gene locus_tag LOCUS_02160 40529 40125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 40896 41678 gene locus_tag LOCUS_02170 40896 41678 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003105.1 protein_id gnl|my_center|LOCUS_02170 42096 43061 gene locus_tag LOCUS_02180 42096 43061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 43198 46677 gene locus_tag LOCUS_02190 43198 46677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 46825 47091 gene locus_tag LOCUS_02200 46825 47091 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037637.1 protein_id gnl|my_center|LOCUS_02200 47103 47756 gene locus_tag LOCUS_02210 47103 47756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 >Feature sequence005 223 1701 gene locus_tag LOCUS_02220 223 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 2060 1863 gene locus_tag LOCUS_02230 2060 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 1968 3260 gene locus_tag LOCUS_02240 1968 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 3283 6405 gene locus_tag LOCUS_02250 3283 6405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 6458 9493 gene locus_tag LOCUS_02260 6458 9493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 9494 12487 gene locus_tag LOCUS_02270 9494 12487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 12553 15234 gene locus_tag LOCUS_02280 12553 15234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 15378 18305 gene locus_tag LOCUS_02290 15378 18305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 18322 19116 gene locus_tag LOCUS_02300 gene fabG 18322 19116 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_02300 19163 21748 gene locus_tag LOCUS_02310 gene clpB 19163 21748 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947476.1 protein_id gnl|my_center|LOCUS_02310 22453 21755 gene locus_tag LOCUS_02320 22453 21755 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103309.1 protein_id gnl|my_center|LOCUS_02320 22534 23238 gene locus_tag LOCUS_02330 22534 23238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 24704 23235 gene locus_tag LOCUS_02340 24704 23235 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350322.1 protein_id gnl|my_center|LOCUS_02340 24779 25039 gene locus_tag LOCUS_02350 24779 25039 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193727.1 protein_id gnl|my_center|LOCUS_02350 25065 25961 gene locus_tag LOCUS_02360 25065 25961 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109274.1 protein_id gnl|my_center|LOCUS_02360 26601 25945 gene locus_tag LOCUS_02370 gene rpiA 26601 25945 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813244.1 protein_id gnl|my_center|LOCUS_02370 27406 26603 gene locus_tag LOCUS_02380 27406 26603 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338148.1 protein_id gnl|my_center|LOCUS_02380 27542 28831 gene locus_tag LOCUS_02390 27542 28831 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932547.1 protein_id gnl|my_center|LOCUS_02390 28845 31139 gene locus_tag LOCUS_02400 28845 31139 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932548.1 protein_id gnl|my_center|LOCUS_02400 31142 31759 gene locus_tag LOCUS_02410 31142 31759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 31772 32686 gene locus_tag LOCUS_02420 31772 32686 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940768.1 protein_id gnl|my_center|LOCUS_02420 32797 35313 gene locus_tag LOCUS_02430 32797 35313 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108570.1 protein_id gnl|my_center|LOCUS_02430 36104 35310 gene locus_tag LOCUS_02440 36104 35310 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_02440 36195 37361 gene locus_tag LOCUS_02450 gene argE 36195 37361 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064838.1 protein_id gnl|my_center|LOCUS_02450 38625 37375 gene locus_tag LOCUS_02460 38625 37375 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530448.1 protein_id gnl|my_center|LOCUS_02460 38715 40043 gene locus_tag LOCUS_02470 gene folP 38715 40043 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883395.1 protein_id gnl|my_center|LOCUS_02470 40230 40709 gene locus_tag LOCUS_02480 40230 40709 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392242.1 protein_id gnl|my_center|LOCUS_02480 40754 42610 gene locus_tag LOCUS_02490 40754 42610 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_02490 42635 43885 gene locus_tag LOCUS_02500 42635 43885 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941893.1 protein_id gnl|my_center|LOCUS_02500 43944 44198 gene locus_tag LOCUS_02510 43944 44198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 44195 44497 gene locus_tag LOCUS_02520 44195 44497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 44497 44745 gene locus_tag LOCUS_02530 44497 44745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 44742 45812 gene locus_tag LOCUS_02540 gene moaA 44742 45812 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532083.1 protein_id gnl|my_center|LOCUS_02540 >Feature sequence006 478 119 gene locus_tag LOCUS_02550 478 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 1073 609 gene locus_tag LOCUS_02560 1073 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 2562 1252 gene locus_tag LOCUS_02570 gene guaD 2562 1252 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003142418.1 protein_id gnl|my_center|LOCUS_02570 2561 3181 gene locus_tag LOCUS_02580 gene uraD 2561 3181 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727574.1 protein_id gnl|my_center|LOCUS_02580 3178 3513 gene locus_tag LOCUS_02590 gene uraH 3178 3513 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336831.1 protein_id gnl|my_center|LOCUS_02590 3516 4721 gene locus_tag LOCUS_02600 3516 4721 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947959.1 protein_id gnl|my_center|LOCUS_02600 4949 4779 gene locus_tag LOCUS_02610 4949 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 6260 4977 gene locus_tag LOCUS_02620 6260 4977 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896012.1 protein_id gnl|my_center|LOCUS_02620 9940 6443 gene locus_tag LOCUS_02630 gene dnaE 9940 6443 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946697.1 protein_id gnl|my_center|LOCUS_02630 10515 9937 gene locus_tag LOCUS_02640 gene rnhB 10515 9937 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191384.1 protein_id gnl|my_center|LOCUS_02640 11674 10517 gene locus_tag LOCUS_02650 gene lpxB 11674 10517 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113865.1 protein_id gnl|my_center|LOCUS_02650 12440 11691 gene locus_tag LOCUS_02660 gene lpxA 12440 11691 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368155.1 protein_id gnl|my_center|LOCUS_02660 12945 12493 gene locus_tag LOCUS_02670 gene fabZ 12945 12493 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192266.1 protein_id gnl|my_center|LOCUS_02670 13997 12942 gene locus_tag LOCUS_02680 gene lpxD 13997 12942 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098585.1 protein_id gnl|my_center|LOCUS_02680 14562 14044 gene locus_tag LOCUS_02690 14562 14044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 17065 14609 gene locus_tag LOCUS_02700 gene bamA 17065 14609 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245414.1 protein_id gnl|my_center|LOCUS_02700 18435 17116 gene locus_tag LOCUS_02710 gene rseP 18435 17116 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098594.1 protein_id gnl|my_center|LOCUS_02710 19697 18522 gene locus_tag LOCUS_02720 gene ispC 19697 18522 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765988.1 protein_id gnl|my_center|LOCUS_02720 20515 19694 gene locus_tag LOCUS_02730 gene cdsA 20515 19694 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092388.1 protein_id gnl|my_center|LOCUS_02730 21276 20512 gene locus_tag LOCUS_02740 21276 20512 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420551.1 protein_id gnl|my_center|LOCUS_02740 21836 21276 gene locus_tag LOCUS_02750 gene frr 21836 21276 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947438.1 protein_id gnl|my_center|LOCUS_02750 26213 21906 gene locus_tag LOCUS_02760 26213 21906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 26755 28344 gene locus_tag LOCUS_02770 26755 28344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 28990 28445 gene locus_tag LOCUS_02780 28990 28445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 29078 29005 gene locus_tag LOCUS_t00050 29078 29005 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 29498 29112 gene locus_tag LOCUS_02790 gene rpsI 29498 29112 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005336286.1 protein_id gnl|my_center|LOCUS_02790 29980 29552 gene locus_tag LOCUS_02800 gene rplM 29980 29552 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918559.1 protein_id gnl|my_center|LOCUS_02800 30826 30080 gene locus_tag LOCUS_02810 gene kdsB 30826 30080 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106922.1 protein_id gnl|my_center|LOCUS_02810 31818 30811 gene locus_tag LOCUS_02820 gene lpxK 31818 30811 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706582.1 protein_id gnl|my_center|LOCUS_02820 33611 31818 gene locus_tag LOCUS_02830 gene msbA 33611 31818 CDS product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706583.1 protein_id gnl|my_center|LOCUS_02830 33738 35285 gene locus_tag LOCUS_02840 33738 35285 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531176.1 protein_id gnl|my_center|LOCUS_02840 35345 35887 gene locus_tag LOCUS_02850 35345 35887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 37914 35884 gene locus_tag LOCUS_02860 37914 35884 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531166.1 protein_id gnl|my_center|LOCUS_02860 38835 37930 gene locus_tag LOCUS_02870 38835 37930 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066873494.1 protein_id gnl|my_center|LOCUS_02870 39791 38859 gene locus_tag LOCUS_02880 39791 38859 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193173633.1 protein_id gnl|my_center|LOCUS_02880 40133 39825 gene locus_tag LOCUS_02890 40133 39825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 40767 40150 gene locus_tag LOCUS_02900 40767 40150 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395377.1 protein_id gnl|my_center|LOCUS_02900 41483 40785 gene locus_tag LOCUS_02910 41483 40785 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037386375.1 protein_id gnl|my_center|LOCUS_02910 <42347 41686 gene locus_tag LOCUS_02920 <42347 41686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071102.1:phosphoribosyltransferase family protein >Feature sequence007 1531 401 gene locus_tag LOCUS_02930 1531 401 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250860.1 protein_id gnl|my_center|LOCUS_02930 1679 3550 gene locus_tag LOCUS_02940 1679 3550 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_02940 3547 4956 gene locus_tag LOCUS_02950 3547 4956 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706705.1 protein_id gnl|my_center|LOCUS_02950 5060 6202 gene locus_tag LOCUS_02960 5060 6202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 6256 6948 gene locus_tag LOCUS_02970 6256 6948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 7026 7748 gene locus_tag LOCUS_02980 gene rph 7026 7748 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038353.1 protein_id gnl|my_center|LOCUS_02980 7772 8374 gene locus_tag LOCUS_02990 7772 8374 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704791.1 protein_id gnl|my_center|LOCUS_02990 8384 10012 gene locus_tag LOCUS_03000 gene gpmI 8384 10012 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_03000 10294 10028 gene locus_tag LOCUS_03010 10294 10028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 10405 11634 gene locus_tag LOCUS_03020 10405 11634 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_03020 11639 12244 gene locus_tag LOCUS_03030 11639 12244 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986868.1 protein_id gnl|my_center|LOCUS_03030 12279 13514 gene locus_tag LOCUS_03040 12279 13514 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 protein_id gnl|my_center|LOCUS_03040 13528 14643 gene locus_tag LOCUS_03050 13528 14643 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815379.1 protein_id gnl|my_center|LOCUS_03050 15749 14634 gene locus_tag LOCUS_03060 gene rnd 15749 14634 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389826.1 protein_id gnl|my_center|LOCUS_03060 15822 17183 gene locus_tag LOCUS_03070 gene mpl 15822 17183 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073577.1 protein_id gnl|my_center|LOCUS_03070 17270 17869 gene locus_tag LOCUS_03080 17270 17869 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403888.1 protein_id gnl|my_center|LOCUS_03080 18098 17874 gene locus_tag LOCUS_03090 18098 17874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 19897 18107 gene locus_tag LOCUS_03100 19897 18107 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_03100 19969 20811 gene locus_tag LOCUS_03110 19969 20811 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921532.1 protein_id gnl|my_center|LOCUS_03110 22719 20845 gene locus_tag LOCUS_03120 22719 20845 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103655.1 protein_id gnl|my_center|LOCUS_03120 22934 22719 gene locus_tag LOCUS_03130 22934 22719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 24795 23266 gene locus_tag LOCUS_03140 24795 23266 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200059.1 protein_id gnl|my_center|LOCUS_03140 25172 24792 gene locus_tag LOCUS_03150 25172 24792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 26259 25207 gene locus_tag LOCUS_03160 26259 25207 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481684.1 protein_id gnl|my_center|LOCUS_03160 28301 26304 gene locus_tag LOCUS_03170 gene metG 28301 26304 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211829411.1 protein_id gnl|my_center|LOCUS_03170 28422 29495 gene locus_tag LOCUS_03180 gene apbC 28422 29495 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567450.1 protein_id gnl|my_center|LOCUS_03180 29528 30007 gene locus_tag LOCUS_03190 29528 30007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 30259 30825 gene locus_tag LOCUS_03200 gene dcd 30259 30825 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808382.1 protein_id gnl|my_center|LOCUS_03200 30910 31488 gene locus_tag LOCUS_03210 30910 31488 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919854.1 protein_id gnl|my_center|LOCUS_03210 31472 32041 gene locus_tag LOCUS_03220 gene msrA 31472 32041 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036064.1 protein_id gnl|my_center|LOCUS_03220 32126 33010 gene locus_tag LOCUS_03230 32126 33010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 33014 33829 gene locus_tag LOCUS_03240 33014 33829 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113213.1 protein_id gnl|my_center|LOCUS_03240 33853 35181 gene locus_tag LOCUS_03250 33853 35181 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114800.1 protein_id gnl|my_center|LOCUS_03250 35776 35192 gene locus_tag LOCUS_03260 35776 35192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 36192 35839 gene locus_tag LOCUS_03270 36192 35839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 36788 36222 gene locus_tag LOCUS_03280 36788 36222 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112737.1 protein_id gnl|my_center|LOCUS_03280 37258 36788 gene locus_tag LOCUS_03290 gene rlmH 37258 36788 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186098.1 protein_id gnl|my_center|LOCUS_03290 37684 37301 gene locus_tag LOCUS_03300 gene rsfS 37684 37301 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100305.1 protein_id gnl|my_center|LOCUS_03300 38334 37681 gene locus_tag LOCUS_03310 gene nadD 38334 37681 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210330.1 protein_id gnl|my_center|LOCUS_03310 38854 38369 gene locus_tag LOCUS_03320 38854 38369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 39050 40111 gene locus_tag LOCUS_03330 gene nadA 39050 40111 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185886.1 protein_id gnl|my_center|LOCUS_03330 40968 40153 gene locus_tag LOCUS_03340 40968 40153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 41880 41359 gene locus_tag LOCUS_03350 41880 41359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 >Feature sequence008 <1 3294 gene locus_tag LOCUS_03360 <1 3294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921648.1:YDG domain-containing protein 4030 3317 gene locus_tag LOCUS_03370 gene lpxH 4030 3317 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706567.1 protein_id gnl|my_center|LOCUS_03370 4429 4214 gene locus_tag LOCUS_03380 4429 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 4335 11873 gene locus_tag LOCUS_03390 4335 11873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 12026 13399 gene locus_tag LOCUS_03400 gene cysS 12026 13399 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_03400 13542 13618 gene locus_tag LOCUS_t00060 13542 13618 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 13702 14241 gene locus_tag LOCUS_03410 13702 14241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 14238 15734 gene locus_tag LOCUS_03420 gene nusA 14238 15734 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037645.1 protein_id gnl|my_center|LOCUS_03420 15722 18115 gene locus_tag LOCUS_03430 gene infB 15722 18115 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958223.1 protein_id gnl|my_center|LOCUS_03430 18122 18499 gene locus_tag LOCUS_03440 gene rbfA 18122 18499 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428234.1 protein_id gnl|my_center|LOCUS_03440 18480 19397 gene locus_tag LOCUS_03450 gene truB 18480 19397 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100522.1 protein_id gnl|my_center|LOCUS_03450 19475 19574 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 19751 19676 gene locus_tag LOCUS_t00070 19751 19676 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 19832 21856 gene locus_tag LOCUS_03460 gene uvrB 19832 21856 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957630.1 protein_id gnl|my_center|LOCUS_03460 22453 21866 gene locus_tag LOCUS_03470 22453 21866 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104746.1 protein_id gnl|my_center|LOCUS_03470 22551 22475 gene locus_tag LOCUS_t00080 22551 22475 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 24052 22592 gene locus_tag LOCUS_03480 gene gatB 24052 22592 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112870.1 protein_id gnl|my_center|LOCUS_03480 25545 24049 gene locus_tag LOCUS_03490 gene gatA 25545 24049 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091960758.1 protein_id gnl|my_center|LOCUS_03490 25916 25557 gene locus_tag LOCUS_03500 gene gatC 25916 25557 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106543.1 protein_id gnl|my_center|LOCUS_03500 26256 32993 gene locus_tag LOCUS_03510 26256 32993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 33118 34155 gene locus_tag LOCUS_03520 33118 34155 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189550.1 protein_id gnl|my_center|LOCUS_03520 34233 35048 gene locus_tag LOCUS_03530 34233 35048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 35038 35538 gene locus_tag LOCUS_03540 35038 35538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 35538 37442 gene locus_tag LOCUS_03550 gene mrdA 35538 37442 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399770.1 protein_id gnl|my_center|LOCUS_03550 37459 38562 gene locus_tag LOCUS_03560 gene rodA 37459 38562 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261454.1 protein_id gnl|my_center|LOCUS_03560 38577 39575 gene locus_tag LOCUS_03570 gene mltB 38577 39575 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132500.1 protein_id gnl|my_center|LOCUS_03570 39615 40430 gene locus_tag LOCUS_03580 39615 40430 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929963.1 protein_id gnl|my_center|LOCUS_03580 >Feature sequence009 453 935 gene locus_tag LOCUS_03590 453 935 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_03590 928 1968 gene locus_tag LOCUS_03600 gene nagZ 928 1968 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268330.1 protein_id gnl|my_center|LOCUS_03600 1998 2717 gene locus_tag LOCUS_03610 1998 2717 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946684.1 protein_id gnl|my_center|LOCUS_03610 2766 3869 gene locus_tag LOCUS_03620 2766 3869 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892127.1 protein_id gnl|my_center|LOCUS_03620 3927 4217 gene locus_tag LOCUS_03630 3927 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 4273 6060 gene locus_tag LOCUS_03640 gene aspS 4273 6060 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807038.1 protein_id gnl|my_center|LOCUS_03640 6122 6841 gene locus_tag LOCUS_03650 6122 6841 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947017.1 protein_id gnl|my_center|LOCUS_03650 6841 7350 gene locus_tag LOCUS_03660 gene ruvC 6841 7350 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003026245.1 protein_id gnl|my_center|LOCUS_03660 7347 7946 gene locus_tag LOCUS_03670 gene ruvA 7347 7946 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772102.1 protein_id gnl|my_center|LOCUS_03670 7972 9027 gene locus_tag LOCUS_03680 gene ruvB 7972 9027 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931466.1 protein_id gnl|my_center|LOCUS_03680 9426 9525 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9600 10325 gene locus_tag LOCUS_03690 gene tolQ 9600 10325 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554655.1 protein_id gnl|my_center|LOCUS_03690 10322 10735 gene locus_tag LOCUS_03700 gene tolR 10322 10735 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126827401.1 protein_id gnl|my_center|LOCUS_03700 10732 11451 gene locus_tag LOCUS_03710 10732 11451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 11448 12743 gene locus_tag LOCUS_03720 gene tolB 11448 12743 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038134.1 protein_id gnl|my_center|LOCUS_03720 12801 13361 gene locus_tag LOCUS_03730 12801 13361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 13397 14212 gene locus_tag LOCUS_03740 13397 14212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 14220 14295 gene locus_tag LOCUS_t00090 14220 14295 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 15300 14323 gene locus_tag LOCUS_03750 15300 14323 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975103.1 protein_id gnl|my_center|LOCUS_03750 16200 15307 gene locus_tag LOCUS_03760 16200 15307 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932553.1 protein_id gnl|my_center|LOCUS_03760 16298 17698 gene locus_tag LOCUS_03770 gene glmU 16298 17698 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215550.1 protein_id gnl|my_center|LOCUS_03770 17751 19580 gene locus_tag LOCUS_03780 gene glmS 17751 19580 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114654.1 protein_id gnl|my_center|LOCUS_03780 19577 20947 gene locus_tag LOCUS_03790 19577 20947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 21448 23106 gene locus_tag LOCUS_03800 21448 23106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 23103 23750 gene locus_tag LOCUS_03810 23103 23750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 24321 23761 gene locus_tag LOCUS_03820 gene efp 24321 23761 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564662.1 protein_id gnl|my_center|LOCUS_03820 24369 25049 gene locus_tag LOCUS_03830 24369 25049 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_03830 25046 26866 gene locus_tag LOCUS_03840 gene uvrC 25046 26866 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764425.1 protein_id gnl|my_center|LOCUS_03840 28163 26820 gene locus_tag LOCUS_03850 gene wbpA 28163 26820 CDS product UDP-N-acetyl-D-glucosamine 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113429.1 protein_id gnl|my_center|LOCUS_03850 29143 28160 gene locus_tag LOCUS_03860 29143 28160 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706039.1 protein_id gnl|my_center|LOCUS_03860 32304 29140 gene locus_tag LOCUS_03870 gene ileS 32304 29140 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258550.1 protein_id gnl|my_center|LOCUS_03870 32897 32301 gene locus_tag LOCUS_03880 32897 32301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 34513 33104 gene locus_tag LOCUS_03890 gene gltA 34513 33104 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389475.1 protein_id gnl|my_center|LOCUS_03890 34714 35682 gene locus_tag LOCUS_03900 34714 35682 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969676.1 protein_id gnl|my_center|LOCUS_03900 35744 36823 gene locus_tag LOCUS_03910 35744 36823 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331284.1 protein_id gnl|my_center|LOCUS_03910 36820 38337 gene locus_tag LOCUS_03920 36820 38337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 38350 39111 gene locus_tag LOCUS_03930 38350 39111 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257492.1 protein_id gnl|my_center|LOCUS_03930 >Feature sequence010 507 58 gene locus_tag LOCUS_03940 gene dut 507 58 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704179.1 protein_id gnl|my_center|LOCUS_03940 1153 557 gene locus_tag LOCUS_03950 1153 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 1240 1339 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2011 2637 gene locus_tag LOCUS_03960 gene radC 2011 2637 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704181.1 protein_id gnl|my_center|LOCUS_03960 2673 3218 gene locus_tag LOCUS_03970 gene cobO 2673 3218 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337767.1 protein_id gnl|my_center|LOCUS_03970 3301 4119 gene locus_tag LOCUS_03980 gene yhdJ 3301 4119 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258927.1 protein_id gnl|my_center|LOCUS_03980 4109 4600 gene locus_tag LOCUS_03990 4109 4600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 4719 5963 gene locus_tag LOCUS_04000 4719 5963 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148382.1 protein_id gnl|my_center|LOCUS_04000 5982 6287 gene locus_tag LOCUS_04010 5982 6287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 6284 9334 gene locus_tag LOCUS_04020 6284 9334 CDS product sarcosine oxidase subunit alpha family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202495.1 protein_id gnl|my_center|LOCUS_04020 9327 9920 gene locus_tag LOCUS_04030 9327 9920 CDS product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205601.1 protein_id gnl|my_center|LOCUS_04030 9917 11218 gene locus_tag LOCUS_04040 9917 11218 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968391.1 protein_id gnl|my_center|LOCUS_04040 13694 11241 gene locus_tag LOCUS_04050 13694 11241 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204034.1 protein_id gnl|my_center|LOCUS_04050 15447 13801 gene locus_tag LOCUS_04060 gene groL 15447 13801 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094059.1 protein_id gnl|my_center|LOCUS_04060 15696 15511 gene locus_tag LOCUS_04070 15696 15511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 16430 15984 gene locus_tag LOCUS_04080 16430 15984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 17290 16427 gene locus_tag LOCUS_04090 17290 16427 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886270.1 protein_id gnl|my_center|LOCUS_04090 17480 19447 gene locus_tag LOCUS_04100 gene dsbD 17480 19447 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064751.1 protein_id gnl|my_center|LOCUS_04100 19453 19959 gene locus_tag LOCUS_04110 19453 19959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 20625 19978 gene locus_tag LOCUS_04120 20625 19978 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252464.1 protein_id gnl|my_center|LOCUS_04120 21134 20691 gene locus_tag LOCUS_04130 gene moaE 21134 20691 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266803.1 protein_id gnl|my_center|LOCUS_04130 21377 21147 gene locus_tag LOCUS_04140 gene moaD 21377 21147 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764130.1 protein_id gnl|my_center|LOCUS_04140 21470 21997 gene locus_tag LOCUS_04150 gene moaB 21470 21997 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965931.1 protein_id gnl|my_center|LOCUS_04150 22089 24332 gene locus_tag LOCUS_04160 gene parC 22089 24332 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095687.1 protein_id gnl|my_center|LOCUS_04160 24335 25228 gene locus_tag LOCUS_04170 24335 25228 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809513.1 protein_id gnl|my_center|LOCUS_04170 25228 26121 gene locus_tag LOCUS_04180 25228 26121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 26927 26118 gene locus_tag LOCUS_04190 26927 26118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 27814 26924 gene locus_tag LOCUS_04200 27814 26924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 27828 28787 gene locus_tag LOCUS_04210 gene rluD 27828 28787 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038203.1 protein_id gnl|my_center|LOCUS_04210 29663 28806 gene locus_tag LOCUS_04220 gene nadC 29663 28806 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104915.1 protein_id gnl|my_center|LOCUS_04220 29741 31312 gene locus_tag LOCUS_04230 29741 31312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 31332 32723 gene locus_tag LOCUS_04240 gene thrC 31332 32723 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390981.1 protein_id gnl|my_center|LOCUS_04240 32720 33646 gene locus_tag LOCUS_04250 32720 33646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 33726 33825 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 34038 34265 gene locus_tag LOCUS_04260 34038 34265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 34275 34496 gene locus_tag LOCUS_04270 34275 34496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 35930 34683 gene locus_tag LOCUS_04280 35930 34683 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337052.1 protein_id gnl|my_center|LOCUS_04280 37139 36039 gene locus_tag LOCUS_04290 37139 36039 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480736.1 protein_id gnl|my_center|LOCUS_04290 38305 37202 gene locus_tag LOCUS_04300 38305 37202 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722797.1 protein_id gnl|my_center|LOCUS_04300 >Feature sequence011 660 1916 gene locus_tag LOCUS_04310 gene hemA 660 1916 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927715.1 protein_id gnl|my_center|LOCUS_04310 1924 3009 gene locus_tag LOCUS_04320 gene prfA 1924 3009 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706935.1 protein_id gnl|my_center|LOCUS_04320 3006 3839 gene locus_tag LOCUS_04330 gene prmC 3006 3839 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114694.1 protein_id gnl|my_center|LOCUS_04330 5090 3885 gene locus_tag LOCUS_04340 5090 3885 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063044.1 protein_id gnl|my_center|LOCUS_04340 4362 4461 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6204 5116 gene locus_tag LOCUS_04350 gene serC 6204 5116 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233234.1 protein_id gnl|my_center|LOCUS_04350 7221 6259 gene locus_tag LOCUS_04360 7221 6259 CDS product hydroxypyruvate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081620.1 protein_id gnl|my_center|LOCUS_04360 8179 7232 gene locus_tag LOCUS_04370 gene asd 8179 7232 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188178.1 protein_id gnl|my_center|LOCUS_04370 8238 8337 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8670 8939 gene locus_tag LOCUS_04380 gene rpsO 8670 8939 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114951.1 protein_id gnl|my_center|LOCUS_04380 8966 11092 gene locus_tag LOCUS_04390 gene pnp 8966 11092 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369529.1 protein_id gnl|my_center|LOCUS_04390 12549 11119 gene locus_tag LOCUS_04400 12549 11119 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085916.1 protein_id gnl|my_center|LOCUS_04400 13256 12546 gene locus_tag LOCUS_04410 13256 12546 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_04410 13298 13921 gene locus_tag LOCUS_04420 13298 13921 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084189.1 protein_id gnl|my_center|LOCUS_04420 16522 13925 gene locus_tag LOCUS_04430 16522 13925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 19623 16735 gene locus_tag LOCUS_04440 19623 16735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 19729 19828 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21683 20574 gene locus_tag LOCUS_04450 21683 20574 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764114.1 protein_id gnl|my_center|LOCUS_04450 22876 21680 gene locus_tag LOCUS_04460 22876 21680 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419738.1 protein_id gnl|my_center|LOCUS_04460 24120 23020 gene locus_tag LOCUS_04470 24120 23020 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722552.1 protein_id gnl|my_center|LOCUS_04470 26524 24386 gene locus_tag LOCUS_04480 26524 24386 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530885.1 protein_id gnl|my_center|LOCUS_04480 27445 26558 gene locus_tag LOCUS_04490 27445 26558 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811978.1 protein_id gnl|my_center|LOCUS_04490 28380 27445 gene locus_tag LOCUS_04500 28380 27445 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530883.1 protein_id gnl|my_center|LOCUS_04500 30268 28568 gene locus_tag LOCUS_04510 30268 28568 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532331.1 protein_id gnl|my_center|LOCUS_04510 30416 31066 gene locus_tag LOCUS_04520 30416 31066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 31063 32133 gene locus_tag LOCUS_04530 31063 32133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 32197 34656 gene locus_tag LOCUS_04540 32197 34656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 >Feature sequence012 3 3212 gene locus_tag LOCUS_04550 3 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 3991 3314 gene locus_tag LOCUS_04560 3991 3314 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106037.1 protein_id gnl|my_center|LOCUS_04560 4439 3999 gene locus_tag LOCUS_04570 4439 3999 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877160.1 protein_id gnl|my_center|LOCUS_04570 4528 5841 gene locus_tag LOCUS_04580 gene glnT 4528 5841 CDS product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532906.1 protein_id gnl|my_center|LOCUS_04580 5862 6455 gene locus_tag LOCUS_04590 5862 6455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 6496 7050 gene locus_tag LOCUS_04600 6496 7050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 8308 7064 gene locus_tag LOCUS_04610 8308 7064 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337262.1 protein_id gnl|my_center|LOCUS_04610 11507 8358 gene locus_tag LOCUS_04620 gene putA 11507 8358 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038915.1 protein_id gnl|my_center|LOCUS_04620 11758 13536 gene locus_tag LOCUS_04630 11758 13536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 13567 13914 gene locus_tag LOCUS_04640 13567 13914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 13914 14510 gene locus_tag LOCUS_04650 gene recR 13914 14510 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036206.1 protein_id gnl|my_center|LOCUS_04650 14579 16144 gene locus_tag LOCUS_04660 14579 16144 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421494.1 protein_id gnl|my_center|LOCUS_04660 16163 17140 gene locus_tag LOCUS_04670 16163 17140 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490818.1 protein_id gnl|my_center|LOCUS_04670 17137 18048 gene locus_tag LOCUS_04680 17137 18048 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455202.1 protein_id gnl|my_center|LOCUS_04680 18055 19011 gene locus_tag LOCUS_04690 18055 19011 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937477.1 protein_id gnl|my_center|LOCUS_04690 19017 20042 gene locus_tag LOCUS_04700 19017 20042 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937476.1 protein_id gnl|my_center|LOCUS_04700 20047 20838 gene locus_tag LOCUS_04710 gene truA 20047 20838 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216995.1 protein_id gnl|my_center|LOCUS_04710 20879 21547 gene locus_tag LOCUS_04720 20879 21547 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104200.1 protein_id gnl|my_center|LOCUS_04720 21544 22446 gene locus_tag LOCUS_04730 gene accD 21544 22446 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104199.1 protein_id gnl|my_center|LOCUS_04730 22443 23831 gene locus_tag LOCUS_04740 gene folC 22443 23831 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811819.1 protein_id gnl|my_center|LOCUS_04740 23828 24355 gene locus_tag LOCUS_04750 23828 24355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 24436 24930 gene locus_tag LOCUS_04760 24436 24930 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113932.1 protein_id gnl|my_center|LOCUS_04760 24930 26462 gene locus_tag LOCUS_04770 gene purF 24930 26462 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091383.1 protein_id gnl|my_center|LOCUS_04770 26630 26729 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26796 28151 gene locus_tag LOCUS_04780 26796 28151 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038949.1 protein_id gnl|my_center|LOCUS_04780 27992 28091 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28106 28252 gene locus_tag LOCUS_04790 28106 28252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 28553 28269 gene locus_tag LOCUS_04800 28553 28269 CDS product DUF2160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312913.1 protein_id gnl|my_center|LOCUS_04800 29369 28563 gene locus_tag LOCUS_04810 29369 28563 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376266.1 protein_id gnl|my_center|LOCUS_04810 30235 29369 gene locus_tag LOCUS_04820 30235 29369 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530331.1 protein_id gnl|my_center|LOCUS_04820 31317 30232 gene locus_tag LOCUS_04830 31317 30232 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531811.1 protein_id gnl|my_center|LOCUS_04830 32380 31310 gene locus_tag LOCUS_04840 32380 31310 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973409.1 protein_id gnl|my_center|LOCUS_04840 <33908 32382 gene locus_tag LOCUS_04850 <33908 32382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003098460.1:glycerol-3-phosphate dehydrogenase >Feature sequence013 2007 2106 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2805 3263 gene locus_tag LOCUS_04860 gene mraZ 2805 3263 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769445.1 protein_id gnl|my_center|LOCUS_04860 3275 4216 gene locus_tag LOCUS_04870 gene rsmH 3275 4216 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110151.1 protein_id gnl|my_center|LOCUS_04870 4324 4560 gene locus_tag LOCUS_04880 4324 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 4560 6236 gene locus_tag LOCUS_04890 4560 6236 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042597405.1 protein_id gnl|my_center|LOCUS_04890 6233 7795 gene locus_tag LOCUS_04900 gene murE 6233 7795 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095570.1 protein_id gnl|my_center|LOCUS_04900 7795 9213 gene locus_tag LOCUS_04910 7795 9213 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957393.1 protein_id gnl|my_center|LOCUS_04910 9207 10289 gene locus_tag LOCUS_04920 gene mraY 9207 10289 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_04920 10292 11629 gene locus_tag LOCUS_04930 gene murD 10292 11629 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766566.1 protein_id gnl|my_center|LOCUS_04930 11626 12816 gene locus_tag LOCUS_04940 gene ftsW 11626 12816 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039094.1 protein_id gnl|my_center|LOCUS_04940 12813 13913 gene locus_tag LOCUS_04950 gene murG 12813 13913 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194182.1 protein_id gnl|my_center|LOCUS_04950 13906 15339 gene locus_tag LOCUS_04960 gene murC 13906 15339 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268845.1 protein_id gnl|my_center|LOCUS_04960 15336 16238 gene locus_tag LOCUS_04970 gene murB 15336 16238 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357031.1 protein_id gnl|my_center|LOCUS_04970 16235 17065 gene locus_tag LOCUS_04980 16235 17065 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948311.1 protein_id gnl|my_center|LOCUS_04980 17059 18276 gene locus_tag LOCUS_04990 gene ftsA 17059 18276 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364017.1 protein_id gnl|my_center|LOCUS_04990 18345 19610 gene locus_tag LOCUS_05000 gene ftsZ 18345 19610 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420911.1 protein_id gnl|my_center|LOCUS_05000 19879 20793 gene locus_tag LOCUS_05010 gene lpxC 19879 20793 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_05010 21124 20810 gene locus_tag LOCUS_05020 21124 20810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 21181 23895 gene locus_tag LOCUS_05030 gene secA 21181 23895 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220108.1 protein_id gnl|my_center|LOCUS_05030 23921 25156 gene locus_tag LOCUS_05040 gene argJ 23921 25156 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388153.1 protein_id gnl|my_center|LOCUS_05040 25137 25556 gene locus_tag LOCUS_05050 25137 25556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 26264 25617 gene locus_tag LOCUS_05060 gene coaE 26264 25617 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194322.1 protein_id gnl|my_center|LOCUS_05060 26416 27921 gene locus_tag LOCUS_05070 gene sufB 26416 27921 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772922.1 protein_id gnl|my_center|LOCUS_05070 27926 28025 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28030 28584 gene locus_tag LOCUS_05080 28030 28584 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066380.1 protein_id gnl|my_center|LOCUS_05080 28677 29447 gene locus_tag LOCUS_05090 gene sufC 28677 29447 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_05090 29444 30760 gene locus_tag LOCUS_05100 gene sufD 29444 30760 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928762.1 protein_id gnl|my_center|LOCUS_05100 30917 31016 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 31316 31636 gene locus_tag LOCUS_05110 31316 31636 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037899.1 protein_id gnl|my_center|LOCUS_05110 31636 32943 gene locus_tag LOCUS_05120 gene murA 31636 32943 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094332.1 protein_id gnl|my_center|LOCUS_05120 >Feature sequence014 4748 3960 gene locus_tag LOCUS_05130 4748 3960 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192025.1 protein_id gnl|my_center|LOCUS_05130 5932 4763 gene locus_tag LOCUS_05140 gene holB 5932 4763 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039871.1 protein_id gnl|my_center|LOCUS_05140 6648 5929 gene locus_tag LOCUS_05150 gene tmk 6648 5929 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091125.1 protein_id gnl|my_center|LOCUS_05150 7913 6645 gene locus_tag LOCUS_05160 7913 6645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 9197 7977 gene locus_tag LOCUS_05170 gene fabF 9197 7977 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193086.1 protein_id gnl|my_center|LOCUS_05170 9526 9287 gene locus_tag LOCUS_05180 gene acpP 9526 9287 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002814322.1 protein_id gnl|my_center|LOCUS_05180 10401 9661 gene locus_tag LOCUS_05190 gene fabG 10401 9661 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091137.1 protein_id gnl|my_center|LOCUS_05190 11446 10478 gene locus_tag LOCUS_05200 11446 10478 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 protein_id gnl|my_center|LOCUS_05200 12633 11443 gene locus_tag LOCUS_05210 gene plsX 12633 11443 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947122.1 protein_id gnl|my_center|LOCUS_05210 12815 12648 gene locus_tag LOCUS_05220 12815 12648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 13031 14131 gene locus_tag LOCUS_05230 gene aroG 13031 14131 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813056.1 protein_id gnl|my_center|LOCUS_05230 14128 15336 gene locus_tag LOCUS_05240 gene sat 14128 15336 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_05240 15350 16330 gene locus_tag LOCUS_05250 gene trxB 15350 16330 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941156.1 protein_id gnl|my_center|LOCUS_05250 16320 16922 gene locus_tag LOCUS_05260 16320 16922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 16938 17261 gene locus_tag LOCUS_05270 16938 17261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 17351 18049 gene locus_tag LOCUS_05280 17351 18049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 18114 18713 gene locus_tag LOCUS_05290 18114 18713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 19822 18737 gene locus_tag LOCUS_05300 19822 18737 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974519.1 protein_id gnl|my_center|LOCUS_05300 20631 19819 gene locus_tag LOCUS_05310 20631 19819 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640674.1 protein_id gnl|my_center|LOCUS_05310 21547 20618 gene locus_tag LOCUS_05320 21547 20618 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265910.1 protein_id gnl|my_center|LOCUS_05320 21732 21831 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23004 21847 gene locus_tag LOCUS_05330 23004 21847 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920973.1 protein_id gnl|my_center|LOCUS_05330 23210 23309 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23332 24564 gene locus_tag LOCUS_05340 23332 24564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 24905 24585 gene locus_tag LOCUS_05350 gene grxD 24905 24585 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186955.1 protein_id gnl|my_center|LOCUS_05350 25249 24971 gene locus_tag LOCUS_05360 25249 24971 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815785.1 protein_id gnl|my_center|LOCUS_05360 25548 25252 gene locus_tag LOCUS_05370 25548 25252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 26216 25545 gene locus_tag LOCUS_05380 26216 25545 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946580.1 protein_id gnl|my_center|LOCUS_05380 26677 26213 gene locus_tag LOCUS_05390 gene mlaD 26677 26213 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815777.1 protein_id gnl|my_center|LOCUS_05390 27468 26677 gene locus_tag LOCUS_05400 gene mlaE 27468 26677 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001887761.1 protein_id gnl|my_center|LOCUS_05400 28286 27465 gene locus_tag LOCUS_05410 gene mlaF 28286 27465 CDS product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073693.1 protein_id gnl|my_center|LOCUS_05410 29235 28495 gene locus_tag LOCUS_05420 29235 28495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 29347 30087 gene locus_tag LOCUS_05430 29347 30087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 31140 30145 gene locus_tag LOCUS_05440 31140 30145 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530045.1 protein_id gnl|my_center|LOCUS_05440 <32398 31175 gene locus_tag LOCUS_05450 <32398 31175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530046.1:mandelate racemase/muconate lactonizing enzyme family protein >Feature sequence015 1198 44 gene locus_tag LOCUS_05460 1198 44 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038918.1 protein_id gnl|my_center|LOCUS_05460 1288 2493 gene locus_tag LOCUS_05470 gene tyrS 1288 2493 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071526.1 protein_id gnl|my_center|LOCUS_05470 2503 3333 gene locus_tag LOCUS_05480 2503 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 3340 4620 gene locus_tag LOCUS_05490 3340 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 4632 6845 gene locus_tag LOCUS_05500 4632 6845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 6848 8857 gene locus_tag LOCUS_05510 6848 8857 CDS product PEGA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008292761.1 protein_id gnl|my_center|LOCUS_05510 8906 9064 gene locus_tag LOCUS_05520 8906 9064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 9066 9857 gene locus_tag LOCUS_05530 9066 9857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 9857 10918 gene locus_tag LOCUS_05540 9857 10918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 10909 11919 gene locus_tag LOCUS_05550 10909 11919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 12225 13766 gene locus_tag LOCUS_r00010 12225 13766 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 13944 14165 gene locus_tag LOCUS_05560 13944 14165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 15118 14192 gene locus_tag LOCUS_05570 15118 14192 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395802.1 protein_id gnl|my_center|LOCUS_05570 15567 15878 gene locus_tag LOCUS_05580 15567 15878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 15875 19510 gene locus_tag LOCUS_05590 15875 19510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 19609 20589 gene locus_tag LOCUS_05600 19609 20589 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113326.1 protein_id gnl|my_center|LOCUS_05600 20868 20944 gene locus_tag LOCUS_t00100 20868 20944 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 21002 21208 gene locus_tag LOCUS_05610 21002 21208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 21231 21306 gene locus_tag LOCUS_t00110 21231 21306 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 21661 24561 gene locus_tag LOCUS_r00020 21661 24561 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 24679 24787 gene locus_tag LOCUS_r00030 24679 24787 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 26242 24851 gene locus_tag LOCUS_05620 26242 24851 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946411.1 protein_id gnl|my_center|LOCUS_05620 26604 26272 gene locus_tag LOCUS_05630 26604 26272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 27052 26612 gene locus_tag LOCUS_05640 27052 26612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 27668 27069 gene locus_tag LOCUS_05650 27668 27069 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894276.1 protein_id gnl|my_center|LOCUS_05650 28033 27827 gene locus_tag LOCUS_05660 28033 27827 CDS product DUF6494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526979.1 protein_id gnl|my_center|LOCUS_05660 28194 29012 gene locus_tag LOCUS_05670 gene fdhD 28194 29012 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118351.1 protein_id gnl|my_center|LOCUS_05670 29841 29467 gene locus_tag LOCUS_05680 29841 29467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 >Feature sequence016 196 1215 gene locus_tag LOCUS_05690 196 1215 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087143.1 protein_id gnl|my_center|LOCUS_05690 1329 1832 gene locus_tag LOCUS_05700 1329 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 1832 3334 gene locus_tag LOCUS_05710 1832 3334 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459464.1 protein_id gnl|my_center|LOCUS_05710 3350 5095 gene locus_tag LOCUS_05720 3350 5095 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972394.1 protein_id gnl|my_center|LOCUS_05720 5136 6383 gene locus_tag LOCUS_05730 gene frc 5136 6383 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085940.1 protein_id gnl|my_center|LOCUS_05730 6383 7309 gene locus_tag LOCUS_05740 gene fmt 6383 7309 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_05740 7306 8289 gene locus_tag LOCUS_05750 7306 8289 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088878.1 protein_id gnl|my_center|LOCUS_05750 8618 8337 gene locus_tag LOCUS_05760 8618 8337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 10140 8668 gene locus_tag LOCUS_05770 gene sthA 10140 8668 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971781.1 protein_id gnl|my_center|LOCUS_05770 10332 11828 gene locus_tag LOCUS_05780 10332 11828 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403903.1 protein_id gnl|my_center|LOCUS_05780 11894 13273 gene locus_tag LOCUS_05790 11894 13273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 13778 13266 gene locus_tag LOCUS_05800 13778 13266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 13838 14266 gene locus_tag LOCUS_05810 13838 14266 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037987.1 protein_id gnl|my_center|LOCUS_05810 14856 14278 gene locus_tag LOCUS_05820 14856 14278 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042064868.1 protein_id gnl|my_center|LOCUS_05820 16022 14853 gene locus_tag LOCUS_05830 16022 14853 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089466.1 protein_id gnl|my_center|LOCUS_05830 16258 17649 gene locus_tag LOCUS_05840 16258 17649 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162600451.1 protein_id gnl|my_center|LOCUS_05840 17646 18341 gene locus_tag LOCUS_05850 gene rpe 17646 18341 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085122.1 protein_id gnl|my_center|LOCUS_05850 18354 19868 gene locus_tag LOCUS_05860 gene trpE 18354 19868 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402019.1 protein_id gnl|my_center|LOCUS_05860 19868 20464 gene locus_tag LOCUS_05870 19868 20464 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_05870 20506 20605 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20616 21407 gene locus_tag LOCUS_05880 gene trpC 20616 21407 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437196.1 protein_id gnl|my_center|LOCUS_05880 21404 21826 gene locus_tag LOCUS_05890 21404 21826 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401427.1 protein_id gnl|my_center|LOCUS_05890 21901 22980 gene locus_tag LOCUS_05900 21901 22980 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_05900 22977 23282 gene locus_tag LOCUS_05910 22977 23282 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064795.1 protein_id gnl|my_center|LOCUS_05910 23321 23668 gene locus_tag LOCUS_05920 gene arsC 23321 23668 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132650.1 protein_id gnl|my_center|LOCUS_05920 23677 24273 gene locus_tag LOCUS_05930 23677 24273 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528294.1 protein_id gnl|my_center|LOCUS_05930 26716 24302 gene locus_tag LOCUS_05940 gene gyrB 26716 24302 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220005.1 protein_id gnl|my_center|LOCUS_05940 26896 26995 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28170 27055 gene locus_tag LOCUS_05950 gene dnaN 28170 27055 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035260.1 protein_id gnl|my_center|LOCUS_05950 <29539 28433 gene locus_tag LOCUS_05960 <29539 28433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010945763.1:chromosomal replication initiator protein DnaA >Feature sequence017 2588 1422 gene locus_tag LOCUS_05970 gene metK 2588 1422 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704903.1 protein_id gnl|my_center|LOCUS_05970 2726 3655 gene locus_tag LOCUS_05980 gene argB 2726 3655 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096572.1 protein_id gnl|my_center|LOCUS_05980 3655 5514 gene locus_tag LOCUS_05990 gene recQ 3655 5514 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038070.1 protein_id gnl|my_center|LOCUS_05990 5631 6386 gene locus_tag LOCUS_06000 5631 6386 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887476.1 protein_id gnl|my_center|LOCUS_06000 7592 6387 gene locus_tag LOCUS_06010 7592 6387 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070947.1 protein_id gnl|my_center|LOCUS_06010 7844 9484 gene locus_tag LOCUS_06020 7844 9484 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074085.1 protein_id gnl|my_center|LOCUS_06020 10459 9524 gene locus_tag LOCUS_06030 gene rluC 10459 9524 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693754.1 protein_id gnl|my_center|LOCUS_06030 11751 10459 gene locus_tag LOCUS_06040 11751 10459 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525489.1 protein_id gnl|my_center|LOCUS_06040 11751 11966 gene locus_tag LOCUS_06050 11751 11966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 11920 13272 gene locus_tag LOCUS_06060 11920 13272 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037489.1 protein_id gnl|my_center|LOCUS_06060 13265 14377 gene locus_tag LOCUS_06070 13265 14377 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726684.1 protein_id gnl|my_center|LOCUS_06070 14382 14481 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14490 15821 gene locus_tag LOCUS_06080 14490 15821 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973446.1 protein_id gnl|my_center|LOCUS_06080 15924 16994 gene locus_tag LOCUS_06090 15924 16994 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528515.1 protein_id gnl|my_center|LOCUS_06090 17055 18152 gene locus_tag LOCUS_06100 17055 18152 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528516.1 protein_id gnl|my_center|LOCUS_06100 18149 19027 gene locus_tag LOCUS_06110 18149 19027 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528517.1 protein_id gnl|my_center|LOCUS_06110 19031 19873 gene locus_tag LOCUS_06120 19031 19873 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528518.1 protein_id gnl|my_center|LOCUS_06120 20967 19915 gene locus_tag LOCUS_06130 gene ugpC 20967 19915 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329344.1 protein_id gnl|my_center|LOCUS_06130 21816 20971 gene locus_tag LOCUS_06140 gene ugpE 21816 20971 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811259.1 protein_id gnl|my_center|LOCUS_06140 22697 21816 gene locus_tag LOCUS_06150 gene ugpA 22697 21816 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969345.1 protein_id gnl|my_center|LOCUS_06150 24068 22755 gene locus_tag LOCUS_06160 gene ugpB 24068 22755 CDS product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083853.1 protein_id gnl|my_center|LOCUS_06160 >Feature sequence018 329 1528 gene locus_tag LOCUS_06170 329 1528 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_06170 1537 2232 gene locus_tag LOCUS_06180 1537 2232 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228074.1 protein_id gnl|my_center|LOCUS_06180 2454 2663 gene locus_tag LOCUS_06190 2454 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 2667 4493 gene locus_tag LOCUS_06200 2667 4493 CDS product VC_2705 family sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259231.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06200 4567 4923 gene locus_tag LOCUS_06210 4567 4923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 5864 4932 gene locus_tag LOCUS_06220 gene miaA 5864 4932 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192300.1 protein_id gnl|my_center|LOCUS_06220 5958 6785 gene locus_tag LOCUS_06230 5958 6785 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074016730.1 protein_id gnl|my_center|LOCUS_06230 8656 6815 gene locus_tag LOCUS_06240 gene mutL 8656 6815 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105240.1 protein_id gnl|my_center|LOCUS_06240 9833 8643 gene locus_tag LOCUS_06250 gene amiB 9833 8643 CDS product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_06250 10339 9827 gene locus_tag LOCUS_06260 gene tsaE 10339 9827 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106408.1 protein_id gnl|my_center|LOCUS_06260 11822 10326 gene locus_tag LOCUS_06270 11822 10326 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704859.1 protein_id gnl|my_center|LOCUS_06270 12653 11841 gene locus_tag LOCUS_06280 12653 11841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 12776 13843 gene locus_tag LOCUS_06290 gene queG 12776 13843 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110324.1 protein_id gnl|my_center|LOCUS_06290 14183 13851 gene locus_tag LOCUS_06300 14183 13851 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_06300 14507 14205 gene locus_tag LOCUS_06310 gene tusB 14507 14205 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932538.1 protein_id gnl|my_center|LOCUS_06310 14932 14507 gene locus_tag LOCUS_06320 gene tusC 14932 14507 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932537.1 protein_id gnl|my_center|LOCUS_06320 15321 14932 gene locus_tag LOCUS_06330 gene tusD 15321 14932 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932536.1 protein_id gnl|my_center|LOCUS_06330 15906 15346 gene locus_tag LOCUS_06340 gene orn 15906 15346 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209143.1 protein_id gnl|my_center|LOCUS_06340 17239 15962 gene locus_tag LOCUS_06350 17239 15962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 17543 18334 gene locus_tag LOCUS_06360 gene fabI 17543 18334 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506490.1 protein_id gnl|my_center|LOCUS_06360 20161 18335 gene locus_tag LOCUS_06370 20161 18335 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_06370 20334 22316 gene locus_tag LOCUS_06380 20334 22316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 22180 22279 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22316 22978 gene locus_tag LOCUS_06390 22316 22978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 >Feature sequence019 127 798 gene locus_tag LOCUS_06400 127 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 841 1815 gene locus_tag LOCUS_06410 841 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 1892 2383 gene locus_tag LOCUS_06420 1892 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 2494 4530 gene locus_tag LOCUS_06430 2494 4530 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_06430 4587 4925 gene locus_tag LOCUS_06440 4587 4925 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970914.1 protein_id gnl|my_center|LOCUS_06440 4922 5389 gene locus_tag LOCUS_06450 4922 5389 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970913.1 protein_id gnl|my_center|LOCUS_06450 5407 6765 gene locus_tag LOCUS_06460 5407 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 6961 6776 gene locus_tag LOCUS_06470 6961 6776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 8223 6958 gene locus_tag LOCUS_06480 8223 6958 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958118.1 protein_id gnl|my_center|LOCUS_06480 8591 8220 gene locus_tag LOCUS_06490 8591 8220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 9773 8634 gene locus_tag LOCUS_06500 9773 8634 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625896.1 protein_id gnl|my_center|LOCUS_06500 9872 10651 gene locus_tag LOCUS_06510 gene panB 9872 10651 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071160.1 protein_id gnl|my_center|LOCUS_06510 11904 10645 gene locus_tag LOCUS_06520 11904 10645 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391471.1 protein_id gnl|my_center|LOCUS_06520 11967 12710 gene locus_tag LOCUS_06530 11967 12710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 14401 12752 gene locus_tag LOCUS_06540 14401 12752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 14937 14551 gene locus_tag LOCUS_06550 14937 14551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 15178 14930 gene locus_tag LOCUS_06560 15178 14930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 15431 15186 gene locus_tag LOCUS_06570 15431 15186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 16784 15624 gene locus_tag LOCUS_06580 16784 15624 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933793.1 protein_id gnl|my_center|LOCUS_06580 18192 17026 gene locus_tag LOCUS_06590 18192 17026 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391469.1 protein_id gnl|my_center|LOCUS_06590 19187 18189 gene locus_tag LOCUS_06600 19187 18189 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241956.1 protein_id gnl|my_center|LOCUS_06600 20741 19230 gene locus_tag LOCUS_06610 20741 19230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 21130 20930 gene locus_tag LOCUS_06620 21130 20930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 23037 21127 gene locus_tag LOCUS_06630 23037 21127 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061526.1 protein_id gnl|my_center|LOCUS_06630 24974 23034 gene locus_tag LOCUS_06640 24974 23034 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061525.1 protein_id gnl|my_center|LOCUS_06640 >Feature sequence020 2452 1004 gene locus_tag LOCUS_06650 2452 1004 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090469.1 protein_id gnl|my_center|LOCUS_06650 7040 2445 gene locus_tag LOCUS_06660 gene gltB 7040 2445 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066927.1 protein_id gnl|my_center|LOCUS_06660 7767 7186 gene locus_tag LOCUS_06670 7767 7186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040721.1 protein_id gnl|my_center|LOCUS_06670 8516 7764 gene locus_tag LOCUS_06680 8516 7764 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197992.1 protein_id gnl|my_center|LOCUS_06680 8488 8700 gene locus_tag LOCUS_06690 8488 8700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 9636 8770 gene locus_tag LOCUS_06700 9636 8770 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038909.1 protein_id gnl|my_center|LOCUS_06700 10222 9659 gene locus_tag LOCUS_06710 10222 9659 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482726.1 protein_id gnl|my_center|LOCUS_06710 10430 10239 gene locus_tag LOCUS_06720 10430 10239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 11941 10358 gene locus_tag LOCUS_06730 gene ctaD 11941 10358 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083723.1 protein_id gnl|my_center|LOCUS_06730 12179 11958 gene locus_tag LOCUS_06740 12179 11958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 12418 12176 gene locus_tag LOCUS_06750 12418 12176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 13603 12461 gene locus_tag LOCUS_06760 gene coxB 13603 12461 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101203.1 protein_id gnl|my_center|LOCUS_06760 15928 13715 gene locus_tag LOCUS_06770 15928 13715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 17109 16204 gene locus_tag LOCUS_06780 gene cyoE 17109 16204 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768584.1 protein_id gnl|my_center|LOCUS_06780 17582 17109 gene locus_tag LOCUS_06790 17582 17109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 17473 18612 gene locus_tag LOCUS_06800 17473 18612 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089449.1 protein_id gnl|my_center|LOCUS_06800 <24971 18628 gene locus_tag LOCUS_06810 <24971 18628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_211921382.1:putative Ig domain-containing protein >Feature sequence021 <1 1900 gene locus_tag LOCUS_06820 <1 1900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776172.1:Ig-like domain-containing protein 2642 1917 gene locus_tag LOCUS_06830 2642 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 2662 2761 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3028 4332 gene locus_tag LOCUS_06840 3028 4332 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705373.1 protein_id gnl|my_center|LOCUS_06840 4329 5939 gene locus_tag LOCUS_06850 4329 5939 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730646.1 protein_id gnl|my_center|LOCUS_06850 6039 8015 gene locus_tag LOCUS_06860 6039 8015 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730645.1 protein_id gnl|my_center|LOCUS_06860 8031 8636 gene locus_tag LOCUS_06870 8031 8636 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268298.1 protein_id gnl|my_center|LOCUS_06870 8633 8956 gene locus_tag LOCUS_06880 8633 8956 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708200.1 protein_id gnl|my_center|LOCUS_06880 8956 10914 gene locus_tag LOCUS_06890 8956 10914 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530253.1 protein_id gnl|my_center|LOCUS_06890 11225 15847 gene locus_tag LOCUS_06900 11225 15847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 15844 20565 gene locus_tag LOCUS_06910 15844 20565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 21999 20602 gene locus_tag LOCUS_06920 21999 20602 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114627.1 protein_id gnl|my_center|LOCUS_06920 22990 22442 gene locus_tag LOCUS_06930 22990 22442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 >Feature sequence022 1533 1 gene locus_tag LOCUS_06940 1533 1 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_06940 3724 1526 gene locus_tag LOCUS_06950 gene scpA 3724 1526 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337301.1 protein_id gnl|my_center|LOCUS_06950 4334 3786 gene locus_tag LOCUS_06960 4334 3786 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943393.1 protein_id gnl|my_center|LOCUS_06960 4451 5701 gene locus_tag LOCUS_06970 4451 5701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 5713 6387 gene locus_tag LOCUS_06980 5713 6387 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457207.1 protein_id gnl|my_center|LOCUS_06980 7285 6392 gene locus_tag LOCUS_06990 gene yhdJ 7285 6392 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258927.1 protein_id gnl|my_center|LOCUS_06990 8283 7288 gene locus_tag LOCUS_07000 8283 7288 CDS product acryloyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233163.1 protein_id gnl|my_center|LOCUS_07000 8888 8301 gene locus_tag LOCUS_07010 8888 8301 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037574.1 protein_id gnl|my_center|LOCUS_07010 9426 8911 gene locus_tag LOCUS_07020 9426 8911 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707093.1 protein_id gnl|my_center|LOCUS_07020 9832 9407 gene locus_tag LOCUS_07030 gene nusB 9832 9407 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707095.1 protein_id gnl|my_center|LOCUS_07030 10284 9832 gene locus_tag LOCUS_07040 gene ribE 10284 9832 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093311.1 protein_id gnl|my_center|LOCUS_07040 11461 10277 gene locus_tag LOCUS_07050 gene ribBA 11461 10277 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039073.1 protein_id gnl|my_center|LOCUS_07050 12093 11458 gene locus_tag LOCUS_07060 12093 11458 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 protein_id gnl|my_center|LOCUS_07060 13245 12097 gene locus_tag LOCUS_07070 gene ribD 13245 12097 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704561.1 protein_id gnl|my_center|LOCUS_07070 13752 13249 gene locus_tag LOCUS_07080 gene nrdR 13752 13249 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771735.1 protein_id gnl|my_center|LOCUS_07080 14783 13758 gene locus_tag LOCUS_07090 gene secF 14783 13758 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486403.1 protein_id gnl|my_center|LOCUS_07090 16666 14783 gene locus_tag LOCUS_07100 gene secD 16666 14783 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482962.1 protein_id gnl|my_center|LOCUS_07100 17868 16792 gene locus_tag LOCUS_07110 17868 16792 CDS product alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533458.1 protein_id gnl|my_center|LOCUS_07110 22084 17897 gene locus_tag LOCUS_07120 22084 17897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 >Feature sequence023 152 79 gene locus_tag LOCUS_t00120 152 79 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 262 178 gene locus_tag LOCUS_t00130 262 178 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1532 867 gene locus_tag LOCUS_07130 1532 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 2311 1532 gene locus_tag LOCUS_07140 2311 1532 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189091.1 protein_id gnl|my_center|LOCUS_07140 3078 2308 gene locus_tag LOCUS_07150 gene birA 3078 2308 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815379.1 protein_id gnl|my_center|LOCUS_07150 3175 3828 gene locus_tag LOCUS_07160 3175 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 3833 4978 gene locus_tag LOCUS_07170 gene ispG 3833 4978 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118672.1 protein_id gnl|my_center|LOCUS_07170 4975 5688 gene locus_tag LOCUS_07180 4975 5688 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327506.1 protein_id gnl|my_center|LOCUS_07180 5724 6197 gene locus_tag LOCUS_07190 gene msrB 5724 6197 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792822.1 protein_id gnl|my_center|LOCUS_07190 6194 6991 gene locus_tag LOCUS_07200 6194 6991 CDS product DUF1223 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195184.1 protein_id gnl|my_center|LOCUS_07200 7081 7494 gene locus_tag LOCUS_07210 7081 7494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 7586 8092 gene locus_tag LOCUS_07220 gene moaC 7586 8092 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969379.1 protein_id gnl|my_center|LOCUS_07220 8099 9367 gene locus_tag LOCUS_07230 8099 9367 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812683.1 protein_id gnl|my_center|LOCUS_07230 9361 10017 gene locus_tag LOCUS_07240 9361 10017 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106022.1 protein_id gnl|my_center|LOCUS_07240 10366 10022 gene locus_tag LOCUS_07250 10366 10022 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918409.1 protein_id gnl|my_center|LOCUS_07250 11761 10388 gene locus_tag LOCUS_07260 11761 10388 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163308.1 protein_id gnl|my_center|LOCUS_07260 12079 11864 gene locus_tag LOCUS_07270 12079 11864 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082372.1 protein_id gnl|my_center|LOCUS_07270 13929 12280 gene locus_tag LOCUS_07280 13929 12280 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102377.1 protein_id gnl|my_center|LOCUS_07280 14124 15125 gene locus_tag LOCUS_07290 14124 15125 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338924.1 protein_id gnl|my_center|LOCUS_07290 16170 15091 gene locus_tag LOCUS_07300 gene ltaE 16170 15091 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112603.1 protein_id gnl|my_center|LOCUS_07300 17131 16178 gene locus_tag LOCUS_07310 17131 16178 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313706.1 protein_id gnl|my_center|LOCUS_07310 17237 17471 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggggtggacatgcactcaaaaccaaatgctttcccacc 18652 17477 gene locus_tag LOCUS_07320 18652 17477 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029732907.1 protein_id gnl|my_center|LOCUS_07320 18808 20016 gene locus_tag LOCUS_07330 18808 20016 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336960.1 protein_id gnl|my_center|LOCUS_07330 20058 21545 gene locus_tag LOCUS_07340 gene nhaB 20058 21545 CDS product sodium/proton antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113594.1 protein_id gnl|my_center|LOCUS_07340 21546 21863 gene locus_tag LOCUS_07350 21546 21863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 >Feature sequence024 217 702 gene locus_tag LOCUS_07360 217 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 678 926 gene locus_tag LOCUS_07370 gene yidD 678 926 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816027.1 protein_id gnl|my_center|LOCUS_07370 938 2626 gene locus_tag LOCUS_07380 gene yidC 938 2626 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105595.1 protein_id gnl|my_center|LOCUS_07380 2658 4124 gene locus_tag LOCUS_07390 gene mnmE 2658 4124 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175133.1 protein_id gnl|my_center|LOCUS_07390 3989 4088 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4248 6134 gene locus_tag LOCUS_07400 gene mnmG 4248 6134 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965608.1 protein_id gnl|my_center|LOCUS_07400 7496 6150 gene locus_tag LOCUS_07410 gene gorA 7496 6150 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160795.1 protein_id gnl|my_center|LOCUS_07410 7580 8197 gene locus_tag LOCUS_07420 7580 8197 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390884.1 protein_id gnl|my_center|LOCUS_07420 8198 8758 gene locus_tag LOCUS_07430 8198 8758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 8758 10104 gene locus_tag LOCUS_07440 gene pepP 8758 10104 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_07440 10101 11318 gene locus_tag LOCUS_07450 gene ubiH 10101 11318 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111165.1 protein_id gnl|my_center|LOCUS_07450 11322 12539 gene locus_tag LOCUS_07460 11322 12539 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266320.1 protein_id gnl|my_center|LOCUS_07460 12564 12983 gene locus_tag LOCUS_07470 gene fur 12564 12983 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194273.1 protein_id gnl|my_center|LOCUS_07470 13015 13953 gene locus_tag LOCUS_07480 13015 13953 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_07480 14040 13965 gene locus_tag LOCUS_t00140 14040 13965 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 14167 14985 gene locus_tag LOCUS_07490 14167 14985 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727532.1 protein_id gnl|my_center|LOCUS_07490 14996 16990 gene locus_tag LOCUS_07500 14996 16990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 20472 17053 gene locus_tag LOCUS_07510 20472 17053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727531.1 protein_id gnl|my_center|LOCUS_07510 21355 20483 gene locus_tag LOCUS_07520 21355 20483 CDS product DUF4007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727530.1 protein_id gnl|my_center|LOCUS_07520 21656 21408 gene locus_tag LOCUS_07530 21656 21408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 >Feature sequence025 <1 1169 gene locus_tag LOCUS_07540 <1 1169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203976.1:FtsH protease activity modulator HflK 1170 2048 gene locus_tag LOCUS_07550 gene hflC 1170 2048 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106429.1 protein_id gnl|my_center|LOCUS_07550 2110 3399 gene locus_tag LOCUS_07560 2110 3399 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095642.1 protein_id gnl|my_center|LOCUS_07560 3436 4929 gene locus_tag LOCUS_07570 gene gabD 3436 4929 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368063.1 protein_id gnl|my_center|LOCUS_07570 5158 5622 gene locus_tag LOCUS_07580 5158 5622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 6693 5782 gene locus_tag LOCUS_07590 gene hisG 6693 5782 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937425.1 protein_id gnl|my_center|LOCUS_07590 6811 7386 gene locus_tag LOCUS_07600 6811 7386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 8808 7405 gene locus_tag LOCUS_07610 gene pntB 8808 7405 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169667.1 protein_id gnl|my_center|LOCUS_07610 10346 8805 gene locus_tag LOCUS_07620 gene pntA 10346 8805 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302608.1 protein_id gnl|my_center|LOCUS_07620 10456 12648 gene locus_tag LOCUS_07630 gene rnr 10456 12648 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112282.1 protein_id gnl|my_center|LOCUS_07630 12681 14501 gene locus_tag LOCUS_07640 12681 14501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 14503 15285 gene locus_tag LOCUS_07650 gene rlmB 14503 15285 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620859.1 protein_id gnl|my_center|LOCUS_07650 16460 15270 gene locus_tag LOCUS_07660 gene msrB 16460 15270 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262910.1 protein_id gnl|my_center|LOCUS_07660 16550 17296 gene locus_tag LOCUS_07670 gene pdxJ 16550 17296 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101974.1 protein_id gnl|my_center|LOCUS_07670 17666 17286 gene locus_tag LOCUS_07680 17666 17286 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198835.1 protein_id gnl|my_center|LOCUS_07680 17773 19083 gene locus_tag LOCUS_07690 17773 19083 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109642.1 protein_id gnl|my_center|LOCUS_07690 19134 20873 gene locus_tag LOCUS_07700 gene recJ 19134 20873 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 protein_id gnl|my_center|LOCUS_07700 >Feature sequence026 799 197 gene locus_tag LOCUS_07710 gene nth 799 197 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096904.1 protein_id gnl|my_center|LOCUS_07710 1482 820 gene locus_tag LOCUS_07720 1482 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 1547 3187 gene locus_tag LOCUS_07730 1547 3187 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089209.1 protein_id gnl|my_center|LOCUS_07730 4236 3181 gene locus_tag LOCUS_07740 4236 3181 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092092.1 protein_id gnl|my_center|LOCUS_07740 5897 4236 gene locus_tag LOCUS_07750 5897 4236 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388526.1 protein_id gnl|my_center|LOCUS_07750 6943 5894 gene locus_tag LOCUS_07760 6943 5894 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974534.1 protein_id gnl|my_center|LOCUS_07760 7180 8895 gene locus_tag LOCUS_07770 gene argS 7180 8895 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958595.1 protein_id gnl|my_center|LOCUS_07770 8895 9458 gene locus_tag LOCUS_07780 8895 9458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 9463 10413 gene locus_tag LOCUS_07790 gene hemC 9463 10413 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099264.1 protein_id gnl|my_center|LOCUS_07790 10394 11203 gene locus_tag LOCUS_07800 10394 11203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 11235 12410 gene locus_tag LOCUS_07810 11235 12410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 12407 13645 gene locus_tag LOCUS_07820 12407 13645 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096390.1 protein_id gnl|my_center|LOCUS_07820 13719 14504 gene locus_tag LOCUS_07830 13719 14504 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614886.1 protein_id gnl|my_center|LOCUS_07830 15037 14501 gene locus_tag LOCUS_07840 15037 14501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 16088 15024 gene locus_tag LOCUS_07850 16088 15024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 17073 16180 gene locus_tag LOCUS_07860 gene argF 17073 16180 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206994.1 protein_id gnl|my_center|LOCUS_07860 17161 18396 gene locus_tag LOCUS_07870 17161 18396 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_07870 18403 19131 gene locus_tag LOCUS_07880 18403 19131 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118717.1 protein_id gnl|my_center|LOCUS_07880 19136 19801 gene locus_tag LOCUS_07890 19136 19801 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029005.1 protein_id gnl|my_center|LOCUS_07890 19798 20757 gene locus_tag LOCUS_07900 19798 20757 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114803.1 protein_id gnl|my_center|LOCUS_07900 >Feature sequence027 1913 1302 gene locus_tag LOCUS_07910 gene yihA 1913 1302 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958433.1 protein_id gnl|my_center|LOCUS_07910 1994 2587 gene locus_tag LOCUS_07920 1994 2587 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_07920 3521 2604 gene locus_tag LOCUS_07930 gene folD 3521 2604 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338398.1 protein_id gnl|my_center|LOCUS_07930 3587 4540 gene locus_tag LOCUS_07940 gene fabD 3587 4540 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245314.1 protein_id gnl|my_center|LOCUS_07940 5601 4537 gene locus_tag LOCUS_07950 gene bmt 5601 4537 CDS product betaine--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240571.1 protein_id gnl|my_center|LOCUS_07950 5747 6877 gene locus_tag LOCUS_07960 5747 6877 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390215.1 protein_id gnl|my_center|LOCUS_07960 7357 6887 gene locus_tag LOCUS_07970 7357 6887 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530371.1 protein_id gnl|my_center|LOCUS_07970 7468 7917 gene locus_tag LOCUS_07980 7468 7917 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945508.1 protein_id gnl|my_center|LOCUS_07980 7923 8744 gene locus_tag LOCUS_07990 7923 8744 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727762.1 protein_id gnl|my_center|LOCUS_07990 8755 9894 gene locus_tag LOCUS_08000 gene leuB 8755 9894 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081326.1 protein_id gnl|my_center|LOCUS_08000 9904 11343 gene locus_tag LOCUS_08010 9904 11343 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459012.1 protein_id gnl|my_center|LOCUS_08010 12470 11340 gene locus_tag LOCUS_08020 12470 11340 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969965.1 protein_id gnl|my_center|LOCUS_08020 13729 12554 gene locus_tag LOCUS_08030 13729 12554 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224609.1 protein_id gnl|my_center|LOCUS_08030 14481 13726 gene locus_tag LOCUS_08040 gene rluB 14481 13726 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291204.1 protein_id gnl|my_center|LOCUS_08040 15098 14478 gene locus_tag LOCUS_08050 15098 14478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 15943 15101 gene locus_tag LOCUS_08060 15943 15101 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396554.1 protein_id gnl|my_center|LOCUS_08060 17164 15950 gene locus_tag LOCUS_08070 17164 15950 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191887.1 protein_id gnl|my_center|LOCUS_08070 17781 17161 gene locus_tag LOCUS_08080 17781 17161 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091486.1 protein_id gnl|my_center|LOCUS_08080 19149 17827 gene locus_tag LOCUS_08090 19149 17827 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095142.1 protein_id gnl|my_center|LOCUS_08090 19219 19291 gene locus_tag LOCUS_t00150 19219 19291 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 19390 19950 gene locus_tag LOCUS_08100 19390 19950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 >Feature sequence028 2358 1168 gene locus_tag LOCUS_08110 2358 1168 CDS product 2-phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350737.1 protein_id gnl|my_center|LOCUS_08110 3671 2409 gene locus_tag LOCUS_08120 3671 2409 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704054.1 protein_id gnl|my_center|LOCUS_08120 5882 3717 gene locus_tag LOCUS_08130 5882 3717 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038548.1 protein_id gnl|my_center|LOCUS_08130 8583 5956 gene locus_tag LOCUS_08140 8583 5956 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310719.1 protein_id gnl|my_center|LOCUS_08140 9092 8622 gene locus_tag LOCUS_08150 9092 8622 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061534.1 protein_id gnl|my_center|LOCUS_08150 9157 10614 gene locus_tag LOCUS_08160 gene guaB 9157 10614 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812368.1 protein_id gnl|my_center|LOCUS_08160 10672 12249 gene locus_tag LOCUS_08170 gene guaA 10672 12249 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037329.1 protein_id gnl|my_center|LOCUS_08170 12240 12698 gene locus_tag LOCUS_08180 gene tadA 12240 12698 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810985.1 protein_id gnl|my_center|LOCUS_08180 12791 13603 gene locus_tag LOCUS_08190 12791 13603 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024325363.1 protein_id gnl|my_center|LOCUS_08190 13761 14858 gene locus_tag LOCUS_08200 gene spuE 13761 14858 CDS product spermidine-binding protein SpuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084301.1 protein_id gnl|my_center|LOCUS_08200 14870 16033 gene locus_tag LOCUS_08210 14870 16033 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530249.1 protein_id gnl|my_center|LOCUS_08210 16033 17058 gene locus_tag LOCUS_08220 16033 17058 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388771.1 protein_id gnl|my_center|LOCUS_08220 17055 17885 gene locus_tag LOCUS_08230 17055 17885 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388770.1 protein_id gnl|my_center|LOCUS_08230 19094 17925 gene locus_tag LOCUS_08240 19094 17925 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920958.1 protein_id gnl|my_center|LOCUS_08240 <19747 19176 gene locus_tag LOCUS_08250 <19747 19176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267129.1:lipid A biosynthesis lauroyl acyltransferase >Feature sequence029 <1 2197 gene locus_tag LOCUS_08260 <1 2197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003095847.1:primosomal protein N' 2204 3247 gene locus_tag LOCUS_08270 gene pyrC 2204 3247 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 protein_id gnl|my_center|LOCUS_08270 5193 3253 gene locus_tag LOCUS_08280 5193 3253 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098131.1 protein_id gnl|my_center|LOCUS_08280 5336 5259 gene locus_tag LOCUS_t00160 5336 5259 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5417 5342 gene locus_tag LOCUS_t00170 5417 5342 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5754 5464 gene locus_tag LOCUS_08290 5754 5464 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357604.1 protein_id gnl|my_center|LOCUS_08290 8435 5991 gene locus_tag LOCUS_08300 gene lon 8435 5991 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071918.1 protein_id gnl|my_center|LOCUS_08300 9891 8578 gene locus_tag LOCUS_08310 gene clpX 9891 8578 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087924.1 protein_id gnl|my_center|LOCUS_08310 10558 9935 gene locus_tag LOCUS_08320 gene clpP 10558 9935 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418252.1 protein_id gnl|my_center|LOCUS_08320 11898 10555 gene locus_tag LOCUS_08330 gene tig 11898 10555 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267215.1 protein_id gnl|my_center|LOCUS_08330 12004 11920 gene locus_tag LOCUS_t00180 12004 11920 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12097 12021 gene locus_tag LOCUS_t00190 12097 12021 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 12206 12131 gene locus_tag LOCUS_t00200 12206 12131 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 12825 12748 gene locus_tag LOCUS_t00210 12825 12748 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 12925 14970 gene locus_tag LOCUS_08340 12925 14970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 15138 15237 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15381 17054 gene locus_tag LOCUS_08350 gene htpG 15381 17054 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026051156.1 protein_id gnl|my_center|LOCUS_08350 17093 17545 gene locus_tag LOCUS_08360 17093 17545 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243288.1 protein_id gnl|my_center|LOCUS_08360 17578 18813 gene locus_tag LOCUS_08370 17578 18813 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105667.1 protein_id gnl|my_center|LOCUS_08370 >Feature sequence030 1922 114 gene locus_tag LOCUS_08380 1922 114 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113630057.1 protein_id gnl|my_center|LOCUS_08380 3303 2041 gene locus_tag LOCUS_08390 3303 2041 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528423.1 protein_id gnl|my_center|LOCUS_08390 4801 3296 gene locus_tag LOCUS_08400 4801 3296 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000463030.1 protein_id gnl|my_center|LOCUS_08400 5515 4817 gene locus_tag LOCUS_08410 5515 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 6592 5561 gene locus_tag LOCUS_08420 6592 5561 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818532.1 protein_id gnl|my_center|LOCUS_08420 6707 8221 gene locus_tag LOCUS_08430 6707 8221 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458967.1 protein_id gnl|my_center|LOCUS_08430 8208 9755 gene locus_tag LOCUS_08440 8208 9755 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393478.1 protein_id gnl|my_center|LOCUS_08440 10993 9764 gene locus_tag LOCUS_08450 10993 9764 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532282.1 protein_id gnl|my_center|LOCUS_08450 11335 11045 gene locus_tag LOCUS_08460 11335 11045 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771921.1 protein_id gnl|my_center|LOCUS_08460 13763 11325 gene locus_tag LOCUS_08470 gene clpA 13763 11325 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317954.1 protein_id gnl|my_center|LOCUS_08470 14102 13779 gene locus_tag LOCUS_08480 gene clpS 14102 13779 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640501.1 protein_id gnl|my_center|LOCUS_08480 14474 14103 gene locus_tag LOCUS_08490 14474 14103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 <19432 14546 gene locus_tag LOCUS_08500 <19432 14546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941413.1:fibronectin type III domain-containing protein >Feature sequence031 1273 440 gene locus_tag LOCUS_08510 1273 440 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089546.1 protein_id gnl|my_center|LOCUS_08510 2930 1275 gene locus_tag LOCUS_08520 2930 1275 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399307.1 protein_id gnl|my_center|LOCUS_08520 3084 4304 gene locus_tag LOCUS_08530 3084 4304 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_08530 4313 4735 gene locus_tag LOCUS_08540 4313 4735 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_08540 5655 4732 gene locus_tag LOCUS_08550 5655 4732 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556463.1 protein_id gnl|my_center|LOCUS_08550 6092 5784 gene locus_tag LOCUS_08560 6092 5784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 6196 7035 gene locus_tag LOCUS_08570 6196 7035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 7098 7973 gene locus_tag LOCUS_08580 7098 7973 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436920.1 protein_id gnl|my_center|LOCUS_08580 9214 7970 gene locus_tag LOCUS_08590 9214 7970 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401363.1 protein_id gnl|my_center|LOCUS_08590 9591 9211 gene locus_tag LOCUS_08600 9591 9211 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009455671.1 protein_id gnl|my_center|LOCUS_08600 10430 9642 gene locus_tag LOCUS_08610 10430 9642 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070532.1 protein_id gnl|my_center|LOCUS_08610 10512 11741 gene locus_tag LOCUS_08620 10512 11741 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073991.1 protein_id gnl|my_center|LOCUS_08620 11872 12765 gene locus_tag LOCUS_08630 11872 12765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 12785 13477 gene locus_tag LOCUS_08640 12785 13477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 13474 14301 gene locus_tag LOCUS_08650 13474 14301 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407632.1 protein_id gnl|my_center|LOCUS_08650 14430 15692 gene locus_tag LOCUS_08660 14430 15692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 15751 17151 gene locus_tag LOCUS_08670 15751 17151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 17316 19007 gene locus_tag LOCUS_08680 17316 19007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 >Feature sequence032 1704 1 gene locus_tag LOCUS_08690 1704 1 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085104.1 protein_id gnl|my_center|LOCUS_08690 3567 1795 gene locus_tag LOCUS_08700 3567 1795 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968009.1 protein_id gnl|my_center|LOCUS_08700 4492 3602 gene locus_tag LOCUS_08710 4492 3602 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113950.1 protein_id gnl|my_center|LOCUS_08710 5007 4525 gene locus_tag LOCUS_08720 gene greA 5007 4525 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688476.1 protein_id gnl|my_center|LOCUS_08720 8297 5004 gene locus_tag LOCUS_08730 gene carB 8297 5004 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095207.1 protein_id gnl|my_center|LOCUS_08730 9513 8290 gene locus_tag LOCUS_08740 gene carA 9513 8290 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037011.1 protein_id gnl|my_center|LOCUS_08740 9616 11040 gene locus_tag LOCUS_08750 9616 11040 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103740.1 protein_id gnl|my_center|LOCUS_08750 11114 12337 gene locus_tag LOCUS_08760 11114 12337 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172709.1 protein_id gnl|my_center|LOCUS_08760 12432 13364 gene locus_tag LOCUS_08770 12432 13364 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 protein_id gnl|my_center|LOCUS_08770 13361 14320 gene locus_tag LOCUS_08780 13361 14320 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 protein_id gnl|my_center|LOCUS_08780 14317 15057 gene locus_tag LOCUS_08790 14317 15057 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083886.1 protein_id gnl|my_center|LOCUS_08790 15068 15772 gene locus_tag LOCUS_08800 15068 15772 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 protein_id gnl|my_center|LOCUS_08800 16594 15782 gene locus_tag LOCUS_08810 gene dapB 16594 15782 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400159.1 protein_id gnl|my_center|LOCUS_08810 16799 18481 gene locus_tag LOCUS_08820 16799 18481 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092366.1 protein_id gnl|my_center|LOCUS_08820 >Feature sequence033 802 3066 gene locus_tag LOCUS_08830 802 3066 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039135.1 protein_id gnl|my_center|LOCUS_08830 3063 4355 gene locus_tag LOCUS_08840 3063 4355 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444876.1 protein_id gnl|my_center|LOCUS_08840 4368 4616 gene locus_tag LOCUS_08850 4368 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 4620 6428 gene locus_tag LOCUS_08860 gene lepA 4620 6428 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193305.1 protein_id gnl|my_center|LOCUS_08860 6428 7228 gene locus_tag LOCUS_08870 gene lepB 6428 7228 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065098.1 protein_id gnl|my_center|LOCUS_08870 7230 7925 gene locus_tag LOCUS_08880 gene rnc 7230 7925 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172746.1 protein_id gnl|my_center|LOCUS_08880 7925 8821 gene locus_tag LOCUS_08890 gene era 7925 8821 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036468.1 protein_id gnl|my_center|LOCUS_08890 8824 9576 gene locus_tag LOCUS_08900 gene recO 8824 9576 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772032.1 protein_id gnl|my_center|LOCUS_08900 9601 12531 gene locus_tag LOCUS_08910 9601 12531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 14527 13100 gene locus_tag LOCUS_08920 gene lpdA 14527 13100 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086503.1 protein_id gnl|my_center|LOCUS_08920 16198 14543 gene locus_tag LOCUS_08930 gene aceF 16198 14543 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063727.1 protein_id gnl|my_center|LOCUS_08930 18871 16199 gene locus_tag LOCUS_08940 gene aceE 18871 16199 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114556.1 protein_id gnl|my_center|LOCUS_08940 >Feature sequence034 281 1180 gene locus_tag LOCUS_08950 281 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08950 1281 2069 gene locus_tag LOCUS_08960 1281 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 2297 2863 gene locus_tag LOCUS_08970 2297 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 2863 3093 gene locus_tag LOCUS_08980 gene rpsR 2863 3093 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095634.1 protein_id gnl|my_center|LOCUS_08980 3105 3683 gene locus_tag LOCUS_08990 gene rplI 3105 3683 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480442.1 protein_id gnl|my_center|LOCUS_08990 3789 5177 gene locus_tag LOCUS_09000 3789 5177 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192724.1 protein_id gnl|my_center|LOCUS_09000 5208 6332 gene locus_tag LOCUS_09010 gene alr 5208 6332 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112284.1 protein_id gnl|my_center|LOCUS_09010 6325 7695 gene locus_tag LOCUS_09020 gene radA 6325 7695 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555235.1 protein_id gnl|my_center|LOCUS_09020 7926 7747 gene locus_tag LOCUS_09030 7926 7747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 7963 8298 gene locus_tag LOCUS_09040 7963 8298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 8724 9344 gene locus_tag LOCUS_09050 8724 9344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 10265 9354 gene locus_tag LOCUS_09060 10265 9354 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061850.1 protein_id gnl|my_center|LOCUS_09060 11107 10265 gene locus_tag LOCUS_09070 gene dapD 11107 10265 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186650.1 protein_id gnl|my_center|LOCUS_09070 11303 12274 gene locus_tag LOCUS_09080 11303 12274 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455166.1 protein_id gnl|my_center|LOCUS_09080 12178 12627 gene locus_tag LOCUS_09090 12178 12627 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859143.1 protein_id gnl|my_center|LOCUS_09090 12648 13205 gene locus_tag LOCUS_09100 12648 13205 CDS product Panacea domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703843.1 protein_id gnl|my_center|LOCUS_09100 13261 13602 gene locus_tag LOCUS_09110 13261 13602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 14439 13627 gene locus_tag LOCUS_09120 14439 13627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 14897 14436 gene locus_tag LOCUS_09130 14897 14436 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705303.1 protein_id gnl|my_center|LOCUS_09130 15427 14894 gene locus_tag LOCUS_09140 15427 14894 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039916.1 protein_id gnl|my_center|LOCUS_09140 17385 15424 gene locus_tag LOCUS_09150 17385 15424 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114291.1 protein_id gnl|my_center|LOCUS_09150 17844 17407 gene locus_tag LOCUS_09160 17844 17407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 17978 17844 gene locus_tag LOCUS_09170 17978 17844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 18753 17989 gene locus_tag LOCUS_09180 18753 17989 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420296.1 protein_id gnl|my_center|LOCUS_09180 >Feature sequence035 127 1179 gene locus_tag LOCUS_09190 127 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 1176 2297 gene locus_tag LOCUS_09200 1176 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 2282 3634 gene locus_tag LOCUS_09210 gene eno 2282 3634 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092364.1 protein_id gnl|my_center|LOCUS_09210 3631 3915 gene locus_tag LOCUS_09220 gene ftsB 3631 3915 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420699.1 protein_id gnl|my_center|LOCUS_09220 6069 3928 gene locus_tag LOCUS_09230 6069 3928 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022388.1 protein_id gnl|my_center|LOCUS_09230 6560 6186 gene locus_tag LOCUS_09240 6560 6186 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943630.1 protein_id gnl|my_center|LOCUS_09240 7558 6557 gene locus_tag LOCUS_09250 gene hemH 7558 6557 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925680.1 protein_id gnl|my_center|LOCUS_09250 8745 7546 gene locus_tag LOCUS_09260 8745 7546 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531195.1 protein_id gnl|my_center|LOCUS_09260 10887 8773 gene locus_tag LOCUS_09270 10887 8773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 11978 10890 gene locus_tag LOCUS_09280 gene ychF 11978 10890 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225667.1 protein_id gnl|my_center|LOCUS_09280 12598 11978 gene locus_tag LOCUS_09290 gene pth 12598 11978 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221185.1 protein_id gnl|my_center|LOCUS_09290 13317 12625 gene locus_tag LOCUS_09300 13317 12625 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770208.1 protein_id gnl|my_center|LOCUS_09300 14286 13336 gene locus_tag LOCUS_09310 14286 13336 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931310.1 protein_id gnl|my_center|LOCUS_09310 14396 14320 gene locus_tag LOCUS_t00220 14396 14320 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 14545 15510 gene locus_tag LOCUS_09320 gene speB 14545 15510 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525503.1 protein_id gnl|my_center|LOCUS_09320 15874 15515 gene locus_tag LOCUS_09330 15874 15515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 15922 16021 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17173 16529 gene locus_tag LOCUS_09340 gene lolB 17173 16529 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365627.1 protein_id gnl|my_center|LOCUS_09340 <18282 17173 gene locus_tag LOCUS_09350 <18282 17173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103429.1:tetratricopeptide repeat protein >Feature sequence036 269 850 gene locus_tag LOCUS_09360 269 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 1113 838 gene locus_tag LOCUS_09370 gene yccX 1113 838 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414772.1 protein_id gnl|my_center|LOCUS_09370 2171 1110 gene locus_tag LOCUS_09380 2171 1110 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 protein_id gnl|my_center|LOCUS_09380 3480 2251 gene locus_tag LOCUS_09390 gene hemL 3480 2251 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704436.1 protein_id gnl|my_center|LOCUS_09390 3502 3601 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5103 3838 gene locus_tag LOCUS_09400 gene rho 5103 3838 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096334.1 protein_id gnl|my_center|LOCUS_09400 5688 5350 gene locus_tag LOCUS_09410 gene trxA 5688 5350 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 protein_id gnl|my_center|LOCUS_09410 5856 7256 gene locus_tag LOCUS_09420 gene rhlB 5856 7256 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704129.1 protein_id gnl|my_center|LOCUS_09420 8131 7253 gene locus_tag LOCUS_09430 gene xerD 8131 7253 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092629.1 protein_id gnl|my_center|LOCUS_09430 9884 8124 gene locus_tag LOCUS_09440 9884 8124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 10308 9958 gene locus_tag LOCUS_09450 gene rplS 10308 9958 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005313505.1 protein_id gnl|my_center|LOCUS_09450 11054 10305 gene locus_tag LOCUS_09460 gene trmD 11054 10305 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469802.1 protein_id gnl|my_center|LOCUS_09460 11659 11081 gene locus_tag LOCUS_09470 gene rimM 11659 11081 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703198.1 protein_id gnl|my_center|LOCUS_09470 12083 11622 gene locus_tag LOCUS_09480 12083 11622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 12677 12213 gene locus_tag LOCUS_09490 12677 12213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 12765 14057 gene locus_tag LOCUS_09500 gene xseA 12765 14057 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705853.1 protein_id gnl|my_center|LOCUS_09500 15447 14086 gene locus_tag LOCUS_09510 gene der 15447 14086 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192452.1 protein_id gnl|my_center|LOCUS_09510 16688 15483 gene locus_tag LOCUS_09520 gene bamB 16688 15483 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771013.1 protein_id gnl|my_center|LOCUS_09520 17410 16688 gene locus_tag LOCUS_09530 17410 16688 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770804.1 protein_id gnl|my_center|LOCUS_09530 <18064 17417 gene locus_tag LOCUS_09540 <18064 17417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023995843.1:histidine--tRNA ligase >Feature sequence037 1046 234 gene locus_tag LOCUS_09550 gene mutM 1046 234 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039216.1 protein_id gnl|my_center|LOCUS_09550 1045 2109 gene locus_tag LOCUS_09560 1045 2109 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_09560 2106 2711 gene locus_tag LOCUS_09570 gene wrbA 2106 2711 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381567.1 protein_id gnl|my_center|LOCUS_09570 3369 2695 gene locus_tag LOCUS_09580 gene hda 3369 2695 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958403.1 protein_id gnl|my_center|LOCUS_09580 3932 3366 gene locus_tag LOCUS_09590 3932 3366 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532444.1 protein_id gnl|my_center|LOCUS_09590 4666 3965 gene locus_tag LOCUS_09600 4666 3965 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640231.1 protein_id gnl|my_center|LOCUS_09600 4870 5892 gene locus_tag LOCUS_09610 gene purM 4870 5892 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194386.1 protein_id gnl|my_center|LOCUS_09610 5883 6527 gene locus_tag LOCUS_09620 gene purN 5883 6527 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112584.1 protein_id gnl|my_center|LOCUS_09620 6524 7216 gene locus_tag LOCUS_09630 6524 7216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 7242 7670 gene locus_tag LOCUS_09640 7242 7670 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283762.1 protein_id gnl|my_center|LOCUS_09640 7690 8610 gene locus_tag LOCUS_09650 7690 8610 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666552.1 protein_id gnl|my_center|LOCUS_09650 8607 9380 gene locus_tag LOCUS_09660 8607 9380 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304632.1 protein_id gnl|my_center|LOCUS_09660 11115 9385 gene locus_tag LOCUS_09670 gene ptsP 11115 9385 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816751.1 protein_id gnl|my_center|LOCUS_09670 11420 11118 gene locus_tag LOCUS_09680 11420 11118 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468661.1 protein_id gnl|my_center|LOCUS_09680 12280 11417 gene locus_tag LOCUS_09690 gene rapZ 12280 11417 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369491.1 protein_id gnl|my_center|LOCUS_09690 12801 12277 gene locus_tag LOCUS_09700 gene ptsN 12801 12277 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222750.1 protein_id gnl|my_center|LOCUS_09700 13091 12798 gene locus_tag LOCUS_09710 gene raiA 13091 12798 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815178.1 protein_id gnl|my_center|LOCUS_09710 13938 13174 gene locus_tag LOCUS_09720 gene lptB 13938 13174 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942533.1 protein_id gnl|my_center|LOCUS_09720 14443 13922 gene locus_tag LOCUS_09730 14443 13922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 14862 14440 gene locus_tag LOCUS_09740 14862 14440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 15875 14886 gene locus_tag LOCUS_09750 15875 14886 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037924.1 protein_id gnl|my_center|LOCUS_09750 16020 16331 gene locus_tag LOCUS_09760 16020 16331 CDS product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970194.1 protein_id gnl|my_center|LOCUS_09760 16643 16383 gene locus_tag LOCUS_09770 16643 16383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 16909 16655 gene locus_tag LOCUS_09780 16909 16655 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022122.1 protein_id gnl|my_center|LOCUS_09780 17094 16906 gene locus_tag LOCUS_09790 17094 16906 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022121.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence038 362 147 gene locus_tag LOCUS_09800 362 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 392 640 gene locus_tag LOCUS_09810 392 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 1446 598 gene locus_tag LOCUS_09820 1446 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 2333 1434 gene locus_tag LOCUS_09830 2333 1434 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875830.1 protein_id gnl|my_center|LOCUS_09830 3963 2419 gene locus_tag LOCUS_09840 3963 2419 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731465.1 protein_id gnl|my_center|LOCUS_09840 4248 4910 gene locus_tag LOCUS_09850 4248 4910 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384632.1 protein_id gnl|my_center|LOCUS_09850 4941 6131 gene locus_tag LOCUS_09860 4941 6131 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243520.1 protein_id gnl|my_center|LOCUS_09860 6161 7384 gene locus_tag LOCUS_09870 6161 7384 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190136.1 protein_id gnl|my_center|LOCUS_09870 7592 7407 gene locus_tag LOCUS_09880 7592 7407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 7871 7608 gene locus_tag LOCUS_09890 7871 7608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 8002 9501 gene locus_tag LOCUS_09900 8002 9501 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973074.1 protein_id gnl|my_center|LOCUS_09900 9514 11511 gene locus_tag LOCUS_09910 9514 11511 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204428.1 protein_id gnl|my_center|LOCUS_09910 11508 12380 gene locus_tag LOCUS_09920 11508 12380 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267708.1 protein_id gnl|my_center|LOCUS_09920 12384 12965 gene locus_tag LOCUS_09930 12384 12965 CDS product DUF2889 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391492.1 protein_id gnl|my_center|LOCUS_09930 12973 13072 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13668 13213 gene locus_tag LOCUS_09940 13668 13213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 <17467 13768 gene locus_tag LOCUS_09950 <17467 13768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921648.1:YDG domain-containing protein >Feature sequence039 1759 344 gene locus_tag LOCUS_09960 gene gltX 1759 344 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026051153.1 protein_id gnl|my_center|LOCUS_09960 1877 1801 gene locus_tag LOCUS_t00230 1877 1801 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2290 1925 gene locus_tag LOCUS_09970 2290 1925 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090655.1 protein_id gnl|my_center|LOCUS_09970 2651 2298 gene locus_tag LOCUS_09980 2651 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 5283 2866 gene locus_tag LOCUS_09990 gene pheT 5283 2866 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103972.1 protein_id gnl|my_center|LOCUS_09990 6327 5296 gene locus_tag LOCUS_10000 gene pheS 6327 5296 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114409.1 protein_id gnl|my_center|LOCUS_10000 6691 6329 gene locus_tag LOCUS_10010 gene rplT 6691 6329 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099086.1 protein_id gnl|my_center|LOCUS_10010 6945 6748 gene locus_tag LOCUS_10020 gene rpmI 6945 6748 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942164.1 protein_id gnl|my_center|LOCUS_10020 7636 7064 gene locus_tag LOCUS_10030 gene infC 7636 7064 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106936.1 protein_id gnl|my_center|LOCUS_10030 9609 7696 gene locus_tag LOCUS_10040 gene thrS 9609 7696 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211836.1 protein_id gnl|my_center|LOCUS_10040 9697 9621 gene locus_tag LOCUS_t00240 9697 9621 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 10356 12467 gene locus_tag LOCUS_10050 10356 12467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 13301 12495 gene locus_tag LOCUS_10060 13301 12495 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947138.1 protein_id gnl|my_center|LOCUS_10060 14311 13298 gene locus_tag LOCUS_10070 14311 13298 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943275.1 protein_id gnl|my_center|LOCUS_10070 17090 14331 gene locus_tag LOCUS_10080 gene fdhF 17090 14331 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence040 5026 5125 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5300 6577 gene locus_tag LOCUS_10090 gene hemW 5300 6577 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038356.1 protein_id gnl|my_center|LOCUS_10090 6718 6817 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8501 7113 gene locus_tag LOCUS_10100 gene pmbA 8501 7113 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037734.1 protein_id gnl|my_center|LOCUS_10100 9981 8515 gene locus_tag LOCUS_10110 gene tldD 9981 8515 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194084.1 protein_id gnl|my_center|LOCUS_10110 10891 10004 gene locus_tag LOCUS_10120 10891 10004 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194407.1 protein_id gnl|my_center|LOCUS_10120 10124 10041 gene locus_tag LOCUS_t00250 10124 10041 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 11874 11080 gene locus_tag LOCUS_10130 gene pgeF 11874 11080 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388401.1 protein_id gnl|my_center|LOCUS_10130 11948 12035 gene locus_tag LOCUS_t00260 11948 12035 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 13103 12171 gene locus_tag LOCUS_10140 gene ispH 13103 12171 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318785.1 protein_id gnl|my_center|LOCUS_10140 13635 13111 gene locus_tag LOCUS_10150 gene lspA 13635 13111 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112823.1 protein_id gnl|my_center|LOCUS_10150 14582 13632 gene locus_tag LOCUS_10160 14582 13632 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535897.1 protein_id gnl|my_center|LOCUS_10160 16154 14622 gene locus_tag LOCUS_10170 gene murJ 16154 14622 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704641.1 protein_id gnl|my_center|LOCUS_10170 >Feature sequence041 1 561 gene locus_tag LOCUS_10180 1 561 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532060.1 protein_id gnl|my_center|LOCUS_10180 1063 545 gene locus_tag LOCUS_10190 1063 545 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193471.1 protein_id gnl|my_center|LOCUS_10190 2042 1056 gene locus_tag LOCUS_10200 gene alc 2042 1056 CDS product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553942.1 protein_id gnl|my_center|LOCUS_10200 2962 2054 gene locus_tag LOCUS_10210 gene puuE 2962 2054 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920459.1 protein_id gnl|my_center|LOCUS_10210 4152 2959 gene locus_tag LOCUS_10220 4152 2959 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083321.1 protein_id gnl|my_center|LOCUS_10220 5160 4156 gene locus_tag LOCUS_10230 5160 4156 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388524.1 protein_id gnl|my_center|LOCUS_10230 6322 5234 gene locus_tag LOCUS_10240 6322 5234 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389655.1 protein_id gnl|my_center|LOCUS_10240 7306 6386 gene locus_tag LOCUS_10250 7306 6386 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389656.1 protein_id gnl|my_center|LOCUS_10250 8405 7329 gene locus_tag LOCUS_10260 8405 7329 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389657.1 protein_id gnl|my_center|LOCUS_10260 9891 8407 gene locus_tag LOCUS_10270 9891 8407 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389658.1 protein_id gnl|my_center|LOCUS_10270 10039 11406 gene locus_tag LOCUS_10280 10039 11406 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112635.1 protein_id gnl|my_center|LOCUS_10280 11436 13004 gene locus_tag LOCUS_10290 gene xdhA 11436 13004 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242244.1 protein_id gnl|my_center|LOCUS_10290 13047 15407 gene locus_tag LOCUS_10300 gene xdhB 13047 15407 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114679.1 protein_id gnl|my_center|LOCUS_10300 >Feature sequence042 1058 983 gene locus_tag LOCUS_t00270 1058 983 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1393 1118 gene locus_tag LOCUS_10310 1393 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 1868 1491 gene locus_tag LOCUS_10320 1868 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 2873 1959 gene locus_tag LOCUS_10330 2873 1959 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390154.1 protein_id gnl|my_center|LOCUS_10330 3601 2984 gene locus_tag LOCUS_10340 gene ampD 3601 2984 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707565.1 protein_id gnl|my_center|LOCUS_10340 4854 3598 gene locus_tag LOCUS_10350 4854 3598 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228155.1 protein_id gnl|my_center|LOCUS_10350 6413 4851 gene locus_tag LOCUS_10360 6413 4851 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_10360 6540 8714 gene locus_tag LOCUS_10370 gene ppk1 6540 8714 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943936.1 protein_id gnl|my_center|LOCUS_10370 <16101 8742 gene locus_tag LOCUS_10380 <16101 8742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257272.1:Calx-beta domain-containing protein 11268 11367 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence043 81 156 gene locus_tag LOCUS_t00280 81 156 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 224 520 gene locus_tag LOCUS_10390 224 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 526 1113 gene locus_tag LOCUS_10400 gene nusG 526 1113 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317113.1 protein_id gnl|my_center|LOCUS_10400 1123 1596 gene locus_tag LOCUS_10410 gene rplK 1123 1596 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690112.1 protein_id gnl|my_center|LOCUS_10410 1593 2288 gene locus_tag LOCUS_10420 gene rplA 1593 2288 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185135.1 protein_id gnl|my_center|LOCUS_10420 2303 2857 gene locus_tag LOCUS_10430 gene rplJ 2303 2857 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806888.1 protein_id gnl|my_center|LOCUS_10430 2919 3299 gene locus_tag LOCUS_10440 gene rplL 2919 3299 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038645.1 protein_id gnl|my_center|LOCUS_10440 3408 7547 gene locus_tag LOCUS_10450 gene rpoB 3408 7547 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946073.1 protein_id gnl|my_center|LOCUS_10450 7547 12226 gene locus_tag LOCUS_10460 7547 12226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 12507 12881 gene locus_tag LOCUS_10470 gene rpsL 12507 12881 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399892.1 protein_id gnl|my_center|LOCUS_10470 12916 13368 gene locus_tag LOCUS_10480 gene rpsG 12916 13368 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093742.1 protein_id gnl|my_center|LOCUS_10480 13406 15499 gene locus_tag LOCUS_10490 gene fusA 13406 15499 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957451.1 protein_id gnl|my_center|LOCUS_10490 >Feature sequence044 1855 554 gene locus_tag LOCUS_10500 1855 554 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268988.1 protein_id gnl|my_center|LOCUS_10500 2937 1912 gene locus_tag LOCUS_10510 gene holA 2937 1912 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114330.1 protein_id gnl|my_center|LOCUS_10510 3452 2937 gene locus_tag LOCUS_10520 gene lptE 3452 2937 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947077.1 protein_id gnl|my_center|LOCUS_10520 5969 3456 gene locus_tag LOCUS_10530 gene leuS 5969 3456 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957661.1 protein_id gnl|my_center|LOCUS_10530 6044 7912 gene locus_tag LOCUS_10540 gene dnaG 6044 7912 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918829.1 protein_id gnl|my_center|LOCUS_10540 8081 10000 gene locus_tag LOCUS_10550 gene rpoD 8081 10000 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453778.1 protein_id gnl|my_center|LOCUS_10550 10622 10044 gene locus_tag LOCUS_10560 10622 10044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 10753 11646 gene locus_tag LOCUS_10570 10753 11646 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091343.1 protein_id gnl|my_center|LOCUS_10570 11643 13466 gene locus_tag LOCUS_10580 gene recN 11643 13466 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879555.1 protein_id gnl|my_center|LOCUS_10580 13463 13963 gene locus_tag LOCUS_10590 13463 13963 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686683.1 protein_id gnl|my_center|LOCUS_10590 13960 14307 gene locus_tag LOCUS_10600 13960 14307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 14827 14333 gene locus_tag LOCUS_10610 14827 14333 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189237.1 protein_id gnl|my_center|LOCUS_10610 >Feature sequence045 736 1275 gene locus_tag LOCUS_10620 gene fabA 736 1275 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087475.1 protein_id gnl|my_center|LOCUS_10620 1283 2530 gene locus_tag LOCUS_10630 gene fabB 1283 2530 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_10630 2527 3606 gene locus_tag LOCUS_10640 2527 3606 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087731.1 protein_id gnl|my_center|LOCUS_10640 4234 3584 gene locus_tag LOCUS_10650 gene coq7 4234 3584 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064484.1 protein_id gnl|my_center|LOCUS_10650 4278 5747 gene locus_tag LOCUS_10660 gene glcD 4278 5747 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268365.1 protein_id gnl|my_center|LOCUS_10660 5747 6826 gene locus_tag LOCUS_10670 gene glcE 5747 6826 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114371.1 protein_id gnl|my_center|LOCUS_10670 6826 8031 gene locus_tag LOCUS_10680 gene glcF 6826 8031 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114370.1 protein_id gnl|my_center|LOCUS_10680 8055 8369 gene locus_tag LOCUS_10690 8055 8369 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_10690 8379 9569 gene locus_tag LOCUS_10700 8379 9569 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404120.1 protein_id gnl|my_center|LOCUS_10700 9573 10394 gene locus_tag LOCUS_10710 9573 10394 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206650.1 protein_id gnl|my_center|LOCUS_10710 10444 10530 gene locus_tag LOCUS_t00290 10444 10530 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11072 10509 gene locus_tag LOCUS_10720 gene ogt 11072 10509 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211023.1 protein_id gnl|my_center|LOCUS_10720 12354 11080 gene locus_tag LOCUS_10730 12354 11080 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967039.1 protein_id gnl|my_center|LOCUS_10730 13480 12398 gene locus_tag LOCUS_10740 gene tgt 13480 12398 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073009.1 protein_id gnl|my_center|LOCUS_10740 <14486 13470 gene locus_tag LOCUS_10750 <14486 13470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930156.1:tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA >Feature sequence046 1165 20 gene locus_tag LOCUS_10760 gene rpoA 1165 20 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555464.1 protein_id gnl|my_center|LOCUS_10760 1827 1204 gene locus_tag LOCUS_10770 gene rpsD 1827 1204 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417269.1 protein_id gnl|my_center|LOCUS_10770 2235 1840 gene locus_tag LOCUS_10780 gene rpsK 2235 1840 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216249.1 protein_id gnl|my_center|LOCUS_10780 2604 2248 gene locus_tag LOCUS_10790 gene rpsM 2604 2248 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213346.1 protein_id gnl|my_center|LOCUS_10790 4098 2761 gene locus_tag LOCUS_10800 gene secY 4098 2761 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806926.1 protein_id gnl|my_center|LOCUS_10800 4196 4295 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4469 4882 gene locus_tag LOCUS_10810 4469 4882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 5033 4839 gene locus_tag LOCUS_10820 gene rpmD 5033 4839 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215447.1 protein_id gnl|my_center|LOCUS_10820 5550 5041 gene locus_tag LOCUS_10830 gene rpsE 5550 5041 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197945.1 protein_id gnl|my_center|LOCUS_10830 5990 5634 gene locus_tag LOCUS_10840 gene rplR 5990 5634 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197946.1 protein_id gnl|my_center|LOCUS_10840 6558 5995 gene locus_tag LOCUS_10850 gene rplF 6558 5995 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093699.1 protein_id gnl|my_center|LOCUS_10850 6979 6584 gene locus_tag LOCUS_10860 gene rpsH 6979 6584 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555475.1 protein_id gnl|my_center|LOCUS_10860 7334 7029 gene locus_tag LOCUS_10870 gene rpsN 7334 7029 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118926.1 protein_id gnl|my_center|LOCUS_10870 7873 7334 gene locus_tag LOCUS_10880 gene rplE 7873 7334 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768935.1 protein_id gnl|my_center|LOCUS_10880 8221 7877 gene locus_tag LOCUS_10890 gene rplX 8221 7877 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008571669.1 protein_id gnl|my_center|LOCUS_10890 8586 8218 gene locus_tag LOCUS_10900 gene rplN 8586 8218 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307975.1 protein_id gnl|my_center|LOCUS_10900 8891 8598 gene locus_tag LOCUS_10910 gene rpsQ 8891 8598 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417239.1 protein_id gnl|my_center|LOCUS_10910 9130 8888 gene locus_tag LOCUS_10920 gene rpmC 9130 8888 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771530.1 protein_id gnl|my_center|LOCUS_10920 9546 9133 gene locus_tag LOCUS_10930 gene rplP 9546 9133 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199857.1 protein_id gnl|my_center|LOCUS_10930 10327 9554 gene locus_tag LOCUS_10940 gene rpsC 10327 9554 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221644.1 protein_id gnl|my_center|LOCUS_10940 10714 10334 gene locus_tag LOCUS_10950 gene rplV 10714 10334 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083595.1 protein_id gnl|my_center|LOCUS_10950 10989 10717 gene locus_tag LOCUS_10960 gene rpsS 10989 10717 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138119.1 protein_id gnl|my_center|LOCUS_10960 11813 10989 gene locus_tag LOCUS_10970 gene rplB 11813 10989 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070620.1 protein_id gnl|my_center|LOCUS_10970 12227 11832 gene locus_tag LOCUS_10980 12227 11832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 13780 12224 gene locus_tag LOCUS_10990 13780 12224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 12900 12999 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence047 <1 744 gene locus_tag LOCUS_11000 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013099255.1:DNA helicase II 808 1503 gene locus_tag LOCUS_11010 gene pdsR 808 1503 CDS product proteobacterial dedicated sortase system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072225.1 protein_id gnl|my_center|LOCUS_11010 1508 3673 gene locus_tag LOCUS_11020 gene pdsS 1508 3673 CDS product proteobacterial dedicated sortase system histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072224.1 protein_id gnl|my_center|LOCUS_11020 4011 3691 gene locus_tag LOCUS_11030 4011 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 4090 6825 gene locus_tag LOCUS_11040 gene polA 4090 6825 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250006.1 protein_id gnl|my_center|LOCUS_11040 6932 8017 gene locus_tag LOCUS_11050 gene cfa 6932 8017 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444610.1 protein_id gnl|my_center|LOCUS_11050 9687 8041 gene locus_tag LOCUS_11060 9687 8041 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974601.1 protein_id gnl|my_center|LOCUS_11060 10549 9677 gene locus_tag LOCUS_11070 10549 9677 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182307726.1 protein_id gnl|my_center|LOCUS_11070 11502 10546 gene locus_tag LOCUS_11080 11502 10546 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974599.1 protein_id gnl|my_center|LOCUS_11080 >Feature sequence048 <1 911 gene locus_tag LOCUS_11090 <1 911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530888.1:FAD-dependent oxidoreductase 912 1622 gene locus_tag LOCUS_11100 912 1622 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407919.1 protein_id gnl|my_center|LOCUS_11100 2362 1619 gene locus_tag LOCUS_11110 gene hisA 2362 1619 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970620.1 protein_id gnl|my_center|LOCUS_11110 3698 2442 gene locus_tag LOCUS_11120 3698 2442 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531197.1 protein_id gnl|my_center|LOCUS_11120 3719 3818 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7149 4117 gene locus_tag LOCUS_11130 7149 4117 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975932.1 protein_id gnl|my_center|LOCUS_11130 8214 7321 gene locus_tag LOCUS_11140 8214 7321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 8365 8207 gene locus_tag LOCUS_11150 8365 8207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 8967 8362 gene locus_tag LOCUS_11160 gene ccoO 8967 8362 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810383.1 protein_id gnl|my_center|LOCUS_11160 10445 8964 gene locus_tag LOCUS_11170 gene ccoN 10445 8964 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072351.1 protein_id gnl|my_center|LOCUS_11170 11065 10445 gene locus_tag LOCUS_11180 11065 10445 CDS product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082455.1 protein_id gnl|my_center|LOCUS_11180 12197 11091 gene locus_tag LOCUS_11190 gene nirK 12197 11091 CDS product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524994.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence049 2404 1853 gene locus_tag LOCUS_11200 2404 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 2554 2653 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5600 3309 gene locus_tag LOCUS_11210 5600 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 6394 5603 gene locus_tag LOCUS_11220 6394 5603 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_11220 6985 6524 gene locus_tag LOCUS_11230 6985 6524 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978225.1 protein_id gnl|my_center|LOCUS_11230 7805 6993 gene locus_tag LOCUS_11240 7805 6993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 8854 7805 gene locus_tag LOCUS_11250 8854 7805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 9044 8859 gene locus_tag LOCUS_11260 9044 8859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 9296 9748 gene locus_tag LOCUS_11270 9296 9748 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086091.1 protein_id gnl|my_center|LOCUS_11270 9834 10778 gene locus_tag LOCUS_11280 9834 10778 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528466.1 protein_id gnl|my_center|LOCUS_11280 11038 11715 gene locus_tag LOCUS_11290 11038 11715 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114053.1 protein_id gnl|my_center|LOCUS_11290 >Feature sequence050 896 177 gene locus_tag LOCUS_11300 896 177 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263187.1 protein_id gnl|my_center|LOCUS_11300 1099 899 gene locus_tag LOCUS_11310 1099 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 1985 1260 gene locus_tag LOCUS_11320 1985 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 3625 1982 gene locus_tag LOCUS_11330 gene atpA 3625 1982 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948668.1 protein_id gnl|my_center|LOCUS_11330 4244 3687 gene locus_tag LOCUS_11340 4244 3687 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097135.1 protein_id gnl|my_center|LOCUS_11340 4747 4244 gene locus_tag LOCUS_11350 4747 4244 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024691.1 protein_id gnl|my_center|LOCUS_11350 4986 4753 gene locus_tag LOCUS_11360 gene atpE 4986 4753 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307205.1 protein_id gnl|my_center|LOCUS_11360 5913 5020 gene locus_tag LOCUS_11370 gene atpB 5913 5020 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100237.1 protein_id gnl|my_center|LOCUS_11370 6373 5978 gene locus_tag LOCUS_11380 6373 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 6987 6388 gene locus_tag LOCUS_11390 6987 6388 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388415.1 protein_id gnl|my_center|LOCUS_11390 7888 7004 gene locus_tag LOCUS_11400 7888 7004 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_11400 8652 7888 gene locus_tag LOCUS_11410 8652 7888 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958543.1 protein_id gnl|my_center|LOCUS_11410 9329 8694 gene locus_tag LOCUS_11420 gene rsmG 9329 8694 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039110.1 protein_id gnl|my_center|LOCUS_11420 9452 10222 gene locus_tag LOCUS_11430 9452 10222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 11848 10223 gene locus_tag LOCUS_11440 gene pckA 11848 10223 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361659.1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence051 2059 728 gene locus_tag LOCUS_11450 gene rsmB 2059 728 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114643.1 protein_id gnl|my_center|LOCUS_11450 3012 2056 gene locus_tag LOCUS_11460 gene fmt 3012 2056 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114642.1 protein_id gnl|my_center|LOCUS_11460 3604 3029 gene locus_tag LOCUS_11470 gene def 3604 3029 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525852.1 protein_id gnl|my_center|LOCUS_11470 4263 4362 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4534 5022 gene locus_tag LOCUS_11480 4534 5022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 6960 5041 gene locus_tag LOCUS_11490 6960 5041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 7278 8510 gene locus_tag LOCUS_11500 7278 8510 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090554.1 protein_id gnl|my_center|LOCUS_11500 8536 9264 gene locus_tag LOCUS_11510 8536 9264 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531897.1 protein_id gnl|my_center|LOCUS_11510 9257 10138 gene locus_tag LOCUS_11520 gene pssA 9257 10138 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_11520 10377 11924 gene locus_tag LOCUS_11530 10377 11924 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522419.1 protein_id gnl|my_center|LOCUS_11530 11967 12692 gene locus_tag LOCUS_11540 11967 12692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11540 >Feature sequence052 <1 1412 gene locus_tag LOCUS_11550 <1 1412 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194180.1:adenylosuccinate lyase 1412 2497 gene locus_tag LOCUS_11560 1412 2497 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036961.1 protein_id gnl|my_center|LOCUS_11560 2494 3918 gene locus_tag LOCUS_11570 gene argH 2494 3918 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114030.1 protein_id gnl|my_center|LOCUS_11570 4044 5300 gene locus_tag LOCUS_11580 gene lysA 4044 5300 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384387.1 protein_id gnl|my_center|LOCUS_11580 6211 5309 gene locus_tag LOCUS_11590 6211 5309 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958093.1 protein_id gnl|my_center|LOCUS_11590 7062 6208 gene locus_tag LOCUS_11600 gene aroE 7062 6208 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194401.1 protein_id gnl|my_center|LOCUS_11600 7700 7059 gene locus_tag LOCUS_11610 7700 7059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 7805 9061 gene locus_tag LOCUS_11620 7805 9061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 9058 12192 gene locus_tag LOCUS_11630 9058 12192 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_11630 <12842 12182 gene locus_tag LOCUS_11640 <12842 12182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011817330.1:taurine dioxygenase >Feature sequence053 820 224 gene locus_tag LOCUS_11650 820 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 1081 1347 gene locus_tag LOCUS_11660 1081 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1369 2298 gene locus_tag LOCUS_11670 gene ispA 1369 2298 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488700.1 protein_id gnl|my_center|LOCUS_11670 2417 4321 gene locus_tag LOCUS_11680 gene dxs 2417 4321 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813105.1 protein_id gnl|my_center|LOCUS_11680 4353 5225 gene locus_tag LOCUS_11690 4353 5225 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529690.1 protein_id gnl|my_center|LOCUS_11690 5222 6352 gene locus_tag LOCUS_11700 5222 6352 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545276.1 protein_id gnl|my_center|LOCUS_11700 6418 7239 gene locus_tag LOCUS_11710 gene tpiA 6418 7239 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208959.1 protein_id gnl|my_center|LOCUS_11710 7273 7626 gene locus_tag LOCUS_11720 gene secG 7273 7626 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040273.1 protein_id gnl|my_center|LOCUS_11720 7643 7729 gene locus_tag LOCUS_t00300 7643 7729 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8953 7751 gene locus_tag LOCUS_11730 8953 7751 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528000.1 protein_id gnl|my_center|LOCUS_11730 9139 10062 gene locus_tag LOCUS_11740 9139 10062 CDS product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532649.1 protein_id gnl|my_center|LOCUS_11740 10062 11300 gene locus_tag LOCUS_11750 10062 11300 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811711.1 protein_id gnl|my_center|LOCUS_11750 >Feature sequence054 991 455 gene locus_tag LOCUS_11760 991 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 2213 981 gene locus_tag LOCUS_11770 2213 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 2364 4613 gene locus_tag LOCUS_11780 2364 4613 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968325.1 protein_id gnl|my_center|LOCUS_11780 6244 4622 gene locus_tag LOCUS_11790 6244 4622 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061789.1 protein_id gnl|my_center|LOCUS_11790 7346 6300 gene locus_tag LOCUS_11800 7346 6300 CDS product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061793.1 protein_id gnl|my_center|LOCUS_11800 7464 8666 gene locus_tag LOCUS_11810 7464 8666 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 protein_id gnl|my_center|LOCUS_11810 10111 8663 gene locus_tag LOCUS_11820 10111 8663 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337852.1 protein_id gnl|my_center|LOCUS_11820 11121 10108 gene locus_tag LOCUS_11830 11121 10108 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337851.1 protein_id gnl|my_center|LOCUS_11830 11826 11122 gene locus_tag LOCUS_11840 11826 11122 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 protein_id gnl|my_center|LOCUS_11840 12686 11823 gene locus_tag LOCUS_11850 12686 11823 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384138.1 protein_id gnl|my_center|LOCUS_11850 >Feature sequence055 1319 1418 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1654 2757 gene locus_tag LOCUS_11860 gene zapE 1654 2757 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766543.1 protein_id gnl|my_center|LOCUS_11860 2925 3365 gene locus_tag LOCUS_11870 2925 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 4493 3423 gene locus_tag LOCUS_11880 4493 3423 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083076.1 protein_id gnl|my_center|LOCUS_11880 5337 4495 gene locus_tag LOCUS_11890 5337 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384461.1 protein_id gnl|my_center|LOCUS_11890 6183 5374 gene locus_tag LOCUS_11900 6183 5374 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262664.1 protein_id gnl|my_center|LOCUS_11900 7416 6232 gene locus_tag LOCUS_11910 7416 6232 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064710.1 protein_id gnl|my_center|LOCUS_11910 7478 8269 gene locus_tag LOCUS_11920 7478 8269 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_11920 8284 9519 gene locus_tag LOCUS_11930 gene yjeH 8284 9519 CDS product L-methionine/branched-chain amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368666.1 protein_id gnl|my_center|LOCUS_11930 9555 10220 gene locus_tag LOCUS_11940 9555 10220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 10231 11526 gene locus_tag LOCUS_11950 10231 11526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 11811 11563 gene locus_tag LOCUS_11960 11811 11563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 >Feature sequence056 <1 582 gene locus_tag LOCUS_11970 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002216784.1:imidazoleglycerol-phosphate dehydratase HisB 595 1296 gene locus_tag LOCUS_11980 gene hisH 595 1296 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931644.1 protein_id gnl|my_center|LOCUS_11980 1298 2053 gene locus_tag LOCUS_11990 gene hisA 1298 2053 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106336.1 protein_id gnl|my_center|LOCUS_11990 2089 2856 gene locus_tag LOCUS_12000 gene hisF 2089 2856 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 protein_id gnl|my_center|LOCUS_12000 2853 3257 gene locus_tag LOCUS_12010 gene hisI 2853 3257 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095888.1 protein_id gnl|my_center|LOCUS_12010 3301 3543 gene locus_tag LOCUS_12020 3301 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 3574 4074 gene locus_tag LOCUS_12030 3574 4074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 4267 5022 gene locus_tag LOCUS_12040 gene tatC 4267 5022 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073887.1 protein_id gnl|my_center|LOCUS_12040 5015 6631 gene locus_tag LOCUS_12050 5015 6631 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211555.1 protein_id gnl|my_center|LOCUS_12050 7365 6655 gene locus_tag LOCUS_12060 7365 6655 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814165.1 protein_id gnl|my_center|LOCUS_12060 8252 7371 gene locus_tag LOCUS_12070 gene aat 8252 7371 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938894.1 protein_id gnl|my_center|LOCUS_12070 8236 9258 gene locus_tag LOCUS_12080 gene tsaD 8236 9258 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369630.1 protein_id gnl|my_center|LOCUS_12080 9913 9290 gene locus_tag LOCUS_12090 gene plsY 9913 9290 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522633.1 protein_id gnl|my_center|LOCUS_12090 10329 10428 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10458 10694 gene locus_tag LOCUS_12100 gene rpmB 10458 10694 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186391.1 protein_id gnl|my_center|LOCUS_12100 10719 10874 gene locus_tag LOCUS_12110 gene rpmG 10719 10874 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689824.1 protein_id gnl|my_center|LOCUS_12110 >Feature sequence057 4204 746 gene locus_tag LOCUS_12120 4204 746 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104408.1 protein_id gnl|my_center|LOCUS_12120 5343 4624 gene locus_tag LOCUS_12130 gene fetB 5343 4624 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937792.1 protein_id gnl|my_center|LOCUS_12130 6413 5343 gene locus_tag LOCUS_12140 6413 5343 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391184.1 protein_id gnl|my_center|LOCUS_12140 7180 6410 gene locus_tag LOCUS_12150 gene map 7180 6410 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947446.1 protein_id gnl|my_center|LOCUS_12150 7407 8624 gene locus_tag LOCUS_12160 7407 8624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 8638 9513 gene locus_tag LOCUS_12170 gene tsf 8638 9513 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947440.1 protein_id gnl|my_center|LOCUS_12170 9841 10431 gene locus_tag LOCUS_12180 9841 10431 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174153.1 protein_id gnl|my_center|LOCUS_12180 11798 10428 gene locus_tag LOCUS_12190 11798 10428 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930606.1 protein_id gnl|my_center|LOCUS_12190 >Feature sequence058 810 394 gene locus_tag LOCUS_12200 810 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1793 876 gene locus_tag LOCUS_12210 gene xerC 1793 876 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114345.1 protein_id gnl|my_center|LOCUS_12210 2473 2572 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2761 3066 gene locus_tag LOCUS_12220 2761 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 4379 3072 gene locus_tag LOCUS_12230 gene cptA 4379 3072 CDS product proteolytic complex protein CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_12230 5210 5309 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5326 5748 gene locus_tag LOCUS_12240 5326 5748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 5768 6298 gene locus_tag LOCUS_12250 5768 6298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 6328 8121 gene locus_tag LOCUS_12260 6328 8121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 8118 9788 gene locus_tag LOCUS_12270 8118 9788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 >Feature sequence059 1458 76 gene locus_tag LOCUS_12280 gene fumC 1458 76 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919970.1 protein_id gnl|my_center|LOCUS_12280 1481 2740 gene locus_tag LOCUS_12290 1481 2740 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529614.1 protein_id gnl|my_center|LOCUS_12290 2786 4576 gene locus_tag LOCUS_12300 gene kefB 2786 4576 CDS product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099039.1 protein_id gnl|my_center|LOCUS_12300 4973 4587 gene locus_tag LOCUS_12310 4973 4587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 5319 5969 gene locus_tag LOCUS_12320 5319 5969 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880077.1 protein_id gnl|my_center|LOCUS_12320 9651 5935 gene locus_tag LOCUS_12330 9651 5935 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930621.1 protein_id gnl|my_center|LOCUS_12330 11660 9648 gene locus_tag LOCUS_12340 11660 9648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 >Feature sequence060 7661 4626 gene locus_tag LOCUS_12350 7661 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 10889 7827 gene locus_tag LOCUS_12360 10889 7827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 <11748 10922 gene locus_tag LOCUS_12370 <11748 10922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070585.1:tandem-95 repeat protein >Feature sequence061 2989 170 gene locus_tag LOCUS_12380 2989 170 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946456.1 protein_id gnl|my_center|LOCUS_12380 3428 2991 gene locus_tag LOCUS_12390 gene holC 3428 2991 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100593.1 protein_id gnl|my_center|LOCUS_12390 4962 3460 gene locus_tag LOCUS_12400 4962 3460 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092867.1 protein_id gnl|my_center|LOCUS_12400 5139 6221 gene locus_tag LOCUS_12410 gene lptF 5139 6221 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071578.1 protein_id gnl|my_center|LOCUS_12410 6218 7285 gene locus_tag LOCUS_12420 gene lptG 6218 7285 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461103.1 protein_id gnl|my_center|LOCUS_12420 7319 8203 gene locus_tag LOCUS_12430 7319 8203 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028000663.1 protein_id gnl|my_center|LOCUS_12430 8651 8208 gene locus_tag LOCUS_12440 8651 8208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 9846 8575 gene locus_tag LOCUS_12450 9846 8575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 8864 8963 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10270 9851 gene locus_tag LOCUS_12460 10270 9851 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195832.1 protein_id gnl|my_center|LOCUS_12460 <11672 10277 gene locus_tag LOCUS_12470 <11672 10277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002219871.1:F0F1 ATP synthase subunit beta >Feature sequence062 4224 271 gene locus_tag LOCUS_12480 4224 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 1188 1287 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5130 4249 gene locus_tag LOCUS_12490 gene dapA 5130 4249 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086270.1 protein_id gnl|my_center|LOCUS_12490 5256 5990 gene locus_tag LOCUS_12500 5256 5990 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947958.1 protein_id gnl|my_center|LOCUS_12500 6020 6613 gene locus_tag LOCUS_12510 6020 6613 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229232.1 protein_id gnl|my_center|LOCUS_12510 7274 6618 gene locus_tag LOCUS_12520 7274 6618 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207207.1 protein_id gnl|my_center|LOCUS_12520 7351 8142 gene locus_tag LOCUS_12530 7351 8142 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080010657.1 protein_id gnl|my_center|LOCUS_12530 9219 8149 gene locus_tag LOCUS_12540 9219 8149 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975839.1 protein_id gnl|my_center|LOCUS_12540 9341 9757 gene locus_tag LOCUS_12550 9341 9757 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425978.1 protein_id gnl|my_center|LOCUS_12550 9761 9860 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10592 11395 gene locus_tag LOCUS_12560 gene znuB 10592 11395 CDS product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707445.1 protein_id gnl|my_center|LOCUS_12560 >Feature sequence063 1 660 gene locus_tag LOCUS_12570 1 660 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769059.1 protein_id gnl|my_center|LOCUS_12570 657 962 gene locus_tag LOCUS_12580 gene nuoK 657 962 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 protein_id gnl|my_center|LOCUS_12580 959 2929 gene locus_tag LOCUS_12590 gene nuoL 959 2929 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930037.1 protein_id gnl|my_center|LOCUS_12590 2926 4404 gene locus_tag LOCUS_12600 2926 4404 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813918.1 protein_id gnl|my_center|LOCUS_12600 4413 5876 gene locus_tag LOCUS_12610 gene nuoN 4413 5876 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224835.1 protein_id gnl|my_center|LOCUS_12610 5873 6991 gene locus_tag LOCUS_12620 gene ddlA 5873 6991 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096588.1 protein_id gnl|my_center|LOCUS_12620 6988 7923 gene locus_tag LOCUS_12630 6988 7923 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390587.1 protein_id gnl|my_center|LOCUS_12630 7920 9302 gene locus_tag LOCUS_12640 7920 9302 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147522.1 protein_id gnl|my_center|LOCUS_12640 9311 11380 gene locus_tag LOCUS_12650 9311 11380 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967138.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence064 1252 3654 gene locus_tag LOCUS_12660 gene ftsK 1252 3654 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895627.1 protein_id gnl|my_center|LOCUS_12660 3692 3791 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3796 5106 gene locus_tag LOCUS_12670 gene serS 3796 5106 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186129.1 protein_id gnl|my_center|LOCUS_12670 5165 5761 gene locus_tag LOCUS_12680 5165 5761 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037878.1 protein_id gnl|my_center|LOCUS_12680 5754 6215 gene locus_tag LOCUS_12690 gene ruvX 5754 6215 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706917.1 protein_id gnl|my_center|LOCUS_12690 6208 6699 gene locus_tag LOCUS_12700 gene pyrR 6208 6699 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084574.1 protein_id gnl|my_center|LOCUS_12700 6696 7664 gene locus_tag LOCUS_12710 6696 7664 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 protein_id gnl|my_center|LOCUS_12710 7661 8968 gene locus_tag LOCUS_12720 7661 8968 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186353.1 protein_id gnl|my_center|LOCUS_12720 8993 10468 gene locus_tag LOCUS_12730 8993 10468 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565602.1 protein_id gnl|my_center|LOCUS_12730 9059 9158 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence065 1735 1004 gene locus_tag LOCUS_12740 1735 1004 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337268.1 protein_id gnl|my_center|LOCUS_12740 2754 1732 gene locus_tag LOCUS_12750 2754 1732 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_12750 3925 2831 gene locus_tag LOCUS_12760 3925 2831 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811203.1 protein_id gnl|my_center|LOCUS_12760 4547 3954 gene locus_tag LOCUS_12770 4547 3954 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_12770 5947 4574 gene locus_tag LOCUS_12780 5947 4574 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_12780 6434 6021 gene locus_tag LOCUS_12790 6434 6021 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_12790 7096 6614 gene locus_tag LOCUS_12800 7096 6614 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477269.1 protein_id gnl|my_center|LOCUS_12800 7166 8305 gene locus_tag LOCUS_12810 7166 8305 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064424.1 protein_id gnl|my_center|LOCUS_12810 8119 8205 gene locus_tag LOCUS_t00310 8119 8205 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9199 8294 gene locus_tag LOCUS_12820 gene pyrF 9199 8294 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194144.1 protein_id gnl|my_center|LOCUS_12820 9198 10025 gene locus_tag LOCUS_12830 9198 10025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence066 1728 2813 gene locus_tag LOCUS_12840 1728 2813 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405433.1 protein_id gnl|my_center|LOCUS_12840 2810 3619 gene locus_tag LOCUS_12850 2810 3619 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405435.1 protein_id gnl|my_center|LOCUS_12850 4521 3598 gene locus_tag LOCUS_12860 4521 3598 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192829.1 protein_id gnl|my_center|LOCUS_12860 6376 4502 gene locus_tag LOCUS_12870 gene btuB 6376 4502 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_12870 6750 8141 gene locus_tag LOCUS_12880 6750 8141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 8149 8559 gene locus_tag LOCUS_12890 8149 8559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 8614 10005 gene locus_tag LOCUS_12900 gene cysG 8614 10005 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113366.1 protein_id gnl|my_center|LOCUS_12900 >Feature sequence067 2360 420 gene locus_tag LOCUS_12910 gene acs 2360 420 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113911.1 protein_id gnl|my_center|LOCUS_12910 3422 2454 gene locus_tag LOCUS_12920 3422 2454 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081163160.1 protein_id gnl|my_center|LOCUS_12920 4605 3445 gene locus_tag LOCUS_12930 4605 3445 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_12930 4719 6020 gene locus_tag LOCUS_12940 4719 6020 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084053.1 protein_id gnl|my_center|LOCUS_12940 6017 6850 gene locus_tag LOCUS_12950 6017 6850 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084052.1 protein_id gnl|my_center|LOCUS_12950 6853 6952 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7022 8365 gene locus_tag LOCUS_12960 7022 8365 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268564.1 protein_id gnl|my_center|LOCUS_12960 8903 8433 gene locus_tag LOCUS_12970 8903 8433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 >Feature sequence068 414 1424 gene locus_tag LOCUS_12980 414 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 1603 2202 gene locus_tag LOCUS_12990 1603 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 2199 3737 gene locus_tag LOCUS_13000 2199 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 3737 4333 gene locus_tag LOCUS_13010 3737 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 5341 4352 gene locus_tag LOCUS_13020 5341 4352 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886970.1 protein_id gnl|my_center|LOCUS_13020 8105 5370 gene locus_tag LOCUS_13030 gene acnB 8105 5370 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818886.1 protein_id gnl|my_center|LOCUS_13030 5406 5505 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8707 8105 gene locus_tag LOCUS_13040 8707 8105 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909445.1 protein_id gnl|my_center|LOCUS_13040 >Feature sequence069 1038 7 gene locus_tag LOCUS_13050 1038 7 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_13050 1548 1048 gene locus_tag LOCUS_13060 1548 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 2227 1568 gene locus_tag LOCUS_13070 2227 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 2332 2431 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4372 2597 gene locus_tag LOCUS_13080 gene xsc 4372 2597 CDS product sulfoacetaldehyde acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945362.1 protein_id gnl|my_center|LOCUS_13080 5577 4459 gene locus_tag LOCUS_13090 gene ald 5577 4459 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391433.1 protein_id gnl|my_center|LOCUS_13090 5605 6171 gene locus_tag LOCUS_13100 5605 6171 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095369.1 protein_id gnl|my_center|LOCUS_13100 6313 6771 gene locus_tag LOCUS_13110 6313 6771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705863.1 protein_id gnl|my_center|LOCUS_13110 6743 7105 gene locus_tag LOCUS_13120 6743 7105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 8391 7294 gene locus_tag LOCUS_13130 8391 7294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 >Feature sequence070 253 1026 gene locus_tag LOCUS_13140 253 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 1124 2251 gene locus_tag LOCUS_13150 1124 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 2939 2223 gene locus_tag LOCUS_13160 2939 2223 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191981.1 protein_id gnl|my_center|LOCUS_13160 3008 4225 gene locus_tag LOCUS_13170 3008 4225 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423059.1 protein_id gnl|my_center|LOCUS_13170 4222 4863 gene locus_tag LOCUS_13180 gene rlmE 4222 4863 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095202.1 protein_id gnl|my_center|LOCUS_13180 4951 6891 gene locus_tag LOCUS_13190 gene ftsH 4951 6891 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809623.1 protein_id gnl|my_center|LOCUS_13190 6906 8249 gene locus_tag LOCUS_13200 gene glmM 6906 8249 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071137.1 protein_id gnl|my_center|LOCUS_13200 8356 8270 gene locus_tag LOCUS_t00320 8356 8270 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence071 <1 1162 gene locus_tag LOCUS_13210 <1 1162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114538.1:lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase 3804 1174 gene locus_tag LOCUS_13220 gene pepN 3804 1174 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940973.1 protein_id gnl|my_center|LOCUS_13220 4174 3851 gene locus_tag LOCUS_13230 4174 3851 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771072.1 protein_id gnl|my_center|LOCUS_13230 5311 4292 gene locus_tag LOCUS_13240 5311 4292 CDS product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207944.1 protein_id gnl|my_center|LOCUS_13240 6678 5308 gene locus_tag LOCUS_13250 6678 5308 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869179.1 protein_id gnl|my_center|LOCUS_13250 6896 6995 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <8327 7047 gene locus_tag LOCUS_13260 <8327 7047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113873.1:DNA mismatch repair protein MutS >Feature sequence072 7 2532 gene locus_tag LOCUS_13270 7 2532 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971758.1 protein_id gnl|my_center|LOCUS_13270 2544 3653 gene locus_tag LOCUS_13280 gene hrcA 2544 3653 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194248.1 protein_id gnl|my_center|LOCUS_13280 3658 4227 gene locus_tag LOCUS_13290 3658 4227 CDS product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338669.1 protein_id gnl|my_center|LOCUS_13290 5021 4236 gene locus_tag LOCUS_13300 5021 4236 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336750.1 protein_id gnl|my_center|LOCUS_13300 5107 6705 gene locus_tag LOCUS_13310 5107 6705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 5754 5853 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7893 6808 gene locus_tag LOCUS_13320 7893 6808 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090622.1 protein_id gnl|my_center|LOCUS_13320 >Feature sequence073 4078 2591 gene locus_tag LOCUS_13330 4078 2591 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088347.1 protein_id gnl|my_center|LOCUS_13330 5128 4139 gene locus_tag LOCUS_13340 5128 4139 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 protein_id gnl|my_center|LOCUS_13340 5978 5205 gene locus_tag LOCUS_13350 gene mtgA 5978 5205 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705989.1 protein_id gnl|my_center|LOCUS_13350 7623 5986 gene locus_tag LOCUS_13360 7623 5986 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095724.1 protein_id gnl|my_center|LOCUS_13360 >Feature sequence074 1508 66 gene locus_tag LOCUS_13370 1508 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 2022 1534 gene locus_tag LOCUS_13380 gene nuoI 2022 1534 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186558.1 protein_id gnl|my_center|LOCUS_13380 3082 2036 gene locus_tag LOCUS_13390 gene nuoH 3082 2036 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769061.1 protein_id gnl|my_center|LOCUS_13390 5610 3079 gene locus_tag LOCUS_13400 gene nuoG 5610 3079 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813928.1 protein_id gnl|my_center|LOCUS_13400 6949 5645 gene locus_tag LOCUS_13410 gene nuoF 6949 5645 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443944.1 protein_id gnl|my_center|LOCUS_13410 6921 7211 gene locus_tag LOCUS_13420 6921 7211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 >Feature sequence075 114 189 gene locus_tag LOCUS_t00330 114 189 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 198 274 gene locus_tag LOCUS_t00340 198 274 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 327 3209 gene locus_tag LOCUS_13430 327 3209 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894214.1 protein_id gnl|my_center|LOCUS_13430 3209 3727 gene locus_tag LOCUS_13440 3209 3727 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194139.1 protein_id gnl|my_center|LOCUS_13440 3756 4718 gene locus_tag LOCUS_13450 gene accA 3756 4718 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109333.1 protein_id gnl|my_center|LOCUS_13450 4720 6096 gene locus_tag LOCUS_13460 gene tilS 4720 6096 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176586.1 protein_id gnl|my_center|LOCUS_13460 6130 6651 gene locus_tag LOCUS_13470 gene purE 6130 6651 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704271.1 protein_id gnl|my_center|LOCUS_13470 6648 7217 gene locus_tag LOCUS_13480 6648 7217 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769752.1 protein_id gnl|my_center|LOCUS_13480 >Feature sequence076 1238 588 gene locus_tag LOCUS_13490 gene tesA 1238 588 CDS product esterase TesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114753.1 protein_id gnl|my_center|LOCUS_13490 1253 1939 gene locus_tag LOCUS_13500 1253 1939 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928863.1 protein_id gnl|my_center|LOCUS_13500 1936 4308 gene locus_tag LOCUS_13510 1936 4308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 3039 3138 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4311 6200 gene locus_tag LOCUS_13520 4311 6200 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529979.1 protein_id gnl|my_center|LOCUS_13520 6254 7051 gene locus_tag LOCUS_13530 gene ppk2 6254 7051 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705561.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence077 2997 1345 gene locus_tag LOCUS_13540 2997 1345 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338426.1 protein_id gnl|my_center|LOCUS_13540 4052 2994 gene locus_tag LOCUS_13550 4052 2994 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087942.1 protein_id gnl|my_center|LOCUS_13550 5160 4045 gene locus_tag LOCUS_13560 5160 4045 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171436.1 protein_id gnl|my_center|LOCUS_13560 7172 5178 gene locus_tag LOCUS_13570 7172 5178 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084241.1 protein_id gnl|my_center|LOCUS_13570 5261 5360 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence078 3263 2889 gene locus_tag LOCUS_13580 gene gcvH 3263 2889 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001355634.1 protein_id gnl|my_center|LOCUS_13580 4415 3300 gene locus_tag LOCUS_13590 gene gcvT 4415 3300 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162129718.1 protein_id gnl|my_center|LOCUS_13590 4417 4516 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5454 4543 gene locus_tag LOCUS_13600 5454 4543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 7019 5487 gene locus_tag LOCUS_13610 7019 5487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 >Feature sequence079 2289 1810 gene locus_tag LOCUS_13620 2289 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 2885 2340 gene locus_tag LOCUS_13630 gene gmk 2885 2340 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098317.1 protein_id gnl|my_center|LOCUS_13630 3693 2896 gene locus_tag LOCUS_13640 3693 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528661.1 protein_id gnl|my_center|LOCUS_13640 4841 3678 gene locus_tag LOCUS_13650 4841 3678 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192390.1 protein_id gnl|my_center|LOCUS_13650 6777 5029 gene locus_tag LOCUS_13660 6777 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 >Feature sequence080 493 1506 gene locus_tag LOCUS_13670 493 1506 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037866.1 protein_id gnl|my_center|LOCUS_13670 1519 1595 gene locus_tag LOCUS_t00350 1519 1595 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1614 2714 gene locus_tag LOCUS_13680 1614 2714 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775991.1 protein_id gnl|my_center|LOCUS_13680 3519 2743 gene locus_tag LOCUS_13690 3519 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 5999 4464 gene locus_tag LOCUS_13700 5999 4464 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_13700 <6893 6045 gene locus_tag LOCUS_13710 <6893 6045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393208.1:cysteine synthase A >Feature sequence081 <1 1111 gene locus_tag LOCUS_13720 <1 1111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140889.1:arsenosugar biosynthesis radical SAM protein ArsS 1108 2085 gene locus_tag LOCUS_13730 gene speB 1108 2085 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895813.1 protein_id gnl|my_center|LOCUS_13730 2091 2621 gene locus_tag LOCUS_13740 2091 2621 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975614.1 protein_id gnl|my_center|LOCUS_13740 2644 4494 gene locus_tag LOCUS_13750 2644 4494 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_13750 <6837 4525 gene locus_tag LOCUS_13760 <6837 4525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030909.1:glycoside hydrolase family 92 protein >Feature sequence082 986 426 gene locus_tag LOCUS_13770 gene folE 986 426 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091896.1 protein_id gnl|my_center|LOCUS_13770 1070 2563 gene locus_tag LOCUS_13780 1070 2563 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 protein_id gnl|my_center|LOCUS_13780 2820 2560 gene locus_tag LOCUS_13790 2820 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 3728 2856 gene locus_tag LOCUS_13800 gene sucD 3728 2856 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388967.1 protein_id gnl|my_center|LOCUS_13800 4909 3728 gene locus_tag LOCUS_13810 gene sucC 4909 3728 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388966.1 protein_id gnl|my_center|LOCUS_13810 4973 5716 gene locus_tag LOCUS_13820 4973 5716 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908611.1 protein_id gnl|my_center|LOCUS_13820 6487 5732 gene locus_tag LOCUS_13830 gene trmJ 6487 5732 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940021.1 protein_id gnl|my_center|LOCUS_13830 >Feature sequence083 2493 4499 gene locus_tag LOCUS_13840 2493 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 6352 4493 gene locus_tag LOCUS_13850 6352 4493 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038259.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence084 55 765 gene locus_tag LOCUS_13860 55 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 3368 762 gene locus_tag LOCUS_13870 3368 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 4303 3371 gene locus_tag LOCUS_13880 4303 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 5505 4381 gene locus_tag LOCUS_13890 5505 4381 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 protein_id gnl|my_center|LOCUS_13890 5824 5645 gene locus_tag LOCUS_13900 5824 5645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 <6527 5824 gene locus_tag LOCUS_13910 <6527 5824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927567.1:flap endonuclease Xni >Feature sequence085 832 3699 gene locus_tag LOCUS_13920 gene uvrA 832 3699 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357696.1 protein_id gnl|my_center|LOCUS_13920 3751 4569 gene locus_tag LOCUS_13930 3751 4569 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261996.1 protein_id gnl|my_center|LOCUS_13930 4566 5267 gene locus_tag LOCUS_13940 4566 5267 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419416.1 protein_id gnl|my_center|LOCUS_13940 5264 5992 gene locus_tag LOCUS_13950 5264 5992 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074307.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence086 1599 664 gene locus_tag LOCUS_13960 gene rodZ 1599 664 CDS product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090860.1 protein_id gnl|my_center|LOCUS_13960 2705 1596 gene locus_tag LOCUS_13970 2705 1596 CDS product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444483.1 protein_id gnl|my_center|LOCUS_13970 3133 2702 gene locus_tag LOCUS_13980 gene ndk 3133 2702 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810689.1 protein_id gnl|my_center|LOCUS_13980 4603 3206 gene locus_tag LOCUS_13990 gene mtaB 4603 3206 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388937.1 protein_id gnl|my_center|LOCUS_13990 4907 4578 gene locus_tag LOCUS_14000 gene iscA 4907 4578 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028953.1 protein_id gnl|my_center|LOCUS_14000 >Feature sequence087 <1 855 gene locus_tag LOCUS_14010 <1 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003102073.1:arginine--pyruvate transaminase AruH 861 3485 gene locus_tag LOCUS_14020 861 3485 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969999.1 protein_id gnl|my_center|LOCUS_14020 3281 3380 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3419 4153 gene locus_tag LOCUS_14030 3419 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 4179 5522 gene locus_tag LOCUS_14040 4179 5522 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810594.1 protein_id gnl|my_center|LOCUS_14040 5538 6446 gene locus_tag LOCUS_14050 5538 6446 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812150.1 protein_id gnl|my_center|LOCUS_14050 >Feature sequence088 1871 1089 gene locus_tag LOCUS_14060 1871 1089 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141949.1 protein_id gnl|my_center|LOCUS_14060 2116 1868 gene locus_tag LOCUS_14070 2116 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 2259 2927 gene locus_tag LOCUS_14080 2259 2927 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522277.1 protein_id gnl|my_center|LOCUS_14080 2941 4248 gene locus_tag LOCUS_14090 gene tolC 2941 4248 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735329.1 protein_id gnl|my_center|LOCUS_14090 5696 4245 gene locus_tag LOCUS_14100 5696 4245 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070440.1 protein_id gnl|my_center|LOCUS_14100 <6403 5700 gene locus_tag LOCUS_14110 <6403 5700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005461427.1:Trk system potassium transporter TrkA >Feature sequence089 <1 786 gene locus_tag LOCUS_14120 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331275.1:phosphate acetyltransferase 783 1841 gene locus_tag LOCUS_14130 783 1841 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123092.1 protein_id gnl|my_center|LOCUS_14130 1831 2859 gene locus_tag LOCUS_14140 1831 2859 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121962.1 protein_id gnl|my_center|LOCUS_14140 2869 3714 gene locus_tag LOCUS_14150 2869 3714 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391324.1 protein_id gnl|my_center|LOCUS_14150 3778 6234 gene locus_tag LOCUS_14160 3778 6234 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969822.1 protein_id gnl|my_center|LOCUS_14160 >Feature sequence090 4 1305 gene locus_tag LOCUS_14170 gene hisD 4 1305 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728086.1 protein_id gnl|my_center|LOCUS_14170 1302 2093 gene locus_tag LOCUS_14180 1302 2093 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 protein_id gnl|my_center|LOCUS_14180 2146 3336 gene locus_tag LOCUS_14190 2146 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 3132 3231 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4480 3371 gene locus_tag LOCUS_14200 4480 3371 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396744.1 protein_id gnl|my_center|LOCUS_14200 5424 4483 gene locus_tag LOCUS_14210 5424 4483 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582557.1 protein_id gnl|my_center|LOCUS_14210 6237 5512 gene locus_tag LOCUS_14220 6237 5512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 >Feature sequence091 444 1364 gene locus_tag LOCUS_14230 gene ilvE 444 1364 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095783.1 protein_id gnl|my_center|LOCUS_14230 1379 1606 gene locus_tag LOCUS_14240 1379 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 1663 2688 gene locus_tag LOCUS_14250 gene waaF 1663 2688 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958358.1 protein_id gnl|my_center|LOCUS_14250 2916 5099 gene locus_tag LOCUS_14260 2916 5099 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895708.1 protein_id gnl|my_center|LOCUS_14260 5132 5881 gene locus_tag LOCUS_14270 5132 5881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096987.1 protein_id gnl|my_center|LOCUS_14270 >Feature sequence092 1063 1281 gene locus_tag LOCUS_14280 gene infA 1063 1281 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006081934.1 protein_id gnl|my_center|LOCUS_14280 2111 1278 gene locus_tag LOCUS_14290 2111 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14290 2016 2285 gene locus_tag LOCUS_14300 2016 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 2618 2717 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2751 2942 gene locus_tag LOCUS_14310 2751 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 2978 3466 gene locus_tag LOCUS_14320 gene coaD 2978 3466 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704185.1 protein_id gnl|my_center|LOCUS_14320 3479 3730 gene locus_tag LOCUS_14330 3479 3730 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016533.1 protein_id gnl|my_center|LOCUS_14330 4823 3735 gene locus_tag LOCUS_14340 gene hisC 4823 3735 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199913.1 protein_id gnl|my_center|LOCUS_14340 6115 4820 gene locus_tag LOCUS_14350 gene hisD 6115 4820 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268859.1 protein_id gnl|my_center|LOCUS_14350 >Feature sequence093 25 1374 gene locus_tag LOCUS_14360 25 1374 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968347.1 protein_id gnl|my_center|LOCUS_14360 1386 3089 gene locus_tag LOCUS_14370 1386 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 1805 1904 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3089 3382 gene locus_tag LOCUS_14380 3089 3382 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821030.1 protein_id gnl|my_center|LOCUS_14380 >Feature sequence094 185 496 gene locus_tag LOCUS_14390 185 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 481 1314 gene locus_tag LOCUS_14400 481 1314 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065267398.1 protein_id gnl|my_center|LOCUS_14400 1353 2462 gene locus_tag LOCUS_14410 gene dprA 1353 2462 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_14410 2501 2974 gene locus_tag LOCUS_14420 2501 2974 CDS product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166401.1 protein_id gnl|my_center|LOCUS_14420 3018 5498 gene locus_tag LOCUS_14430 3018 5498 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038837.1 protein_id gnl|my_center|LOCUS_14430 5956 5495 gene locus_tag LOCUS_14440 5956 5495 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094122848.1 protein_id gnl|my_center|LOCUS_14440 >Feature sequence095 2441 1320 gene locus_tag LOCUS_14450 2441 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 <5856 2446 gene locus_tag LOCUS_14460 <5856 2446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114676.1:chromosome segregation protein SMC >Feature sequence096 <1 3030 gene locus_tag LOCUS_14470 <1 3030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257272.1:Calx-beta domain-containing protein 3083 5383 gene locus_tag LOCUS_14480 3083 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 >Feature sequence097 2716 1805 gene locus_tag LOCUS_14490 gene glyQ 2716 1805 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070431.1 protein_id gnl|my_center|LOCUS_14490 4351 2732 gene locus_tag LOCUS_14500 4351 2732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 5373 4348 gene locus_tag LOCUS_14510 gene galE 5373 4348 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544967.1 protein_id gnl|my_center|LOCUS_14510 5450 5526 gene locus_tag LOCUS_t00360 5450 5526 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence098 <1 1107 gene locus_tag LOCUS_14520 <1 1107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000132407.1:succinyl-diaminopimelate desuccinylase 1135 2826 gene locus_tag LOCUS_14530 1135 2826 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943977.1 protein_id gnl|my_center|LOCUS_14530 2848 3867 gene locus_tag LOCUS_14540 gene sohB 2848 3867 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925731.1 protein_id gnl|my_center|LOCUS_14540 3880 4395 gene locus_tag LOCUS_14550 3880 4395 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524734.1 protein_id gnl|my_center|LOCUS_14550 5422 4424 gene locus_tag LOCUS_14560 5422 4424 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531149.1 protein_id gnl|my_center|LOCUS_14560 >Feature sequence099 <5465 4222 gene locus_tag LOCUS_14570 <5465 4222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921648.1:YDG domain-containing protein >Feature sequence100 2040 745 gene locus_tag LOCUS_14580 2040 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 1201 1300 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3291 2041 gene locus_tag LOCUS_14590 gene odhB 3291 2041 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267377.1 protein_id gnl|my_center|LOCUS_14590 <5374 3281 gene locus_tag LOCUS_14600 <5374 3281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005769626.1:2-oxoglutarate dehydrogenase E1 component >Feature sequence101 1315 1623 gene locus_tag LOCUS_14610 1315 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 1679 2479 gene locus_tag LOCUS_14620 1679 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 2547 2846 gene locus_tag LOCUS_14630 2547 2846 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582865.1 protein_id gnl|my_center|LOCUS_14630 2840 4012 gene locus_tag LOCUS_14640 2840 4012 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460953.1 protein_id gnl|my_center|LOCUS_14640 4014 4113 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4190 5281 gene locus_tag LOCUS_14650 4190 5281 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082910123.1 protein_id gnl|my_center|LOCUS_14650 >Feature sequence102 2009 1101 gene locus_tag LOCUS_14660 2009 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 2839 2006 gene locus_tag LOCUS_14670 2839 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 3355 2861 gene locus_tag LOCUS_14680 3355 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 3440 4111 gene locus_tag LOCUS_14690 3440 4111 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114590.1 protein_id gnl|my_center|LOCUS_14690 <5139 4069 gene locus_tag LOCUS_14700 <5139 4069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876803.1:metallophosphoesterase >Feature sequence103 <1 2045 gene locus_tag LOCUS_14710 <1 2045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387813.1:acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha 2032 3015 gene locus_tag LOCUS_14720 gene meaB 2032 3015 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390231.1 protein_id gnl|my_center|LOCUS_14720 3012 3416 gene locus_tag LOCUS_14730 gene mce 3012 3416 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389447.1 protein_id gnl|my_center|LOCUS_14730 3426 4151 gene locus_tag LOCUS_14740 gene cmoA 3426 4151 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019609.1 protein_id gnl|my_center|LOCUS_14740 >Feature sequence104 1099 590 gene locus_tag LOCUS_14750 1099 590 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 protein_id gnl|my_center|LOCUS_14750 1477 1121 gene locus_tag LOCUS_14760 1477 1121 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813943.1 protein_id gnl|my_center|LOCUS_14760 1576 2547 gene locus_tag LOCUS_14770 1576 2547 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920875.1 protein_id gnl|my_center|LOCUS_14770 3279 3378 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4618 4058 gene locus_tag LOCUS_14780 gene gmhB 4618 4058 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522791.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence105 108 1628 gene locus_tag LOCUS_14790 gene pyk 108 1628 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398560.1 protein_id gnl|my_center|LOCUS_14790 2899 1625 gene locus_tag LOCUS_14800 2899 1625 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947133.1 protein_id gnl|my_center|LOCUS_14800 3069 3668 gene locus_tag LOCUS_14810 3069 3668 CDS product glutaredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261874.1 protein_id gnl|my_center|LOCUS_14810 4285 3674 gene locus_tag LOCUS_14820 4285 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 <4913 4282 gene locus_tag LOCUS_14830 <4913 4282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015940983.1:site-specific DNA-methyltransferase >Feature sequence106 813 127 gene locus_tag LOCUS_14840 813 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 1409 810 gene locus_tag LOCUS_14850 gene ccmA 1409 810 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693414.1 protein_id gnl|my_center|LOCUS_14850 1485 2651 gene locus_tag LOCUS_14860 gene dinB 1485 2651 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119785.1 protein_id gnl|my_center|LOCUS_14860 3441 2596 gene locus_tag LOCUS_14870 gene panC 3441 2596 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336964.1 protein_id gnl|my_center|LOCUS_14870 4228 3536 gene locus_tag LOCUS_14880 gene gph 4228 3536 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957521.1 protein_id gnl|my_center|LOCUS_14880 <4911 4225 gene locus_tag LOCUS_14890 <4911 4225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005766737.1:bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase >Feature sequence107 1962 1186 gene locus_tag LOCUS_14900 1962 1186 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815367.1 protein_id gnl|my_center|LOCUS_14900 2076 3992 gene locus_tag LOCUS_14910 2076 3992 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388801.1 protein_id gnl|my_center|LOCUS_14910 >Feature sequence108 1472 318 gene locus_tag LOCUS_14920 1472 318 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070680.1 protein_id gnl|my_center|LOCUS_14920 1746 1937 gene locus_tag LOCUS_14930 1746 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 1973 2206 gene locus_tag LOCUS_14940 1973 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 2245 2427 gene locus_tag LOCUS_14950 2245 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 2752 3528 gene locus_tag LOCUS_14960 2752 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 3585 4817 gene locus_tag LOCUS_14970 3585 4817 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310733.1 protein_id gnl|my_center|LOCUS_14970 >Feature sequence109 150 3851 gene locus_tag LOCUS_14980 150 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 3889 4437 gene locus_tag LOCUS_14990 3889 4437 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092665.1 protein_id gnl|my_center|LOCUS_14990 >Feature sequence110 >Feature sequence111 <1 543 gene locus_tag LOCUS_15000 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531177.1:4Fe-4S dicluster domain-containing protein 2036 540 gene locus_tag LOCUS_15010 gene glsA 2036 540 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021841.1 protein_id gnl|my_center|LOCUS_15010 1992 4217 gene locus_tag LOCUS_15020 1992 4217 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968324.1 protein_id gnl|my_center|LOCUS_15020 2064 2163 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence112 >Feature sequence113 956 57 gene locus_tag LOCUS_15030 956 57 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532814.1 protein_id gnl|my_center|LOCUS_15030 1338 2228 gene locus_tag LOCUS_15040 1338 2228 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189368.1 protein_id gnl|my_center|LOCUS_15040 2704 2270 gene locus_tag LOCUS_15050 2704 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 3954 2701 gene locus_tag LOCUS_15060 gene cca 3954 2701 CDS product fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708487.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence114 >Feature sequence115 <3985 395 gene locus_tag LOCUS_15070 <3985 395 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921648.1:YDG domain-containing protein >Feature sequence116 <1 1210 gene locus_tag LOCUS_15080 <1 1210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880235.1:pyridoxal phosphate-dependent aminotransferase 1295 1495 gene locus_tag LOCUS_15090 1295 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 1507 1839 gene locus_tag LOCUS_15100 1507 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 2190 2792 gene locus_tag LOCUS_15110 2190 2792 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096321.1 protein_id gnl|my_center|LOCUS_15110 2792 3250 gene locus_tag LOCUS_15120 2792 3250 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958244.1 protein_id gnl|my_center|LOCUS_15120 3331 3969 gene locus_tag LOCUS_15130 gene ppiA 3331 3969 CDS product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477215.1 protein_id gnl|my_center|LOCUS_15130 >Feature sequence117 1221 577 gene locus_tag LOCUS_15140 1221 577 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186002.1 protein_id gnl|my_center|LOCUS_15140 1255 2202 gene locus_tag LOCUS_15150 1255 2202 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072295.1 protein_id gnl|my_center|LOCUS_15150 3419 2526 gene locus_tag LOCUS_15160 3419 2526 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871202.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence118 1179 100 gene locus_tag LOCUS_15170 gene mnmA 1179 100 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131114.1 protein_id gnl|my_center|LOCUS_15170 2381 2118 gene locus_tag LOCUS_15180 2381 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 2739 2473 gene locus_tag LOCUS_15190 2739 2473 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_15190 3791 2736 gene locus_tag LOCUS_15200 gene mutY 3791 2736 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707498.1 protein_id gnl|my_center|LOCUS_15200 >Feature sequence119 <1 589 gene locus_tag LOCUS_15210 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003083872.1:triclosan efflux RND transporter adaptor protein TriB >Feature sequence120 >Feature sequence121 >Feature sequence122 15 1868 gene locus_tag LOCUS_15220 15 1868 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185769.1 protein_id gnl|my_center|LOCUS_15220 1754 1853 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1909 2232 gene locus_tag LOCUS_15230 1909 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 2237 2734 gene locus_tag LOCUS_15240 gene ilvN 2237 2734 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814006.1 protein_id gnl|my_center|LOCUS_15240 >Feature sequence123 887 2578 gene locus_tag LOCUS_15250 887 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence124 2080 1613 gene locus_tag LOCUS_15260 2080 1613 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390521.1 protein_id gnl|my_center|LOCUS_15260 3315 2077 gene locus_tag LOCUS_15270 3315 2077 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531195.1 protein_id gnl|my_center|LOCUS_15270 >Feature sequence125 1047 193 gene locus_tag LOCUS_15280 gene ubiA 1047 193 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455228.1 protein_id gnl|my_center|LOCUS_15280 3084 1054 gene locus_tag LOCUS_15290 gene recG 3084 1054 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096624.1 protein_id gnl|my_center|LOCUS_15290 3542 3144 gene locus_tag LOCUS_15300 3542 3144 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687566.1 protein_id gnl|my_center|LOCUS_15300 >Feature sequence126 >Feature sequence127 746 24 gene locus_tag LOCUS_15310 746 24 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942828.1 protein_id gnl|my_center|LOCUS_15310 806 1105 gene locus_tag LOCUS_15320 806 1105 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_15320 1637 1119 gene locus_tag LOCUS_15330 gene thpR 1637 1119 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070956.1 protein_id gnl|my_center|LOCUS_15330 1693 2427 gene locus_tag LOCUS_15340 1693 2427 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330118.1 protein_id gnl|my_center|LOCUS_15340 2508 3260 gene locus_tag LOCUS_15350 2508 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 >Feature sequence128 150 815 gene locus_tag LOCUS_15360 150 815 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098558.1 protein_id gnl|my_center|LOCUS_15360 897 1475 gene locus_tag LOCUS_15370 897 1475 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349540.1 protein_id gnl|my_center|LOCUS_15370 1481 2320 gene locus_tag LOCUS_15380 1481 2320 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766016.1 protein_id gnl|my_center|LOCUS_15380 >Feature sequence129 <1 809 gene locus_tag LOCUS_15390 <1 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_116269310.1:tetratricopeptide repeat protein 872 1774 gene locus_tag LOCUS_15400 872 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 2912 1782 gene locus_tag LOCUS_15410 2912 1782 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942826.1 protein_id gnl|my_center|LOCUS_15410 >Feature sequence130 1591 1307 gene locus_tag LOCUS_15420 gene hfq 1591 1307 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036893.1 protein_id gnl|my_center|LOCUS_15420 2418 1699 gene locus_tag LOCUS_15430 2418 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence131 1587 1874 gene locus_tag LOCUS_15440 1587 1874 CDS product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 protein_id gnl|my_center|LOCUS_15440 1902 2468 gene locus_tag LOCUS_15450 1902 2468 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207954.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence132 >Feature sequence133 368 1174 gene locus_tag LOCUS_15460 368 1174 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706862.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence134 2525 2821 gene locus_tag LOCUS_15470 2525 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 >Feature sequence135 108 521 gene locus_tag LOCUS_15480 108 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 518 2266 gene locus_tag LOCUS_15490 518 2266 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389659.1 protein_id gnl|my_center|LOCUS_15490 3050 2274 gene locus_tag LOCUS_15500 3050 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 >Feature sequence136 1566 22 gene locus_tag LOCUS_15510 gene lnt 1566 22 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089648.1 protein_id gnl|my_center|LOCUS_15510 2047 1583 gene locus_tag LOCUS_15520 gene ybeY 2047 1583 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037474.1 protein_id gnl|my_center|LOCUS_15520 <3015 2044 gene locus_tag LOCUS_15530 <3015 2044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005763270.1:PhoH family protein >Feature sequence137 1617 22 gene locus_tag LOCUS_15540 gene ubiB 1617 22 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948590.1 protein_id gnl|my_center|LOCUS_15540 2285 1632 gene locus_tag LOCUS_15550 2285 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 <2977 2285 gene locus_tag LOCUS_15560 <2977 2285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103462.1:bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE >Feature sequence138 83 340 gene locus_tag LOCUS_15570 gene rpmA 83 340 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383095.1 protein_id gnl|my_center|LOCUS_15570 419 1441 gene locus_tag LOCUS_15580 gene cgtA 419 1441 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551973.1 protein_id gnl|my_center|LOCUS_15580 1405 2541 gene locus_tag LOCUS_15590 gene proB 1405 2541 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094756.1 protein_id gnl|my_center|LOCUS_15590 2810 2547 gene locus_tag LOCUS_15600 2810 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 >Feature sequence139 211 2805 gene locus_tag LOCUS_15610 211 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 >Feature sequence140 <1 951 gene locus_tag LOCUS_15620 <1 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070585.1:tandem-95 repeat protein 1869 1324 gene locus_tag LOCUS_15630 1869 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence141 <2890 1889 gene locus_tag LOCUS_15640 <2890 1889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000973081.1:acyl-CoA dehydrogenase FadE >Feature sequence142 1221 73 gene locus_tag LOCUS_15650 gene recA 1221 73 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947527.1 protein_id gnl|my_center|LOCUS_15650 1814 1317 gene locus_tag LOCUS_15660 1814 1317 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532447.1 protein_id gnl|my_center|LOCUS_15660 1940 2731 gene locus_tag LOCUS_15670 1940 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 >Feature sequence143 654 34 gene locus_tag LOCUS_15680 gene cysC 654 34 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046849124.1 protein_id gnl|my_center|LOCUS_15680 752 678 gene locus_tag LOCUS_t00370 752 678 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2692 809 gene locus_tag LOCUS_15690 gene parE 2692 809 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102062.1 protein_id gnl|my_center|LOCUS_15690 >Feature sequence144 <1 810 gene locus_tag LOCUS_15700 <1 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003316297.1:anthranilate phosphoribosyltransferase 1899 865 gene locus_tag LOCUS_15710 1899 865 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958277.1 protein_id gnl|my_center|LOCUS_15710 2417 1905 gene locus_tag LOCUS_15720 2417 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 2824 2417 gene locus_tag LOCUS_15730 2824 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 >Feature sequence145 >Feature sequence146 >Feature sequence147 >Feature sequence148 >Feature sequence149 <2564 222 gene locus_tag LOCUS_15740 <2564 222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964263.1:DEAD/DEAH box helicase family protein